A method for screening long oyster broodstock with high glycogen content and its related SNP primer pairs

Through whole-genome association analysis and SNP marker screening, the problem of difficulty in improving oyster glycogen content was solved, and genetic improvement of oyster quality and improvement of breeding efficiency were achieved.

CN107475415BActive Publication Date: 2025-09-09INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN201710855508.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2017-09-20
Publication Date
2025-09-09
Estimated Expiration
2037-09-20

AI Technical Summary

Technical Problem

Existing technologies make it difficult to efficiently screen and improve the glycogen content of oysters, making it difficult for my country's oyster industry to enter the high-end market. Traditional breeding methods also have long cycles and low efficiency.

Method used

Through whole-genome association analysis, SNP markers related to the glycogen content of long oysters were developed. Whole-genome resequencing was performed using second-generation sequencing technology to screen out significantly associated SNP sites. The genotype was identified through PCR amplification and high-resolution melting curve analysis, and CC genotype broodstock were selected to increase the glycogen content of offspring.

Benefits of technology

It significantly increased the glycogen content of oyster offspring, shortened the breeding cycle, improved breeding efficiency and accuracy, and achieved genetic improvement of oyster quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0001413864810000031
    Figure BDA0001413864810000031
  • Figure BDA0001413864810000041
    Figure BDA0001413864810000041
  • Figure BDA0001413864810000042
    Figure BDA0001413864810000042
Patent Text Reader

Abstract

The present invention relates to a method for screening long oyster broodstock with high glycogen content and its related SNP primer pairs. Through whole-genome association analysis of 486 individuals, 67 SNP signals significantly correlated with glycogen content on chromosome 6 of long oysters were identified. A corresponding detection method was developed for a SNP site at the scaffold1243_53489 base in this region, and the results showed that the SNP site can be detected simply and quickly using this method. At the same time, individuals with the CC genotype at this site are compared with individuals with the TT genotype. Parent oysters with the CC genotype are screened to guide oyster breeding. The nucleotide sequence of the long oyster 500kb upstream and downstream of this site is shown in SEQ ID No.1. The beneficial effect of the present invention is to identify the genotype of parent oysters before seed breeding, thereby increasing the glycogen content of the offspring. The SNP markers obtained by this study are more reliable and have more stable effects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering and genetic breeding, and relates to a primer pair for screening SNP markers related to glycogen content in long oysters and an application thereof. Background Art

[0002] Oysters are a vital marine aquatic resource and one of the world's most important marine aquaculture shellfish. my country has consistently ranked first in the world in both oyster aquaculture scale and production for many years, yet the average export price of oysters is only one-third of that of oysters from other countries. This suggests that most Chinese oysters are produced and sold domestically, making it difficult for them to enter the high-end market. Improving the economic benefits of oyster aquaculture in my country, transforming the industry from a high-yield, low-efficiency model to a high-yield, high-efficiency model, and improving oyster product quality are urgent issues. A high content of nutrients, such as glycogen, is one of the most significant characteristics of oysters. Glycogen content not only affects oyster plumpness and yield but also, as the primary flavoring substance, influences the oyster's taste and directly determines its quality. Genetic improvement of nutritional quality traits, such as glycogen, is a key approach to addressing the high-yield, low-efficiency situation in my country's oyster industry.

[0003] Aquatic animal breeding research started late and currently focuses primarily on growth traits. Methods often rely on traditional selection and hybridization, which are time-consuming and slow to produce results. Research on the quality traits of oysters is relatively rare. In recent years, advances in genomics, marker-assisted selection, and whole-genome selection have seen rapid growth, significantly advancing oyster genetic breeding. This not only makes it possible to breed for complex quality traits like glycogen, but also significantly improves the efficiency and precision of trait selection. Marker-assisted selection can also reduce blindness, shorten breeding cycles, and improve breeding efficiency. Currently, methods for obtaining molecular markers using whole-genome sequencing primarily include QTL mapping and genome-wide association analysis. While QTL mapping can quickly pinpoint chromosomal segments associated with traits and offers high accuracy in trait analysis, it relies on limited meiotic linkage analysis, which links large genomic regions together, making precise targeting difficult. Genome-wide association analysis (GWAS) overcomes this shortcoming by performing genome-wide association analysis of genetic variants, localizing associated loci within a very small interval. This significantly improves the accuracy and precision of location, making it particularly suitable for genetic analysis of complex traits. In recent years, with the completion of whole-genome sequencing in non-model organisms, the application of GWAS to study the location of genes for complex quantitative traits has become a popular trend.

[0004] While GWAS have played a significant role in agricultural biological research on crops and livestock, only a limited number of studies have been conducted on aquatic animals. For example, in a study of Atlantic salmon quality, an association analysis was conducted on fillet fat content using 5,650 SNP markers. Currently reported association analysis studies on aquatic animals, particularly bivalves, primarily focus on candidate genes. However, this approach relies on prior information to identify polymorphic loci within known functional genes. The relatively small number of markers does not necessarily identify major loci, and it also hinders a comprehensive understanding of the genetic regulation of phenotypes. With the completion of whole-genome sequencing of the long oyster and the acquisition of a high-density genetic linkage map, GWAS analyses have become possible. This study, based on the long oyster genome, used second-generation sequencing technology to perform whole-genome resequencing and conducted a genome-wide association analysis targeting glycogen content, identifying major polymorphic loci and key genes controlling glycogen content. Based on this whole-genome resequencing, the present invention developed a large number of SNP markers to decipher the genetic basis of glycogen content in oysters. A cluster of SNP markers highly significantly associated with glycogen content was identified for use in screening for glycogen phenotypes. Compared with previously developed SNP sites, the SNP signals obtained by GWAS are more credible and have the characteristics of simplicity and strong portability. Summary of the Invention

[0005] The purpose of the present invention is to provide a SNP marker related to the glycogen content of long oysters, so as to provide a reference for the molecular marker-assisted selection of long oysters.

[0006] The specific methods for obtaining SNPs are as follows: (1) Collection of experimental materials and homogenized domestication: 486 wild individuals of long oysters were collected and cultured in a homogenized manner. (2) Determination of phenotypic data: Glycogen content of different long oyster individuals was determined using anthrone colorimetric analysis. (3) Genotyping: Using the second-generation sequencing technology platform, the whole genome of 486 oysters was resequenced, SNPs sites were screened and individual typing was performed to obtain effective SNPs sites for association analysis and construct the haplotype map of oysters. (4) Association analysis: Whole genome association analysis was performed using a mixed linear model to obtain 67 SNP sites that were significantly associated with the traits (P-value < 10 -6 ), located within the 16,015-67,096 kb region of scaffold 1243 of the Crassostrea gigas genome. LDblock analysis revealed that the 67 SNPs were tightly linked (LD > 0.7). A Manhattan plot of the genome-wide association analysis is attached. Figure 2 Then the base located at scaffold1243_53,489kb was selected, with a P-value of 2.67×10 -7, was selected as a candidate SNP for this project. This site exists in two base forms: T and C. The same identification method was used for the other 66 SNPs located within the 16,015-67,096 kb range of scaffold 1243.

[0007] The present invention is achieved through the following technical solutions:

[0008] A SNP marker associated with glycogen content in the long oyster: This marker is located at base 1243_53, 489 kb in the long oyster genome. This base exists in two forms: T and C. The sequence 500 kb upstream and downstream of this site is shown in SEQ ID No. 1. The main detection steps are as follows:

[0009] 1) Extract genomic DNA from Crassostrea gigas and dilute to 10-20 ng / uL using sterile water or TE buffer;

[0010] 2) Using the genomic DNA of the long oyster described in step 1) as a template, a reaction system was prepared using primers F and R: 1 μL of genomic DNA, 5 μL of universal PCR mix, 0.2 μL of primers F and R, and 3.6 μL of sterile double-distilled water (if the genomic DNA concentration is ≤5 ng / μL, 4.6 μL of genomic DNA can be added without sterile double-distilled water. The reaction system can also be scaled up accordingly).

[0011] 3) The reaction procedure for PCR amplification is:

[0012]

[0013] The forward and reverse primer sequences used for the above PCR amplification are:

[0014] F: 5'-TAGTATTAAGGCACATGCCG-3';

[0015] R: 5'-ATGATGTTTACTTGTTTGCTTG-3'.

[0016] 4) After the PCR reaction described in step 3) is completed, 1 μL each of the saturated fluorescent dye Lcgreen and an internal standard (equal amounts of a mixture of a high-temperature internal standard and a low-temperature internal standard, i.e., two double-stranded oligonucleotides with different GC contents, with the final concentrations of the high and low-temperature internal standards at 2.5 μM, respectively) is added, and annealed at 95°C for 5-10 minutes;

[0017] 5) After the annealing in step 4), the sample is naturally cooled to room temperature, and a high-resolution melting curve analysis is performed to identify the genotype of the long oyster SNP marker in the sample to be tested. The specific method is as follows:

[0018] a) Correcting the melting curves of all samples using the internal standard melting curve;

[0019] b) Grouping the corrected melting curves of all samples to be tested. If the derivative of the melting curve shows a single peak and the temperature corresponding to the abscissa of the peak is greater than 77.5°C, the SNP genotype is CC. If the derivative of the melting curve shows a single peak and the temperature corresponding to the abscissa of the peak is less than 77.5°C, the SNP genotype is TT. If the derivative of the melting curve shows a double peak, the SNP genotype is TC.

[0020] c) determining the genotype of the Crassostrea gigas SNP marker of each sample to be tested.

[0021] The high and low internal standard sequences required for SNP genotyping are:

[0022]

[0023] The low temperature internal standard sequence is:

[0024]

[0025] The specific method for obtaining the internal standard is:

[0026] 1) Entrust a company to synthesize four single-stranded oligonucleotides:

[0027] GWNB+: 5'-GCGGTCAGTCGGCCTAGCGGTAGCCAGCTGCGGCACTGCGTGACGCTCAG-3'

[0028] GWNB-:5'-CGCCAGTCAGCCGGATCGCCATCGGTCGACGCCGTGACGCACTGCGAGTC-3'

[0029] DWNB+: 5'-ATCGTGATTTCTATAGTTATCTAAGTAGTTGGCATTAATAATTTCATTTT-3'

[0030] DWNB-:5'-TAGCACTAAAGATATCAATAGATTCATCAACCGTAATTATTAAAGTAAAA-3'

[0031] 2) Dissolve the four single-stranded nucleotides in sterile double-distilled water to a final concentration of 10 μM;

[0032] 3) Mix four single-stranded nucleotides in equal volumes to obtain high and low temperature internal standards with a final concentration of 2.5 μM each.

[0033] Potential application of SNP markers related to glycogen content in long oysters: So far, except for this patent, there have been no reports on the development of SNP markers based on whole genome association analysis in oysters. Compared with the previous development of single SNP markers, the results of this study are more credible, adaptable to a wider range of populations, and more stable in effect. Before seedling breeding, oyster genomic DNA is extracted by non-lethal sampling, and the SNP markers and identification methods as described above are used to determine the genotype of parent oysters. By screening parent oysters with CC genotypes, the glycogen content of offspring long oysters is effectively increased. The present invention provides a method for determining SNP genotypes based on the melting curve of PCR products, such as Figure 1 As shown, when the melting curve is single-peaked after derivation and the temperature of the abscissa corresponding to the peak is greater than 77.5°C, the SNP genotype is CC; when the melting curve is single-peaked after derivation and the temperature of the abscissa corresponding to the peak is less than 77.5°C, the SNP genotype is TT; when the melting curve is double-peaked after derivation, the SNP genotype is TC. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] 1. Figure 1 This is the derivative graph of the melting curve of the PCR product of the scaffold1243_53,489 site mentioned above; 2. Figure 2 This is the Manhattan plot of the genome-wide association analysis of glycogen content in the long oyster. DETAILED DESCRIPTION

[0035] The present invention is further explained below with reference to the following examples, but the examples do not limit the present invention in any form.

[0036] Example 1:

[0037] a) Sample collection: 288 individuals from a wild population hatched simultaneously in Jiaonan were collected and dissected. The adductor muscles and remaining tissues were removed, quickly frozen in liquid nitrogen, and stored at -80°C for later use.

[0038] b) DNA Extraction: Genomic DNA was extracted from 288 samples and the concentration was determined by UV spectrophotometry. The genomic DNA was diluted to 10 ng / uL with sterile water according to the measured concentration.

[0039] c) SNP genotype detection: Take the genomic DNA diluted in step 1) as a template and perform PCR amplification using primers F and R. The reaction system is as follows: 1uL genomic DNA, 0.2uL each of primers F and R, 5uL PCR mix, and 3.6uL sterile double-distilled water;

[0040] The reaction procedure for PCR amplification is:

[0041]

[0042] After the PCR reaction was completed, 1 μL of saturated fluorescent dye Lcgreen and internal standard were added, and annealed at 95°C for 8 minutes;

[0043] The forward primer was F: 5′-TAGTATTAAGGCACATGCCG-3′;

[0044] The reverse primer was R: 5′-ATGATGTTTACTTGTTTGCTTG-3′;

[0045] After the reaction, 1 μl of internal standard (the same as above) and 1 μl of LC-green dye were added, and the mixture was denatured at 95°C for 10 min after instant centrifugation and cooled to room temperature.

[0046] After annealing, the sample was cooled to room temperature and subjected to high-resolution melting curve analysis to identify the sample.

[0047] a) Correcting the melting curves of all samples using the internal standard melting curve;

[0048] b) The corrected melting curves of all tested samples were grouped. When the melting curve derivative showed a single peak and the temperature of the abscissa corresponding to the peak was greater than 77.5°C, the SNP genotype was CC. When the melting curve derivative showed a single peak and the temperature of the abscissa corresponding to the peak was less than 77.5°C, the SNP genotype was TT. When the melting curve derivative showed a double peak, the SNP genotype was TC.

[0049] c) determining the genotype of the Crassostrea gigas SNP marker of each sample to be tested.

[0050] The high and low internal standard sequences required for SNP genotyping,

[0051] The high temperature internal standard sequence is:

[0052]

[0053] The low temperature internal standard sequence is:

[0054]

[0055] The specific method for obtaining the internal standard is:

[0056] 1) Entrust a company to synthesize four single-stranded oligonucleotides:

[0057] GWNB+: 5'-GCGGTCAGTCGGCCTAGCGGTAGCCAGCTGCGGCACTGCGTGACGCTCAG-3'

[0058] GWNB-:5'-CGCCAGTCAGCCGGATCGCCATCGGTCGACGCCGTGACGCACTGCGAGTC-3'

[0059] DWNB+: 5'-ATCGTGATTTCTATAGTTATCTAAGTAGTTGGCATTAATAATTTCATTTT-3'

[0060] DWNB-:5'-TAGCACTAAAGATATCAATAGATTCATCAACCGTAATTATTAAAGTAAAA-3'

[0061] 2) Dissolve the four single-stranded nucleotides in sterile double-distilled water to a final concentration of 10 μM;

[0062] 3) Mix four single-stranded nucleotides in equal volumes to obtain high and low temperature internal standards with a final concentration of 2.5 μM each.

[0063] d) HRM typing: Remove the 96-well PCR reaction plate and place it in the LightScanner 96 machine for HRM detection. The fluorescence signal between 55°C and 95°C is collected. After the run, the results are analyzed based on the melting curve and the genotype of each individual is calculated.

[0064] e) Analysis of results: After testing, only the 102nd individual had a genotype of C / C, 136 individuals had a genotype of T / C, 49 individuals had a genotype of T / T, and 1 individual had a genotype of NN.

[0065] f) Glycogen Content Measurement and Correlation Analysis: Glycogen content was measured in 288 wild individuals using an anthrone colorimetric method. The data shown in the figure show that the order of glycogen content among different genotypes is CC > TC > TT. The CC genotype has a significantly higher glycogen content of 8.6% compared to the TT genotype. Therefore, the genotype at this locus is significantly correlated with glycogen content. By selecting CC genotypes during breeding, glycogen content in offspring can be significantly increased.

[0066] Table 1: Glycogen content and genotyping analysis of 288 individuals.

[0067]

[0068] Sequence Listing (1) SEQ ID NO.1 Information sequence characteristic length: 1001 bp

[0069] Type: Nucleic acid

[0070] Chain type: single chain

[0071] Topology: Linear

[0072] Molecule type: DNA

[0073] Source: Long Oyster

[0074] Sequence Description:

[0075] AATATTCAAATACATGTATATGATGCAAGTTTTCTTCTTTATGCTACATCTTACATA

[0076]

[0077] Through genome-wide association analysis of 486 individuals, 67 SNP signals significantly correlated with glycogen content on chromosome 6 of the long oyster were identified. A corresponding detection method was developed for a SNP site at the scaffold1243_53489 base in this region. The results showed that the method can be used to detect the SNP site simply and quickly. At the same time, the glycogen content of individuals with the CC genotype at this site was significantly increased by 8.6% compared with individuals with the TT genotype. Subsequently, this method can be used to screen parent oysters with the CC genotype to guide oyster breeding. The nucleotide sequence of the 500kb upstream and downstream of this site in the long oyster is shown in SEQ ID No.1. The present invention provides a SNP marker significantly correlated with the glycogen content of the long oyster and its potential application. Its beneficial effect is that the genotype of the parent oyster can be identified before seed breeding, thereby increasing the glycogen content of the offspring. Sequence Listing <110> Institute of Oceanology, Chinese Academy of Sciences <120> A method for screening long oyster broodstock with high glycogen content and its related SNP primer pairs <141> 2017-09-20 <160> 1 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1001 <212> DNA <213> gene <220> <221> gene <222> (1)..(1001) <400> 1 aatattcaaa tacatgtata tgatgcaagt tttcttcttt atgctacatc ttacatacaa 60 cacatgaaca tacactgcag ataaatgcag aatgagtgat tttccctgtt ttgtgaattc 120 tttgacatgc agaaatatta gagttatttc ccttttaaca caagatattc ttgtacaaaa 180 gaggactccg aatgtctcctttgtggtctc ttttttgtgc attcaaattc tctttttgat 240 ggtatggtca tattataagt atagatacca cttaggaat gcatcaaac atgataaga 300 tatggcaaa ttaaatatt tcagacaag attaattta gataggaaa acatctgttc 360 agttaaataa tattttatt tggttttga tgcaacgttc aagtctgaga tattattaa 420 caggtatgga accacaatgg aaacacacat gagaattta gtattaaggc acatgccgcc 480 assatttaca actaggact tcaagcaac aagtaacaat assatcctta accagttact 540 ttcaactaaa tgttatcatt tgacttat cccaatttta aagagtcagt tgaaaatga 600 aaatttcag taatctgctt ctctcgtca acaccaatcc gcctactt ggacagttac 660 gtgttcctgc gtgtgaacga ggacactgac ggagttctag tggagga aacgttagac 720 acggggtgag ttatcctgat gandacacgtg tgtatgtagc cgacttactg tacaggaat 780 gtacacgtca aggatttaat ttcctgaagt ttgtgtagag aagtctgatg ataccggta 840 catgatgaag tctgtttcgt gggaattata ttcattgcc tgcacattta tacaatttga 900 ttctcttgat ttattctgtt ttttaaaatg gggccaatgt catataaatt atatgtataa 960 cccaacaata actttaatat cattgttgta aaatattaac a 1001

Claims

1. A method for determining the genotype of a SNP marker in a long oyster, characterized by: SNP primer pairs: The forward primer was F: 5′-TAGTATTAAGGCACATGCCG-3′; The reverse primer was R: 5′-ATGATGTTTACTTGTTTGCTTG-3′. A SNP marker was obtained through genome-wide association analysis, which is located at the 489kb base of scaffold1243_53 in the long oyster genome; this site has two base forms, T and C. Before seed breeding, the genotype of the SNP marker site was identified in the parent oysters. The order of glycogen content of different genotypes is CC>TC>TT. By screening the parent oysters with the CC genotype at this site, the glycogen content of the offspring population was improved. The steps are as follows: (1) Extracting the long oyster genome, specifically extracting the long oyster genomic DNA and diluting it to 10-20 ng / uL using sterile water or TE buffer; (2) Using the genomic DNA of the long oyster as a template, a reaction system was prepared: 1uL of genomic DNA, 5uL of universal PCR mix, 0.2uL of primers F and R, and 3.6uL of sterile double-distilled water; the reaction system can be scaled up accordingly; (3) The reaction procedure for PCR amplification is: 35-55 cycles (number of cycles can be selected as needed) (4) After the PCR reaction is completed, 1 μL of saturated fluorescent dye Lcgreen and internal standard are added, and annealed at 95°C-98°C for 5-10 minutes; (5) After annealing, the sample is cooled to room temperature and subjected to high-resolution melting curve analysis to identify the sample. a) Correcting the melting curves of all samples using the internal standard melting curve; b) The corrected melting curves of all tested samples were grouped. When the melting curve derivative showed a single peak and the temperature of the abscissa corresponding to the peak was greater than 77.5°C, the SNP genotype was CC. When the melting curve derivative showed a single peak and the temperature of the abscissa corresponding to the peak was less than 77.5°C, the SNP genotype was TT. When the melting curve derivative showed a double peak, the SNP genotype was TC. c) determining the genotype of the Crassostrea gigas SNP marker of each sample to be tested. In step (5), the internal standard is an equal mixture of a high-temperature internal standard and a low-temperature internal standard, i.e., two double-stranded oligonucleotides with different GC contents, and the final concentrations of the high-temperature internal standard and the low-temperature internal standard are 2.5 μM respectively; The high and low internal standard sequences required for SNP genotyping, The high temperature internal standard sequence is: The low temperature internal standard sequence is:

2. The method according to claim 1, wherein: The specific method for obtaining the internal standard is: 1) Synthesis of four single-stranded oligonucleotides: GWNB+: 5'-GCGGTCAGTCGGCCTAGCGGTAGCCAGCTGCGGCACTGCGTGACGCTCAG-3' GWNB-:5'-CGCCAGTCAGCCGGATCGCCATCGGTCGACGCCGTGACGCACTGCGAGTC-3' DWNB+: 5'-ATCGTGATTTCTATAGTTATCTAAGTAGTTGGCATTAATAATTTCATTTT-3' DWNB-:5'-TAGCACTAAAGATATCAATAGATTCATCAACCGTAATTATTAAAGTAAAA-3' 2) Dissolve the four single-stranded nucleotides in sterile double-distilled water to a final concentration of 10 μM; 3) Mix four single-stranded nucleotides in equal volumes to obtain high and low temperature internal standards with a final concentration of 2.5 μM each.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) marker relevant to heat tolerance of argopectehs irradias and identification method and potential application thereof

    CN103740702A

  • SNP marker associated with oyster antiviral properties and application thereof

    CN104450697A

  • SNP marker related to rapid growth of pacific oysters and identification method as well as application thereof

    CN105506162A

  • SNP (single-nucleotide polymorphism) marker related to Crassostrea gigas glycogen content character and application thereof

    CN104152444A