Microcapsules for detecting and / or quantifying analytes in samples

Abstract

The present invention relates to microcapsules for detecting and / or quantifying analytes in a sample. In addition, the present invention relates to methods for detecting and / or quantifying analytes in a sample using said microcapsules. In addition, the present invention relates to methods for preparing microcapsules for detecting and / or quantifying analytes in a sample.

Description

Technical Field

[0001] The present invention relates to microcapsules for detecting and / or quantifying analytes in a sample. In addition, the present invention relates to methods for detecting and / or quantifying analytes in a sample using said microcapsules. In addition, the present invention relates to methods for preparing microcapsules for detecting and / or quantifying analytes in a sample. Background Art

[0002] There are a large number of techniques that can be used to detect small differences in analyte or quantitative analyte concentrations in samples. In particular, these techniques have also been used in multiplex assay formats. For example, in Fulton et al. Clinical Chemistry, 1997, 43 (9); pp. 1749-1756, a multiplex data acquisition and analysis platform is disclosed for performing flow cytometry analysis of microsphere-based assays for simultaneous measurement of up to 64 different analytes. In order to detect small differences in single analytes or quantitative analyte concentrations in samples, digital analysis techniques have been established (Witters et al., Lab. Chip, 2014, 14 (17); pp. 3225-3232). In order to provide defined constraints for specific biochemical reactions, emulsification techniques have been established and used to establish digital detection schemes (Kanagal-Shamanna, Methods Mol. Biol., 2016, 1392; pp. 33-42). The quality of these assays depends to a large extent on the stability of the emulsion. To this end, a combination of certain emulsifiers provided in the non-aqueous phase and bovine serum albumin (BSA) in the aqueous phase of the water-in-oil emulsion has been used to form droplets with a protein sheath (see US 2011 / 0217711 A1). This approach has also been used in Hindson et al. (Anal. Chem., 2011, 83 (22); pp. 8604-8610). In this approach, PCR reagents including BSA are mixed with a diluted aqueous sample and a microfluidic device is used to produce an emulsion of aqueous droplets in a fluorocarbon oil containing a suitable emulsifier. After heating to 95°C, a sheath is formed around the droplets and provides protection against aggregation during the subsequent thermal cycling step for nucleic acid amplification. The actual encapsulation effect has long been known and has also been used to produce microcapsules for drug delivery or as food additives (Acton et al., Journal of Food Science, 1972, 37(5); pp. 795-796 and Gires et al., J. Mech. Behav. Biomed. Mater., 2016, 58, pp. 2-10).

[0003] Microcapsules have also been used to perform highly parallel single polymerase chain reactions (Mak et al., Advanced Functional Materials 2017, 18 (19); pp. 2930-2937). Temperature-stable microcapsules with selectively permeable capsule walls were constructed on agarose gel particles with embedded and dissolved reagents including targets to be amplified by matrix-assisted layer-by-layer assembly (LbL) in encapsulation technology (Bai et al., angewandte Chemie, 2017, 122 (30); pp. 5316-5320). In this method, during the polymerase chain reaction, small molecular weight building blocks such as nucleotides (dNTPs) are supplied from the outside and diffuse into the inside through the permeable capsule wall, so that the high molecular weight PCR products obtained during PCR accumulate in the microcapsules.

[0004] All of the aforementioned techniques either require in situ generation of droplets or are difficult to perform and require the establishment of elaborate protocols. In addition, the resulting capsules are not storable or they are difficult to manipulate and require the establishment of elaborate protocols. Therefore, there is a need in the art for improved methods that allow easy manufacture, storage and use of microcapsules for detecting and / or quantifying analytes in samples. There is also a need in the art for providing prefabricated capsules that allow for the detection of analytes and for use in prefabricated reagents. In addition, there is a need in the art for providing prefabricated capsules that allow the capture of analytes. Summary of the invention

[0005] Therefore, in a first aspect, the present invention relates to a microcapsule for detecting and / or quantifying an analyte in a sample, the microcapsule comprising

[0006] ● a reagent capable of generating and / or amplifying a signal in the presence of an analyte to be detected and / or quantified; wherein the reagent is in a dry state;

[0007] - A porous matrix surrounding said reagent, said porous matrix having means for receiving an analyte to be detected and / or quantified; wherein said dry state reagent is separated from said porous matrix by a barrier, such as at least one barrier layer surrounding said reagent.

[0008] In one embodiment, the means for receiving the analyte to be detected and / or quantified is an interstitial pore of a size suitable for receiving a liquid sample containing the analyte.

[0009] In one embodiment, the interstitial pores are sized to accommodate sufficient liquid sample to dissolve the dried reagent.

[0010] In one embodiment, the means for receiving the analyte to be detected and / or quantified is the interstitial pores containing the liquid sample or a combination of the interstitial pores and one or more capture agents, which are capable of selectively and specifically binding to the analyte to be detected and / or quantified after the microcapsule is exposed to the sample surrounding the microcapsule and containing such analyte, wherein the one or more capture agents are attached to the portion of the microcapsule exposed to the surrounding environment of the microcapsule.

[0011] In one embodiment, the microcapsules according to the present invention comprise:

[0012] one or more impermeable cores, preferably water-impermeable cores, containing and / or embedding said signal generating and / or amplifying reagents and thus separating said dry state reagents from said porous matrix;

[0013] - A porous hydrophilic shell forming said porous matrix and surrounding said one or several impermeable cores, wherein said one or more capture agents, if present, are attached to said porous hydrophilic shell.

[0014] When used in this article, the term "impermeable" is preferably intended to refer to impermeability to water. In a preferred embodiment, a "water-impermeable core" prevents water from diffusing into the core and / or passing through the core from the surrounding environment of the core. When used in this article, an "impermeable core" contains and / or is embedded with a reagent that can produce and / or amplify a signal, and the reagent is in a dry state. Therefore, when used in this article, an "impermeable core" effectively separates the dry state reagent from the surrounding environment and maintains them in a dry state. Therefore, in an embodiment of the present invention, the impermeable core represents at least one barrier layer surrounding the reagent.

[0015] In one embodiment, the porous hydrophilic shell is composed of a hydrogel former or of a thermoresponsive polymer.

[0016] In one embodiment,

[0017] - the hydrogel forming agent is selected from: a) synthetic polymers such as polymethyl methacrylate, polyamide; b) silicon-based polymers such as polydimethylsiloxane; c) naturally occurring polymers selected from polysaccharides such as agarose, chitin, chitosan, dextran, alginate, carrageenan, cellulose, fucoidan, laminarin, gums selected from xanthan gum, gum arabic, gum ghatti, guar gum, locust bean gum, tragacanth gum, karaya gum; and inulin; polypeptides, collagen, gelatin, polyamino acids such as polylysine; polynucleotides; and combinations thereof; and

[0018] - the thermosensitive polymer is a LCST thermosensitive polymer, which is preferably selected from poly(N-isopropylacrylamide) (PNIPAm), poly[2-(dimethylamino)ethyl methacrylate] (pDMAEMA), hydroxypropyl cellulose, poly(vinyl caprolactam) (P(VCL)) and polyvinyl methyl ether, or the thermosensitive polymer is a thermosensitive polymer with an upper critical solution temperature (UCST), which is preferably selected from poly(N-acryloylglycinamide) (PNAGA), poly(allylamine)-co-poly(allyl urea) and its derivatives, poly(methacrylamide), poly(N-acryloyl asparagine), poly(N-methacryloyl glutamine), poly(acrylamide)-co-(acrylonitrile), poly(sulfobetaine), poly(phosphorylcholine).

[0019] In one embodiment, the impermeable core is composed of a material suitable for containing and / or embedding the agents, and wherein the material surrounds the agents and isolates them from the rest of the microcapsule, such as the porous matrix, in particular the hydrophilic shell, wherein the material is preferably selected from paraffin, triglycerides, waxes, in particular vegetable waxes such as carnauba wax, animal waxes such as beeswax, waxes derived from petroleum, mineral waxes.

[0020] In one embodiment, the impermeable core contains and / or embeds the reagent capable of generating and / or amplifying a signal in a dry state and separates them from the porous matrix. Since the impermeable core is a water-impermeable core in a preferred embodiment, this water-impermeable core maintains the reagent in the dry state.

[0021] In one embodiment, the reagent capable of generating and / or amplifying a signal is

[0022] - a reagent capable of performing nucleic acid amplification using a nucleic acid analyte, and wherein preferably, the reagent comprises a molecule capable of amplifying the analyte in the sample, such as an amplification enzyme, one or more molecules necessary to promote the amplification of the analyte, such as one or more nucleic acid primers, nucleotides, salts and buffers, and optionally one or more detection reagents, or

[0023] - one or several detection reagents for detecting proteins or peptides or cells as analytes in the sample, wherein preferably the one or several detection reagents are selected from antibodies or antibody fragments, nucleic acids including aptamers, Spiegelmers (mirror oligonucleotide anti-nucleases), non-antibody proteins such as receptors, receptor fragments, affinity proteins such as streptavidin, each of which is optionally labeled with a suitable reporter molecule such as a dye, an enzyme, a chemical catalyst, or a mixture of reagents capable of initiating a chemical reaction that produces an optical or other detectable signal indicating the presence of the protein or peptide or cell as the analyte to be detected.

[0024] In one embodiment, the microcapsules do not contain the analyte to be detected.

[0025] In one embodiment, the microcapsules are not capsules or particles generated in situ.

[0026] In one embodiment, the capture agent is selected from antibodies, antibody fragments, nucleic acids including aptamers, spiegelmers, non-antibody proteins such as receptors, receptor fragments, affinity proteins such as streptavidin, chemical groups such as biotin, Digoxigenin, dinitrophenol, nucleic acid or nucleic acid analog-tag, or can be bound by antibodies, antibody fragments, nucleic acids including aptamers, non-antibody proteins such as receptors, receptor fragments, affinity proteins such as streptavidin with K D =10 -8 Up to 10 -15 M, or is selected from hydrophobic structures that can specifically bind to hydrophobic molecules or molecules having hydrophobic groups, wherein preferably the hydrophobic structure has a logD greater than 2 under the conditions for performing the detection of the analyte.

[0027] As used in this article, the term " " usually refers to a protein having the sequence -Ala-Trp-Arg-His-Pro-Gln-Phe-Gly-Gly-COOH or...-Asn-Trp-Ser-His-Pro-Gln-Phe-Glu-Lys-... Peptide that binds reversibly but with high affinity to streptavidin ( and ) or an engineered form of streptavidin, i.e., " ”

[0028] When used in this article, the term "logD" refers to the logarithm of the distribution coefficient (D), which is the ratio of the concentration of a compound in a mixture of two immiscible phases at equilibrium. In a preferred embodiment, the term "distribution coefficient" used herein is used synonymously with "partition coefficient". In a preferred embodiment, "distribution coefficient" refers to the concentration ratio of a compound in a mixture of water and 1-octanol. Typically, the measurement of this distribution coefficient is carried out by any suitable method known to those skilled in the art. This suitable method includes the "shake bottle method", in which the compound in question is dissolved in a certain volume of octanol and water, and then the concentration of this compound in each solvent is further measured. Other suitable methods include high performance liquid chromatography (HPLC). In this HPLC method, the distribution coefficient (D) and its logarithm can be determined by associating its retention time with similar compounds with known distribution coefficient values.

[0029] In one embodiment, the microcapsule further contains one or more protective agents for protecting one or more of the agents capable of generating and / or amplifying a signal in the aqueous solution, wherein preferably, the one or more protective agents are selected from cyclodextrin and poly(alkylene oxide).

[0030] In one embodiment, the microcapsules further contain a label for labeling the microcapsules and / or a magnetic component, wherein the magnetic component allows for subsequent manipulation of the microcapsules.

[0031] In one embodiment, the reagents capable of performing nucleic acid amplification further comprise one or more detection reagents, wherein the one or more detection reagents are selected from antibodies or antibody fragments, nucleic acids including aptamers, Spiegelmers, non-antibody proteins such as receptors, receptor fragments, affinity proteins such as streptavidin, each of which is optionally labeled with a suitable reporter molecule such as a dye, an enzyme, a chemical catalyst, or a reagent mixture that can initiate a chemical reaction that produces an optical or other detectable signal indicating the presence of the analyte to be detected.

[0032] In another aspect, the present invention relates to a method for detecting and / or quantifying an analyte in a sample, the method comprising:

[0033] i. providing a microcapsule according to the present invention as described in any one of the above embodiments;

[0034] ii. exposing the microcapsules to an aqueous sample surrounding the microcapsules and containing or suspected of containing the analyte to be detected and / or quantified;

[0035] iii. removing the microcapsules from the aqueous sample and transferring the microcapsules to a non-aqueous phase;

[0036] iv. dissolving or rupturing the microcapsules, preferably dissolving or rupturing the impermeable core alone or the impermeable core together with the porous hydrophilic shell, to produce aqueous droplets in a non-aqueous environment, wherein the aqueous droplets contain the reagent capable of generating and / or amplifying a signal in the presence of the analyte to be detected and / or quantified in dissolved form;

[0037] v. A reaction that generates and / or amplifies a signal is performed within the aqueous droplet, wherein a signal is generated and / or amplified only if the analyte is already present in the sample.

[0038] In one embodiment, the reaction performed in step v. is a nucleic acid amplification reaction or a signal amplification reaction, wherein preferably the reaction performed in step v. is a nucleic acid amplification reaction selected from PCR or an isothermal amplification reaction such as TMA, NASBA, LAMP, 3SR, SDA, RCA, LCR, RPA, NEAR.

[0039] In one embodiment, in step iv., the microcapsules, preferably the impermeable core, are dissolved or destroyed by means selected from mechanical means, chemical cleavage, temperature change, pH change, solvent change, application of an electric field, application of a magnetic field, exposure of the microcapsules to electromagnetic radiation, in particular light of a defined wavelength range such as UV light, preferably temperature change, more preferably temperature increase.

[0040] In one embodiment, the microcapsule is a microcapsule according to any of the embodiments defined above and the porous hydrophilic shell consists of a LCST (= "lower critical solution temperature") thermosensitive polymer.

[0041] In one embodiment wherein the porous hydrophilic shell is composed of a LCST thermosensitive polymer, the method comprises an additional step between steps ii. and iii.

[0042] ii.a heating the microcapsules to a temperature above the lower critical solution temperature (LCST) of the LCST thermosensitive polymer, and subsequently cooling the microcapsules or allowing them to cool to a temperature below the lower critical solution temperature (LCST) of the LCST thermosensitive polymer to achieve enrichment of the analyte bound to the microcapsules, and performing this step ii.a n times, wherein n is an integer from 1 to 1000, preferably from 1 to 500, and / or an additional step

[0043] ii.b washing the microcapsules in an aqueous solution to remove unbound analytes, wherein if step ii.b is performed in addition to step ii.a, it is performed before or after step ii.a.

[0044] In another embodiment, the microcapsule is a microcapsule according to any of the embodiments as defined above and the porous hydrophilic shell consists of a UCST (= "Upper Critical Solution Temperature") thermosensitive polymer.

[0045] In one embodiment wherein the porous hydrophilic shell is composed of a UCST thermosensitive polymer, the method comprises an additional step between steps ii. and iii.

[0046] ii.a cooling the microcapsules to a temperature below the upper critical solution temperature (UCST) of the UCST thermosensitive polymer, and then heating the microcapsules or allowing them to heat to a temperature above the upper critical solution temperature (UCST) of the UCST thermosensitive polymer to achieve enrichment of the analyte bound to the microcapsules, and performing this step ii.a n times, wherein n is an integer from 1 to 1000, preferably from 1 to 500, and / or an additional step

[0047] ii.b washing the microcapsules in an aqueous solution to remove unbound analytes, wherein if step ii.b is performed in addition to step ii.a, it is performed before or after step ii.a.

[0048] In another aspect, the present invention relates to a method for preparing microcapsules for detecting and / or quantifying an analyte in a sample, the microcapsules being as defined in any one of the above embodiments of the present invention, the method comprising the following steps:

[0049] a) providing an aqueous solution of reagents capable of generating and / or amplifying a signal in the presence of an analyte to be detected and / or quantified, wherein the aqueous solution of reagents optionally comprises, in addition to the reagents, one or more protective reagents for protecting one or more of the reagents capable of generating and / or amplifying a signal in the aqueous solution;

[0050] b) drying the aqueous solution of a) , preferably spray drying or freeze drying, thereby producing a dry reagent capable of generating and / or amplifying a signal, which is preferably in the form of nanoparticles;

[0051] c) incorporating the dry reagent into a material suitable for containing and / or embedding the reagent, so that the material surrounds the reagent and isolates them, wherein the material is preferably selected from paraffin, triglycerides, waxes, in particular vegetable waxes such as carnauba wax, animal waxes such as beeswax, waxes derived from petroleum, mineral waxes;

[0052] d) producing microparticles from the product of said c) by drying, preferably spray drying or freeze drying, thereby producing an impermeable core;

[0053] e) incorporating the impermeable core into a porous hydrophilic shell forming a porous matrix and surrounding the one or several impermeable cores by

[0054] ■ incorporating the impermeable core into a hydrogel former and inducing the hydrogel former to form a hydrogel around the impermeable core, or

[0055] ■ Incorporating the impermeable core into a precursor / monomer of a thermosensitive polymer and inducing the precursor / monomer to polymerize around the impermeable core into a thermosensitive polymer, or

[0056] ■ incorporating the impermeable core into a preformed thermosensitive polymer and allowing the preformed thermosensitive polymer to mold around the impermeable core;

[0057] f) optionally, coupling one or several capture agents to said porous hydrophilic shell surrounding said one or several impermeable cores, thereby producing microcapsules with one or several capture agents attached, wherein said one or several capture agents are capable of selectively and specifically binding to an analyte to be detected and / or quantified upon exposure of said microcapsules to a sample surrounding said microcapsules and containing such analyte;

[0058] g) optionally collecting the microcapsules;

[0059] h) further optionally washing and / or drying the microcapsules, preferably freeze-drying.

[0060] In an embodiment according to the present invention, a microcapsule for detecting and / or quantifying an analyte in a sample is provided, wherein the microcapsule comprises a reagent capable of generating and / or amplifying a signal in the presence of an analyte to be detected and / or quantified, wherein the reagent is in a dry state and is separated from a porous matrix surrounding the reagent by a suitable barrier. The microcapsules according to the present invention are easy and simple to manufacture, they can be stored for a long time, can be transported when convenient, and do not need to be prepared in situ at the time and place of intended use. The barrier used in the microcapsules according to the present invention allows the reagent to be kept in a dry state. The barrier can take many different forms, and can be, for example, at least one barrier layer surrounding the reagent. In another embodiment, the barrier can be one or several impermeable cores, which contain and / or are embedded with the reagent, and thus they are isolated from the porous matrix surrounding the reagent. In yet another embodiment, the reagent capable of generating and / or amplifying a signal can be contained in a compartment separated from the porous matrix surrounding the reagent in the microcapsule. In a preferred embodiment, the barrier is formed by a shell containing and / or embedded with one or several impermeable cores of the reagent. In this embodiment, the impermeable core has a shell on the outside that acts as a barrier to protect, separate and isolate the agents located within the core.

[0061] According to an embodiment of the invention, the porous matrix surrounding the reagent has means for receiving the analyte to be detected.

[0062] In an embodiment according to the invention, the microcapsule itself spans and encloses a certain volume, which acts as a reaction space for detecting and / or quantifying the analyte during the use of the microcapsule. This volume is occupied and filled by the reagent capable of generating and / or amplifying a signal and an impermeable core containing the reagent and a porous matrix surrounding the reagent including means for receiving the analyte before use of the microcapsule.

[0063] In one embodiment, the means for receiving the analyte is the interstitial pores of the porous matrix of the size suitable for accommodating the liquid (i.e., usually aqueous) sample containing the analyte. In one embodiment, the size of the interstitial pores is selected to be suitable for accommodating a sufficient amount of liquid (e.g., usually aqueous) sample to dissolve a certain amount of dry reagent located in the microcapsule. In other words, the size of the microcapsule, in particular the porous matrix, is selected according to the amount of dry reagent contained in the microcapsule. In one embodiment, the porous matrix with the means for receiving the analyte to be detected and / or quantitatively acts like a sponge using the interstitial pores to absorb the liquid sample that may contain the analyte. By absorbing this liquid sample, the analyte is effectively received by the microcapsule. In one embodiment, the means for receiving the analyte to be detected is additionally formed by the presence of one or more capture agents in addition to the interstitial pores, and the capture agent is attached to a part of the microcapsule exposed to its surroundings. In those embodiments where the microcapsules comprise a porous hydrophilic shell forming the porous matrix, the one or more capture agents are attached to the porous hydrophilic shell because such porous hydrophilic shell is exposed to the surrounding environment of the microcapsule and comes into contact with any sample to which the microcapsule may be exposed.

[0064] In one embodiment, the microcapsules according to the present invention have a size in the range of 1 μm to 2000 μm, preferably 1 μm to 1500 μm, more preferably 10 μm to 1000 μm, even more preferably 20 μm to 500 μm, even more preferably 30 μm to 300 μm, and any range therebetween.

[0065] When used herein in the context of microcapsules according to the invention, the term "having a certain size" generally refers to the dimensions of these microcapsules, and generally to the longest dimension of these microcapsules. In one embodiment, the term "size" refers to the average diameter of the microcapsules.

[0066] In one embodiment, the microcapsule has a spherical, ellipsoidal, ball, egg, or irregular rounded shape.

[0067] As used herein, the term "micro" generally refers to dimensions in the micrometer range.

[0068] In one embodiment, a "microcapsule" is an effectively encapsulated microsphere having inside it a reagent capable of generating and / or amplifying a signal in the presence of an analyte to be detected and / or quantified; wherein said reagent is in a dry state; and furthermore comprises a porous matrix surrounding said reagent, said porous matrix having means for receiving the analyte to be detected and / or quantified; wherein said dry state reagent is separated from said porous matrix by a barrier, such as at least one barrier layer surrounding said reagent. In one embodiment, these encapsulated microspheres comprise one or more impermeable cores, which contain and / or embed said reagent capable of generating and / or amplifying a signal and thus separate said dry state reagent from said porous matrix; and furthermore comprises a porous hydrophilic shell forming said porous matrix and surrounding said one or more impermeable cores; wherein said one or more capture agents, if present, are attached to said porous matrix or, in one embodiment, to said porous hydrophilic shell.

[0069] According to an embodiment of the present invention, the microcapsule according to the present invention can also be characterized according to the volume it surrounds. This volume surrounded by the microcapsule effectively represents the reaction space in which the detection and / or quantification of the analyte occurs. In one embodiment, the volume surrounded by the microcapsule represents the maximum reaction space that can be used for the detection and / or quantification of the analyte. Therefore, the microcapsule provides a reaction space that can be used for the detection and / or quantification of the analyte by virtue of the surrounded volume, and the reaction space is partially or completely filled with water or an aqueous solution during the detection and / or quantification of the analyte. Typically, the water or aqueous solution that fills the reaction space during detection and / or quantification is derived from a sample suspected of containing the analyte, or it is derived from a cleaning solution or buffer to which the microcapsule is exposed after the analyte has been combined (i.e., after the microcapsule has been exposed to a sample suspected of containing the analyte before).

[0070] In one embodiment, the microcapsules have a volume in the range of 0.5 fl to 4.2 μl, preferably 0.5 fl to 1.8 nl, more preferably 500 fl to 525 nl, even more preferably 4 pl to 65 nl, even more preferably 14 pl to 14 nl and any range therebetween.

[0071] In the embodiment wherein the microcapsule comprises a porous hydrophilic shell forming the porous matrix, the porous hydrophilic shell is not a shell formed by a polyelectrolyte. More specifically, it is not a shell formed by a polyelectrolyte that has been deposited by a layer-by-layer deposition technique.

[0072] Since the agent capable of generating and / or amplifying a signal is present in the microcapsules in a dry state before the microcapsules are used, the microcapsules according to the invention can be produced in an easy manner and importantly separated in time and space from the time and space in which the microcapsules are intended to be used. Therefore, the microcapsules according to the invention can also be easily stored for a long time and can be transported without expending a lot of effort on maintaining temperature or other storage conditions.

[0073] During use, the microcapsules according to embodiments of the present invention can be exposed to aqueous liquid samples containing analytes, which are then absorbed by the porous matrix of the microcapsules. In effect, if the sample contains analytes, the porous matrix receives the analytes to be detected. In addition to the interstitial pores, the means for receiving the analytes to be detected and / or quantified can also be one or more capture agents attached to the microcapsules exposed to the surrounding environment of the microcapsules. After the microcapsules are exposed to samples surrounding the microcapsules and containing analytes or suspected of containing analytes to be detected and / or quantified, the one or more capture agents can selectively and specifically bind to such analytes. Therefore, by the presence of these capture agents, the ability of the microcapsules to receive and selectively bind to analytes to be detected and / or quantified is greatly enhanced. In embodiments of the present invention, the interstitial pores of the porous matrix promote the fixation and ingestion of liquid samples by the microcapsules. By the presence of the interstitial pores, the porous matrix of the microcapsules acts as a reservoir for liquid ingestion that includes or is suspected of including analytes to be detected and / or quantified.

[0074] During use, after having been exposed to a sample suspected of containing an analyte, the microcapsules according to embodiments of the present invention may be additionally exposed to an aqueous liquid such as a wash buffer or another preferred aqueous medium such as an exchange buffer having defined concentrations and conditions such as salt concentration, buffer concentration, pH, etc. The aqueous liquid is then typically absorbed by the porous matrix of the microcapsules and partially or completely fills the volume of the microcapsules and / or may displace liquid present there from a previous reaction or exposure. Thus, effectively, the volume of the microcapsules represents the reaction space in which detection and / or quantification of the analyte occurs.

[0075] During use, after the microcapsules have absorbed a liquid sample and optionally have undergone one or several washing steps or buffer exchange steps, the microcapsules according to the invention are removed from the aqueous sample or from the aqueous phase of the aqueous sample and transferred to a non-aqueous phase. After the microcapsules have been transferred to the non-aqueous phase, the impermeable core alone or the impermeable core together with the porous hydrophilic shell forming the porous matrix and surrounding the one or several impermeable cores is dissolved or destroyed. As a result, an aqueous droplet in a non-aqueous environment is produced for each dissolved / destroyed microcapsule. This aqueous droplet has a volume corresponding to the volume of the aqueous liquid previously absorbed by the microcapsule. In one embodiment, the volume of the aqueous droplet corresponds substantially to the volume of the microcapsule. In another embodiment, the microcapsule has not previously absorbed the aqueous liquid to its full capacity, i.e. absorbed to its full volume. In this case, the volume of the aqueous droplet corresponds to a portion of the volume of the microcapsule. The dissolution / destruction is carried out by any suitable means, the means being selected from mechanical means, chemical cutting, temperature change, in particular temperature increase to allow the melting of the impermeable core and the porous hydrophilic shell. Other suitable means include pH change, solvent change, application of electric and / or magnetic fields, exposing the microcapsules to electromagnetic radiation, in particular light of limited wavelength, such as UV light. The aqueous droplets produced by this dissolution / destruction have the same volume or substantially the same volume as the volume spanned / surrounded by the microcapsules. The aqueous droplets contain all the reagents capable of generating and / or amplifying signals, and if the liquid sample to which the microcapsules have been previously exposed also contains an analyte, the aqueous droplets also contain such an analyte. Therefore, the aqueous droplets provide a reaction space allowing the detection and / or quantification of the analyte in the sample. In this reaction space, a signal is usually generated and / or amplified in the aqueous droplet, wherein such a signal is generated and / or amplified only when the analyte is already present in the sample to which the microcapsules have been previously exposed. In one embodiment, the reaction to generate and / or amplify the signal is a nucleic acid amplification reaction or a signal amplification reaction. In one embodiment, the analyte is amplified using an amplification reaction, and the product thus amplified is detected using a detection reagent, which is particularly preferred when the analyte is a nucleic acid and the amplification reaction is a nucleic acid amplification reaction. Examples of such nucleic acid amplification reactions are polymerase chain reaction (PCR) or isothermal amplification reactions such as transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), loop-mediated isothermal amplification (LAMP), self-sustaining sequence replication (3SR), strand displacement amplification (SDA), rolling circle amplification (RCA), ligase chain reaction (LCR), recombinase polymerase amplification (RPA) and nickase amplification reaction (NEAR).Those skilled in the art are fully aware of any of these amplification reactions and can perform these amplification reactions as required. In another embodiment, the detection of the analyte can be performed by first performing a signal amplification reaction and then detecting the signal amplified thereby. In the latter embodiment, the signal is amplified only when there is a signal at first, i.e., the signal only occurs when there is an analyte to be detected, and for example, if nucleic acid is a part of the detection reagent or forms a part of the detection reagent, the signal amplification reaction can be nucleic acid amplification. Alternatively, if an enzyme is a part of the detection reagent or forms a part of the detection reagent, the signal amplification reaction can be a signal amplification based on an enzyme.

[0076] According to an embodiment of the present invention, a method for preparing a microcapsule for detecting and / or quantifying an analyte in a sample is also provided, and the microcapsule is as defined in any one of the above-mentioned embodiments. In this method, according to step a), an aqueous solution of a reagent is provided, wherein the reagent is capable of generating and / or amplifying a signal in the presence of an analyte to be detected and / or quantified, wherein the aqueous solution of the reagent, in addition to the reagent, optionally comprises one or more protective agents, which are used to protect one or more of the reagents capable of generating and / or amplifying a signal in the aqueous solution. According to this preparation method, in the next step, i.e., step b), the aqueous solution of step a) is dried, preferably spray-dried or freeze-dried, thereby producing a dry reagent capable of generating and / or amplifying a signal. Preferably, drying produces the reagent in the form of nanoparticles. In the next step, i.e., step c), the dry reagent obtained from step b) is incorporated into a material suitable for containing and / or embedding the reagent so that the material surrounds the reagent and isolates them. In a preferred embodiment, the material surrounding the reagent is selected from paraffin, triglyceride, wax, in particular plant wax such as carnauba wax, animal wax such as beeswax, wax derived from petroleum and mineral wax. The purpose of these paraffins, triglycerides and / or waxes is to provide a barrier, through which the reagent capable of generating and / or amplifying a signal is separated from the porous matrix of the microcapsule. In one embodiment, these paraffins, triglycerides and / or waxes have a condensation point in the range of 50°C to 80°C. In one embodiment, the condensation point is measured according to ASTM D938. As outlined above, the reagent is in a dry / dried state and should be kept in this state as long as possible, i.e. until the barrier is deliberately dissolved. Also as further outlined above, the porous matrix preferably encloses interstitial pores for accommodating a liquid sample, however, the reagent capable of generating and / or amplifying a signal should not be in contact with the liquid sample too early. The wax / triglyceride / paraffin mentioned above is a barrier material suitable for this purpose.

[0077] After the dry reagent from step b) has been incorporated into the material in step c), the next step d) is then performed, wherein microparticles are produced from the product of step c) by drying, preferably spray drying or freeze drying, thereby producing an impermeable core containing and / or embedded with the reagent capable of generating and / or amplifying a signal. The impermeable core produced in step d) is then incorporated into a porous hydrophilic shell in the next step, i.e. step e). The porous hydrophilic shell forms a porous matrix and surrounds the one or several impermeable cores. The incorporation of the impermeable core into the porous hydrophilic shell is achieved by any of the following methods:

[0078] - incorporating the impermeable core into a hydrogel former and inducing the hydrogel former to form a hydrogel around the impermeable core, or

[0079] - incorporating the impermeable core into a precursor / monomer of a thermosensitive polymer and inducing polymerization of the precursor / monomer around the impermeable core into a thermosensitive polymer, or

[0080] - Incorporating the impermeable core into a preformed thermosensitive polymer and allowing the preformed thermosensitive polymer to mold around the impermeable core.

[0081] It should be noted that in the above embodiments involving a thermosensitive polymer, the thermosensitive polymer forms the porous hydrophilic shell into which the impermeable core is incorporated.

[0082] In one embodiment, the method for preparing microcapsules according to the present invention optionally contains another step f) coupling one or several capture agents to the porous hydrophilic shell surrounding the one or several impermeable cores, thereby producing microcapsules with one or several capture agents attached, wherein after exposing the microcapsules to a sample surrounding the microcapsules and containing the analyte to be detected and / or quantified, the one or several capture agents are capable of selectively and specifically binding to such analyte.

[0083] In one embodiment, the method for preparing microcapsules according to the present invention optionally comprises a further step g) in which the microcapsules are collected. In one embodiment, the method for preparing microcapsules according to the present invention additionally comprises a further optional step h) of washing and / or drying the microcapsules, preferably freeze drying.

[0084] In an embodiment of the microcapsule according to the present invention, the microcapsule contains only a single impermeable core surrounded by a porous hydrophilic shell. In another embodiment, the microcapsule according to the present invention contains a plurality of impermeable cores, which are surrounded by the porous hydrophilic shell.

[0085] In one embodiment, the porous hydrophilic shell is composed of a hydrogel former or of a thermosensitive polymer. In one embodiment, the hydrogel former is selected from a) synthetic polymers such as polymethyl methacrylate, polyamide; b) silicon-based polymers such as polydimethylsiloxane; c) naturally occurring polymers selected from polysaccharides such as agarose, chitin, chitosan, dextran, alginates, carrageenan, cellulose, fucoidan, laminarin, gums selected from xanthan gum, gum arabic, gum ghatti, guar gum, locust bean gum, tragacanth, karaya gum and inulin, polypeptides, collagen, gelatin, polyamino acids such as polylysine, polynucleotides, and combinations thereof. Hydrogel formers are known to those skilled in the art and are described, for example, in European Polymer Journal,2015,65,pp.252-267.

[0086] In one embodiment, the porous hydrophilic shell is formed by a thermosensitive polymer that may or may not form a hydrogel. Thermosensitive polymers are polymers that exhibit discontinuous changes in one or more of their physical properties depending on temperature. A typical example of the physical property of the change is solubility, such as solubility in water. Exemplary typical thermosensitive polymers are soluble and transparent in water at low temperatures, and experience a reversible phase transition for their solubility in water as the temperature rises, producing turbidity or forming a precipitate in an aqueous solution at high temperatures. The intrinsic temperature at which this phase transition occurs is called the lower critical solution temperature (LCST).

[0087] Another exemplary typical thermosensitive polymer is soluble and transparent in water at high temperature, and undergoes a reversible phase change in its solubility in water as the temperature decreases, producing turbidity or forming a precipitate in the aqueous solution at low temperature. The intrinsic temperature at which this phase change occurs is called the upper critical solution temperature (UCST).

[0088] In one embodiment of the microcapsule according to the invention, the porous hydrophilic shell is composed of a thermosensitive polymer, wherein preferably, the thermosensitive polymer is a LCST (=lower critical solution temperature) thermosensitive polymer. In one embodiment, this LCST thermosensitive polymer is selected from poly(N-isopropylacrylamide) (PNIPAm), poly[2-(dimethylamino)ethyl methacrylate] (pDMAEMA), hydroxypropylcellulose, poly(vinyl caprolactam) (P(VCL)) and polyvinyl methyl ether.

[0089] In another embodiment of the microcapsule according to the invention, the porous hydrophilic shell consists of a thermosensitive polymer, wherein preferably the thermosensitive polymer is a UCST (=upper critical solution temperature) thermosensitive polymer. In one embodiment, such a UCST thermosensitive polymer is selected from poly(N-acryloyl glycinamide) (PNAGA), poly(allylamine)-co-poly(allyl urea) and its derivatives, poly(methacrylamide), poly(N-acryloyl asparagine), poly(N-methacryloyl glutamine), poly(acrylamide)-co-(acrylonitrile), poly(sulfobetaine), poly(phosphorylcholine).

[0090] Embodiments of the microcapsules according to the invention, in which the porous hydrophilic shell is composed of a thermosensitive polymer, in particular a LCST thermosensitive polymer, are particularly suitable for enriching analytes with the microcapsules. This is because using this embodiment, the microcapsules can be heated to a temperature above the lower critical solution temperature (LCST) of the LCST thermosensitive polymer, as a result of which its solubility in water will rapidly decrease, and as a result the entire microcapsule will shrink / contract, and thus change the total volume spanned or surrounded by the microcapsule. By this shrinkage, the solvent, in particular water, will be driven out of the microcapsule, in particular the porous hydrophilic shell. The microcapsules are then subsequently cooled again or allowed to cool to a temperature below the lower critical solution temperature (LCST) of the LCST thermosensitive polymer, as a result of which the solubility of the thermosensitive polymer will increase again, and therefore the porous hydrophilic shell will expand again, thereby allowing the pores of the porous hydrophilic shell to be filled with a solution containing the analyte. By this process of heating and cooling above and below the lower critical solution temperature, the enrichment of the analyte in the porous hydrophilic shell is achieved. This heating and cooling step is reversible and can optionally be repeated once or several times, for example up to 1000 times or even more, preferably up to 500 times, and this will result in the enrichment of the analyte. In certain embodiments, the heating and cooling steps can be repeated several thousand times, for example up to 10,000 times or any number between 1000 and 10,000 times. The effect will even be enhanced if one or more capture agents are attached to the porous hydrophilic shell, in which case the analyte can be bound to the capture agent after the porous hydrophilic shell has expanded.

[0091] Other embodiments of the microcapsules according to the present invention, in which the porous hydrophilic shell is composed of a thermosensitive polymer, in particular a UCST thermosensitive polymer, are particularly suitable for enriching analytes with the microcapsules. This is because using this embodiment, the microcapsules can be cooled to a temperature below the upper critical solution temperature (UCST) of the UCST thermosensitive polymer, as a result of which its solubility in water will decrease rapidly, and as a result the entire microcapsule will shrink / contract, and thus change the total volume spanned or surrounded by the microcapsule. Through this shrinkage, the solvent, in particular water, will be driven out of the microcapsule, in particular the porous hydrophilic shell. Then, the microcapsule is subsequently heated again or allowed to be heated to a temperature above the upper critical solution temperature (UCST) of the UCST thermosensitive polymer, as a result of which the solubility of the thermosensitive polymer will increase again, and therefore the porous hydrophilic shell will expand again, thereby allowing the pores of the porous hydrophilic shell to be filled with a solution containing the analyte. Through this process of cooling and heating below and above the upper critical solution temperature, the enrichment of the analyte in the porous hydrophilic shell is achieved. Optionally, this cooling and heating step can be repeated once or several times, for example up to 1000 times or even more, preferably up to 500 times, and this will result in the enrichment of the analyte. The effect will even be enhanced if one or more capture agents are attached to the porous hydrophilic shell, in which case the analyte can be bound to the capture agent after the porous hydrophilic shell has expanded. Sequence Listing <110> Brinker <120> Microcapsules for detecting and / or quantifying analytes in samples <130> AJ4799PT2001 <150> EP 17 211 031.4 <151> 2017-12-29 <160> 8 <170> BiSSAP 1.3.6 <210> 1 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Strep-tag <400> 1 Ala Trp Arg His Pro Gln Phe Gly Gly 1 5 <210> 2 <211> 9 <212> PRT <213> Artificial Sequence <220> <223> Strep-tag II <400> 2 Asn Trp Ser His Pro Gln Phe Glu Lys 1 5 <210> 3 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Sense Primer <400> 3 gcagtggcgc ccgaacagg 19 <210> 4 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Antisense primer <400> 4 actgacgctc tcgcacccat ct 22 <210> 5 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Taq-Man probe labeled with Cy5 <400> 5 ctccgacgca acgggctcg 19 <210> 6 <211> 200 <212> DNA <213> Artificial Sequence <220> <223> Biotinylated cDNA template <400> 6 cagtggcgcc cgaacaggga ctttaaagag aaagtgaaac cagggaagaa aacctccgac 60 gcaacgggct cggcttagcg gagtgcacct gctaagaggc gagaggact cacagagggt 120 gagtaatttt gctggcagtg gccagaccta ggggaagggc gaagtctcta ggggaggaag 180 atgggtgcga gagcgtcagt 200 <210> 7 <211> 19 <212> DNA <213> Artificial Sequence <220> <223> Taq-Man probe labeled with CF647 <400> 7 ctccgacgca acgggctcg 19 <210> 8 <211> twenty two <212> DNA <213> Artificial Sequence <220> <223> Biotinylated antisense primer <400> 8 actgacgctc tcgcacccat ct 22 BRIEF DESCRIPTION OF THE DRAWINGS

[0092] In addition, reference is made to the following description of the drawings, in which:

[0093] Figure 1Schematic diagrams of various different embodiments of microcapsules according to the present invention are shown. Figure A shows an embodiment of an impermeable core with a single embedded reagent content. The reagent is in a dry state and remains intact. The impermeable core is coated with a triglyceride layer, such as a wax layer, that separates the dry reagent from the surrounding environment; Figure B shows an embodiment of an impermeable core with multiple reagent contents, which are embedded in a triglyceride matrix, such as a wax matrix; Figure C shows an embodiment of a microcapsule with a single impermeable core, in which a reagent capable of generating and / or amplifying a signal is contained. The microcapsule further includes a hydrophilic shell matrix surrounding the impermeable core and further has a capture agent attached to the hydrophilic shell. Figure D shows an embodiment of a microcapsule with multiple impermeable cores, the core containing a reagent inside and surrounded by a hydrophilic shell matrix. Similarly, the capture agent is attached to the hydrophilic shell. Figure E shows an embodiment of a microcapsule comprising a single impermeable core with a reagent and having a highly porous hydrophilic shell, the hydrophilic shell forming a porous matrix around the single impermeable core with a reagent. A capture agent is attached to the hydrophilic shell.

[0094] Figure 2 A schematic manufacturing flow chart of an embodiment of the microcapsule according to the present invention is shown.

[0095] Figure 3 A schematic diagram of the use of an embodiment of the microcapsule according to the present invention is shown. More specifically, in step 1, a microcapsule having a single impermeable core containing a dry reagent and having a capture agent for the analyte is exposed to an aqueous solution of a sample suspected of containing the analyte (and in fact containing such an analyte). The aqueous solution of the sample also contains a detection marker, which itself can also bind the analyte. After exposure to the sample, the analyte is bound by the capture agent and labeled with the detection marker. Subsequently, any non-specifically bound detection marker is washed off in a cleaning step (step 2), but the step is optional. In step 3, the microcapsule is transferred to a non-aqueous phase and dissolved / destroyed, for example, by a suitable temperature change or pH change, accompanied by aqueous droplet formation and reagent release, and then amplified and / or detected. The microcapsule provides a reaction space in which such amplification and / or detection occurs.

[0096] Figure 4 A schematic usage flow chart of an embodiment of the microcapsule according to the present invention is shown.

[0097] Figure 5An embodiment of a microcapsule is shown, comprising a single impermeable core in which a reagent is embedded, and further comprising a porous hydrophilic shell composed of a material capable of undergoing a phase change with a change in an external parameter, such as a thermosensitive polymer. In the expanded state of the porous hydrophilic shell, the pores are filled with an aqueous solution containing an analyte and a detection marker. Upon a change in ambient conditions, such as temperature, the shell becomes deflated and liquid is expelled from the pores while any bound analyte remains within the microcapsule. The process is reversible, so the microcapsule can cycle between an expanded state and a deflated state.

[0098] Figure 6 A photographic image of an embodiment of a microcapsule having a porous hydrophilic shell surrounding an impermeable core, wherein the core is embedded with a fluorescent dye (the upper left photograph shows an optical transmission image of a single agent particle). The microcapsule contains a fully formed porous hydrophilic shell containing water, and the microcapsule is surrounded by a non-aqueous phase.

[0099] - Microcapsules in mineral oil with a diameter of approximately 500 μm on a microscope slide

[0100] - Shell composed of 1% agarose (type A0576)

[0101] -Multiple core particles make up 7% of the particle weight

[0102] - Core particles were produced by spray drying 10% (wt) Rhodamine / Cavasol powder

[0103] - Wax Tm = 58°C

[0104] -Tm of agarose = 75°C

[0105] The series of photographs below show four stages of the heating process of the microcapsules from 30°C to 70°C to 95°C and back to 30°C.

[0106] T = 30°C: low fluorescence, dry dye surrounded by a hydrophobic core matrix

[0107] T = 70°C: The core matrix melts and the fluorescent dye is released; after the fluorescent dye dissolves in the aqueous buffer contained in the agarose gel shell, the fluorescent signal increases

[0108] T = 95 °C: agarose matrix melts, dye fully resuspended; core matrix material fuses into a single large droplet

[0109] T = 30°C: particles have fluorescent dye distributed in an agarose gel matrix; core material released into the surrounding oil

[0110] At 30°C, the dry dye contained in the impermeable core shows low fluorescence. After heating to 70°C, the matrix of the impermeable core melts and the fluorescent dye is released. When the dye dissolves in the solution contained in the porous hydrophilic shell, the fluorescent signal increases. After further heating to 95°C, the hydrophilic shell material, such as agarose, also melts and the fluorescent dye is fully dissolved. The core material fuses into a single large droplet. After the particle is cooled to 30°C again, the fluorescent dye has become distributed throughout the porous hydrophilic shell matrix, and the core material from the impermeable core has been released into the surrounding non-aqueous phase.

[0111] Figure 7 An example of an embodiment of a microcapsule according to the present invention is shown, wherein granulated freeze-dried PCR reagents are incorporated into paraffin and the wax-coated particles ("impermeable core") thus produced are transferred to a certain liquid volume of agarose solution to produce a porous hydrophilic shell around the impermeable core. The resulting microcapsules are dried and subsequently incubated in an aqueous solution containing or not containing an analyte. The microcapsules are then transferred to a non-aqueous phase and PCR is performed. In the settings referred to as "positive 1", "positive 2", "positive 3", "positive 4", an increase in fluorescence can be observed, indicating that amplification / detection has occurred. In the settings referred to as "negative control 1" and "negative control 2", an increase in fluorescence was not observed, thus indicating that amplification did not occur. More specifically, amplification / detection comprises the following steps:

[0112] - Pelleted freeze-dried PCR reagents were coated with paraffin (Tm 58°C) to provide a water-impermeable layer

[0113] - Transfer the wax coated particles to a 1% agarose solution in the volume of liquid necessary to resuspend the coated reagent at the appropriate final reagent concentration; the agarose has been kept above the gel point (A2576 type agarose, Tg≤20°C, Tm=62°C)

[0114] - The dried agarose particles were incubated with aqueous solutions without analyte (samples negative control 1 and 2) and with analyte (samples positive 1, 2, 3, 4)

[0115] - Replace aqueous solutions with paraffin oil

[0116] -Perform PCR cycling and real-time detection for each container according to standard procedures

[0117] Additionally, reference is made to the following examples, which are provided to illustrate and not to limit the present invention. Example

[0118] Embodiment 1. Production of monodisperse reagent containing microcapsules

[0119] Preparation of microcapsule solution

[0120] Ultra-low gelling temperature agarose A2576 (Sigma) with a gel point ≤ 20°C and a melting point ≤ 62°C was labeled with a reactive biotin monochlorotriazine-based dye (INNOVENT). Alternatively, the agarose can be activated first and then coupled to the EZ-Link TM Amine-PEG11 biotin. In addition, the activation can be carried out by cyanogen bromide modification, mild oxidation (generation of aldehyde groups), carbonyl diimidazole (CDI) or by other known methods. The optimal biotin coverage was determined by titration in preliminary tests to maximize the streptavidin binding capacity while maintaining the matrix properties of agarose (melting and gel formation behavior, low nonspecific binding).

[0121] Component 1:

[0122] ● Biotinylated ultra-low gelling temperature agarose A2576 solution (1% w / v)

[0123] Nuclease-free water

[0124] 2% (v / v) polyvinyl alcohol

[0125] The components of component 1 were pipetted together, shaken briefly on a vortex mixer and centrifuged. Subsequently, the mixture was incubated at 72°C for 30 min with gentle shaking (100 rpm) in order to melt the agarose and obtain a homogenous agarose solution, which was then kept at 42°C until further use.

[0126] (2-Hydroxypropyl)-y-cyclodextrin stock solution (100%) was also prepared in nuclease-free water using Cavasol W7 or W8 (Sigma) and stored at room temperature. Containing all reagents to be encapsulated, the final mixture for PCR contained the following components:

[0127] Component 2:

[0128] 1.25 U / μl Hot Start Taq DNA polymerase (biotechrabbit GmbH)

[0129] ●4.0mM dNTP (biotechrabbit GmbH)

[0130] ●8.0 μM sense primer (5'-GCAGTGGCGCCCGAACAGG-3') (Metabion International AG)

[0131] ●8.0 μM antisense primer (5'-ACTGACGCTCTCGCACCCATCT-3') (Metabion International AG)

[0132] ●8.0 μM Taq-Man probe (5'-Cy5-CTCCGACGCAACGGGCTCG-BHQ3-3') (Metabion International AG) or 10x Fluorescent DNA stain (Jena Bioscience GmbH)

[0133] ●Sodium polyphosphate (Merck)

[0134] ●9% (w / v) (2-hydroxypropyl)-γ-cyclodextrin (Sigma)

[0135] The reagent mixture was spray dried using a Nano spray dryer B-90 (Büchi Labortechnik GmbH) to obtain nanoparticle-sized reagents. The nanoparticles were then dried under vacuum and then immediately sonicated at high temperature (80-90° C.) using a S-450D digital sonicator (Branson) to disperse them in the triglyceride Softenol 3118 (IOI Oleo GmbH) as tristearin at a maximum concentration of 10% (w / v).

[0136] Production of monodisperse microcapsules

[0137] Component 3:

[0138] a.

[0139] Mineral oil / paraffin oil (Sigma)

[0140] 2% (w / v) Span80

[0141] or

[0142] b.

[0143] ●HFE 7500(Dolomite Microfluidics)

[0144] ●2-5% Picosurf 1 (Dolomite MIcrofluidics)

[0145] Monodisperse agarose microparticles containing triglyceride-embedded reagents can be fabricated in a one-step process of double emulsion formation using a simple dual flow focusing device (Dolomite Microfluidics). Specifically, two Dolomite droplet junction chips, one of which is a regular glass chip (hydrophilic, 100 μm) and the second is hydrophobic in nature (190 μm), were mounted on a chip holder using linear connectors as fluid inlets and outlets. By choosing this chip order, channel surface wettability suitable for stable oil / water / oil two-phase droplet formation was obtained. Triglyceride-embedded reagents with a wax to reagent ratio of up to 10:1 and component 1 (cooled to 42°C) and component 3 were all pre-filtered with a 2 μm filter before being placed in the P-pump (Mitos) of the droplet system. The temperature control for chip 1 was set to above the freezing temperature of the triglycerides (75°C), and the temperature control for chip 2 was set to 42°C. The fluid lines were primed at 2000 mbar for 1 minute using the flow control software. Connect both ends of the linear connector to the chip using interfaces. Adjust the flow ratio of inner, middle and outer to 1:10:100, respectively. Flow rates need to be optimized to obtain stable two-phase droplet formation. Parameters are monitored using Dolomite Flow Control Advanced software. The triglyceride containing reagent is sheared at the first junction, producing a jet extending to the second junction and forming a coaxial jet, which is cut again or produces droplets encapsulated at the second junction. The O / W / O droplets are collected on ice to initiate freezing of the triglyceride and solidification of the agarose.

[0146] The process produces agarose microcapsules with a diameter of approximately 190 μm, which have a triglyceride embodiment containing a defined volume of the dried reaction mixture. The functional microcapsules were extracted from the oil phase by centrifugation (200×g) with a sieve (w=44 μm), washed five times with 0.1% (v / v) Triton X-100, and then resuspended in nuclease-free water, 0.02% sodium azide (v / v), and stored in a refrigerator at 7° C. for further processing.

[0147] In the case of droplet generation in HFE 7500 (2-5% Picosurf 1), 50 μl of a 1% (v / v) Triton X-100 aqueous solution was pipetted onto the microparticles.

[0148] The test tube is then centrifuged at 2000g for 1 min. The oil phase (bottom) and the aqueous phase (top) are now well separated, and the middle phase contains the particles. 200 μl of density gradient medium (Optiprep, Axis shield) is now slowly pipetted into the test tube. It is important to prevent excessive mixing of the aqueous phase with the density gradient medium. Ideally, most of the density gradient medium slides below the particle phase. The test tube is centrifuged at 2000g for 2 min. Subsequently, the density gradient medium phase is located between the oil phase and the particle phase. The particle phase can now be transferred to a new test tube. Care needs to be taken in this step so as not to transfer any volume of oil and as little volume of density gradient medium as possible to the new test tube.

[0149] 1 mL of 0.1% (v / v) Triton X-100 in PCR grade water is added to the test tube containing the particles. The volumes are mixed and centrifuged at 2000 g for 2 min. The particles are now deposited to the bottom of the test tube. The supernatant is removed, leaving the particles in the test tube. 1 mL of 0.1% (v / v) Triton X-100 is added to the test tube again, and the washing process is repeated 5 times. Finally, the particles are pipetted into a volume of PCR grade water, 0.02% sodium azide (v / v), or buffer suitable for the following process.

[0150] Alternatively, wax beads containing submicron-sized dry reagents are produced by spray drying using a Büchi Mini spray dryer B-290, producing beads with an average diameter of 10 μm. A defined amount of triglyceride wax beads is then resuspended in molten agarose below the melting point of the wax. To produce a uniform dispersion of wax beads, agarose is first suspended in a 50% ethanol solution and gently stirred during distribution. Microcapsules are then produced by dispensing agarose droplets of 200 μm in diameter in mineral oil using an MD-K-140 dispenser head (Microdrop).

[0151] Coating microcapsules with streptavidin

[0152] The microcapsules were washed once with a washing buffer (20 mM Trix-HCl, 22 mM KCl, 22 mM NH4Cl, 3 mM MgCl2, 5% (v / v) glycerol). The coating of the microcapsules with streptavidin was completed in the same buffer. The concentration of streptavidin was selected so that no biotin residue was available on the surface of the microcapsules. In any case, streptavidin was applied in excess to avoid cross-linking of the microcapsules. The optimal concentration of streptavidin has been determined in preliminary tests by determining the platform surface coverage using labeled streptavidin. After coupling with streptavidin, the microcapsules were washed several times with a washing buffer without streptavidin on a 44 μm SEFAR PETEX centrifugal device. Subsequently, the microcapsule concentration was determined by counting under a microscope in a DHC-N01 (Neubauer modified) counting chamber (INCYTO) or by cell counting on a CytoFlex flow cytometer (Beckman Coulter). The extent of labeling / coating was also assessed spectroscopically using a monochlorotriazine-based dye label.Aliquots containing approximately 100,000 beads were resuspended in a 9% (w / v) (2-hydroxypropyl)-y-cyclodextrin solution and then freeze-dried or vacuum-dried.

[0153] Embodiment 2: Using monodisperse microcapsules for digital PCR

[0154] Analyte capture

[0155] Purified HIV-1 RNA (subtype O) labeled with biotin by reverse transcription is enriched on hydrogel microparticles encapsulated with a reagent modified with streptavidin. The total volume of reverse transcription (RT) reaction is added to a determined amount of freeze-dried or dried microcapsules. The beads are carefully resuspended and incubated with the RT reaction mixture. The microcapsules are allowed to absorb a portion of the applied liquid, swell and bind the biotin-labeled cDNA. In order to avoid agglomeration, ultrasound can be used. The suspension is then applied to a microgel equipped with SEFAR The microcapsules were placed in a centrifuge tube with a mesh (w=44 μm). The supernatant was removed by centrifuging the column at 300×g. For washing, the previously used washing buffer was added to the column and centrifuged at 300×g as well. The washing was repeated several times and the microcapsules were finally drawn into component 4. In this step, the microcapsules bind the analyte from the solution and draw up the remaining components required for PCR by diffusion.

[0156] Component 4 consisted of the following reagents (final concentrations):

[0157] 20 mM Trix-HCl, 22 mM KCl, 22 mM NH4Cl, 3 mM MgCl2, 5% (v / v) glycerol

[0158] MgCl2 [Invitrogen] or MgSO4 [Sigma]

[0159] The biotin-labeled cDNA template has the following sequence:

[0160] 5'-Bio-CAGTGGCGCCCGAACAGGGACTTTAAAGAGAAAGTGAAACCAGGGAAGAAAACCTCCGACGCAACGGGCTCGGCTTAGCGGAGTGCACCTGCTAAGAGGCGAGAGGAACTCACAGAGGGTGAGTAATTTTGCTGGCAGTGGCCAGACCTAGGGGAAGGGCGAAGTCTCTAGGGGAGGAAGATGGGTGCGAGAGCGTCAGT-3'

[0161] Compartmentalization by transfer to the non-aqueous phase

[0162] The microcapsules were transferred to a non-aqueous phase by washing them three times with paraffin oil (Sigma) containing the surfactant Triton-X 100 (0.1% w / w) (Sigma) and the emulsifier ABILEM-90 (3% w / w) (Evonik Industries) or other substances to avoid agglomeration of the microcapsules. Washing was performed by using a SEFAR equipped The centrifuge tubes with mesh (w=44 μm) were centrifuged at 200×g for 1 min.

[0163] By dispersing the microcapsules in a fluorocarbon oil such as 5% PicoSurf in Novec 7500 oil TM (Dolomite Microfluidics) to produce microcompartments with defined volumes. Instead of heavy fluorocarbon oils, light mineral oils containing emulsifiers, such as paraffin oil (Sigma) containing 5% (w / w) Span 80 (Sigma), can be used.

[0164] The completely aqueous phase was placed in contact with excess oil in an Eppendorf tube. TM S-450 and Ultrasonics Sonifier TM The microcapsules loaded with cDNA and the supernatant of component 3 were both dispersed and emulsified in the oil phase. The resulting aqueous droplets of the supernatant of component 3 were significantly different in volume from the microcapsules, the droplets having a much smaller volume. The resulting emulsion was pipetted onto a SEFAR 4000 filter with a mesh width of 44 μm. The microcapsules are then removed from the mesh. Smaller droplets as well as larger droplets that may not contain microcapsules are removed by gentle centrifugation. All droplets are removed using repeated washings with the same oil. The concentrated microcapsules are extracted from the mesh by introducing the filter device in the opposite direction into a suitable centrifuge tube.

[0165] Release of reagents and direct amplification of captured cDNA in microcompartments

[0166] The oil containing the microcapsules was transferred to an area of ​​approximately 2 cm 2 The microcapsules are suspended in paraffin oil and are placed in a detection chamber with a layer thickness of about 50-1000 μm. The opposite surface of the chamber is made of a transparent hydrophobic material. Whether by the size of the reaction chamber or other means such as flexible tubing, the microcapsules suspended in paraffin oil are forced to form a monolayer. Thus, the microcapsules provide uniformly spaced micro-reaction vessels for subsequent digital PCR.

[0167] The microcapsules were temperature cycled using a PELTIER element 30x30x4.7 mm, 19.3 W (Quick-Ohm, Küpper & Co. GmbH, #QC-71-1.4-3.7 M). The reaction chamber was heated to 5°C above the melting temperature of the wax for at least 2 min to release the dry reagents smoothly into the hydrogel matrix before the agarose melted and the microcapsules were transformed into droplets surrounded by oil. Amplification of individual cDNA molecules occurred in the resulting micro-reaction compartments.

[0168] The thermal conditions used were:

[0169] Initial denaturation at 95°C for 2 min (likely sufficient to release the reagents and melt the agarose particles) was followed by 45 cycles of denaturation at 95°C for 15 sec, annealing at 65°C for 15 sec, and extension at 72°C for 30 sec. After completion of the thermal schedule, the contents of the reaction chamber were imaged at room temperature in transmitted white light and fluorescence mode with excitation λexc=470 nm and long-pass emission >496 nm or with excitation λexc=660 nm and emission wavelengths of 670 nm. The total number of microcapsules and the number of microcapsules with a fluorescent signal above a defined intensity threshold were determined. The threshold was derived from a previously performed amplification reaction without template. The number of templates in the reaction was determined by applying Poisson statistics to the determined number of positive and negative droplets.

[0170] Embodiment 3: Manufacturing of reagent capsules visible to the naked eye

[0171] In an alternative method, capsules with a diameter of approximately 1.5 mm were produced using the following procedure.

[0172] The complete PCR reagent mixture (see Embodiment 1) is freeze-dried to form a reagent pellet with a diameter of about 0.8 mm. The wax coating is applied by dipping each reagent pellet in molten paraffin at a temperature slightly higher than the melting point of paraffin. Subsequently, each coated pellet is exposed to oxygen low-temperature plasma treatment to reduce the contact angle of the wax surface. The high gel point agarose is biotinylated using the same process as in Embodiment 1, and then the pellet is transferred to a cavity containing a determined volume of agarose, which is melted and maintained close to the gelling temperature of the agarose. The agarose is then picked up with a vacuum pipette, washed and coated with streptavidin as described in Embodiment 1. The capture and washing of the reagent is carried out in a similar process to that in Embodiment 2, while the capsule is gently incubated and rinsed with buffer. The transfer of the capsule in the non-aqueous phase and the washing with mineral oil are carried out by rinsing the capsule.

[0173] PCR is performed similarly to Embodiment 2.

[0174] Embodiment 4: Fabrication of pNIPAM-based monodisperse amplification microcapsules and use for combined target capture / digital PCR assays

[0175] This example describes the use of pNIPAM-based monodisperse amplification microcapsules to perform a combined nucleic acid target capture / digital PCR assay. In this application, the microcapsules provide several functions:

[0176] 1. They provide binding groups and an outer surface or inner and outer surfaces to capture the assay target at the location where amplification will occur in a subsequent step.

[0177] 2. They provide a matrix that can be easily filled and emptied with aqueous solutions by exploiting the LCST behavior of pNIPAM polymers.

[0178] 3. The polymer also provides a matrix that allows the aqueous phase contained in the particles to be brought into the oil emulsion. The advantage of using the microcapsules as a matrix is ​​that a uniform size distribution of the aqueous volume in the oil can be achieved without the use of microfluidics or other complex technical devices.

[0179] 4. The pNIPAM contains all the reagents required to perform PCR amplification embedded in a water-impermeable core.

[0180] In this experiment, the cDNA produced in a separate step was used as a PCR template. When RNA is used as a template, the particles can be filled with the RT-PCR reaction mixture and the entire process of the RT-PCR process can be performed based on DAB.

[0181] Generation of pNIPAM microcapsule solution

[0182] Component 1 (aqueous polymerization phase):

[0183] Generation of Biotin-Modified Monomer-Mixtures:

[0184] Biotin-modified acrylic monomers were generated in a separate reaction. The reaction mixture consisted of N-hydroxysuccinimidyl acrylate (an activated amino-reactive acrylic monomer) and biotin-dPEG7-NH2 (a biotin derivative modified with a PEG7 spacer arm with an amino group at the end).

[0185] 2,5% Biotin-modified monomer mix PBS added to total volume (mL) 0,114 N-Hydroxysuccinimide Acrylate(mg) 2,8 Biotin-dPEG7-NH2(mg) 10,0

[0186] The reaction mixture was incubated for 30 minutes at 25° C. The mixture was used directly in pNIPAM polymerization without any further purification.

[0187] Components per mL of polymerization mixture

[0188] Reaction mixture 20% (w / v) N-isopropylacrylamide (NIPAM) 250μl 2,5% (w / v) N,N′-methylenebisacrylamide 20μl 2,5% Biotinylated Monomers 10μl 5% (w / v) ammonium persulfate 150μl <![CDATA[ Deionized water ]]> <![CDATA[ 570μl ]]>

[0189] Component 2 (reagent phase):

[0190] (2-Hydroxypropyl)-y-cyclodextrin stock solution (100%) was also prepared in nuclease-free water using Cavasol W7 or W8 (Sigma) and stored at room temperature. Containing all reagents to be encapsulated, the final mixture for PCR contained the following components:

[0191] Component 2:

[0192] 1.25 U / μl Hot Start Taq DNA polymerase (biotechrabbit GmbH)

[0193] ●4.0mM dNTP (biotechrabbit GmbH)

[0194] ●8.0 μM sense primer (5'-GCAGTGGCGCCCGAACAGG-3') (Metabion International AG)

[0195] ●8.0 μM antisense primer (5'-ACTGACGCTCTCGCACCCATCT-3') (Metabion International AG)

[0196] ●8.0 μM Taq-Man probe (5'-CF647-CTCCGACGCAACGGGCTCG-BHQ3-3') (Metabion International AG) or 10x Fluorescent DNA stain (Jena Bioscience GmbH)

[0197] ●Sodium polyphosphate (Merck)

[0198] ●9% (w / v) (2-hydroxypropyl)-γ-cyclodextrin (Sigma)

[0199] The reagent mixture was spray dried using a Nano spray dryer B-90 (Büchi Labortechnik GmbH) to obtain nanoparticle-sized reagents. The nanoparticles were then dried under vacuum and immediately dispersed in tristearin Softenol 3118 (IOI Oleo GmbH) at a maximum concentration of 10% (w / v) by sonication using an S-450D digital sonicator (Branson) at high temperature (80-90° C.).

[0200] Component 3 (Oil phase for polymerization):

[0201] <![CDATA[ Pico-Surf TM 1, 10ml, 2%, in Novec 7500 ]]> 1485μl N,N,N′,N′-Tetramethylethylenediamine 15μl

[0202] Production of monodisperse microcapsules

[0203] Monodisperse pNIPAM (= poly(N-isopropylacrylamide)-based microparticles containing tristearin-embedded reagents can be fabricated in a one-step process for double emulsion formation using a simple dual flow focusing device (Dolomite Microfluidics). Specifically, two Dolomite droplet junction chips, one of which was a regular glass chip (hydrophilic, 100 μm) and the second of which was hydrophobic in nature (190 μm), were mounted on a chip holder using linear connectors as fluid inlets and outlets. By choosing this chip sequence, channel surface wettability suitable for stable oil / water / oil two-phase droplet formation was obtained. Component 2 with a wax to reagent ratio of up to 10:1 as well as components 1 and 3 were pre-filtered with a 2 μm filter before placing them in the P-pump (Mitos) of the droplet system. The temperature control for chip 1 was set to above the freezing temperature of Softenol (75°C), and the temperature control for chip 2 was set to 25°C. The fluid lines were primed at 2000 mbar for 1 min using the flow control software. Both ends of the linear connector were connected to the chip using the interface. The flow ratios for the inner, middle, and outer were adjusted to 1:10:100, respectively. The flow rates needed to be optimized to obtain stable two-phase droplet formation. The parameters were monitored using Dolomite Flow Control Advanced software. The triglyceride containing reagent was sheared at the first junction, producing droplets that were encapsulated at the second junction. The O / W / O droplets were collected in a tube at 20 °C to initiate freezing of the triglyceride and polymerization of the pNIPAM.

[0204] The process produced pNIPAM microcapsules approximately 190 μm in diameter and having a tristearin embodiment containing a defined volume of the dried reaction mixture.

[0205] Recovery of microcapsules and transfer to aqueous phase

[0206] After the polymerization process is complete, use a pipette to gently remove as much oil phase as possible from the droplet reservoir, taking care not to remove the pNIPAM particles. Then 50 μl of 1% (v / v) TritonX-100 aqueous solution is drawn onto the particles. Mix the volume by pipetting up and down so that the particles do not adhere to the wall of the droplet chip. Transfer the volume to an Eppendorf tube and repeat the process once more. The transfer process can be monitored under a binocular microscope to prevent a large loss of particles during this step.

[0207] The test tube is then centrifuged at 2000g for 1 min. The oil phase (bottom) and the aqueous phase (top) are now well separated, and the middle phase contains the particles. 200 μl of density gradient medium (Optiprep, Axis shield) is now slowly pipetted into the test tube. It is important to prevent excessive mixing of the aqueous phase with the density gradient medium. Ideally, most of the density gradient medium slides below the particle phase. The test tube is centrifuged at 2000g for 2 min. Subsequently, the density gradient medium phase is located between the oil phase and the particle phase. The particle phase can now be transferred to a new test tube. Care needs to be taken in this step so as not to transfer any volume of oil and as little volume of density gradient medium as possible to the new test tube.

[0208] To the test tube containing the particles, 1 mL of PBS, 0.1% (v / v) Triton X-100 was added. The volumes were mixed and centrifuged at 2000 g for 2 min. The particles now settled to the bottom of the test tube. The supernatant was removed, leaving the particles in the test tube. 1 mL of PBS, 0.1% (v / v) Triton X-100 was added to the test tube again, and the washing process was repeated 5 times. Finally, the particles were pipetted into PBS containing 0.1% Triton X-100.

[0209] Coating of pNIPAM-based monodisperse microcapsules with streptavidin

[0210] The coating of the microcapsules with streptavidin is done in the previously used washing buffer. The concentration of streptavidin is chosen so that no biotin residues are accessible on the surface of the microcapsules. In any case, streptavidin is applied in excess in order to avoid cross-linking of the microcapsules. The optimum concentration of streptavidin has been determined in preliminary tests by determining the platform surface coverage using labeled streptavidin.

[0211] Incubation mixture:

[0212] Every 100.000 particles Streptavidin (2 mg / ml) in PBS, 0,1% Triton X-100 250μl

[0213] The coupling was performed in an Eppendorf Thermoshaker, where the solution was stirred at 350 rpm for 30 min and the temperature was oscillated 5 times between 25°C and 37°C. After coupling with streptavidin, the microcapsules were washed to remove excess streptavidin. 1 mL PBS, 0.1% (v / v) Triton X-100 was added to the test tube containing the particles. The volume was mixed and the temperature was set to 40°C. The particles shrank and the internal liquid was expelled. The particles were then centrifuged at 2000g for 2 min at 40°C. The particles now settled to the bottom of the tube. The supernatant was removed, leaving the particles in the test tube. 1 mL 20°C PBS, 0.1% (v / v) Triton X-100 was added to the test tube. The particles swelled and aspirated the washing buffer. The volume was mixed and the temperature was set to 40°C again. This washing process was repeated 5 times. Finally, the particles were aspirated into water containing 0,01% Triton X-100. Subsequently, the microcapsule concentration was determined by counting under a microscope in a DHC-N01 (Neubauer modified) counting chamber (INCYTO) or by cell counting on a CytoFlex flow cytometer (Beckman Coulter).

[0214] Preparation of biotin-modified HIV-1 cDNA template

[0215] Biotinylated HIV-1 cDNA was generated by reverse transcription in the presence of a PCR reverse primer. The reaction mixture was incubated at 50°C for 15 minutes and stopped by heating the reaction mixture to 70°C for 10 minutes.

[0216] Incubation mixture:

[0217] ○Purified HIV-1 RNA (~10 6 copies)

[0218] ○1 μM biotinylated reverse primer 5'Biotin-ACT GAC GCT CTC GCACCC ATC T-3'

[0219] ○1x reaction buffer (cDNA synthesis kit Thermo Fisher)

[0220] ○dNTP (1mM each)

[0221] ○RevertAid reverse transcriptase (200U, Thermo Fisher)

[0222] The cDNA reaction mixture was diluted with PBS 0.1% Triton X-100 to obtain ∼10 4 The final concentration of cp / μl.

[0223] Capture of HIV-1 cDNA Target on Streptavidin-Modified Microcapsules

[0224] HIV-1 RNA labeled with biotin by reverse transcription was captured on streptavidin-modified microcapsules.

[0225] 100000 pNIPAM microcapsules were transferred to a reaction tube and heated to 50°C to drive the liquid phase from the particles. The particles were briefly centrifuged at 2000 g and kept at 40°C. The shrunken and deposited particles adhered tightly together so that the driven liquid could be completely removed from the sediment. The following incubation mixture was then added to the sediment

[0226] ○1μl cDNA mixture (~10 4 copies)

[0227] ○49 μl PBS containing 0.1% Triton X-100

[0228] The capture was performed in an Eppendorf Thermoshaker, where the solution was stirred at 350 rpm for 30 min and the temperature was shaken 5 times between 25°C and 37°C.

[0229] After target capture, the microcapsules were heated to 50° C. to drive off the liquid phase from the microcapsules. The particles were briefly centrifuged at 2000 g and kept at 40° C. The shrunken and deposited microcapsules adhered tightly together, so that the driven off liquid could be completely removed from the deposit.

[0230] To the microcapsules, 10 μl of water containing 0,01% Tritonx-100 was added. The volume of water needs to be smaller than the volume that can be taken up by the particles. This depends mainly on the number and size of the particles. In this example, the particles used were able to take up a volume of 12 μl.

[0231] Compartmentalization by dispersing microcapsules in oil

[0232] By dispersing the microcapsules in a fluorocarbon oil such as 5% PicoSurf in Novec 7500 oil TM (Dolomite Microfluidics, #3200214) to produce microcompartments with defined volumes. Light mineral oil containing an emulsifier can be used instead of heavy fluorocarbon oil, such as mineral oil (Sigma-Aldrich, #M5904 Sigma) containing 5% (w / w) Span 80 (Sigma Aldrich, #85548).

[0233] The microcapsule deposit was contacted with excess oil in an Eppendorf tube. Ultrasound was applied until the deposit was dispersed and the microcapsules were evenly distributed. The pNIPAM microcapsules loaded with HIV-1 cDNA target were now emulsified in the oil phase. The oil containing the microcapsules was transferred to a 2 cm 2 The microcapsules are placed in a detection chamber with a layer thickness of about 1 mm. The opposite surface of the chamber is made of a transparent hydrophobic material. If fluorocarbon oil is used, the microcapsules assemble into a monolayer (densely packed) on the hydrophobic upper surface due to the density difference between the beads and the oil. If mineral oil is used, the microcapsules will accumulate at the lower surface. Therefore, the microcapsules provide a miniature reaction vessel for subsequent digital PCR.

[0234] Amplification reactions in microcompartments

[0235] Microcapsules suspended in oil were temperature cycled in the same chamber using a PELTIER element 30x30x4.7mm, 19.3W (Quick-Ohm, Küpper & Co. GmbH, #QC-71-1.4-3.7M). The microcapsules were heated to a temperature of 80°C, which resulted in shrinkage of the pNIPAM capsules and melting of the Softenol. The embedded reagents were exposed to the aqueous phase. This process was supported by several cycles of thermal cycling between 25°C and 80°C. The reagents dissolved in the water volume expelled from the pNIPAM at high temperature. A single aqueous droplet was formed around the condensed microcapsule, which served as a micro-reaction compartment. The reaction mixture came into contact with the captured individual cDNA targets amplified in the micro-compartment during PCR.

[0236] The thermal conditions used were:

[0237] Initial denaturation was at 95°C for 2 min, followed by 45 cycles of denaturation at 95°C for 15 sec, annealing at 65°C for 15 sec, and extension at 72°C for 30 sec. After completion of the thermal schedule, the contents of the reaction chamber were imaged at 21°C in transmitted white light and fluorescence mode with excitation λexc=650 nm and long-pass emission >670 nm. The total number of microcompartments and the number of microcompartments with a fluorescent signal above a defined intensity threshold were determined. The threshold was derived from a previously performed amplification reaction without template. The number of templates in the reaction was determined by applying Poisson statistics to the determined number of positive and negative droplets.

[0238] The features of the invention disclosed in the description, the claims and / or the drawings may, both separately and in any combination thereof, become material for realizing the invention in various different forms.

Claims

1. A microcapsule for detecting and / or quantifying an analyte in a sample, the microcapsule comprising: • a reagent capable of generating and / or amplifying a signal in the presence of an analyte to be detected and / or quantified; wherein said reagent is in a dry state; • a porous matrix surrounding said reagent, said porous matrix having means for receiving an analyte to be detected and / or quantified; wherein said reagent in a dry state is separated from said porous matrix by at least one barrier layer surrounding said reagent; wherein the means for receiving the analyte to be detected and / or quantified is an interstitial pore of a size suitable for receiving a liquid sample containing the analyte; and wherein the interstitial pores are sized to accommodate sufficient liquid sample to dissolve the reagent in a dry state; And further wherein the means for receiving the analyte to be detected and / or quantified is the interstitial pores that accommodate the liquid sample or a combination of the interstitial pores and one or more capture agents, which are capable of selectively and specifically binding to such analytes when the microcapsule is exposed to a sample surrounding the microcapsule and containing the analyte to be detected and / or quantified, wherein the one or more capture agents are attached to a portion of the microcapsule exposed to its surroundings.

2. The microcapsule according to claim 1, comprising: • one or several water-impermeable cores containing and / or embedding said agents capable of generating and / or amplifying a signal, thus separating said agents in a dry state from said porous matrix; • a porous hydrophilic shell forming said porous matrix and surrounding said one or several water-impermeable cores; wherein said one or more capture agents are attached to said porous hydrophilic shell.

3. The microcapsule according to claim 2, wherein the porous hydrophilic shell is composed of a hydrogel former.

4. The microcapsule according to claim 2, wherein the porous hydrophilic shell is composed of a thermosensitive polymer.

5. The microcapsule according to claim 3, wherein - The hydrogel former is selected from the group consisting of: a) synthetic polymers; b) naturally occurring polymers selected from the group consisting of polysaccharides; polypeptides, polyamino acids; polynucleotides; and combinations thereof.

6. The microcapsule according to claim 3, wherein - The hydrogel former is selected from the group consisting of: a) silicon-based polymers; b) naturally occurring polymers selected from the group consisting of polysaccharides; collagen, gelatin; polynucleotides; and combinations thereof.

7. The microcapsule according to claim 4, wherein - The thermosensitive polymer is a LCST thermosensitive polymer, or the thermosensitive polymer is a thermosensitive polymer having an upper critical solution temperature (UCST).

8. The microcapsule according to claim 5, wherein a) the synthetic polymer is selected from polymethyl methacrylate and polyamide; b) the polysaccharide is selected from agarose, chitin, chitosan, dextran, alginate, carrageenan, cellulose, fucoidan, laminarin, xanthan gum, gum arabic, gum ghatti, guar gum, locust bean gum, tragacanth, karaya gum, and inulin; And the polyamino acid is selected from polylysine.

9. The microcapsule according to claim 6, wherein the silicon-based polymer is selected from polydimethylsiloxane.

10. The microcapsule according to claim 7, wherein the LCST thermosensitive polymer is selected from poly( N -isopropylacrylamide) (PNIPAm), poly[2-(dimethylamino)ethyl methacrylate] (pDMAEMA), hydroxypropylcellulose, poly(vinylcaprolactam) (P(VCL)), and polyvinyl methyl ether; and The thermosensitive polymer having UCST is selected from poly(N-acryloylglycinamide) (PNAGA), poly(allylamine)-co-poly(allyl urea) and its derivatives, poly(methacrylamide), poly(N-acryloylasparagine), poly(N-methacryloylglutamine), poly(acrylamide)-co-(acrylonitrile), poly(sulfobetaine), and poly(phosphorylcholine).

11. The microcapsule according to claim 2, wherein the water-impermeable core is composed of a material suitable for containing and / or embedding the agent, and wherein the material surrounds the agent and separates them from the porous hydrophilic shell, wherein the material is selected from triglycerides and waxes.

12. The microcapsule according to claim 11, wherein the wax is selected from the group consisting of plant wax, animal wax, and mineral wax.

13. The microcapsule according to claim 11, wherein the wax is paraffin wax.

14. The microcapsule of claim 11, wherein the wax is a petroleum-derived wax.

15. The microcapsule according to claim 2, wherein the water-impermeable core contains and / or embeds the agents capable of generating and / or amplifying signals in a dry state and separates them from the porous matrix.

16. The microcapsule according to claim 1, wherein the agent capable of generating and / or amplifying a signal is - a reagent capable of performing nucleic acid amplification using a nucleic acid analyte, and wherein, The reagents include a molecule capable of amplifying the nucleic acid analyte in the sample, which is an amplification enzyme; one or more molecules necessary to promote the amplification of the analyte, which are several nucleic acid primers, nucleotides, salts and buffers, and optionally one or more detection reagents, or - one or more detection reagents for detecting proteins or peptides or cells as analytes in the sample, wherein one or more of the detection reagents are selected from antibodies or antibody fragments, nucleic acids, non-antibody proteins, each of which is optionally labeled with a suitable reporter molecule, which is a dye, an enzyme, a chemical catalyst, or a mixture of reagents that can initiate a chemical reaction that produces an optical or other detectable signal indicating the presence of the protein or peptide or cell as the analyte to be detected.

17. The microcapsule according to claim 16, wherein the detection agent is selected from aptamers, Spiegelmers, receptors, receptor fragments, affinity proteins.

18. The microcapsule according to claim 1, wherein the capture agent is selected from antibodies, antibody fragments, nucleic acids, non-antibody proteins capable of specifically binding to an analyte or an analyte complex, chemical groups selected from biotin, Strep-tag®, digoxigenin, dinitrophenol and nucleic acid-tags.

19. The microcapsule according to claim 18, wherein the capture agent is selected from the group consisting of aptamers, Spiegelmers, receptors, receptor fragments, affinity proteins.

20. The microcapsule according to claim 16, wherein the reagent capable of performing nucleic acid amplification further comprises one or more detection reagents, wherein the one or more detection reagents are selected from antibodies or antibody fragments, nucleic acids, non-antibody proteins, each of which is optionally labeled with a suitable reporter molecule, which is a dye, an enzyme, a chemical catalyst, or a reagent mixture that can initiate a chemical reaction that produces an optical or other detectable signal indicating the presence of the analyte to be detected.

21. The microcapsule according to claim 20, wherein the detection agent is selected from aptamers, Spiegelmers, receptors, receptor fragments, affinity proteins.

22. The microcapsule according to any one of claims 17, 19 and 21, wherein the affinity protein is streptavidin.

23. A method for detecting and / or quantifying an analyte in a sample, the method comprising: i. Providing a microcapsule according to any one of claims 1-22; ii. exposing the microcapsules to an aqueous sample surrounding the microcapsules and containing or suspected of containing the analyte to be detected and / or quantified; iii. removing the microcapsules from the aqueous sample and transferring the microcapsules to a non-aqueous phase; iv. dissolving or rupturing the microcapsules to generate aqueous droplets in a non-aqueous environment, wherein the aqueous droplets contain the reagent capable of generating and / or amplifying a signal in the presence of an analyte to be detected and / or quantified in dissolved form; v. performing a reaction within the aqueous droplet to generate and / or amplify a signal, wherein the signal is generated and / or amplified only when the analyte is already present in the sample, wherein the reaction performed in step v. is a nucleic acid amplification reaction or a signal amplification reaction, wherein the nucleic acid amplification reaction is selected from PCR, or an isothermal amplification reaction including TMA, NASBA, LAMP, 3SR, SDA, RCA, LCR, RPA, NEAR.

24. The method of claim 23, wherein in step iv., the microcapsules are dissolved or ruptured by a method selected from mechanical means, chemical cleavage, temperature change, pH change, solvent change, application of an electric field, application of a magnetic field, and exposure of the microcapsules to electromagnetic radiation.

25. The method of claim 24, wherein in step iv., the microcapsules are dissolved or ruptured by exposing them to UV light or a change in temperature.

26. The method of claim 25, wherein in step iv., the microcapsules are dissolved or ruptured by exposing them to an increase in temperature.

27. The method according to any one of claims 23 to 26, wherein the microcapsule is a microcapsule as defined in any one of claims 3 to 7, and the porous hydrophilic shell consists of a LCST thermosensitive polymer.

28. The method according to claim 27, wherein the method comprises an additional step between steps ii. and iii. ii.a heating the microcapsules to a temperature above the lower critical solution temperature (LCST) of the LCST thermosensitive polymer, and then cooling the microcapsules or allowing them to cool to a temperature below the lower critical solution temperature (LCST) of the LCST thermosensitive polymer to achieve enrichment of the analyte bound to the microcapsules, and performing this step ii.a n times, wherein n is an integer from 1 to 1000, and / or an additional step ii.b The microcapsules are washed in an aqueous solution to remove unbound analyte, wherein if step ii.b is performed in addition to step ii.a, it is performed before or after step ii.a.

29. A method for preparing microcapsules for detecting and / or quantifying an analyte in a sample, the microcapsules being as defined in any one of claims 1 to 22, the method comprising the steps of: a) providing an aqueous solution of reagents capable of generating and / or amplifying a signal in the presence of an analyte to be detected and / or quantified, wherein the aqueous solution of reagents optionally comprises, in addition to the reagents, one or more protective reagents for protecting one or more of the reagents capable of generating and / or amplifying a signal in the aqueous solution; b) drying the aqueous solution of a) thereby producing a dried reagent capable of generating and / or amplifying a signal; c) incorporating the dry reagent into a material suitable for containing and / or embedding the reagent such that the material surrounds the reagent and isolates them, wherein the material is selected from the group consisting of triglycerides and waxes; d) producing microparticles from the product of c) by drying the product of c) thereby producing a water-impermeable core; e) incorporating the water-impermeable core into a porous hydrophilic shell forming a porous matrix and surrounding the one or several water-impermeable cores by • incorporating the water-impermeable core into a hydrogel former and inducing the hydrogel former to form a hydrogel around the water-impermeable core, or • incorporating the water-impermeable core into a precursor / monomer of a thermoresponsive polymer and inducing the precursor / monomer to polymerize around the water-impermeable core into a thermoresponsive polymer, or • incorporating said water-impermeable core into a preformed thermoresponsive polymer and allowing said preformed thermoresponsive polymer to mold around said water-impermeable core; Thus, microcapsules are produced; f) optionally, coupling one or several capture agents to said porous hydrophilic shell surrounding said one or several water-impermeable cores, thereby producing microcapsules with one or several capture agents attached, wherein said one or several capture agents are capable of selectively and specifically binding to an analyte to be detected and / or quantified upon exposure of said microcapsules to a sample surrounding said microcapsules and containing such analyte; g) optionally collecting the microcapsules; h) further optionally washing and / or drying the microcapsules.

30. The method according to claim 29, wherein in steps b) and d), the drying is spray drying or freeze drying; and / or wherein the wax in step c) is selected from plant wax, animal wax and mineral wax; and / or wherein in step b), the dry reagent is in the form of nanoparticles; and / or Wherein in step h), the drying is freeze-drying.

31. The method of claim 30, wherein the wax in step c) is a wax derived from petroleum.

Images