Expression of Pneumococcal Surface Protein A (PSPA)

Abstract

This invention relates to the expression of pneumococcal surface protein A (PspA). This invention represents an advancement in the fields of genetic engineering and vaccine technology. This invention discloses expression vectors and recombinant host cells for expressing truncated PspA peptides. This invention also discloses vaccine compositions comprising the truncated peptide as a carrier protein.

Description

Technical Field

[0001] The present invention relates to high-level expression of truncated pneumococcal surface protein A1 (PspA1) in bacteria. Background Art

[0002] Streptococcus pneumoniae is an important cause of otitis media, meningitis, bacteremia, and pneumonia, and is a leading cause of fatal infections in the elderly and patients with underlying medical conditions. An attractive goal of streptococcal vaccination is to reduce carriage in the vaccinated population and subsequently reduce the incidence of pneumococcal disease.

[0003] The pneumococcal polysaccharide vaccine, sold under the brand name Pneumovax23, is ineffective in children under 2 years of age. The ineffectiveness of the polysaccharide vaccine in this population has been attributed to the immaturity of the infant immune system in terms of B cell receptor expression. The conjugation of the polysaccharide (PS) to a carrier protein converts it from a T cell-independent antigen to a T cell-dependent antigen. As a T cell-dependent antigen, the polysaccharide can elicit responses to isotype switching, memory cell generation, and an enhanced immune response.

[0004] Membrane proteins are present in and across membranes, through which they are used to transport molecules or facilitate cell adhesion. Proteins can assist in the movement of substances by facilitating diffusion (i.e., passive transport) or active transport. Pneumococcal surface protein A (PspA) is a membrane protein that is another important virulence factor attached to the cell wall of all Streptococcus pneumoniae strains.

[0005] In addition to expanding vaccine coverage, the replacement of universal carrier proteins, such as tetanus toxoid (TT) or CRM 197, by pneumococcal proteins, especially PspA1 or fragments thereof, can also prevent the impaired immune response caused by overuse of the same carrier protein in conjugate vaccines. Expression plasmids are engineered to contain regulatory sequences that act as enhancer and promoter regions and lead to efficient transcription of the genes carried on the expression vector. The goal of a well-designed expression vector is to efficiently produce proteins, which can be achieved by synthesizing large amounts of stable messenger RNA. An expression vector can be designed that exerts strict control over expression and can only produce proteins in large quantities when necessary by using suitable expression conditions.

[0006] Proteins can also be constitutively expressed without strict control of gene expression.

[0007] Corynebacterium glutamicum (Corynebacterium glutamicum) is a gram-positive fermentation bacterium, and it is widely used in mass production of monosodium glutamate.Due to its stable genetic characteristics and lack of any endotoxin, Corynebacterium glutamicum is classified as GRAS organism (generally considered to be safe).It is not clear that any extracellular protease is secreted by this bacterium, so it becomes the attractive platform for producing heterologous protein in culture medium.This can be realized using expression plasmid construct, and this construct can synthesize recombinant proteins in a large amount.

[0008] EP2310502 B1 Publicly published P tac Use of the promoter in a construct wherein E. coli strains containing IPTG-inducible ftsZ and minCDE deletion mutations were grown in LB medium.

[0009] Nokano et al. J Bacteriol.1984 Jan;157(1):79-83 The invention discloses the use of a kanamycin resistance gene in a plasmid construct to make the transformed strain acquire the property of being resistant to kanamycin.

[0010] Masai et al. Proc Natl Acad Sci USA. 1987 Jul;84(l4):4781-5 The RepA protein is disclosed for initiating R1 plasmid replication and interacting with the oriR sequence.

[0011] Nayak et al., Infect. Immun.-1998-Nayak-3744-51 discloses an oral recombinant live Salmonella vaccine strain expressing pneumococcal surface protein A (PspA).

[0012] Nabors et al., Vaccine 18 (2000) 1743-54 disclose the expression of recombinant truncated PspA as a cytoplasmic protein in E. coli.

[0013] Figueredo et al., Appl Microbiol Biotechnol (2017) 101: 2305-2317 discloses the production and purification of untagged recombinant pneumococcal surface protein A (PspA4Pro).

[0014] The above references disclose the expression of genetic components of expression vectors or pneumococcal surface protein A in Escherichia coli and Salmonella.

[0015] The inventors have identified immunogenic fragments of pneumococcal surface proteins. Since then, the inventors have devoted considerable effort to developing expression constructs capable of stably and constitutively or inducibly expressing high levels of truncated pneumococcal surface protein A1 (PspA1) in bacteria.

[0016] Therefore, the present invention intends to overcome the challenges of the prior art by preparing expression vectors and recombinant host cells for expressing truncated pneumococcal surface proteins. In addition, the inventors have prepared vaccine compositions comprising truncated proteins as carrier proteins.

[0017] Purpose of the Invention

[0018] The main object of the present invention is to provide an expression construct for expressing high levels of truncated pneumococcal surface protein A1 (PspA1) in bacteria.

[0019] Another object of the present invention is to provide an expression construct capable of stably and constitutively or inducibly expressing high levels of truncated pneumococcal surface protein A1 (PspA1) in bacteria. Summary of the invention

[0020] The present invention provides an expression construct capable of expressing a truncated pneumococcal surface protein A1 (PspA1) as described in SEQ ID NOs: 3 and 4 at a high level.

[0021] The present invention provides an expression construct comprising a gene encoding a truncated pspA1 as described in SEQ ID NO: 5 and 6.

[0022] The present invention provides an expression construct for high-level expression of a truncated PspA1 (pneumococcal surface protein A1) as described in SEQ ID NO: 3 or 4 in bacteria, comprising:

[0023] a) a gene encoding a truncated pspA1 as described in SEQ ID NO: 5 or 6,

[0024] b) copy the origin,

[0025] c) antibiotic resistance genes,

[0026] d) a promoter, and

[0027] e) Ribosome binding site.

[0028] The present invention also relates to a method for expressing truncated PspA1 (Pneumococcal surface protein A1) at high levels, the method comprising culturing bacteria transformed with the expression construct, thereby purifying the expressed protein. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1Panel A shows a schematic diagram of pBE31C. Panel B shows a schematic diagram of the pspA domain depicted by the deduced amino acid sequence of Rx1 PspA1. Panel C shows a schematic diagram of pBE117. Panel D shows a PCR amplicon containing RBS, native signal peptide, truncated pspA1, native terminator, and trrnB.

[0030] Figure 2 : Protein sequence coverage of truncated PspA1 in peptide fingerprint analysis.

[0031] Figure 3 : Intact mass analysis of truncated PspA1 expressed in Corynebacterium glutamicum.

[0032] Figure 4 : Truncated PspAl eluted from a ceramic hydroxyapatite (CHT-II) column.

[0033] Figure 5 : Truncated PspA1 eluted from an anion exchange column.

[0034] Figure 6 : Truncated PspA1 after diafiltration.

[0035] Figure 7 : SEC-HPLC chromatograms of the binding reaction kinetics of pneumococcal polysaccharide serotypes 3 (A), 6A (B) and 6B (C).

[0036] Figure 8 : Serum antibody titers of immunized rabbits against different conjugates of Streptococcus pneumoniae polysaccharides from serotypes 3, 6A, and 6B (2.2 mcg) and truncated pspA 1 carrier protein.

[0037] Fig. 9 : Serum antibody titers of immunized rabbits against different conjugates of Streptococcus pneumoniae polysaccharides from serotypes 3, 6A, and 6B (4.4 mcg) and truncated pspA 1 carrier protein.

[0038] Fig.10 : Panel A shows a schematic diagram of pBE114k. Panel B shows confirmation of pBE114k by restriction digestion.

[0039] Fig.11 : Truncated PspA1 eluted from CHT I chromatography.

[0040] Fig.12 : Truncated PspA1 eluted from Capto Q Impress chromatography.

[0041] Fig.13 : Protein coverage of PspA1 by MALDI.

[0042] Fig.14 : Intact mass analysis of truncated PspA1 expressed in Escherichia coli. DETAILED DESCRIPTION

[0043] The term PspA1 refers to the pneumococcal surface protein A1 from Streptococcus pneumoniae.

[0044] The present invention relates to the high-level expression of truncated PspA1 (pneumococcal surface protein A1) in bacteria. Bacteria suitable for high-level expression of PspA1 are Corynebacterium glutamicum and Escherichia coli.

[0045] In one embodiment, the present invention relates to high-level expression of a truncated PspA1 (Pneumococcal surface protein A1) as described in SEQ ID NO: 3 in Corynebacterium glutamicum.

[0046] In another embodiment, the present invention relates to high-level expression of the truncated PspA1 (Pneumococcal surface protein A1) as described in SEQ ID NO: 4 in E. coli.

[0047] The present invention provides an expression construct capable of expressing a surface protein as described in SEQ ID NO:3 at a high level.

[0048] The present invention also provides an expression construct capable of expressing the surface protein described by SEQ ID NO:4 at a high level.

[0049] In another embodiment, the present invention relates to an expression construct for high-level expression of the truncated PspA1 (Pneumococcal surface protein A1) as described in SEQ ID NO: 3 in Corynebacterium glutamicum.

[0050] In yet another embodiment, the present invention relates to an expression construct for high-level expression of the truncated PspA1 (Pneumococcal surface protein A1) as described in SEQ ID NO: 4 in Escherichia coli.

[0051] The present invention relates to an expression construct for high-level expression of truncated PspA1 in Corynebacterium glutamicum, comprising:

[0052] i.ori R copy origin,

[0053] ii. Kanamycin resistance gene,

[0054] iii.P tac Promoter,

[0055] iv. A target gene encoding a truncated PspA1 (SEQ ID NO: 5).

[0056] The present invention also relates to an expression construct for high-level expression of truncated PspA1 in Escherichia coli, comprising:

[0057] i.pUC replication origin

[0058] ii. Kanamycin resistance gene

[0059] iii.P T7 Promoter

[0060] iv. A target gene encoding a truncated PspA1 (SEQ ID NO: 6).

[0061] In one embodiment, the expression construct for high-level expression of truncated pspA1 also contains a ribosome binding site (RBS). The RBS is contained in the forward primer, and a short DNA containing a natural terminator is contained in the reverse primer for further amplification of the truncated PspA1. The RBS (ribosome binding site) is a triose phosphate isomerase in the expression construct for expressing the truncated PspA1 in Corynebacterium glutamicum.

[0062] In one embodiment of the present invention, the expression construct comprises the PspA1 signal peptide coding region (native) of the triosephosphate isomerase gene, a truncated pspA1, a P tac Promoter and ribosome binding site (RBS).

[0063] In a preferred embodiment, the present invention provides an expression construct for high-level expression of truncated PspA1 (SEQ ID NO: 3) in Corynebacterium glutamicum, comprising:

[0064] a. A gene encoding a truncated PspA1 (SEQ ID NO: 5),

[0065] b.ori R replication origin (SEQ ID NO: 12),

[0066] c. kanamycin resistance gene (SEQ ID NO: 1),

[0067] dP tac Promoter (SEQ ID NO: 2) and

[0068] e. Triosephosphate isomerase ribosome binding site.

[0069] In another preferred embodiment, the present invention provides an expression construct for high-level expression of truncated PspA1 (SEQ ID NO: 4) in Escherichia coli, comprising:

[0070] a) a gene encoding a truncated pspA1 (SEQ ID NO: 6),

[0071] b) pUC replication origin,

[0072] c) kanamycin resistance gene (SEQ ID NO: 1),

[0073] d) P T7 Promoter (SEQ ID NO: 11) and

[0074] e) Ribosome binding site.

[0075] Pneumococcal surface protein A (PspA) is a membrane protein that is an important virulence factor found attached to the cell wall of all S. pneumoniae strains and is a promising component as it has been shown to be highly immunogenic.

[0076] In a specific embodiment of the present invention, truncated PspA1 is used as a carrier protein. The carrier protein used in the conjugate vaccine is preferably a protein that is non-toxic and non-reactogenic and can be obtained in large quantities and in a pure form. The carrier protein can be conjugated to a capsular polysaccharide isolated from a pathogen to enhance the immunogenicity of the polysaccharide. The carrier protein should conform to standard chemical conjugation procedures.

[0077] Truncated PspA1 in Corynebacterium glutamicum is secreted into the extracellular medium. Secretion into the extracellular medium facilitates efficient purification.

[0078] The present invention relates to high-level expression of truncated PspA1 in Corynebacterium glutamicum, wherein the N-terminal region and the proline-rich region of the truncated pspA1 gene are amplified from the 23F capsular serotype of Streptococcus pneumoniae together with the upstream region.

[0079] In one embodiment of the present invention, the expression construct comprises a truncated pspA1, P tac Promoter and ribosome binding site (RBS).

[0080] In one embodiment of the present invention, the expression construct comprises truncated pspA1, P T7 Promoter and ribosome binding site (RBS).

[0081] The expression construct was electroporated into C. glutamicum and selected on LB plates with kanamycin as selection marker.

[0082] P tac It is a strong hybrid promoter consisting of the -35 region of the trp promoter and the -10 region of the lacUV5 promoter / operator.

[0083] The pspA sequence was obtained from GenBank and aligned with the protein database. Primers were designed to specifically amplify the native signal peptide coding region, the N-terminal region, and the proline-rich region of the pspA genes belonging to families 1 and 2. The desired pspA1 and pspA2 regions were amplified from available clinical isolates of S. pneumoniae. MHC peptide analysis showed that pspA1 was relatively more immunogenic than pspA2.

[0084] The amino acid sequence encoding the truncated PspA1 expressed and produced in C. glutamicum is shown in SEQ ID NO: 3 and an intact mass of 35452 Daltons was observed.

[0085] The amino acid sequence encoding the truncated PspA1 expressed and produced in E. coli is shown in SEQ ID NO: 4, and an intact mass of 41966 Daltons was observed.

[0086] The DNA sequences encoding the truncated pspA1 expressed in Corynebacterium glutamicum and Escherichia coli are shown in SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

[0087] The Corynebacterium glutamicum (previously known as glutamic acid micrococcus) used to express brachymemma pspA1 is a GRAS microorganism gram-positive rod-shaped bacterium.Corynebacterium glutamicum is a GRAS microorganism.The whole genome sequence of Corynebacterium glutamicum ATCC 13032 can be obtained, which can grow to higher cell density, and is also genetically stable due to lack of recombination repair system.It has a limited restriction modification system.It does not have autolysis, and can maintain metabolic activity under the condition of growth stagnation.It has low protease activity, which is conducive to recombinant protein production.The plasticity of its metabolism and powerful secondary metabolism characteristics, the ability of utilizing a wide spectrum carbon source (pentose, hexose and alternative carbon source), the tolerance to carbon source make it become a promising host for heterologous protein production.These physiological characteristics enable Corynebacterium glutamicum to operate and cultivate under powerful industrial conditions, therefore making it a successful industrial main force.The heterologous expression of proteins such as alpha-amylase, endoglucanase, endoxylanase, GFP, xylanase has been reported in Corynebacterium glutamicum.

[0088] In one embodiment of the present invention, the yield of truncated PspA1 is about 500 mg / L, about 400 mg / L, about 300 mg / L, about 250 mg / L, about 220 mg / L, about 200 mg / L, about 180 mg / L, about 160 mg / L, about 150 mg / L, about 120 mg / L, about 100 mg / L.

[0089] In another embodiment, the present invention provides a pneumococcal conjugate vaccine comprising at least one polysaccharide from a serotype of S. pneumoniae selected from 1, 2, 3, 4, 5, 6A, 6B, 6C, 6D, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15A, 15B, 15C, 16F, 17F, 18C, 19F, 19A, 20A, 20B, 22F, 23A, 23B, 23F, 24B, 24F, 31, 33F, 34, 35B, 35F, 38, 39 and 45, other carrier proteins such as CRM197, tetanus toxoid, pertussis toxoid; PsaA, etc.

[0090] In another embodiment, the present invention provides a multivalent pneumococcal vaccine composition selected from 10-valent, 14-valent, 15-valent, 17-valent, 18-valent, 19-valent, 20-valent, 22-valent, 23-valent, 24-valent or 25-valent, comprising a polysaccharide from a serotype of Streptococcus pneumoniae combined with a truncated PspA1 of the present invention or a combination of a truncated PspA1 and other carrier proteins, wherein the serotype of Streptococcus pneumoniae is selected from 1, 2, 3, 4, 5, 6A, 6B, 6C, 6D, 7F, 8, 9N, 9V, 10A, 11A, 12F, 14, 15A, 15B, 15C, 16F, 17F, 18C, 19F, 19A, 20A, 20B, 22F, 23A, 23B, 23F, 24B, 24F, 31, 33F, 34, 35B, 35F, 38, 39 and 45, other carrier proteins such as CRM197, tetanus toxoid, pertussis toxoid; psaA, etc.

[0091] In a preferred embodiment, the present invention provides a multivalent conjugate vaccine comprising at least three polysaccharides from S. pneumoniae serotypes 3, 6A and 6B conjugated to the truncated PspA1 of the present invention.

[0092] In one embodiment of the present invention, a conjugate vaccine is provided, comprising polysaccharides from serotypes 3, 6A and 6B of Streptococcus pneumoniae combined with the truncated PspA1 of the present invention and combined with CRM 197 Binds to S. pneumoniae serotypes 1, 4, 5, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F and 33F.

[0093] The present invention provides a method comprising 2.2 μg or 4.4 μg of each pneumococcal polysaccharide from serotypes 3, 6A and 6B, each of which is bound to a truncated PspA1 of the present invention, and about 2.2 μg of each pneumococcal polysaccharide from serotypes 3, 6A and 6B, each of which is bound to a truncated PspA1 of the present invention 197Preparations of each pneumococcal polysaccharide of serotypes 1, 4, 5, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F and 33F combined.

[0094] In another embodiment, the present invention provides a single 0.5 mL dose of a pneumococcal vaccine composition comprising about 2.2 to 4.4 μg of one or more pneumococcal polysaccharides; about 1 μg to about 50 μg of a truncated PspA1 of the present invention combined with each of the one or more pneumococcal polysaccharides; about 0.2 mg to about 1 mg of an aluminum phosphate adjuvant; and an excipient.

[0095] In another embodiment, the present invention provides a single 0.5 mL dose of a pneumococcal vaccine composition comprising about 2.2 to 4.4 μg of one or more pneumococcal polysaccharides; about 1 μg to about 30 μg of a truncated PspA1 of the present invention combined with each of the one or more pneumococcal polysaccharides; about 1 μg to about 30 μg of a CRM combined with each of the one or more pneumococcal polysaccharides. 197 ; about 0.2 mg to about 1 mg of an aluminum phosphate adjuvant; and an excipient.

[0096] In another embodiment, the present invention also provides a vaccine for preventing invasive diseases caused by Streptococcus pneumoniae by administering a conjugate vaccine prepared by conjugating the truncated PspA1 of the present invention to pneumococcal polysaccharide.

[0097] Example

[0098] The following examples are provided to illustrate the present invention and are for illustrative purposes only and should not be construed as limiting the scope of the present invention.

[0099] Example 1: Recombinant expression of truncated PspA1 in Corynebacterium glutamicum.

[0100] Construction of pBE31C

[0101] Using a synthetic plasmid with a 2.692 Kb pNG2 oriR sequence, a small stably replicating broad host range plasmid pBE30 was generated. Using this plasmid DNA as a template, the 1.8 Kb oriR region was amplified using primers pEP-Fl (5'-GCG CGG ACT AGT AGA TCT ATGGTA AAT CTG CGC AGA CAG-3') and pEP-Rl (5'-GCG CGG ACT AGT GAA TTC GGT GAG GTTATG GCG-3').

[0102] At the same time, the 1.033 Kb kanR sequence was amplified using pUC4-KIXX template DNA and Kan-F2 (5'-AAG GTC CCG GGA TGG CGA TAG CTAGAC TGG GCG GT-3') and Kan-R2 (5'-AAG GTC CCG GGG GTT GGG CGT CGC TTG GTC GG-3') primers. The kanR gene amplicon and oriR amplicon were blunt-ended to generate the pBE30 vector. In addition, P tac -Fl(5'-GG AGC ACT AGT CTG AAA TGAGCT GTT GAC AAT TAA TC-3') and P tac -R1 (5'-GG AGC ACT AGT TTT AAA CAT GAG CGG ATACAT ATT TGA A-3') primer amplified a 0.851 Kb expression cassette containing a tandem tac lac UV5 promoter, a multiple cloning site, a lacZa component and a TrrnB terminator sequence. The template DNA used to amplify the expression cassette was pMMB206 (ATCC37808). Afterwards, the expression cassette was cloned into the unique SpeI site designed in the pBE30 plasmid. The plasmid thus obtained was called pBE31C ( Figure 1 A; SEQ ID NO: 14).

[0103] Construction of pBE117

[0104] A truncated PspA1 gene (N-terminal region and proline-rich region, Figure 1 PspA1 was cloned into the TA vector (pTZ57R / T from Fermentas) and sequence verified using primers PSPAF1_FP (5'ATG AAT AAG AAA AAA ATG ATT TTAACA AGT CTA GCC 3') and PSPAF1_RP (5'CGA GAG AGA TCT AAA TTA AAA TGT CAA ATG TTCTTA ACA TGC TTT AAT TTT TAT TTT GGT GC 3'). This was designated pTZ-PspA1. The natural terminator sequence was included in the reverse primer PSPAF1_RP. The clade-restricted region was mapped to the obtained truncated PspA1 sequence to confirm that it belongs to family 1 of the PspA protein.

[0105] To express the truncated PspA1 in C. glutamicum, Ptac Promoter (SEQ ID NO:2) and the ribosome binding site (RBS) of the triosephosphate isomerase gene (SEQ ID NO:7) belonging to Corynebacterium, use primer-SDTICGR0949_FP5 (5'GAG CGA TGG ATC CTA GAA AGG TGT GTT TCA CCC ATG AAT AAG AAAAA 3') and PSPA2_2RP (5'TCA AAT GTT CTT AAC ATG CTT TAA TTT TTA TGG TGC AGG AGCTGG TTG 3') and pTZ-PspA 1 as template amplification psp A 1 gene and the complete box including RBS, natural signal peptide (SEQ ID NO:8), brachymemma PspA 1 gene, natural terminator (SEQ ID NO:10). RBS is contained in the forward primer SDTICGR0949_FP5. The rrn B terminator (SEQ ID NO: 13) region was amplified from internally available pBE31C and ligated to the gene encoding the truncated PspA1 using splicing by overlap extension (SOE) PCR. The rrnB gene was amplified using TER FP2 (5' ATG TTAAGA ACA TTT GAC ATT TTA ATT TCG GCA CTG GCC GTC GTT 3') and TER RP3 (5' GCG AT ATGG ATC CCA TGA GCG GAT ACA 3'). PSPA2 2RP and TER FP2 were designed to have an overlap of 17 bases. The amplicons pspA1 and rrnB were added in a 1:1 molar ratio and used as templates for SOE PCR with primers SDTICGR0949_FP5 (5'GAG CGA TGG ATC CTA GAA AGG TGT GTT TCA CCC ATG AAT AAG AAA AA 3') and TER_RP3 (5'GCG ATA TGG ATC CCA TGA GCG GAT ACA3'). Subsequently, the entire amplicon including the RBS, the native signal peptide (SEQ ID NO: 8), the truncated pspA1 gene, the native terminator (SEQ ID NO: 8), the rrnB terminator were digested with restriction enzymes attached to the forward (SDTICGR0949_FP5) and reverse primers (TER_RP3) and cloned into the expression vector pBE31C prepared for Corynebacterium. The resulting clone was named expression construct pBEH7 ( Figure 1C; SEQ ID NO: 15). Hereinafter, the expression vector and the truncated PspA1 are collectively referred to as the expression construct. The orientation of the insert was confirmed by PCR analysis ( Figure 1 D) The sequence of the truncated PspA1 gene and its expression cassette were confirmed by DNA sequencing.

[0106] Expression of truncated PspA1

[0107] The expression construct is electroporated in Corynebacterium glutamicum ATCC 13032, and selected on the LB flat plate with kanamycin as selection marker.Twenty recombinant Corynebacterium glutamicum bacterium colonies are selected, and analyzed by PCR.Five bacterium colonies are selected to be used for the constitutive expression of brachymemma pspA1.Recombinant bacterium colonies and Corynebacterium glutamicum ATCC 13032 (as negative control) are inoculated together in the very abundant substratum of 10ml of kanamycin with 25 μ g / ml final concentration, and are followed at 35 ℃ and shaken to hatch at 200rpm.After 16 hours, in the above-mentioned same substratum of 10ml, secondary inoculation is carried out, so that final OD is 0.1.Following shaking at 200rpm, culture is hatched at 35 ℃ for 18-20h.After 18 hours, the expression of brachymemma pspA1 in the culture supernatant is checked.The supernatant of 30 μ l is loaded on 12% SDS-PAGE and analyzes brachymemma pspA1 expression. A prominent band was observed at approximately 45 kDa.

[0108] Western analysis using N-terminal epitope-specific pspA polyclonal antibody (SantaCruz) confirmed the expression of truncated PspA1. The expression analysis of recombinant clone 5 was scaled up to 500 ml and the expression of truncated PspA1 was confirmed at least 3 times. Initially, truncated PspA1 was purified from shake flask experiments using type 1 CHT, and Capto Q impress reached a purity of nearly 99%. Subsequently, after confirming the consistent expression of truncated PspA1 in Corynebacterium glutamicum, the expression was scaled up to 1.5 L.

[0109] Purification and validation of truncated PspAl

[0110] 800 ml of culture supernatant obtained from upstream containing 1.6 L (0.66 mg / ml) of truncated PspA1 was dialyzed to 10 kDa and concentrated to 260 ml (1.92 mg / ml). 70 ml of this dialyzed concentrate was purified using type 1 CHT and Capto Q impress. The final recovery of truncated pspA1 was 162 mg / L.

[0111] MALDI MS / MS analysis of a gel plug containing purified truncated PspA1 from SDS-PAGE gave a clear hit score of 233 for pneumococcal surface protein A. The pspA protein with NCBI protein id ABY67187.1 showed 31% ( Figure 2 ) sequence coverage. The intact molecular weight analysis showed that the molecular weight of the expressed truncated PspA1 was 35.4 kDa. This mass matches the theoretical molecular weight of the truncated pspA1. The peak at 17725.4 is the peak of a molecule with a charge of 2, so in m / z, this peak appears at half the intact mass of the truncated pspA1. ( Figure 3 )

[0112] Example 2: Production of truncated PspA1

[0113] Corynebacterium glutamicum ATCC 13032 with an expression construct comprising a truncated PspA 1 (hereinafter referred to as PspA1) gene was regenerated from a source pool in LB medium. It was used to inoculate a fermentation tank (5L; CSTR). The parameters monitored during the production process were pH, DO, temperature (ΔT), carbon source, and metabolites. A short-fed batch fermentation of truncated PspA1 was performed using a feed strategy based on process automation technology (PAT). There was no induction-based control of the product (truncated PspA1) because it was a growth-related product. When harvested in semi-synthetic medium, the OD harvested was about 90 (OD 6 oo nm ). The cells were collected and washed with PBS and then disrupted in a French press.

[0114] Purification of truncated PspA1

[0115] From the 20-L fermentation batch, 16.2 L of spent culture medium was collected with a total protein concentration of 0.8 mg / mL. 2The 16.2L spent culture medium was concentrated to 2.6L (3.6mg / mL) by a cassette, and then 20mM potassium phosphate pH-6.8 was Dia filtered at a concentration of 3.2ms / cm. The 2.6L was divided into two batches, batch 1 with 1.4L and batch 2 with 1.2L, and further purified. 500ml of CHT I resin was filled in a HiScale 50 / 40 chromatographic column. The resin was washed with sterile distilled water and then balanced with 8 column volumes (CV) of 20mM potassium phosphate pH-6.8 (buffer A). 1400mL (3.6mg / mL) of spent culture medium concentrate (batch 1) was loaded onto the chromatographic column, and the flow-through was collected. The column was washed with 5 column volumes of buffer A. PspA1 was eluted with a step gradient using 250mM potassium phosphate pH-6.8 (buffer B). The step gradient involved 5CV of step-40% B, 5CV of step-80% B, and 3CV of 0.5M potassium phosphate buffer. The flow rate was maintained at 80 mL / min throughout the run. PspA1 was collected in fraction 1 of step-80% B with a fraction volume of 1250 mL. Figure 4 )

[0116] Capto Q Impress was used as the second chromatographic step for PspA1 purification. 250 ml of Capto Q Impress resin was filled in an XK 50 / 20 column. The resin was washed with sterile distilled water and then balanced with 5 column volumes (CV) of 20 mM potassium phosphate and 100 mM NaCl, pH-6.8 (buffer A). 1250 mL of CHT I fraction was diluted to 2300 mL with 20 mM potassium phosphate (pH-6.8), loaded onto the column and the flow-through was collected. The column was washed with 5 column volumes of buffer A. PspA1 was eluted with 12 CV of buffer B (20 mM potassium phosphate and 1 M NaCl, pH-6.2) with a linear gradient of 0-40% B, and the last step was 3 CV of 100% B. 250 mL of each fraction was collected. The flow rate was maintained at 40 mL / min. PspAl was collected with a linear gradient of 40% B, and the combined fraction volume was 1250 mL. ( Figure 5 )

[0117] Capto Q fractions 4, 5, 6, 7 and 8 were combined and concentrated / diafiltered with 20 mM potassium phosphate pH-6.8. The final recovery obtained from batch 1 was 100 mL of PspA1 at a concentration of 15.5 mg / mL protein (total PspA1 was 1550 mg). Batch 2 followed a similar process and obtained a final recovery of 70 mL of PspA1 at a concentration of 16 mg / mL for batch 2 (total PspA1 was 1120 mg). The purified PspA1 from batches 1 and 2 was 2670 mg from a 16.2 L batch (purified PspA1 yield of 164 mg / L). Figure 6 )

[0118] Example 3: Construction of pBE114K

[0119] The expression vector pRSET A (commercial vector from Invitrogen) was modified by removing the ampicillin resistance gene using Dral restriction digestion and ligating with the kanamycin encoding gene (obtained from pUC4 KIXX) digested with Smal. The modified vector was named pRSET-km. The truncated PspA1 was inserted into the P T7 The PspA1 gene was expressed in E. coli under the promoter (SEQ ID NO: 11). A short DNA fragment containing the natural terminator was included in the reverse primer for further amplification of PspA1. Subsequently, the complete truncated PspA gene and its natural terminator were amplified, digested with the restriction enzymes attached to the forward and reverse primers, and cloned into the pRSET-km vector. The resulting clone was named pBEH4k ( Fig.10 A). Hereinafter, the expression vector and the truncated PspA1 are collectively referred to as the expression construct. The expression construct pBEH4k ( Fig.10 B) The sequence of the truncated PspA1 gene and its expression cassette were confirmed by DNA sequencing.

[0120] Expression of truncated PspA1

[0121] pBEH4k was transformed into E. coli DH5α-T1R chemically competent cells (purchased from Invitrogen) and selected on LB plates with kanamycin as a selection marker. 40 recombinant E. coli colonies were picked and analyzed by PCR. All 40 colonies were selected for induced expression of truncated PspA1. The recombinant colonies were inoculated into 10 ml of very rich medium with 25 μg / ml final concentration of kanamycin together with E. coli (as a negative control) and incubated at 37°C with shaking at 200 rpm. In the mid-log phase, 1 mM IPTG was added to induce the expression of PspA1 in E. coli (pBel14k). After induction, the culture was incubated at 30°C with shaking at 200 rpm for 16 hours. After 16 hours, the expression of truncated PspA1 in the culture supernatant was checked. The cells were collected by centrifugation, lysed and loaded on 12% SDS-PAGE, and the expression of truncated PspA1 was analyzed. A prominent band was observed at approximately 65 kDa. Western analysis using an N-terminal epitope-specific PspA polyclonal antibody (SantaCruz) confirmed the expression of the truncated PspA1. Expression analysis confirmed that recombinant clone 29 was used to express the truncated PspA1 at least three times. The truncated PspA1 was initially purified from shake flask experiments using type 1 CHT and Capto Q impress.

[0122] Purification and validation of truncated PspAl

[0123] Take 40 grams (wet weight) of cell pellet from Escherichia coli (pBEH4k) and resuspend it in 400 ml of 20 mM potassium phosphate buffer pH-6.8 containing 1 mg / ml lysozyme and 1 mM PMSF. Use a high pressure homogenizer to lyse the cell suspension 3 times at 1000 psi. Dilute 400 mL of cell lysate with a total protein concentration of 4 mg / mL to 750 mL with 20 mM potassium phosphate buffer pH-6.8 and purify using CHT I resin, then Capto Q Impress as the second chromatography purification.

[0124] A HiScale 50 / 20 column was filled with 250 ml of CHT I resin. The resin was washed with sterile distilled water and then equilibrated with 5 column volumes (CV) of buffer A. 750 mL of diluted cell lysate was loaded onto the column and the flow-through was collected. The column was washed with 5 column volumes of buffer A. PspA1 was eluted with a step gradient using 250 mM potassium phosphate pH-6.8, cond-29.5 ms / cm (buffer B). The step gradient involved 5 CV of step-50% buffer B, 5 CV of step-80% buffer B and the column was eluted with 3 CV of 0.5 M potassium phosphate buffer pH-6.8, Cond-48 ms / cm (buffer C). The flow rate was maintained at 40 mL / min throughout the run. The peak fractions of PspA1 protein were manually collected and the elution fractions of 5, 6 and 7 of step-80% B were combined to a final volume of 350 mL ( Fig.11 ).

[0125] Capto Q Impress was used as the second chromatographic step for the purification of PspA1. 60 ml of Capto Q Impress resin was filled in a XK 26 / 20 column. The resin was washed with sterile distilled water and then equilibrated with 5 column volumes (CV) of 20 mM potassium phosphate and 100 mM NaCl, pH-6.8, cond-13.6 ms / cm (buffer A). 350 mL of CHT I fraction was diluted to 700 mL with 1 mM potassium phosphate (pH-6.8), loaded onto the column and the flow-through was collected. The column was washed with 5 column volumes of buffer A. PspA1 was eluted with a linear gradient of 10 CV of buffer B (20 mM potassium phosphate and 1 M NaCl, pH-6.2, cond-89 ms / cm) from 0 to 40%. Fraction B was collected manually, fractions 4 to 8, 10 and 11 were 60 mL, and fractions 9 and 12 were 100 mL ( Fig.12 ). 3CV of 100% B in the final step was collected, and 180 mL was collected as fraction 13. The flow rate was maintained at 10 mL / min. PspA1 protein was collected, and fraction 9, in which the linear gradient was 40%, was 100 mL.

[0126] 9 Capto Q fractions were collected and concentrated / diafiltered with 20 mM potassium phosphate pH-6.8. The final recovery obtained was 100 mL of PspAl from 400 mL of cell lysate at a concentration of 4 mg / mL, protein at a concentration of 5 mg / mL (total PspAl protein was 500 mg). The recovery % was 31.25.

[0127] MALDI MS / MS analysis of a gel plug containing purified truncated PspA1 from SDS-PAGE gave a clear hit score of 223 for pneumococcal surface protein A. The PspA protein with NCBI protein id WP 050210652.1 showed 39% ( Fig.13 ) sequence coverage.

[0128] The intact molecular weight analysis showed that the molecular weight of the expressed truncated PspA1 was 41.96 kDa. The intact mass analysis of the truncated PspA1 expressed in E. coli showed 41966 Da (41.9 kDa), which is consistent with the theoretical molecular weight of the truncated PspA1. The peak at 20982.7 Da is the peak of a molecule with a charge of 2, so in m / z, this peak appears at half the intact mass of the truncated PspA 1. ( Fig.14 ).

[0129] Example 4: Conjugation of individual pneumococcal polysaccharides to carrier proteins to form polysaccharide truncated PspAl conjugates

[0130] Activation of serotype 3 and binding to truncated PspA1

[0131] Size adjusted serotype 3 (6.0 mF PS at a concentration of 10 mg / mF) and CDAP (100 mg / mF (w / v) in acetonitrile) were mixed in a glass vial in a ratio of approximately 1:1 and stirred for 1 minute. The pH of pneumococcal polysaccharide serotype 3 was adjusted to 9.25 with 0.2 M triethylamine and stirred at room temperature (RT) for 3 minutes. Truncated PspA1 (4.0 mF at a concentration of 15.0 mg / mF) was added to the activated serotype 3 in a ratio of 1:1 (truncated PspA1: serotype 3).

[0132] The pH of the reaction was adjusted to about 9.05 with 0.2 M triethylamine and the reaction was continued for 5 hours at room temperature with stirring. Finally, the reaction was quenched by adding excess concentration of glycine.

[0133] The reaction mixture was diafiltered using a 100 kDa MWCO membrane and purified by size exclusion chromatography, where the solid line represents the polysaccharide, the dashed line represents the truncated PspAl, and the five hour reaction is represented by the dashed line in chromatogram A ( Figure 7 ). The fractions were analyzed by the SEC-MAFFS anthrone method and the fractions containing the conjugate were pooled and sterile filtered using a 0.2μ filter. From now on, this material is referred to as the monovalent conjugate bulk (serotype 3-truncated PspA1 conjugate).

[0134] Activation of serotype 6A and binding to truncated PspA1

[0135] Size adjusted serotype 6A (6.0 mF PS at a concentration of 10 mg / mF) and CDAP (100 mg / mF (w / v) in acetonitrile) were mixed in a glass vial in a ratio of approximately 1:1 and stirred for 1 minute. The pH of pneumococcal polysaccharide serotype 6A was adjusted to 9.25 with 0.2 M triethylamine and stirred at room temperature (RT) for 3 minutes. Truncated PspA1 (4.0 mF at a concentration of 15.0 mg / mF) was added to the activated serotype 6A in a ratio of 1:1 (truncated PspA1:serotype 6A).

[0136] The pH of the reaction was adjusted to about 9.05 with 0.2 M triethylamine and the reaction was continued for 5 hours at room temperature with stirring. Finally, the reaction was quenched by adding excess concentration of glycine.

[0137] The reaction mixture was diafiltered using a 100 kDa MWCO membrane and purified by size exclusion chromatography, where the solid line represents the polysaccharide, the dashed line represents the truncated PspAl, and the five hour reaction is represented by the dashed line in chromatogram B ( Figure 7 ). The fractions were analyzed by the SEC-MALLS anthrone method and the fractions containing the conjugate were pooled and sterile filtered using a 0.2μ filter. From now on, this material is referred to as the monovalent conjugate bulk (serotype 6A-truncated PspA1 conjugate). Activation of serotype 6B and binding to truncated PspA1

[0138] Activation of serotype 6B and binding to truncated PspA1

[0139] Size adjusted serotype 6B (6.0 mF PS at a concentration of 10 mg / mL) and CDAP (100 mg / mL (w / v) in acetonitrile) were mixed in a glass vial in a ratio of approximately 1:1 and stirred for 1 minute. The pH of pneumococcal polysaccharide serotype 6B was adjusted to 9.25 with 0.2 M triethylamine and stirred at room temperature (RT) for 3 minutes. Truncated PspA1 (4.0 mL of a concentration of 15.0 mg / mL) was added to the activated serotype 6B in a ratio of 1:1 (truncated PspA1:serotype 6B).

[0140] The pH of the reaction was adjusted to about 9.05 with 0.2 M triethylamine and the reaction was continued for 5 hours at room temperature with stirring. Finally, the reaction was quenched by adding excess concentration of glycine.

[0141] The reaction mixture was diafiltered using a 100 kDa MWCO membrane and purified by size exclusion chromatography, where the solid line represents the polysaccharide, the dashed line represents the truncated PspAl, and the five hour reaction is represented by the dashed line in chromatogram C ( Figure 7). The fractions were analyzed by the SEC-MALLS anthrone method and the fractions containing the conjugate were pooled and sterile filtered using a 0.2μ filter. From now on, this material is referred to as the monovalent conjugate bulk (serotype 6B-truncated PspA1 conjugate).

[0142] Example 5: Immunogenicity study of conjugate vaccine

[0143] Two formulations were prepared containing either 2.2 μg or 4.4 μg of serotypes 3, 6A, and 6B each bound to truncated PspA1 and 2.2 μg of each bound to CRM 197 Conjugates serotypes 1, 4, 5, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F and 33F. These conjugates were adsorbed onto aluminum hydrogels.

[0144] Rabbits weighing 1.5 to 2 kg were divided into groups of 7 animals and immunized with the above conjugate preparations. Serum samples were analyzed before and after immunization. The sera obtained from the immunized rabbits were analyzed in an indirect ELISA for the presence of polysaccharide-specific antibodies.

[0145] Serum antibody titers of immunized rabbits were assessed by indirect ELISA. Microtiter plates coated with specific polysaccharides were reacted with serum antibodies. Rabbit sera after the first and second administrations before immunization were used for analysis, where the Y axis represents antibody titers, which were derived using the reciprocal of the maximum dilution, so that the ELISA OD 450 Above the cut-off point. Serum antibody titers of rabbits before immunization were below the detection limit. The hollow bars represent the titers after the first dose of vaccine administration, while the solid black bars represent the antibody titers after the second dose of vaccine ( Figure 8 and 9 ). There was a dose-dependent increase in the titers of both the serotypes bound by truncated PspA1 and the serotypes bound by CRM197. The presence of the truncated PspA1 conjugate did not inhibit the titers of the polysaccharide bound by CRM197, and vice versa. This suggests that truncated PspA1 can be used as an alternative carrier protein for polysaccharide-protein conjugate vaccines. SEQUENCE LISTING <110> Bio-E Ltd. <120> Expression of pneumococcal surface protein A <130> pspA1 <160> 15 <170> PatentIn version 3.5 <210> 1 <211> 795 <212> DNA <213> Artificial <220> <223> Kanamycin resistance gene <400> 1 atgattgaac aagatggatt gcacgcaggt tctccggccg cttgggtgga gaggctattc 60 ggctatgact gggcacaaca gacaatcggc tgctctgatg ccgccgtgtt ccggctgtca 120 gcgcaggggc gcccggttct ttttgtcaag accgacctgt ccggtgccct gaatgaactg 180 caggacgagg cagcgcggct atcgtggctg gccacgacgg gcgttccttg cgcagctgtg 240 ctcgacgttg tcactgaagc gggaagggac tggctgctat tgggcgaagt gccggggcag 300 gatctcctgt catctcacct tgctcctgcc gagaaagtat ccatcatggc tgatgcaatg 360 cggcggctgc atacgcttga tccggctacc tgcccattcg accaccaagc gaaacatcgc 420 atcgagcgag cacgtactcg ggatggagcc gggtcttgtc gatcagatga tctggacgaa 480 gagcatcagg ggctcgcgcc agccgaactg ttcgccaggc tcaaggcgcg catgcccgac 540 ggcgaggatc tcgtcgtgac ccatggcgat gcctgcttgc cgaatatcat ggtggaaaat 600 ggccgctttt ctggattcat cgactgtggc cggctgggtg tggcggaccg ctatcaggac 660 atagcgttgg ctacccgtga tattgctgaa gagcttggcg gcgaatgggc tgaccgcttc 720 ctcgtgcttt acggtatcgc cgctcccgat tcgcagcgca tcgccttcta tcgccttctt 780 gacgagttct tctga 795 <210> 2 <211> 30 <212> DNA <213> artificial <220> <223> hybrid promoter <400> 2 ttgacaatta atcatcggct cgtataatgt 30 <210> 3 <211> 310 <212> PRT <213> Streptococcus pneumoniae <400> 3 Glu Asp Ala Pro Val Ala Asn Gln Ser Lys Ala Glu Lys Asp Tyr Asp 1 5 10 15 Ala Ala Lys Arg Asp Ala Glu Asn Ala Lys Lys Ala Leu Glu Asp Ala 20 25 30 Lys Arg Ala Gln Lys Lys Tyr Lys Asp Asp Gln Lys Ile Thr Glu Glu 35 40 45 Lys Ala Glu Glu Glu Lys Lys Ala Ser Gln Glu Gln Gln Lys Ala Asn 50 55 60 Leu Asp Tyr Gln Gln Lys Leu Arg Lys Tyr Ile Asn Glu Lys Asp Ser 65 70 75 80 Lys Lys Arg Ser Met Leu Gln Lys Glu Met Glu Glu Ala Glu Arg Lys 85 90 95 Asp Lys Glu Lys Gln Ala Glu Phe Lys Lys Ile Arg Glu Lys Val Ile 100 105 110 Pro Ser Ala Glu Glu Leu Thr Glu Thr Arg Arg Lys Ala Glu Glu Ala 115 120 125 Glu Ala Lys Glu Pro Glu Leu Thr Lys Lys Val Lys Glu Ala Glu Glu 130 135 140 Lys Val Thr Glu Ala Lys Gln Lys Leu Asp Ala Glu Arg Ala Lys Glu 145 150 155 160 Val Ala Leu Gln Ala Lys Ile Ala Glu Leu Glu Asn Glu Val His Arg 165 170 175 Leu Glu Thr Lys Leu Lys Glu Ile Asp Glu Ser Asp Ser Glu Asp Tyr 180 185 190 Val Lys Glu Gly Leu Arg Ala Pro Leu Gln Ser Glu Leu Asp Ala Lys 195 200 205 Gln Ala Lys Leu Ser Lys Leu Glu Glu Leu Ser Asp Lys Ile Asp Glu 210 215 220 Leu Asp Ala Glu Ile Ala Lys Leu Glu Lys Asp Val Glu Asp Phe Lys 225 230 235 240 Asn Ser Asp Gly Glu Tyr Ser Ala Leu Tyr Leu Glu Ala Ala Glu Lys 245 250 255 Asp Leu Ala Ala Lys Lys Ala Glu Leu Glu Lys Thr Glu Ala Asp Leu 260 265 270 Light Light Ala Val Asp Glu Pro Glu Light Pro Ala Pro Ala Pro Glu Thr 275 280 285 Pro Ala Pro Glu Ala Pro Ala Glu Gln Pro Lys Pro Ala Pro Ala Pro 290 295 300 Gln Pro Ala Pro Ala Pro 305 310 <210> 4 <211> 369 <212> PRT <213> pneumococcal bacteria <400> 4 Glu Asp Ala Pro Val Ala Asn Gln Ser Lys Ala Glu Lys Asp Tyr Asp 1 5 10 15 Ala Ala Lys Arg Asp Ala Glu Asn Ala Lys Lys Ala Leu Glu Asp Ala 20 25 30 Lys Arg Ala Gln Lys Lys Tyr Lys Asp Asp Gln Lys Ile Thr Glu Glu 35 40 45 Light Ala Glu Glu Glu Light Light Ala Ser Gln Glu Gln Gln Light Ala Asn 50 55 60 Leu Asp Tyr Gln Gln Lys Leu Arg Lys Tyr Ile Asn Glu Lys Asp Ser 65 70 75 80 Lys Lys Arg Ser Met Leu Gln Lys Glu Met Glu Glu Ala Glu Arg Lys 85 90 95 Asp Lys Glu Lys Gln Ala Glu Phe Lys Lys Ile Arg Glu Lys Val Ile 100 105 110 Pro Ser Ala Glu Glu Leu Thr Glu Thr Arg Arg Lys Ala Glu Glu Ala 115 120 125 Glu Ala Lys Glu Pro Glu Leu Thr Lys Lys Val Lys Glu Ala Glu Glu 130 135 140 Lys Val Thr Glu Ala Lys Gln Lys Leu Asp Ala Glu Arg Ala Lys Glu 145 150 155 160 Val Ala Leu Gln Ala Lys Ile Ala Glu Leu Glu Asn Glu Val His Arg 165 170 175 Leu Glu Thr Lys Leu Lys Glu Ile Asp Glu Ser Asp Ser Glu Asp Tyr 180 185 190 Val Lys Glu Gly Leu Arg Ala Pro Leu Gln Ser Glu Leu Asp Ala Lys 195 200 205 Gln Ala Lys Leu Ser Lys Leu Glu Glu Leu Ser Asp Lys Ile Asp Glu 210 215 220 Leu Asp Ala Glu Ile Ala Lys Leu Glu Lys Asp Val Glu Asp Phe Lys 225 230 235 240 Asn Ser Asp Gly Glu Tyr Ser Ala Leu Tyr Leu Glu Ala Ala Glu Lys 245 250 255 Asp Leu Ala Ala Lys Lys Ala Glu Leu Glu Lys Thr Glu Ala Asp Leu 260 265 270 Lys Lys Ala Val Asp Glu Pro Glu Lys Pro Ala Pro Ala Pro Glu Thr 275 280 285 Pro Ala Pro Glu Ala Pro Ala Glu Gln Pro Lys Pro Ala Pro Ala Pro 290 295 300 Gln Pro Ala Pro Ala Pro Lys Pro Glu Lys Pro Ala Glu Gln Pro Lys 305 310 315 320 Pro Glu Lys Thr Asp Asp Gln Gln Ala Glu Glu Asp Tyr Ala Arg Arg 325 330 335 Ser Glu Glu Glu Tyr Asn Arg Leu Thr Gln Gln Gln Pro Pro Lys Ala 340 345 350 Glu Lys Pro Ala Pro Ala Pro Lys Pro Glu Gln Pro Ala Pro Ala Pro 355 360 365 Lys <210> 5 <211> 933 <212> DNA <213> Streptococcus pneumoniae <400> 5 gagacgctc ctgtagctaa ccagtctaaa gctgagaaag actatgatgc agcgaagaga 60 gatgctgaga atgcgaaaaa agctttagag gacgcaaac gtgcgcagaa aaaataag 120 gagaaactga gagaaagcg gagaaa aaaagctc txaactc 180 CAAAAAAGCAATCTGACTTA CAAAAAAG TGAGAAT ATTACK AAAAGACTCC 240 aaaaaaagat ctatgctca gaaagaatg gaggaagctg aggaaaga taggaaaaaa 300 caagcagaat taggaaag gtgattccta gcgcggaag gttacagag 360 actagacgaa aagcagaga ggctgaagca aaagaaccag agctacta aaagtaaaa 420 gaagctgagg aaaagttac tgaagccaaa caaaattgg atgctgaacg tgctaagaa 480 gttgctctc aagccaaaat cgctgagttg gaaaatgaag ttcatagact agaaacaaaa 540 ctcaagaga ttgatgaatc tgactcagaa gattgtta aagaaggtct ccgtgctcct 600 cttcaatctg aattggatgc taagcaagct aaactatca aacttgaga gttgagtgat 660 aagattgatg agttagacgc tgaattgca aaacttgaa aagatgtaga agatttcaa 720 aactcagacg gtgaatattc tgcattatat cttgaagctg cagaaaaaga tttagctgct 780 aaaaaagctg aattagaaaa aactgaagct gacctcaaga aagcagttga tgagccagaa 840 aaaccagctc cagctccaga aactccagcc ccagaagcac cagctgaaca accaaaacca 900 gcgccggctc ctcaaccagc tcctgcacca taa 933 <210> 6 <211> 1110 <212> DNA <213> Streptococcus pneumoniae <400> 6 gaagacgctc ctgtagctaa ccagtctaaa gctgagaaag actatgatgc agcgaagaga 60 gatgctgaga atgcgaaaaa agctttagag gacgcaaaac gtgcgcagaa aaaatataag 120 gatgatcaga agataactga ggagaaagcg gaagaagaaa aaaaagcttc tcaagagcaa 180 caaaaagcaa atctggacta tcaacaaaag ttgaggaaat atattaacga aaaagactcc 240 aaaaaaagat ctatgcttca gaaagaaatg gaggaagctg agagaaaaga taaggaaaaa 300 caagcagaat ttaagaagat tagagaaaag gtgattccta gcgcggaaga gttaacagag 360 actagacgaa aagcagaaga ggctgaagca aaagaaccag agcttactaa aaaagtaaaa 420 gaagctgagg aaaaagttac tgaagccaaa caaaaattgg atgctgaacg tgctaaagaa 480 gttgctcttc aagccaaaat cgctgagttg gaaaatgaag ttcatagact agaaacaaaa 540 ctcaaagaga ttgatgaatc tgactcagaa gattatgtta aagaaggtct ccgtgctcct 600 cttcaatctg aattggatgc taagcaagct aaactatcaa aacttgaaga gttgagtgat 660 aagattgatg agttagacgc tgaaattgca aaacttgaaa aagatgtaga agatttcaaa 720 aactcagacg gtgaatattc tgcattat cttgaagctg cagaaaaaga tttagctgct 780 aaaaaagctg aattagaaaa aactgaagct gacctcaaga aagcagttga tgagccagaa 840 aaaccagctc cagctccaga aactccagcc ccagaagcac cagctgaaca accaaaacca 900 gcgccggctc ctcaaccagc tccgcacca aaaccagaga agccagctga acaaccaaaa 960 ccagaaaaaa cagatgatca acaagctgaa gaagactatg ctcgtagatc agaagaagaa 1020 tataaccgct tgactcaaca gcaaccgcca aaagcagaaa aaccagctcc cgcaccaaaa 1080 ccagagcaac cagctcctgc accaaaataa 1110 <210> 7 <211> 20 <212> DNA <213> Corynebacterium glutamicum <400> 7 tagaaaggtg tgtttcaccc 20 <210> 8 <211> 93 <212> DNA <213> Streptococcus pneumoniae <400> 8 atgaataaga aaaaaatgat tttaacaagt ctagccagcg tcgctatctt aggggctggt 60 tttgttgcgt cttcgcctac tgttgtaaga gca 93 <210> 9 <211> 31 <212> PRT <213> Streptococcus pneumoniae <400> 9 Met Asn Lys Lys Lys Met Ile Leu Thr Ser Leu Ala Ser Val Ala Ile 1 5 10 15 Leu Gly Ala Gly Phe Val Ala Ser Ser Pro Thr Val Val Arg Ala 20 25 30 <210> 10 <211> 38 <212> DNA <213> Streptococcus pneumoniae <400> 10 aaattaaagc atgttaagaa catttgacat tttaattt 38 <210> 11 <211> 19 <212> DNA <213> Artificial <220> <223> PT7 promoter <400> 11 taatacgact cactatagg 19 <210> 12 <211> 1854 <212> DNA <213> Corynebacterium diphtheriae <400> 12 gaattcggtg aggttatggc ggagggttgc gaggtctagg agaacagagg aagtcatgct 60 ttgaagcata taagctgccc tgcccctcaa ggttttcttc aagtgaggtt ttatctaact 120 gcctaacggc aggggaaccg tatattgctt acggtatgag accccttaaa cgtccggata 180 gtcaccgctc ttctttagct ccgcgacatg cctagcaacc gtggcgcgag agactcctac 240 ctctgcccct atttcagccc acgtgggaac tgtccctgtc tggaaatact gatcgttcac 300 catttggcta atacgggact tcgtagatcg tccttgagcc tttttcttac ggtgcgtctt 360 ttcaagcttc gacctttgtg cttgcgcata tttgccctcg gggtctgttt tccagcgttg 420 tgcggctttt tgtccgcctc tgcgtcccat cgtggccaag gctttccgct cgctgctggt 480 ggctttacct ggtgcgttag agccgctgta ggtctcgctc ttggattggg cgacataccc 540 gcgcacgcgc cttgccatgg tttggcggtc gcgcatgggt ggcatctcgt tgtcgcggcc 600 tgcaccgccg tgggtgtgtg cgacgttgta ggcgtgctca taggcgtcga tgattgctgc 660 gtctgtcagg cgttggcctt gctggcgcaa gcggtggcca gtcttaagcg catgtctaaa 720 ggctgtttcg tcgcgtgctg cggttccttg gacaatccag agcacacgca caccgtcgat 780 aagttccggg tcatactggt cgagaccacc ggcgatttcc gcgtctacgt cctgggcgag 840 tgctttgaat gcttgggctt cttcacggcg ggtcttgacc gcgttgataa gttcgcggcc 900 agagctgaat tgctggcgtg gggtggggtt gaactggtcg tgtcctgcca tatcccttac 960 ctgctttatc aagtctccaa ggcgcatcac ccggttgtgc tgcctatacc aacgataagc ggtaggggct ttgcctgtgt agaacggggtt gcggctaaag cggtgggaaa agtgcgggtc 1080 atggtctaaa agctcaccca gcacacgcgt ggttgctgca agaagcttca tctgcgcaga tttaccgtta cggtcagcgt agacagggtc aatagccat atgaactggg ctttgccgtt agttgggtta atacccaccc aggctggccc gacgctatga gtaatcagtg agcgcaccac 1260. gtcgcggacg tacgggttta agtctgcggg gtcaccgcct gcggtaccta cttggtcaac 1320 gtctacgacc aggacggcgg cgtactgctt ggtggtgagc atggcgtact cgcaccgtcc 1380 taaagcatca gtctcgaagc gatacatacg cggcgagttc gtgccgtcag cgttgcgtcg 1440 ataggccttt ttaaagtctc gtgtgactga accgtggagt acatcgcggc ctagatgatc 1500 gcgtaaaagg tcgcggtcac tggcagatgc tggggtgttg tccagtccac cacggtcgcg 1560 ctcgacgcgg gtaggtgttt tagtgtgcgc attctgcgca tgagtctgta aactcatgac 1620 cgtgatttct cccaggtgtg tgctgggtga taagcgaaag tcatcgggtt gccgcccggt 1680 ggctttcttc gtttttcatt gtctttccct gactctaaat gacaccggtg ttatttacta 1740 gccatgacac gcgaaaaata tgccttttac ctgcggttac gtatggctag acatatggca 1800 agctatacgt aaccgcgttt cagctgcaca gggctgtctg cgcagattta ccat 1854 <210> 13 <211> 627 <212> DNA <213> Artificial <220> <223> rrnB terminator <400> 13 cggcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt acccaactta 60 atcgccttgc agcacatccc cctttcgcca gctggctaat agcgaagagg cccgcaccga 120 tcgcccttcc caacagttgc gcagcctgaa tggcgatggc tgttttggcg gatgagagaa 180 gattttcagc ctgatacaga ttaaatcaga acgcagaagc ggtctgataa aacagaattt 240 gcctggcggc agtagcgcgg tggtcccacc tgaccccatg ccgaactcag aagtgaaacg 300 ccgtagcgcc gatggtagtg tggggtctcc ccatgcgaga gtagggaact gccaggcatc 360 aaataaaacg aaaggctcag tcgaaagact gggcctttcg ttttatctgt tgtttgtcgg 420 tgaacgctct cctgagtagg acaaatccgc cgggagcgga tttgaacgtt gcgaagcaac 480 ggcccggagg gtggcgggca ggacgcccgc cataaactgc caggcatcaa attaagcaga 540 aggccatcct gacggatggc ctttttgcgt ttctacaaac tcttttgttt atttttctaa 600 atacattcaa atatgtatcc gctcatg 627 <210> 14 <211> 3784 <212> DNA <213> Artificial <220> <223> pBE31C <400> 14 actagtctga aatgagctgt tgacaattaa tcatcggctc gtataatgtg tggaattgtg 60 agcggataac aatttcacac aggaaactag gcaccccagg ctttacactt tatgcttccg 120 gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac 180 catgattacg aattcccggg gatccgtcga cctgcagcca agcttggcac tggccgtcgt 240 tttacaacgt cgtgactggg aaaaccctgg cgttacccaa cttaatcgcc ttgcagcaca 300 tccccctttc gccagctggc taatagcgaa gaggcccgca ccgatcgccc ttcccaacag 360 ttgcgcagcc tgaatggcga tggctgtttt ggcggatgag agaagatttt cagcctgata 420 cagattaaat cagaacgcag aagcggtctg ataaaacaga atttgcctgg cggcagtagc 480 gcggtggtcc cacctgaccc catgccgaac tcagaagtga aacgccgtag cgccgatggt 540 agtgtggggt ctccccatgc gagagtaggg aactgccagg catcaaataa aacgaaaggc 600 tcagtcgaaa gactgggcct ttcgttttat ctgttgtttg tcggtgaacg ctctcctgag 660 taggacaaat ccgccgggag cggatttgaa cgttgcgaag caacggcccg gagggtggcg 720 ggcaggacgc ccgccataaa ctgccaggca tcaaattaag cagaaggcca tcctgacgga 780 tggccttttt gcgtttctac aaactctttt gtttattttt ctaaatacat tcaaatatgt 840 atccgctcat gtttaaaact agtccgaggt cccgggggtt gggcgtcgct tggtcggtca 900 tttcgaaccc cagagtcccg ctcagaagaa ctcgtcaaga aggcgataga aggcgatgcg 960 ctgcgaatcg ggagcggcga taccgtaaag cacgaggaag cggtcagccc attcgccgcc 1020 aagctcttca gcaatatcac gggtagccaa cgctatgtcc tgatagcggt ccgccacacc 1080 cagccggcca cagtcgatga atccagaaaa gcggccattt tccaccatga tattcggcaa 1140 gcaggcatcg ccatgggtca cgacgagatc ctcgccgtcg ggcatgcgcg ccttgagcct 1200 ggcgaacagt tcggctggcg cgagcccctg atgctcttcg tccagatcat ctgatcgaca 1260 agacccggct ccatcccgag tacgtgctcg ctcgatgcga tgtttcgctt ggtggtcgaa 1320 tgggcaggta gccggatcaa gcgtatgcag ccgccgcatt gcatcagcca tgatggatac 1380 tttctcggca ggagcaaggt gagatgacag gagatcctgc cccggcactt cgcccaatag 1440 cagccagtcc cttcccgctt cagtgacaac gtcgagcaca gctgcgcaag gaacgcccgt 1500 cgtggccagc cacgatagcc gcgctgcctc gtcctgcagt tcattcaggg caccggacag 1560 gtcggtcttg acaaaaaga ccggggcgccc ctgcgctgac agccggaca cggcggcatc 1620 agccagccg attgtctgtt gtgcccagtc agccgat agcctctcca cccaagcggc 1680. cggagaacct gcgtgcaatc catcttgttc aatcatgcga aacgatcctc atcctgtctc ttgatcagat cttgatcccc tgcgccatca gatccttggc ggcaagaaag ccatccagtt tactttgcag ggcttcccaa ccttaccaga gggcgcccca gctggcaatt ccggttcgct tgctgtccat aaaaccgccc buy tcgccatcc gggaccttct buy 1920 aattcggtga ggttatggcg gagggttgcg aggtctagga gaacagagga agtcatgctt tgaagcatat aagctgccct gcccctcaag gttttcttca agtgaggttt tatctaactg cctaacggca ggggaaccgt atattgctta cggtatgaga ccccttaac gtccggatag tcaccgctct tctttagctc cgcgacatgc ctagcaaccg tggcgcgaga gactcctacc tctgccccta tttcagccca cgtgggaact gtccctgtct ggaaatactg atcgttcacc atttggctaa tacgggactt cgtagatcgt ccttgagcct ttttcttacg gtgcgtcttt 2280 tcaagcttcg acctttgtgc ttgcgcatat ttgccctcgg ggtctgtttt ccagcgttgt 2340 gcggcttttt gtccgcctct gcgtcccatc gtggccaagg ctttccgctc gctgctggtg 2400 gctttacctg gtgcgttaga gccgctgtag gtctcgctct tggattgggc gacatacccg 2460 cgcacgcgcc ttgccatggt ttggcggtcg cgcatgggtg gcatctcgtt gtcgcggcct 2520 gcaccgccgt gggtgtgtgc gacgttgtag gcgtgctcat aggcgtcgat gattgctgcg 2580 tctgtcaggc gttggccttg ctggcgcaag cggtggccag tcttaagcgc atgtctaaag 2640 gctgtttcgt cgcgtgctgc ggttccttgg acaatccaga gcacacgcac accgtcgata 2700 agttccgggt catactggtc gagaccaccg gcgatttccg cgtctacgtc ctgggcgagt 2760 gctttgaatg cttgggcttc ttcacggcgg gtcttgaccg cgttgataag ttcgcggcca 2820 gagctgaatt gctggcgtgg ggtggggttg aactggtcgt gtcctgccat atcccttacc 2880 tgctttatca agtctccaag gcgcatcacc cggttgtgct gcctatacca acgataagcg 2940 gtaggggctt tgcctgtgta gaacgggttg cggctaaagc ggtgggaaaa gtgcgggtca 3000 tggtctaaaa gctcacccag cacacgcgtg gttgctgcaa gaagcttcat ctgcgcagat 3060 ttaccgttac ggtcagcgta gacagggtca ataagccata tgaactgggc tttgccgtta 3120 gttgggttaa tacccaccca ggctggcccg acgctatgag taatcagtga gcgcaccacg 3180 tcgcggacgt acgggtttaa gtctgcgggg tcaccgcctg cggtacctac ttggtcaacg 3240 tctacgacca ggacggcggc gtactgcttg gtggtgagca tggcgtactc gcaccgtcct 3300 aaagcatcag tctcgaagcg atacatacgc ggcgagttcg tgccgtcagc gttgcgtcga 3360 taggcctttt taaagtctcg tgtgactgaa ccgtggagta catcgcggcc tagatgatcg 3420 cgtaaaaggt cgcggtcact ggcagatgct ggggtgttgt ccagtccacc acggtcgcgc 3480 tcgacgcggg taggtgtttt agtgtgcgca ttctgcgcat gagtctgtaa actcatgacc 3540 gtgatttctc ccaggtgtgt gctgggtgat aagcgaaagt catcgggttg ccgcccggtg 3600 gctttcttcg tttttcattg tctttccctg actctaaatg acaccggtgt tatttactag 3660 ccatgacacg cgaaaaatat gccttttacc tgcggttacg tatggctaga catatggcaa 3720 gctatacgta accgcgtttc agctgcacag ggctgtctgc gcagatttac catagatcta 3780 ctag 3784 <210> 15 <211> 5501 <212> DNA <213> Artificial <220> <223> pBE117 <400> 15 actagtctga aatgagctgt tgacaattaa tcatcggctc gtataatgtg tggaattgtg 60 agcggataac aatttcacac aggaaactag gcaccccagg ctttacactt tatgcttccg 120 gctcgtatgt tgtgtggaat tgtgagcgga taacaatttc acacaggaaa cagctatgac 180 catgattacg aattcccggg gatcctagaa aggtgtgttt cacccatgaa taagaaaaaa 240 atgattttaa caagtctagc cagcgtcgct atcttagggg ctggttttgt tgcgtcttcg 300 cctactgttg taagagcaga agacgctcct gtagctaacc agtctaaagc tgagaaagac 360 tatgatgcag cgaagagaga tgctgagaat gcgaaaaaag ctttagagga cgcaaaacgt 420 gcgcagaaaa aatataagga tgatcagaag ataactgagg agaaagcgga agaagaaaaa 480 aaagcttctc aagagcaaca aaaagcaaat ctggactatc aacaaaagtt gaggaaatat 540 attaacgaaa aagactccaa aaaaagatct atgcttcaga aagaaatgga ggaagctgag 600 agaaaagata aggaaaaaca agcagaattt aagaagatta gagaaaaggt gattcctagc 660 gcggaagagt taacagagac tagacgaaaa gcagaagagg ctgaagcaaa agaaccagag 720 cttactaaaa aagtaaaaga agctgaggaa aaagttactg aagccaaaca aaaattggat 780 gctgaacgtg ctaaagaagt tgctcttcaa gccaaaatcg ctgagttgga aaatgaagtt 840 catagactag aaacaaaact caaagagatt gatgaatctg actcagaaga ttatgttaaa 900 gaaggtctcc gtgctcctct tcaatctgaa ttggatgcta agcaagctaa actatcaaaa 960 cttgaagagt tgagtgataa gattgatgag ttagacgctg aaattgcaaa acttgaaaaa 1020 gatgtagaag atttcaaaaa ctcagacggt gaatattctg cattatatct tgaagctgca 1080 gaaaaagatt tagctgctaa aaaagctgaa ttagaaaaaa ctgaagctga cctcaagaaa 1140 gcagttgatg agccagaaaa accagctcca gctccagaaa ctccagcccc agaagcacca 1200 gctgaacaac caaaaccagc gccggctcct caaccagctc ctgcaccata aaaattaaag 1260 catgttaaga acatttgaca ttttaatttc ggcactggcc gtcgttttac aacgtcgtga 1320 ctgggaaaac cctggcgtta cccaacttaa tcgccttgca gcacatcccc ctttcgccag 1380 ctggctaata gcgaagaggc ccgcaccgat cgcccttccc aacagttgcg cagcctgaat 1440 ggcgatggct gttttggcgg atgagagaag attttcagcc tgatacagat taaatcagaa 1500 cgcagaagcg gtctgataaa acagaatttg cctggcggca gtagcgcggt ggtcccacct 1560 gaccccatgc cgaactcaga agtgaaacgc cgtagcgccg atggtagtgt ggggtctccc 1620 catgcgagag tagggaactg ccaggcatca aataaaacga aaggctcagt cgaaagactg 1680 ggcctttcgt tttatctgtt gtttgtcggt gaacgctctc ctgagtagga caaatccgcc 1740 gggagcggat ttgaacgttg cgaagcaacg gcccggaggg tggcgggcag gacgcccgcc 1800 ataaactgcc aggcatcaaa ttaagcagaa ggccatcctg acggatggcc tttttgcgtt 1860 tctacaaact cttttgttta tttttctaaa tacattcaaa tatgtatccg ctcatgggat 1920 ccgtcgacct gcagccaagc ttggcactgg ccgtcgtttt acaacgtcgt gactgggaaa 1980 acctggcgt tacccaactt aatcgccttg cagcacatcc cccttcgcc agctggctaa 2040 tagcgaagag gcccgcaccg atcgcccttc ccaacagttg cgcagcctga atggcgatgg 2100 ctgttttggc ggatgagaga agattttcag cctgatacag attaaatcag aacgcagaag 2160 cggtctgata aaacagaatt tgcctggcgg cagtagcgcg gtggtcccac ctgaccccat 2220 gccgaactca gaagtgaaac gccgtagcgc cgatggtagt gtggggtctc cccatgcgag 2280 agtagggaac tgccaggcat caaataaaac gaaaggctca gtcgaaagac tgggcctttc 2340 gtttatctg ttgtttgtcg gtgaacgctc tcctgagtag gacaaatccg ccgggagcgg 2400 atttgaacgt tgcgaagcaa cggcccggag ggtggcgggc aggacgccg cataaactg 2460 ccaggcatca aattaagcag aaggccatcc tgacggatgg cctttttgcg tttctacaaa 2520 ctctttgtt tatttttcta aatacattca aatatgtatc cgctcatgtt taaaactagt 2580 ccgaggtccc gggggttggg cgtcgcttg tcggtcattt cgaaccccag agtcccgctc 2640 agaagaactc gtcaagaagg cgatagaagg cgatgcgctg cgaatcgggga gcggcgatac 2700 cgtaaagcac gaggaagcgg tcagcccatt cgccgccaag ctcttcagca atatcacggg 2760 tagccaacgc tatgtcctga tagcggtccg ccacacccag ccggccacag tcgatgaatc 2820 cagaaaagcg gccattttcc accatgatat tcggcaagca ggcatcgcca tgggtcacga 2880 cgagatcctc gccgtcgggc atgcgcgcct tgagcctggc gaacagttcg gctggcgcga 2940 gccctgatg ctcttcgtcc agatcatctg atcgacaaga cccggctcca tcccgagtac 3000 gtgctcgctc gatgcgatgt ttcgcttggt ggtcgaatgg gcaggtagcc ggatcaagcg 3060 tatgcagccg ccgcattgca tcagccatga tggatacttt ctcggcagga gcaaggtgag 3120 atgacaggag atcctgcccc ggcacttcgc ccaatagcag ccagtccctt cccgcttcag 3180 tgacaacgtc gagcacagct gcgcaaggaa cgcccgtcgt ggccagccac gatagccgcg 3240 ctgcctcgtc ctgcagttca ttcagggcac cggacaggtc ggtcttgaca aaaagaaccg 3300 ggcgcccctg cgctgacagc cggaacacgg cggcatcaga gcagccgatt gtctgttgtg 3360 cccagtcata gccgaatagc ctctccaccc aagcggccgg agaacctgcg tgcaatccat 3420 cttgttcaat catgcgaaac gatcctcatc ctgtctcttg atcagatctt gatcccctgc 3480 gccatcagat ccttggcggc aagaaagcca tccagtttac tttgcagggc ttcccaacct 3540 taccagaggg cgccccagct ggcaattccg gttcgcttgc tgtccataaa accgcccagt 3600 ctagctatcg ccatcccggg accttctagt agatctgaat tcggtgaggt tatggcggag 3660 ggttgcgagg tctaggagaa cagaggaagt catgctttga agcatataag ctgccctgcc 3720 cctcaaggtt ttcttcaagt gaggttttat ctaactgcct aacggcaggg gaaccgtata 3780 ttgcttacgg tatgagaccc cttaaacgtc cggatagtca ccgctcttct ttagctccgc 3840 gacatgccta gcaaccgtgg cgcgagagac tcctacctct gcccctattt cagcccacgt 3900 gggaactgtc cctgtctgga aatactgatc gttcaccatt tggctaatac gggacttcgt 3960 agatcgtcct tgagcctttt tcttacggtg cgtcttttca agcttcgacc tttgtgcttg 4020 cgcatatttg ccctcggggt ctgttttcca gcgttgtgcg gctttttgtc cgcctctgcg 4080 tcccatcgtg gccaaggctt tccgctcgct gctggtggct ttacctggtg cgttagagcc 4140 gctgtaggtc tcgctcttgg attgggcgac atacccgcgc acgcgccttg ccatggtttg 4200 gcggtcgcgc atgggtggca tctcgttgtc gcggcctgca ccgccgtggg tgtgtgcgac 4260 gttgtaggcg tgctcatagg cgtcgatgat tgctgcgtct gtcaggcgtt ggccttgctg 4320 gcgcaagcgg tggccagtct taagcgcatg tctaaaggct gtttcgtcgc gtgctgcggt 4380 tccttggaca atccagagca cacgcacacc gtcgataagt tccgggtcat actggtcgag 4440 accaccggcg atttccgcgt ctacgtcctg ggcgagtgct ttgaatgctt gggcttcttc 4500 acggcgggtc ttgaccgcgt tgataagttc gcggccagag ctgaattgct ggcgtggggt 4560 ggggttgaac tggtcgtgtc ctgccatatc ccttacctgc tttatcaagt ctccaaggcg 4620 catcacccgg ttgtgctgcc tataccaacg ataagcggta ggggctttgc ctgtgtagaa 4680 cgggttgcgg ctaaagcggt gggaaaagtg cgggtcatgg tctaaaagct cacccagcac 4740 acgcgtggtt gctccaagaa gcttcatctg cgcagattta ccgttacggt cagcgtagac 4800 agggtcaata agccatatga actgggcttt gccgttagtt gggttaatac ccacccaggc 4860 tggcccgacg ctatgagtaa tcagtgagcg caccacgtcg cggacgtacg ggtttaagtc 4920 tgcggggtca ccgcctgcgg tacctacttg gtcaacgtct acgaccagga cggcggcgta 4980 ctgcttggtg gtgagcatgg cgtactcgca ccgtcctaaa gcatcagtct cgaagcgata 5040 catacgcggc gagttcgtgc cgtcagcgtt gcgtcgatag gcctttttaa agtctcgtgt 5100 gactgaaccg tggagtacat cgcggcctag atgatcgcgt aaaaggtcgc ggtcactggc 5160 agatgctggg gtgttgtcca gtccaccacg gtcgcgctcg acgcgggtag gtgttttagt 5220 gtgcgcattc tgcgcatgag tctgtaaact catgaccgtg atttctccca ggtgtgtgct 5280 gggtgataag cgaaagtcat cgggttgccg cccggtggct ttcttcgttt ttcattgtct 5340 ttccctgact ctaaatgaca ccggtgttat ttactagcca tgacacgcga aaaatatgcc 5400 ttttacctgc ggttacgtat ggctagacat atggcaagct atacgtaacc gcgtttcagc 5460 tgcacagggc tgtctgcgca gatttaccat agatctacta g 5501

Claims

1. An expression construct for high-level secretory expression of truncated PspA1 (Pneumococcal surface protein A1) in Corynebacterium glutamicum, wherein the amino acid sequence of the truncated PspA1 is as shown in SEQ ID NO: 3, comprising: a. a gene encoding the truncated PspA1 having a nucleotide sequence described in SEQ ID NO: 5; b. Copy the origin; c. Antibiotic resistance genes; d. Promoter; e. ribosome binding site; and f. PspA1 signal peptide coding region as set forth in SEQ ID NO:

8.

2. The expression construct according to claim 1, wherein the antibiotic resistance gene is a kanamycin resistance gene.

3. The expression construct according to claim 1, comprising: a. The replication origin is the ori R replication origin; b. the antibiotic resistance gene is a kanamycin resistance gene; and c. The promoter is P tac Promoter.

4. An expression construct for high-level secretory expression of a truncated PspA1 in Corynebacterium glutamicum, wherein the amino acid sequence of the truncated PspA1 is shown in SEQ ID NO: 3, comprising: a. A gene encoding a truncated pspA1 as set forth in SEQ ID NO:5; b. the ori R replication origin as set forth in SEQ ID NO: 12; c. a kanamycin resistance gene as set forth in SEQ ID NO: 1; d. P as set forth in SEQ ID NO: 2 tac Promoter; e. a triosephosphate isomerase ribosome binding site as set forth in SEQ ID NO: 7; and f. A signal peptide as set forth in SEQ ID NO:

8.

5. A recombinant host cell comprising the expression construct of any one of claims 1 to 4.

6. The recombinant host cell according to claim 5, wherein the host is Corynebacterium glutamicum.

7. A method for high-level expression of truncated PspA1 (Pneumococcal surface protein A1) of Streptococcus pneumoniae, comprising culturing bacteria transformed with the expression construct of any one of claims 1 to 4, thereby purifying the protein expressed therefrom.

8. The method for high-level expression and purification of truncated PspA1 according to claim 7, wherein the yield of truncated pspA1 is 500 mg / L, 400 mg / L, 300 mg / L, 250 mg / L, 220 mg / L, 200 mg / L, 180 mg / L, 160 mg / L, 150 mg / L, 120 mg / L or 100 mg / L.

9. A multivalent pneumococcal conjugate vaccine comprising Streptococcus pneumoniae serotypes 3, 6A and 6B conjugated to a truncated PspA1 as shown in SEQ ID NO: 3, and to a CRM 197 Binds to S. pneumoniae serotypes 1, 4, 5, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F and 33F.

Images