A method for increasing the yield of glucosamine in bacillus subtilis

By overexpressing phosphatase YwpJ and knocking out related genes in recombinant Bacillus subtilis, the problem of excessive intracellular phosphate sugar accumulation was solved, resulting in a significant increase in acetylglucosamine yield and conversion rate.

CN111893129BActive Publication Date: 2026-01-30JIANGNAN UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202010687117.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2020-07-16
Publication Date
2026-01-30
Estimated Expiration
2040-07-16

AI Technical Summary

Technical Problem

In the process of acetylglucosamine synthesis, existing recombinant Bacillus subtilis has excessive accumulation of intracellular phosphate sugars, leading to cytotoxicity, affecting cell growth and yield, and lacks a key phosphatase to catalyze the dephosphorylation of acetylglucosamine 6-phosphate.

Method used

By screening and overexpressing phosphatase YwpJ, knocking out the glucosamine 6-phosphate deaminase gene nagBB and the acetylmumarate 6-phosphate synthase gene murQ, the dephosphorylation process in GlcNAc synthesis was enhanced, and N-acetylglucosamine acetyltransferase GNA1 was overexpressed.

Benefits of technology

It effectively reduced intracellular phosphate sugar accumulation and increased acetylglucosamine production, with GlcNAc yield reaching 26.1 g/L and conversion rate reaching 0.483 g/g glucose, significantly improving cell growth and product accumulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN111893129B_ABST
    Figure CN111893129B_ABST
Patent Text Reader

Abstract

This invention discloses a method for increasing the yield of acetylglucosamine in Bacillus subtilis. The method involves knocking out and verifying the key phosphatase YwpJ, which catalyzes the dephosphorylation of GlcNAc-6-P to generate GlcNAc. Overexpression of YwpJ reduces the excessive accumulation of intracellular phosphate sugars, eliminating the toxic effects of excessive phosphate sugars on cells and effectively secreting phosphate sugars extracellularly, thereby improving cell growth. Furthermore, knocking out the key genes murQ and nagBB in the GlcNAc synthesis precursor degradation pathway blocks the degradation of precursor substances, reduces carbon flux waste, and allows more carbon flux to be converted into products. Ultimately, the GlcNAc yield of the recombinant strain FMIP34 reached 26.1 g / L, an increase of 61.1%, and the GlcNAc conversion rate reached 0.483 g / g glucose.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a method for increasing the yield of acetylglucosamine from Bacillus subtilis, belonging to the field of metabolic engineering technology. Background Technology

[0002] Glucosamine is a monosaccharide found in living organisms, widely distributed in bacteria, yeast, molds, plants, and animals. In humans, glutamine is a precursor for the synthesis of glycosaminoglycan disaccharide units, playing a crucial role in repairing and maintaining the function of cartilage and joint tissues. Bacillus subtilis is a widely used host for the production of food enzymes and important nutritional chemicals, and its products are certified by the FDA as "generally regarded as safe" (GRAS). Therefore, constructing recombinant Bacillus subtilis using metabolic engineering is an effective way to produce food-grade glutamine.

[0003] Previously constructed recombinant Bacillus subtilis SFMI(ΔnagPΔgamPΔgamAΔnagAΔnagBΔldhΔptaΔglmS ribozyme-trp-P 43 The modification of *B. subtilis* (anti-pfkA-glmM glmS ribozyme sRNA-anti-pgi glmSribozyme M9 sRNA) primarily targets issues related to carbon metabolism, nitrogen metabolism, and pathway balance. Modifying *B. subtilis* to synthesize GlcNAc leads to excessive intracellular accumulation of GlcNAc-6-P, causing intracellular phosphate-glucose stress. Since high concentrations of phosphate-glucose are toxic to cells, causing DNA damage and severely impairing cell growth, its intracellular level must be strictly controlled. To synthesize large quantities of GlcNAc without affecting normal cellular metabolism, it is necessary to enhance the dephosphorylation of GlcNAc-6-P to GlcNAc. Therefore, identifying the key dephosphorylating phosphatase in GlcNAc synthesis is crucial. However, the key phosphatase in the preceding step of acetylglucosamine (GlcNAc) synthesis in *B. subtilis*—the dephosphorylation of the precursor acetylglucosamine 6-phosphate (GlcNAc-6-P)—has not been reported. Currently, the phosphatase YqaB from *E. coli* has been reported to catalyze GlcNAc-6-P. However, no phosphatase with the same function from *Bacillus subtilis* has been reported. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention screens key phosphatases and further overexpresses phosphatase YwpJ to alleviate excessive accumulation of phosphate sugars in the cell, thereby promoting the synthesis of GlcNAc. Furthermore, by knocking out the precursor degradation pathway genes nagBB and murQ, the yield of GlcNAc is increased.

[0005] The first objective of this invention is to provide a method for increasing the yield of acetylglucosamine in Bacillus subtilis, comprising the following steps: overexpressing phosphatase YwpJ in Bacillus subtilis that produces acetylglucosamine, and knocking out the glucosamine-6-phosphate deaminase gene nagBB and the acetylmuramic acid-6-phosphate synthase gene murQ.

[0006] Furthermore, the gene encoding the phosphatase YwpJ is, for example, Gene ID: 936907.

[0007] Furthermore, the Bacillus subtilis used to produce acetylglucosamine is Bacillus subtilis SFMI(ΔnagPΔgamPΔgamAΔnagAΔnagBΔldhΔptaΔglmS ribozyme-trp-P 43 The N-acetylglucosamine acetyltransferase GNA1 was obtained by overexpressing N-acetylglucosamine acetyltransferase GNA1 in anti-pgi glmS ribozyme sRNA-anti-pgi glmS ribozyme M9 sRNA.

[0008] Furthermore, the Bacillus subtilis SFMI(ΔnagPΔgamPΔgamAΔnagAΔnagBΔldhΔptaΔglmS ribozyme-trp-P 43 The anti-pfkA-glmM glmS ribozyme sRNA-anti-pgi glmSribozyme M9 sRNA was obtained by using B. subtilis 168ΔnagPΔgamPΔgamAΔnagAΔnagBΔldhΔptaΔglmS5'UTR::lox72 as the host, by deleting the glmS ribozyme, and then further using the glmS ribozyme to control pfkA and glmM, and using the glmS ribozyme mutant to control pgi.

[0009] Furthermore, the gene sequence encoding N-acetylglucosamine acetyltransferase GNA1 is shown in SEQ ID NO.1.

[0010] Furthermore, overexpression of phosphatase YwpJ and overexpression of N-acetylglucosamine acetyltransferase GNA1 were achieved via recombinant plasmid pP 43 -GNA1-ywpJ is used for expression.

[0011] The second objective of this invention is to provide a recombinant Bacillus subtilis, wherein the recombinant Bacillus subtilis uses Bacillus subtilis that produces acetylglucosamine as a host, overexpresses phosphatase YwpJ, and knocks out the glucosamine-6-phosphate deaminase gene nagBB and the acetylmuramic acid-6-phosphate synthase gene murQ.

[0012] The third objective of this invention is to provide a method for producing acetylglucosamine by fermentation of the recombinant Bacillus subtilis, wherein the method includes activating the recombinant Bacillus subtilis in a seed culture medium, and then transferring the activated seed into a fermentation culture medium for fermentation to obtain acetylglucosamine.

[0013] Furthermore, the seed culture medium comprises: 8–12 g / L peptone, 4–6 g / L yeast extract, and 8–12 g / L sodium chloride.

[0014] Further, the fermentation medium comprises: 18–22 g / L glucose, 5–7 g / L peptone, 10–14 g / L yeast extract, 5–7 g / L ammonium sulfate, 12–13 g / L dipotassium hydrogen phosphate, 2–3 g / L potassium dihydrogen phosphate, 4–6 g / L calcium carbonate, and 8–12 ml / L trace element solution; the trace elements comprise the following components: 0.8–1.2 g / L manganese sulfate, 0.3–0.5 g / L cobalt chloride, 0.1–0.3 g / L sodium molybdate, 0.1–0.3 g / L zinc sulfate, 0.05–0.15 g / L aluminum chloride, 0.05–0.15 g / L copper chloride, 0.04–0.06 g / L boric acid, and 4–6 mol / L hydrochloric acid.

[0015] The beneficial effects of this invention are:

[0016] This invention validated by knocking out the key phosphatase YwpJ, which catalyzes the dephosphorylation of GlcNAc-6-P to generate GlcNAc. Overexpression of phosphatase YwpJ reduces the excessive accumulation of intracellular phosphate sugars, eliminating the toxic effects of excessive phosphate sugars on cells and effectively secreting phosphate sugars extracellularly, thereby improving cell growth. Furthermore, knocking out the key genes murQ and nagBB in the GlcNAc synthesis precursor degradation pathway blocks the degradation of precursor substances, reduces carbon flux waste, and allows more carbon flux to be converted into products. Ultimately, the GlcNAc yield of the recombinant strain FMIP34 reached 26.1 g / L, an increase of 61.1%, and the GlcNAc conversion rate reached 0.483 g / g glucose. Attached Figure Description

[0017] Figure 1 To investigate the effect of phosphatase knockout on bacterial cell and GlcNAc synthesis.

[0018] Figure 2 The effect of phosphatase overexpression on bacterial growth and GlcNAc synthesis.

[0019] Figure 3 To eliminate the influence of precursor degradation pathways on GlcNAc synthesis. Detailed Implementation

[0020] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, so that those skilled in the art can better understand and implement the present invention. However, the embodiments described are not intended to limit the present invention.

[0021] Determination methods for acetylglucosamine and acetylglucosamine-6-phosphate:

[0022] HPLC detection of acetylglucosamine: Agilent 1200, RID detector, NH2 column (250×4.6mm, 5μm), mobile phase: 70% acetonitrile, flow rate: 0.75mL / min, column temperature: 30℃, injection volume: 10μL.

[0023] Intracellular GlcNAc6P was determined using an ACQUITY UPLC BEH Amide column (1.7 μm, 2.1 mm × 150 mm, Waters Corporation). Mobile phase A consisted of 95% acetonitrile, 5% water, and 10 mM ammonium bicarbonate. Mobile phase B consisted of water containing 10 mM ammonium carbonate and 0.2% ammonium hydroxide (final pH = 10.4). The gradient elution conditions were: 0 min 10% B; 2 min 10% B; 3 min 45% B; 8 min 48% B; 8.1 min 60% B; 11 min 60% B; 11.5 min 10% B; 18 min 10% B. The flow rate was 0.2 mL / min throughout the process.

[0024] Methods for determining the enzyme activity of key enzymes: Phosphatase activity was determined using a 1 ml system: 50 mM CHES buffer (pH 9.0), 100 mM substrate, and 100 μl supernatant enzyme solution. The reaction was carried out at 37 °C for 30 min, and then the content of dephosphorylated sugars was measured. The method for determining phosphatase activity can be found in the literature "Genome-wide analysis of substrate specificities of the Escherichia coli haloacid dehalogenase-like phosphatase family (The Journal of Biological Chemistry, 2006, 281(47):36149-36161)", which will not be described further here.

[0025] Example 1: Construction of the YwpJ phosphatase knockout box

[0026] Based on the Bacillus subtilis 168 (purchased from the American Type Culture Collection, ATCC No. 27370) published on NCBI, primers for amplifying the upstream and downstream homologous arms of the phosphatase gene ywpJ were designed according to the published upstream and downstream sequences.

[0027] The upstream homologous arm amplification primers are (SEQ ID NO.2\3):

[0028] ywpJ-UF:TACGCTCCTGCAAGTGTCAAGG,

[0029] ywpJ-UR: GCTATACGAACGGTAGAATCTC GTTTGTCAGTCCTTTCCTTCATCCTGCTCT;

[0030] The downstream homologous arm amplification primers are (SEQ ID NO.4\5):

[0031] ywpJ-DF: TATACGAACGGTAGCGCACATA TGATGAAACATTTGTTGTAAGT,

[0032] ywpJ-DR: TATTTAAAGGAAGAGCAAACCGAGC.

[0033] The primers for amplifying the bleomycin resistance gene are (SEQ ID NO. 6\7):

[0034] zeo-F: ATGAAGGAAAGGACTGACAA ACGAGATTCTACCGTTCGTATAGC

[0035] zeo-R: CAAATGTTTCATCATATGTGCG CTACCGTTCGTATAATGTATGC

[0036] Then, using fusion PCR technology, the upstream homologous arm of ywpJ, the bleomycin resistance gene zeo, and the downstream homologous arm of ywpJ were fused into a modified ywpJ knockout frame fragment (upstream homologous arm - zeo - downstream homologous arm).

[0037] Example 2: Construction of the glucosamine-6-phosphate deaminase gene nagBB knockout cassette

[0038] Based on the published upstream and downstream sequences of the glucosamine 6-phosphate deaminase gene nagBB (Gene ID: 938425), primers for amplifying the upstream and downstream homologous arms were designed.

[0039] The upstream homologous arm amplification primers are (SEQ ID NO. 8\9):

[0040] nagBB-UF:TTAACAATTCAAACAGCGAGCCG,

[0041] nagBB-UR: GCTATACGAACGGTAGAATCTC ACTTACAGAGTTCTTCGTAGTGCT;

[0042] The downstream homologous arm amplification primers are (SEQ ID NO.10\11):

[0043] nagBB-DF: GCATACATTATACGAACGGTAG CGCCGATTATAAAGCAGCTCAAAA,

[0044] nagBB-DR: GCGTATAAAAAATATGATGCAGGGCC.

[0045] The primers for amplifying the bleomycin resistance gene are (SEQ ID NO.12\13):

[0046] zeo-F: AGCACTACGAAGAACTCTGTAAGT GAGATTCTACCGTTCGTATAGC

[0047] zeo-R: TTTTGAGCTGCTTTATAATCGGCG CTACCGTTCGTATAATGTATGC

[0048] Then, using fusion PCR technology, the upstream homologous arm of nagBB, the bleomycin resistance gene zeo, and the downstream homologous arm of nagBB were fused into a modified nagBB knockout frame fragment (upstream homologous arm - zeo - downstream homologous arm).

[0049] Example 3: Constructing the murQ knockout box

[0050] Based on the published upstream and downstream sequences of the acetylmucol-6-phosphate synthase gene murQ (Gene ID: 938882), primers for amplifying the upstream and downstream homologous arms were designed.

[0051] The upstream homologous arm amplification primers are (SEQ ID NO.14\15):

[0052] murQ-UF:AAAAAATCACCGGCAGCGGAGTAA,

[0053] murQ-UR: GCTATACGAACGGTAGAATCTC TTAATGGTTCTGACATGAGGATGCC;

[0054] The downstream homologous arm amplification primers are (SEQ ID NO.16\17):

[0055] murQ-DF: GCATACATTATACGAACGGTAG CATTACCATCCATGATAAGGAGAGA,

[0056] murQ-DR: AATTGTGTGAGGCTGATCGTTGT.

[0057] The primers for amplifying the bleomycin resistance gene are (SEQ ID NO.18\19):

[0058] zeo-F: GGCATCCTCATGTCAGAACCATTAA GAGATTCTACCGTTCGTATAGC

[0059] zeo-R: TCTCTCCTTATCATGGATGGTAATG CTACCGTTCGTATAATGTATGC

[0060] Then, using fusion PCR technology, the upstream homologous arm of murQ, the bleomycin resistance gene zeo, and the downstream homologous arm of murQ were fused into a modified murQ knockout frame fragment (upstream homologous arm - zeo - downstream homologous arm).

[0061] Example 4: Construction of GNA1 and YwpJ co-expression plasmid

[0062] Based on the published upstream and downstream sequences of the ywpJ phosphatase gene, primers for cloning and amplification were designed.

[0063] The amplification primers are (SEQ ID NO.20\21):

[0064] ywpJ-F: TTAATTAAAAAGAGGAGGTCAATTCTT ATGAAATTAATTGCGATTGACTTAGATG,

[0065] ywpJ-R:

[0066] The primers for amplifying the GlcN6P acetyltransferase gene GNA1 are (SEQ ID NO.22\23):

[0067] GNA1-F:

[0068] GNA1-R: TTCATAAGAATTGACCTCCTCTTTTT AATTAAAAGCGCTGGGTCATAAAATTACAG.

[0069] Then, using fusion PCR technology, the ywpJ and GNA1 fragments were fused to obtain a KpnI-GNA1-ywpJ-PstI ligation fragment for vector ligation. The fusion fragment and pP were then ligated using restriction endonucleases KpnI and PstI. 43 The NMK vector was digested and then ligated to obtain the co-expression plasmid pP. 43 -GNA1-ywpJ.

[0070] Example 5: Construction of recombinant Bacillus subtilis

[0071] The knockout frames constructed in Examples 1-3 were transformed into recombinant Bacillus subtilis SFMI(ΔnagPΔgamPΔgamAΔnagAΔnagBΔldhΔptaΔglmS ribozyme-trp-P 43 -anti-pfkA-glmM glmS ribozymesRNA-anti-pgi glmS ribozyme M9 sRNA (hereinafter referred to as SFMI) was obtained by using B. subtilis 168ΔnagPΔgamPΔgamAΔnagAΔnagBΔldhΔptaΔglmS5'UTR::lox72 as the host, by deleting the glmS ribozyme, and then further using the glmS ribozyme to control pfkA and glmM, and using the glmS ribozyme mutant to control pgi. The construction method is described in "Engineering a glucosamine-6-phosphateresponsive glmS ribozyme switch enables dynamic control of metabolic flux in Bacillus subtilis for overproduction of N-acetylglucosamine (ACS Synthetic Biology, 2018, 7(10): 2423-2435.)", which will not be described further here.

[0072] Through bleomycin resistance plate screening, colony PCR verification, and resistance gene elimination, the ywpJ knockout frame was transformed into SFMI, verifying successful ywpJ gene knockout and yielding recombinant Bacillus subtilis SFMIP7; the nagBB knockout frame was transformed into SFMI, verifying successful nagBB gene knockout and yielding recombinant Bacillus subtilis SFMIB; the murQ knockout frame was transformed into SFMI and SFMIB, verifying successful murQ gene knockout and yielding recombinant Bacillus subtilis SFMQ and SFMIBQ. The recombinant plasmid pP 43-GNA1 was transformed into SFMI and SFMIP7 to obtain engineered strains SFMI01 and SFMIP01, and the recombinant plasmid pP was used to transform them. 43 -GNA1-ywpJ was transformed into SFMI, SFMIP, SFMIB, SFMIQ, and SFMIBQ, respectively, to obtain engineered strains SFMI34, SFMIP34, SFMIB34, SFMIQ34, and SFMIBQ34.

[0073] Furthermore, this invention also follows the construction method of SFMIP01, knocking out the ycsE, yhaX, ntdB, yitU, ykrA, ywtE, and yxeH phosphatase genes in SFMI, and then using the recombinant plasmid pP 43 -GNA1 was introduced to obtain strains with the SFMIP1, SFMIP2, SFMIP3, SFMIP4, SFMIP5, SFMIP6, and SFMIP8 phosphatase genes knocked out.

[0074] Example 6: Production of acetylglucosamine by fermentation of recombinant Bacillus subtilis

[0075] The recombinant Bacillus subtilis constructed in Example 5 was used for shake-flask fermentation.

[0076] The seed culture medium consists of 10 g / L peptone, 5 g / L yeast extract, and 10 g / L sodium chloride.

[0077] The fermentation medium consists of: 20 g / L glucose, 6 g / L peptone, 12 g / L yeast extract, 6 g / L ammonium sulfate, 12.5 g / L dipotassium hydrogen phosphate, 2.5 g / L potassium dihydrogen phosphate, 5 g / L calcium carbonate, and 10 ml / L trace element solution.

[0078] The trace element solution, based on its weight, includes the following components: 1.0 g / L manganese sulfate, 0.4 g / L cobalt chloride, 0.2 g / L sodium molybdate, 0.2 g / L zinc sulfate, 0.1 g / L aluminum chloride, 0.1 g / L copper chloride, 0.05 g / L boric acid, and 5 mol / L hydrochloric acid.

[0079] Recombinant Bacillus subtilis was cultured in seed culture medium at 37°C and 220 rpm for 8 h. Then, the seed culture was transferred to fermentation medium at a 5% inoculum and cultured in 500 mL shake flasks at 37°C and 220 rpm for 48 h. At the end of fermentation, the content of acetylglucosamine in the fermentation supernatant was measured.

[0080] Compared to SFMI01, knocking out the ycsE, yhaX, ntdB, yitU, ykrA, ywtE, and yxeH phosphatase genes did not significantly alter the GlcNAc yield or cell growth of the recombinant strains SFMIP1, SFMIP2, SFMIP3, SFMIP4, SFMIP5, SFMIP6, and SFMIP8; while... Figure 1 As shown, knocking out YwpJ significantly inhibited bacterial growth, decreasing from 7.13 g / L to 5.21 g / L; simultaneously, GlcNAc production decreased from 16.2 g / L to 10.8 g / L. Therefore, the knockout of phosphatase YwpJ likely affected the GlcNAc6P dephosphorylation reaction, thereby reducing GlcNAc synthesis and inhibiting cell growth.

[0081] At the same time, from Figure 2 It can also be seen that co-expression of GNA1 and phosphatase YwpJ can increase cell dry weight to 9.99 g / L. Figure 2 A). Due to the expression of phosphatase, the dephosphorylation of GlcNAc6P is accelerated, leading to the rapid accumulation of GlcNAc. Overexpression of YwpJ resulted in a GlcNAc yield of 21.1 g / L. Figure 2 B), which increased by 95.4%; among them, the expression of YwpJ can effectively accumulate GlcNAc production, that is, YwpJ can effectively dephosphorylate GlcNAc6P.

[0082] And, as Figure 2 As shown in Figure C, compared with SFMIP01, the co-expression plasmid did not change the GNA1 enzyme activity, meaning that the change in GlcNAc production was not caused by the change in GNA1 expression; the phosphatase activity of recombinant strain SFMIP34 was 350.6 U / mg, which was 286.5% higher than that of SFMI01 (90.7 U / mg), while the phosphatase activity of recombinant strain SFMIP01 was 29.7 U / mg, which was 67.2% lower. Figure 2 C). Simultaneously, analysis of intracellular GlcNAc6P content revealed a significant decrease in the concentration of GlcNAc6P in the YwpJ expression strain. Compared to the control, the intracellular GlcNAc6P content decreased from 28.4 μmol / g DCW to 15.0 μmol / g DCW after 24 h of fermentation. However, the intracellular GlcNAc6P content in the YwpJ knockout strain SFMIP01 increased to 38.5 μmol / g DCW. Therefore, YwpJ expression significantly reduced the intracellular GlcNAc6P content. Figure 2 D).

[0083] like Figure 3A. Knocking out the murQ gene had no effect on cell growth; knocking out nagBB resulted in a slight decrease in cell growth. This is likely because nagBB's degradation of GlcN6P provides more glycolytic flux for cell growth, and knocking out nagBB prevents some carbon flux from entering the glycolytic pathway, thus slightly downregulating cell growth. Knocking out murQ and nagBB increased the yield of GlcNAc to 22.6 g / L and 23.3 g / L, respectively, and improved the conversion rates to 0.435 g / g glucose and 0.464 g / g glucose, respectively. Figure 3 (B) When murQ and nagBB were simultaneously knocked out, the GlcNAc yield of the recombinant strain FMIP34 reached 26.1 g / L, an increase of 23.7%, the GlcNAc conversion rate reached 0.483 g / g glucose, and the cell yield reached 2.86 g / g cell dry weight. The results indicate that knocking out the GlcNAc precursor degradation pathway can effectively accumulate GlcNAc.

[0084] The above-described embodiments are merely preferred embodiments provided to fully illustrate the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention. The scope of protection of the present invention is defined by the claims. sequence list <110> Jiangnan University, Shandong Runde Biotechnology Co., Ltd. <120> A method to increase the yield of Bacillus subtilis acetylglucosamine <160> twenty three <170> PatentIn version 3.3 <210> 1 <211> 516 <212> DNA <213> (Artificial sequence) <400> 1 atgcaccacc accaccacca cagccatatc ttcgacgcat ctgtactggc tccacatatt 60 cctagtaacc ttcctgataa tttcaaggtg agaccactgg caaaggatga tttttcgaag 120 ggatatgtcg acctgctgtc acaattgacg tcagttggaa accttgacca agaagcattt 180 gagaaacgat ttgaggcgat gagaacaagc gtaccgaatt atcacatcgt agtaattgag 240 gattccaaca gccagaaagt ggtggcgtct gctagttttgg ttgttgaaat gaaattcatt 300 catggggccg gatcaagggg tcgtgttgaa gatgttgtcg tcgatacaga aatgcgccgg 360 caaaaattag gtgccgtgct tttaaaaact ttggtgtcac ttggcaaatc tttaggcgtc 420 tacaaaataa gcctcgaatg cgtcccggaa ttactcccgt tctattccca atttggcttt 480 caggatgact gtaattttat gacccagcgc ttttaa 516 <210> 2 <211> 22 <212> DNA <213> (Sunshine) <400> 2 tacgctcctg caagtgtcaa gg 22 <210> 3 <211> 52 <212> DNA <213> (Sunshine) <400> 3 gctatacgaa cggtagaatc tcgtttgtca gtccttttcct tcatcctgct ct 52 <210> 4 <211> 44 <212> DNA <213> (Sunshine) <400> 4 tatacgaacg gtagcgcaca tatgatgaaa catttgttgt aagt 44 <210> 5 <211> 25 <212> DNA <213> (Artificial sequence) <400> 5 tatttaaagg aagagcaaac cgagc 25 <210> 6 <211> 44 <212> DNA <213> (Artificial sequence) <400> 6 atgaaggaaa ggactgacaa acgagattct accgttcgta tagc 44 <210> 7 <211> 44 <212> DNA <213> (Artificial sequence) <400> 7 caaatgtttc atcatatgtg cgctaccgtt cgtataatgt atgc 44 <210> 8 <211> twenty three <212> DNA <213> (Artificial sequence) <400> 8 ttaacaattc aaacagcgag ccg 23 <210> 9 <211> 46 <212> DNA <213> (Artificial sequence) <400> 9 gctatacgaa cggtagaatc tcacttacag agttcttcgt agtgct 46 <210> 10 <211> 46 <212> DNA <213> (Artificial sequence) <400> 10 gcatacatta tacgaacggt agcgccgatt ataaagcagc tcaaaa 46 <210> 11 <211> 25 <212> DNA <213> (Sunshine) <400> 11 gcgtataaaa aatatgatgc aggcc 25 <210> 12 <211> 46 <212> DNA <213> (Sunshine) <400> 12 agcactacga agaactctgt aagtgagatt ctaccgttcg tatagc 46 <210> 13 <211> 46 <212> DNA <213> (Sunshine) <400> 13 ttttgagctg ctttataatc ggcgctaccg ttcgtataat gtatgc 46 <210> 14 <211> 24 <212> DNA <213> (Sunshine) <400> 14 aaaaaatcac cggcagcgga gtaa 24 <210> 15 <211> 47 <212> DNA <213> (Sunshine) <400> 15 gctatacgaa cggtagaatc tcttaatggt tctgacatga ggatgcc 47 <210> 16 <211> 47 <212> DNA <213> (Sunshine) <400> 16 gcatacatta tacgaacggt agcattacca tccatgataa ggagaga 47 <210> 17 <211> 23 <212> DNA <213> (Sunshine) <400> 17 aattgtgtga ggctgatcgt tgt 23 <210> 18 <211> 47 <212> DNA <213> (Sunshine) <400> 18 ggcatcctca tgtcagaacc attaagagat tctaccgttc gtatagc 47 <210> 19 <211> 47 <212> DNA <213> (Sunshine) <400> 19 tctctcctta tcatggatgg taatgctacc gttcgtataa tgtatgc 47 <210> 20 <211> 55 <212> DNA <213> (Sunshine) <400> 20 ttaattaaaa agaggaggtc aattcttatg aaattaattg cgattgactt agatg 55 <210> 21 <211> 36 <212> DNA <213> (Sunshine) <400> 21 tgcctgcagt tacaacaaat gtttcatcat atgtgc 36 <210> 22 <211> 24 <212> DNA <213> (Sunshine) <400> 22 agcggtacca ttataggtaa gaga 24 <210> 23 <211> 56 <212> DNA <213> (Artificial sequence) <400> twenty three ttcataagaa ttgacctcct ctttttaatt aaaagcgctg ggtcataaaa ttacag 56

Claims

1. A method of increasing the production of glucosamine by Bacillus subtilis, characterized in that, The method comprises the following steps: overexpressing phosphatase YwpJ and N-acetylglucosamine acetylase GNA1 in a Bacillus subtilis host strain, and knocking out an acetylmuramate 6-phosphate synthase gene murQ ; The Bacillus subtilis host strain is Bacillus subtilis SFMI (Δ nagP Δ gamP Δ gamA Δ nag AΔ nagB Δ ldh Δ pta Δ glmS ribozyme-trp- P 43 -anti- pfkA - glmMglmS ribozyme sRNA-anti- pgiglmS ribozyme M9 sRNA Overexpression of phosphatase YwpJ and N-acetylglucosamine acetylase GNA1 was performed by recombination of plasmid p P 43 - GNA1 - ywpJ Expression was performed; Gene ID of the phosphatase YwpJ encoding gene: 936907; The sequence of the N-acetylglucosamine acetylase GNA1 encoding gene is shown as SEQ ID NO.

1. The acetylmuramate 6-phosphate synthase gene murQ Gene ID: 938882.

2. A recombinant Bacillus subtilis, characterized in that, The recombinant Bacillus subtilis is Bacillus subtilis SFMI (Δ nagP Δ gamP Δ gamA Δ nag AΔ nagB Δ ldh Δ pta Δ glmS ribozyme-trp- P 43 -anti- pfkA - glmMglmS ribozyme sRNA-anti- pgiglmS ribozyme M9 sRNA)as a host, overexpresses phosphatase YwpJ and N-acetylglucosamine acetylase GNA1, and knocks out the acetylmuramate 6-phosphate synthase gene murQ ; Overexpression of phosphatase YwpJ and N-acetylglucosamine acetylase GNA1 is carried out by recombinant plasmid p P 43 - GNA1 - ywpJ The expression is carried out; the Gene ID of the phosphatase YwpJ encoding gene: 936907, the sequence of the N-acetylglucosamine acetylase GNA1 encoding gene is shown as SEQ ID NO. 1, the acetylmuramate 6 phosphate synthetase gene murQ Gene ID: 938882.

3. The method of recombinant Bacillus subtilis fermentation for the production of acetylglucosamine according to claim 2, characterized in that, The method comprises activating the recombinant Bacillus subtilis in a seed culture medium, then transferring the activated seed into a fermentation culture medium for fermentation culture, so as to obtain acetylglucosamine.

4. The method of claim 3, wherein, The components of the seed culture medium include 8-12 g / L peptone, 4-6 g / L yeast powder and 8-12 g / L sodium chloride.

5. The method of claim 3, wherein, The components of the fermentation culture medium include 18-22 g / L glucose, 5-7 g / L peptone, 10-14 g / L yeast powder, 5-7 g / L ammonium sulfate, 12-13 g / L dipotassium hydrogen phosphate, 2-3 g / L potassium dihydrogen phosphate, 4-6 g / L calcium carbonate and 8-12 ml / L trace element solution; the trace elements include the following components: 0.8-1.2 g / L manganese sulfate, 0.3-0.5 g / L cobalt chloride, 0.1-0.3 g / L sodium molybdate, 0.1-0.3 g / L zinc sulfate, 0.05-0.15 g / L aluminum chloride, 0.05-0.15 g / L copper chloride, 0.04-0.06 g / L boric acid and 4-6 mol / L hydrochloric acid.