siRNA inhibiting duck RIG-I gene expression

Abstract

The present invention discloses a siRNA for inhibiting duck RIG-I gene expression, discloses the cell transfection, RNA extraction and reverse transcription of the present invention; discloses the qRT-PCR detection of the present invention; the siRNA of the present invention can effectively inhibit the expression of duck RIG-I gene, can be used in the preparation of duck RIG-I inhibitors, and can also be applied to the functional study of duck RIG-I gene silencing.

Description

Technical Field

[0001] The present invention relates to siRNA for inhibiting the expression of duck RIG-Ⅰ gene. Background Art

[0002] The host's pattern recognition receptors play an important role in antiviral natural immunity. The process of host cells producing antiviral natural immunity mainly depends on the recognition of the conserved structure of pathogenic microorganisms by pattern recognition receptors, which then produce a cascade reaction through a series of signal transduction pathways in the cell, inducing the host cell to secrete antiviral proteins and enter an antiviral immune state. The TLR family and the RLR family are the two main receptor families for recognizing RNA viruses, among which the RLR family is mainly involved in recognizing viral nucleic acid components in cells. RIG-I is a representative member of the RLRs receptor family. It is a relatively key recognition receptor for pathogen-related molecular patterns in the cytoplasm and can recognize single-stranded and double-stranded RNA viral components in cells.

[0003] The RIG-Ⅰ gene was first reported in 2000. In 2004, it was found that the gene can recognize viral RNA in the cytoplasm and mediate the host's antiviral natural immunity. In 2010, Barber et al. confirmed that there was no RIG-Ⅰ gene in chickens, and isolated and identified the RIG-Ⅰ gene in duck spleen for the first time by Western blot and RT-PCR technology. At present, the functional research on RIG-Ⅰ gene in mammals such as humans, mice, and pigs is relatively in-depth, while the research on poultry started late. Studies have found that the duck RIG-Ⅰ gene can recognize avian influenza virus. Cell transfection technology has confirmed that the duck RIG-Ⅰ gene can be expressed in chicken cell lines and can significantly inhibit the replication of influenza virus. According to research, it is speculated that the duck RIG-Ⅰ gene may play an antiviral role in the process of infection with a variety of avian viruses. The RIG-Ⅰ gene consists of two tandem effector domains (CARD) at the N-terminus, the DexD / H helicase region in the middle, and the C-terminal inhibitory region (RD). The C-terminal domain (CTD) of the RD region can bind to double-stranded RNA produced by the virus, ， Triphosphate single-stranded RNA or RNA / DNA hybrid activates the ATPase activity of the DexH / H helicase region, exposing CARD. CARD is responsible for binding to downstream adaptor proteins, thereby continuously activating downstream signaling pathways and inducing the expression of interferon to mediate antiviral innate immune responses.

[0004] RNA interference technology refers to the introduction of exogenous double-stranded RNA into cells, which causes the specific degradation of homologous mRNA to achieve the purpose of silencing the expression of specific genes at the RNA level, i.e. post-transcriptional gene silencing. RNA interference has extremely strong specificity. It is reported that a double-stranded RNA with a sequence of 19 nucleotides can significantly inhibit gene expression, and a change in a nucleotide sequence can release the silencing state of a gene. RNA interference technology is efficient, highly specific, fast-acting and has few side effects. It has been widely used in the exploration of gene functions and in the biomedical field. The discoverers of this technology, Mello and Fire, were awarded the 2006 Nobel Prize in Physiology. Summary of the invention

[0005] In previous studies, we infected duck embryo fibroblasts with duck short beak dwarf syndrome virus (SBDSV) in vitro, and verified by qRT-PCR that the expression of duck RIG-Ⅰ gene increased significantly during SBDSV infection, and speculated that duck RIG-Ⅰ gene played a certain role in the process of resisting SBDSV infection. The purpose of the present invention is to provide an siRNA that effectively interferes with the transcriptional expression of duck RIG-Ⅰ gene, and the implementation method of the present invention is as follows:

[0006] First, the cDNA sequence of duck RIG-Ⅰ protein (NM_001310380.1) was obtained through Genebank. Based on RNA interference technology and the basic principles of siRNA design, a 21-nucleotide siRNA was designed according to the duck RIG-Ⅰ gene. Its sequence corresponds to the 335-357 base site of the target gene mRNA sequence. The siRNA is as follows:

[0007] siRNA sense strand: 5'-GGAUAGAGGCAACAAUGUUAG-3'

[0008] Antisense strand: 5'-AACAUUGUUGCCUCUAUCCGC-3'

[0009] According to a preferred embodiment of the present invention, two dTdTs are added to the 3' end of the synthesized siRNA. The two overhanging bases at the 3' end enhance the stability of the siRNA double-stranded complex and prevent it from being degraded.

[0010] The siRNA according to the present invention can effectively inhibit the expression of duck RIG-I gene, can be used in the preparation of duck RIG-I inhibitors, and can also be used in the functional study of duck RIG-I gene silencing. The siRNA of the present invention that effectively interferes with the transcriptional expression of duck RIG-I gene, whose nucleotide sequence is composed of a continuous nucleotide sequence of the GGAUAGAGGCAACAAUGUUAG sequence or a complementary sequence, is used to explore the function of RIG-I gene and its role in the process of resisting pathogenic microorganism infection.

[0011] The details are as follows:

[0012] 1. Synthetic siRNA

[0013] After obtaining the duck RIG-Ⅰ gene cDNA sequence from the Genebank database, the siDirect siRNA design software was used to select siRNAs that simultaneously satisfied the three algorithms for effective siRNA selection by Ui-Tei, Reynolds, Amarzguioui, and others as candidates. Then, siRNAs with a GC content of 35-50% were selected from them. The selected siRNAs were then compared with the duck genome sequences included in the Genebank database using the NCBI blast function, and siRNAs with homology were excluded. The following siRNAs were designed, in which the sense strand sequence was identical to the target sequence designed on the target gene (U replaced T), and the antisense strand sequence was completely complementary to the target sequence (U replaced T):

[0014] siRNA sense strand: 5'-GGAUAGAGGCAACAAUGUUAG-3'

[0015] Antisense strand: 5'-AACAUUGUUGCCUCUAUCCGC-3'

[0016] The siRNA sequence was chemically synthesized and two overhanging dTdTs were added to the 3' end to enhance the stability of the siRNA. According to the duck RIG-Ⅰ gene sequence, RIG-Ⅰ gene primers were designed for qRT-PCR experiments to detect the expression of RIG-Ⅰ gene;,

[0017] 2. Cell Transfection, RNA Extraction and Reverse Transcription

[0018] ATCC MEM (containing 10% fetal bovine serum) complete medium was used for cell culture. ATCC DEF (immortalized duck embryo fibroblasts) were subcultured and plated in 6-well plates the day before transfection, with 2 ml per well. When the cells grew to 40-60% density the next day, the medium was replaced with ATCC MEM without antibiotics and serum, and the pre-synthesized siRNA was transfected into the growing cells using the liposome transfection reagent Lipofectamine2000 (Invitrogen), with siRNA 100 nM / well. 12 hours after transfection, the culture medium was replaced with ATCC MEM containing 10% fetal bovine serum and cultured in a constant temperature incubator at 37°C, 6% CO2 and 90% humidity for 24 hours. After that, 300 μL / well of duck short-beaked dwarf syndrome virus SBDSV M15 was inoculated into each well. 24 hours after inoculation, RNA of transfected DEF cells was extracted using TRIzol method (Total RNA Extraction Kit). The extracted total RNA was thoroughly digested with DNAaseⅠ for residual genomic DNA. The purified RNA was purified by HifairⅢ 1 st Strand cDNA Synthesis (YEASON) was reverse transcribed into cDNA. The specific operations of the above experiments were carried out according to the product instructions. The following groups were designed in this experiment: normally grown DEF cells, DEF cells transfected with Lipofectamine2000 reagent alone, siRNA universal negative control (siRNA NCTL), siRNA FAM-universal negative control (siRNA FAM-NCTL) and RIG-Ⅰ siRNA.

[0019] 3. qRT-PCR detection

[0020] The reverse transcribed cDNA was diluted one-fold and then qPCR reaction was performed using TransStart Top Green qPCR SuperMix (Full Gold). The reaction conditions were as follows: 20 μl reaction system, 1 μl cDNA template was added to each system.

[0021] qPCR reaction procedure (taking the two-step method as an example): pre-denaturation at 94°C for 30 seconds; denaturation at 94°C for 5 seconds, annealing-extension at 60°C for 30 seconds, 40 cycles; melting curve stage at 60-95°C.

[0022] Using GAPDH as the internal reference, the following are the duck GAPDH and RIG-I primer sequences used in the qPCR reaction:

[0023]

[0024] Figure 1 The results of qRT-PCR detection of RIG-Ⅰ gene expression in each experimental group. Figure 1 It can be seen that the mRNA expression level of RIG-Ⅰ gene in DEFs cells transfected with RIG-Ⅰ siRNA was significantly decreased compared with the untransfected group and the transfected N-CTL control group, indicating that the synthetic RIG-Ⅰ siRNA can effectively and specifically inhibit the expression of duck RIG-Ⅰ gene.

[0025] Figure 2 Figure 1 shows the electrophoresis of PCR products in each group after 1% agarose gel electrophoresis. The primers used were the qPCR primers of the RIG-Ⅰ gene mentioned above. Figure 2 It can be seen that the product fragment of approximately 90 bp is consistent with the expected product size (92 bp), and the electrophoresis band of the amplified product in the RIG-I gene siRNA treatment group is significantly weaker than that in the control group, which is consistent with the qRT-PCR results.

[0026] The siRNA according to the present invention can effectively inhibit the expression of duck RIG-I gene, and can be used in the preparation of duck RIG-I inhibitors, and can also be applied to the functional study of duck RIG-I gene silencing.

[0027] The molecular biological techniques involved in all the above embodiments, including cell culture, PCR, electrophoresis, cell transfection, RNA extraction and reverse transcription, are all conventional techniques known to researchers in the field, and the relevant equipment and instruments involved are also available to researchers in the field through public channels.

[0028] Compared with the prior art, the present invention is characterized in that it is the first to discover siRNA that can significantly inhibit duck RIG-I gene and is used to carry out RIG-I related function research. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 This is a diagram of the RIG-I gene expression in each treatment group detected by qRT-PCR in the present invention.

[0030] Figure 2 The nucleic acid gel electrophoresis images of each treatment group.

Claims

1. An siRNA for inhibiting duck RIG-I gene expression, characterized in that: The cDNA sequence of duck RIG-Ⅰ protein NM_001310380.1 was obtained through Genebank. Based on RNA interference technology and the basic principles of siRNA design, a 21-nucleotide siRNA was designed according to the duck RIG-Ⅰ gene. Its sequence corresponds to the 335-357 base site of the target gene mRNA sequence. The siRNA is as follows: siRNA positive strand: 5'-GGAUAGAGGCAACAAUGUUAG-3', Antisense strand: 5'-AACAUUGUUGCCUCUAUCCGC-3', Two dTdT residues were added to the 3' end of the sense and antisense strands of the siRNA.

Images