Compositions and methods related to nucleic acid anticoagulants

Abstract

The present disclosure provides compositions and methods related to nucleic acid molecules with therapeutic aptamers. Specifically, the present disclosure provides nucleic acid molecules comprising one or more aptamers with anticoagulant activity, and corresponding nucleic acid antidotes, for use in regulating blood coagulation in the context of disease and surgical intervention.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to and the benefit of U.S. Provisional Patent Application No. 62 / 750,900, filed on October 26, 2018, which is incorporated herein by reference in its entirety for all purposes.

[0003] Government funding

[0004] This invention was made with government support awarded by the National Science Foundation (NSF) under Grant Nos. 1559077, 1603179, and 1709010. The government has certain rights in this invention.

[0005] Incorporation by Reference of Electronically Submitted Materials

[0006] The computer-readable nucleotide / amino acid sequence listing filed concurrently with this document and identified as follows is incorporated herein by reference in its entirety: a 10,156-byte ASCII (text) file named "37060-601_ST25.txt," created on October 25, 2019. Technical Field

[0007] The present disclosure provides compositions and methods related to nucleic acid molecules with therapeutic aptamers. Specifically, the present disclosure provides nucleic acid molecules comprising one or more aptamers with anticoagulant activity, and corresponding nucleic acid antidotes, for use in regulating blood coagulation in the context of disease and surgical intervention. Background Art

[0008] The coagulation cascade involves a series of enzymatic reactions that ultimately produce a fibrin clot on the surface of ruptured blood vessels and cells. Anticoagulants interrupt the coagulation process by blocking key players in the cascade. Thus, regulation of fibrin clot formation by anticoagulants can avoid thrombosis, i.e. the formation of blood clots in vital organs such as the heart, lungs and brain. The life-threatening consequences of thrombosis include stroke or transient ischemic attack, heart attack, deep vein thrombosis and pulmonary embolism.

[0009] The most commonly used prescription anticoagulant is warfarin, which is a small molecule often used as a rodenticide. Warfarin is a vitamin K antagonist that inhibits the synthesis of coagulation factors II, VII, IX and X and endogenous anticoagulant proteins C and S. The sensitivity of the human body to vitamin K fluctuations needs to be strictly and promptly monitored, and the dosage is adjusted accordingly. Other forms of anticoagulants include heparin, factor Xa inhibitors, direct thrombin inhibitors and fibrinolytics. For effectively treating coagulation and not causing excessive anticoagulation administration, for example, if the dosage of anticoagulant is too high during surgery, all current anticoagulation methods are uniformly narrow treatment windows. Unfortunately, there is no antidote for the anticoagulant based on chemicals, which can further mediate administration and inhibit cytotoxic effects. SUMMARY OF THE INVENTION

[0011] Embodiments of the present disclosure provide a single-stranded nucleic acid molecule including at least one A-form double helix structure and at least one crossover region, at least one anastomosing loop region, and at least one nucleic acid aptamer having anticoagulant activity.

[0012] In some embodiments, the nucleic acid molecule comprises at least one tetraloop region. In some embodiments, the nucleic acid molecule is an RNA molecule, or is an RNA molecule comprising at least one nucleotide having a 2'-modification.

[0013] In some embodiments, the single-stranded nucleic acid molecule includes at least one tetraloop region comprising a tetranucleotide motif. In some embodiments, the single-stranded nucleic acid molecule includes one to six tetraloop regions, each of which includes a tetranucleotide motif. In some embodiments, the single-stranded nucleic acid molecule includes at least one anastomotic loop region, and the at least one anastomotic loop region is a 180° anastomotic loop region. In some embodiments, the single-stranded nucleic acid molecule includes a 180° anastomotic loop region.

[0014] In some embodiments, the single-stranded nucleic acid molecule includes one to four aptamers having anticoagulant activity. According to these embodiments, each of the one to four aptamers replaces the tetraloop region.

[0015] In some embodiments, the nucleic acid molecule is an RNA molecule having at least 80% sequence identity to SEQ ID NO: 1.SEQ 1.

[0016] In some embodiments, the anticoagulant activity of the at least one nucleic acid aptamer comprises thrombin inhibition. In some embodiments, the anticoagulant activity of the at least one nucleic acid aptamer comprises inhibition of one or more of factor XIIa, factor XIIIa, factor XIa, factor IXa, factor Xa, and von Willebrand factor. In some embodiments, the at least one nucleic acid aptamer comprises an antithrombin RNA R9D-14T Aptamer or derivative thereof. In some embodiments, the at least one nucleic acid aptamer comprises an antithrombin Toggle-25t RNA aptamer or a derivative thereof.

[0017] In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 600 nucleotides.

[0018] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (2HO-RNA-12NN or 2HF-RNA-12NN) comprising a nucleic acid aptamer capable of binding to thrombin exosite 1 and a nucleic acid aptamer capable of binding to thrombin exosite 2, wherein the nucleic acid aptamer capable of binding to thrombin exosite 1 replaces the tetraloop region 1 of the RNA molecule, and the nucleic acid aptamer capable of binding to thrombin exosite 2 replaces the tetraloop region 2 of the RNA molecule. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO: 2.

[0019] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (2HO-RNA-1N2N or 2HF-RNA-1N2N) comprising a nucleic acid aptamer capable of binding to thrombin exosite 1 and a nucleic acid aptamer capable of binding to thrombin exosite 2, wherein the nucleic acid aptamer capable of binding to thrombin exosite 1 replaces the tetraloop region 1 of the RNA molecule, and the nucleic acid aptamer capable of binding to thrombin exosite 2 replaces the tetraloop region 3 of the RNA molecule. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO: 3.

[0020] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (2HO-RNA-2NN1 or 2HF-RNA-2NN1) comprising a nucleic acid aptamer capable of binding to thrombin exosite 2 and a nucleic acid aptamer capable of binding to thrombin exosite 1, wherein the nucleic acid aptamer capable of binding to thrombin exosite 2 replaces the tetraloop region 1 of the RNA molecule, and the nucleic acid aptamer capable of binding to thrombin exosite 1 replaces the tetraloop region 4 of the RNA molecule. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO:4.

[0021] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (Fss12) comprising a nucleic acid aptamer capable of binding to thrombin exosite 2 connected to one end of a single-stranded RNA linker and a nucleic acid aptamer capable of binding to thrombin exosite 1 connected to the other end of the single-stranded RNA linker. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO: 5.

[0022] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (2H-2211) comprising two nucleic acid aptamers capable of binding to thrombin exosite 2 and two nucleic acid aptamers capable of binding to thrombin exosite 1, wherein the two nucleic acid aptamers capable of binding to thrombin exosite 2 each replace tetraloop regions 1 and 2 of the RNA molecule, and the two nucleic acid aptamers capable of binding to thrombin exosite 1 each replace tetraloop regions 3 and 4 of the RNA molecule. In some embodiments, the RNA molecule has at least 80% sequence identity to SEQ ID NO: 6.

[0023] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (3H-2NN1) comprising a nucleic acid aptamer capable of binding to thrombin exosite 2, a nucleic acid aptamer capable of binding to thrombin exosite 1, and an A-type double helix structure, wherein the nucleic acid aptamer capable of binding to thrombin exosite 2 replaces the tetraloop region 1 of the RNA molecule, the nucleic acid aptamer capable of binding to thrombin exosite 1 replaces the tetraloop region 4 of the RNA molecule, and the A-type double helix structure separates the nucleic acid aptamer capable of binding to thrombin exosite 2 from the nucleic acid aptamer capable of binding to thrombin exosite 1. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO:7.

[0024] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (4H-2NN1) comprising a nucleic acid aptamer capable of binding to thrombin exosite 2, a nucleic acid aptamer capable of binding to thrombin exosite 1, and two A-type double helical structures, wherein the nucleic acid aptamer capable of binding to thrombin exosite 2 replaces the tetraloop region 1 of the RNA molecule, the nucleic acid aptamer capable of binding to thrombin exosite 1 replaces the tetraloop region 4 of the RNA molecule, and the two A-type double helical structures separate the nucleic acid aptamer capable of binding to thrombin exosite 2 from the nucleic acid aptamer capable of binding to thrombin exosite 1. In some embodiments, the RNA molecule has at least 80% sequence identity with SEQ ID NO: 8.

[0025] In some embodiments, the nucleic acid aptamer capable of binding to thrombin exosite 1 is RNA R9D-14TAptamer or its derivative. In some embodiments, the nucleic acid aptamer capable of binding to thrombin exosite 2 is a Toggle-25t RNA aptamer or its derivative.

[0026] Embodiments of the present disclosure also include DNA molecules encoding any of the single-stranded nucleic acid molecules described herein.

[0027] Embodiments of the present disclosure also include anticoagulant compositions. According to these embodiments, the composition includes a single-stranded nucleic acid molecule and a pharmaceutically acceptable excipient, solvent, carrier or diluent, wherein the single-stranded nucleic acid molecule comprises at least one A-type double helix structure, at least one cross-over region, at least one four-loop region, at least one anastomotic loop region, and at least one nucleic acid aptamer having anticoagulant activity.

[0028] Embodiments of the present disclosure also include systems for regulating coagulation. According to these embodiments, the system includes any of the single-stranded nucleic acid molecules described herein, and at least one single-stranded nucleic acid antidote capable of binding to at least a portion of any of the single-stranded nucleic acid molecules described herein, the at least one single-stranded nucleic acid antidote counteracting the anticoagulant activity of these single-stranded nucleic acid molecules.

[0029] In some embodiments, the at least one nucleic acid antidote is a DNA molecule, an RNA molecule, an O-methyl RNA molecule, a fluoro-modified RNA molecule, a PNA molecule, an LNA molecule, or a combination or derivative thereof. In some embodiments, the at least one nucleic acid antidote binds to at least a portion of any of the single-stranded nucleic acid molecules described herein in a reverse complementary manner. In some embodiments, the at least one nucleic acid antidote binds to at least one nucleic acid aptamer of any of the single-stranded nucleic acid molecules described herein to counteract the anticoagulant activity. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of the coagulation cascade and the corresponding enzymes targeted by anticoagulant drugs. Thrombin plays an important role in coagulation by catalyzing the cleavage of fibrinogen, upstream coagulation factors and platelet receptors. The catalytic active site and two extended surfaces of thrombin, known as exosites, are involved in macromolecular ligand binding and can be blocked using chemical- and biologic-based molecules, thereby preventing coagulation. Control of thrombin activity in the coagulation cascade provides therapeutic, surgical and clinical benefits.

[0031] Figure 2A Figures 2 to 2E include representative depictions of nucleic acid-based aptamers with anticoagulant activity. Figure 2AThe tertiary structure of thrombin is included, including the locations of exosite 1 and exosite 2. Figures 2B to 2E include examples of DNA aptamers and RNA aptamers that are useful as anticoagulants due to their specific inhibition of thrombin activity. R9D-14T (Fig. 2B) and Toggle-25t (Fig. 2C) RNA aptamers bind to exosite 1 and exosite 2 of thrombin, respectively. DNA aptamers NU172 (Fig. 2D) and HD22 (Fig. 2E) bind to exosite 1 and exosite 2 of thrombin, respectively.

[0032] Figure 3 The crystal structure of the Toggle-25t RNA aptamer bound to thrombin exosite 2 is depicted.

[0033] Figure 4 is an illustrative image (not to scale) of RNA origami bound to thrombin. The RNA origami structure comprises a 2-helix structure.

[0034] 5A-5B include representative images of RNA molecules having an A-form double helix structure (FIG. 5A) and a 180° anastomotic loop (FIG. 5B).

[0035] Figures 6A-6B include representative images of a tetraring before (Figure 6A) and after (Figure 6B) extraction from a larger structure. The red circle shows the tetraring within the larger structure.

[0036] Figures 7A-7B include representative images of the exosite 2 thrombin aptamer before (Figure 7A) and after (Figure 7B) extraction from a larger structure. The red circles illustrate the four loops within the larger structure.

[0037] Figures 8A to 8B include representative images of the double helix after being aligned to form a crossover (Figure 8A; the top helix is ​​helix 1 and the bottom helix is ​​helix 2). The phosphate atoms and the backbone and sides (sugar / base) at the crossover location are identified in red and yellow, respectively. Figure 8B includes a representative side view of the RNA structure with all motifs aligned with the helix. The top left motif is the RNA thrombin aptamer.

[0038] Fig. 9 is a 3D depiction of the junction structure of a 2-helix RNA origami molecule including an RNA aptamer.

[0039] Fig.10 Representative images of RNA origami molecules (top) transcribed from a 2D model into a text file (bottom).

[0040] Figures 11A to 11B Included are representative descriptions of RNA origami sequences. Fig.11AIncluded is a representative depiction of the text file after running it through the tracking script; the red box highlights the output code that can be submitted to NUPACK which subsequently provides the RNA sequence. Fig. 11B Included are representative descriptions of RNA sequences output by NUPACK; the NED is also provided (generally, sequences with the lowest NED are selected for analysis).

[0041] Figures 12A-12B 3D illustration of a 2-helix RNA origami (2HO-RNA-NNNN) without an RNA aptamer ( Fig. 12A ) and 2D ribbon models ( Fig. 12B ). Numbers indicate four possible positions of RNA aptamers on the RNA origami molecule. The four loops are indicated by yellow boxes, and the anastomosing loops are indicated by green boxes.

[0042] Figures 13A to 13D include representative 2D models of four designs of RNA origami including two aptamers. Figure 13A depicts 2HO-RNA-NNNN (SEQ ID NO: 1); Figure 13B depicts 2HO-RNA-12NN (SEQ ID NO: 2); Figure 13C depicts 2HO-RNA-1N2N (SEQ ID NO: 3), and Figure 13D depicts 2HO-RNA-2NN1 (SEQ ID NO: 4).

[0043] Figures 14A to 14C include a representative 2D model of 2HO-RNA-NNNN (A) and computational simulations of RNA folding analyzed by (B) mfold and (C) NUPACK. The tetraloop and anastomosing loop are indicated by yellow and green boxes, respectively.

[0044] Figures 15A to 15C include a representative 2D model of 2HO-RNA-12NN (A) and computational simulations of RNA folding analyzed by (B) mfold and (C) NUPACK. The four loops and the anastomotic loop are indicated by yellow and green boxes, respectively. The exosite 1 and 2 binding RNA aptamers are represented by purple and blue rectangles, respectively.

[0045] Figure 16A to 16C include a representative 2D model (A) of 2HO-RNA-1N2N and computational simulations of RNA folding analyzed by (B) mfold and (C) NUPACK. Four rings and anastomosis rings are indicated with yellow and green frames, respectively. Exosite 1 and 2 binding RNA aptamers are represented with purple and blue rectangles, respectively.

[0046] Figures 17A to 17C include a representative 2D model of 2HO-RNA-2NN1 (A) and computational simulations of RNA folding analyzed by (B) mfold and (C) NUPACK. The four loops and the anastomotic loop are indicated by yellow and green boxes, respectively. The exosite 1 and 2 binding RNA aptamers are represented by purple and blue rectangles, respectively.

[0047] Fig.18 Included are representative images characterizing DNA template amplification using a 1% agarose gel run at 150 V for 30 minutes. 1 kb ladder (lanes 1 and 5), 2H-DNA-NNNN (lane 2), 2H-DNA-12NN (lane 3), 2H-DNA-1N2N (lane 4), and 2H-DNA-2NN1 (lane 6).

[0048] Fig.19 Representative images showing the difference between transcription with and without fresh DTT are included. New England Biolabs native T7 RNA polymerase was used for transcription of unmodified RNA constructs.

[0049] Fig. 20 Included are representative images of RNA origami run on a 6% denaturing acrylamide gel run for 1 hour at 20 W. 1 kb ladder (lane 1), 2HO-RNA-NNNN (lane 2), 2HF-RNA-NNNN (lane 3), 2HO-RNA-2NN1 (lane 4), 2HF-RNA-2NN1 (lane 5), 2HO-RNA-1N2N (lane 6), and 2HF-RNA-1N2N (lane 7).

[0050] Fig.21 Included are representative images of RNA origami run on a 6% denaturing acrylamide gel run for 1 hour at 20 W. 1 kb ladder (lane 1); 2HO-RNA-1N2N, 279 nucleotides (lane 2); 2HO-RNA-NNNN, 210 nucleotides (lane 3); 1 kb ladder (lane 4); 2HF-RNA-2NN1, 285 nucleotides (lane 5); 2HF-RNA-1N2N, 279 nucleotides (lane 6); 2HF-RNA-12NN, 279 nucleotides (lane 7); and 2HF-RNA-NNNN, 210 nucleotides (lane 8).

[0051] Fig. 22Included are representative images of RNA origami run on a 6% native acrylamide gel run for 3 hours at 150 V. DNA marker, GeneRuler Ultra Low Range DNA Ladder (left lane), and 2HO-RNA-2NN1 (right lane).

[0052] Fig.23 Representative results of anticoagulation assays including comparison of the average clotting times of 2′-fluoro-modified free aptamers, unmodified RNA origami (2HO-RNA), 2′-fluoro-modified RNA origami (2HF-RNA), and DNA weave tile (2HT-DNA) using aPTT assay. Error bars are standard deviations (N=3).

[0053] Fig.24 Representative images of acrylamide gel electrophoresis results including RNA origami-thrombin complexes. Nucleic acid-stained gel (left) and protein-stained gel (right).

[0054] Fig.25 Representative images of acrylamide gel electrophoresis results including specificity testing of thrombin aptamers included in RNA origami with four different proteins by gel electrophoretic mobility shift assay. Lane 1: DNA marker; Lane 2: 2HF-RNA-NNNN; Lanes 3 to 6: 2HF-RNA-NNNN incubated with thrombin, Factor IXa, Factor Xa, and BSA, respectively. The left gel is a nucleic acid-stained gel, and the right gel is a protein-stained gel.

[0055] Fig.26 Representative images of acrylamide gel electrophoresis results including specificity tests of thrombin aptamers included in RNA origami with four different proteins. Lane 1: DNA marker; Lane 2: 2HF-RNA-12NN; Lanes 3 to 6: 2HF-RNA-12NN incubated with thrombin, Factor IXa, Factor Xa, and BSA, respectively. The left gel is a nucleic acid-stained gel, and the right gel is a protein-stained gel.

[0056] Fig. 27 Representative images of acrylamide gel electrophoresis results including specificity tests of thrombin aptamers included in RNA origami with four different proteins. Lane 1: DNA marker; Lane 2: 2HF-RNA-1N2N; Lanes 3 to 6: 2HF-RNA-1N2N incubated with thrombin, Factor IXa, Factor Xa, and BSA, respectively. The left gel is a nucleic acid-stained gel, and the right gel is a protein-stained gel.

[0057] Fig.28Representative images of acrylamide gel electrophoresis results including specificity tests of thrombin aptamers included in RNA origami with four different proteins. Lane 1: DNA marker; Lane 2: 2HF-RNA-2NN1; Lanes 3 to 6: 2HF-RNA-2NN1 incubated with thrombin, Factor IXa, Factor Xa, and BSA, respectively. The left gel is a nucleic acid-stained gel, and the right gel is a protein-stained gel.

[0058] Fig.29 Representative results of a binding assay of thrombin DNA aptamers included in a DNA braid sheet to thrombin. The left gel is a nucleic acid stained gel, and the right gel is a protein stained gel.

[0059] Figures 30A-30B include representative results of stability testing of modified (A) and unmodified (B) RNA origami treated with 10 ug / ml RNase A. Samples were characterized by denaturing gel electrophoresis.

[0060] Figures 31A-31B include representative results of stability testing of modified (A) and unmodified RNA origami (B) treated with high concentration of RNase A (500 ug / ml). Samples were characterized by denaturing gel electrophoresis.

[0061] Figures 32A to 32B include representative results of stability testing of modified RNA origami (2HF-RNA-2NN1) stored in human plasma for 10 minutes to 24 hours. Modified RNA origami (A) was stored with human plasma at 37°C for 4 hours. 2HF-RNA-2NN1 origami (B) was stored in human plasma for 10 minutes to a maximum of 24 hours. The control was 2HF-RNA-2NN1 stored in 1x buffer at 37°C for 24 hours.

[0062] Fig.33 Included are representative results of stability testing of unmodified RNA origami (2HO-RNA-2NN1) stored in human plasma at 37°C for 10 min to 24 h.

[0063] Fig.34 Included are representative results of stability testing of DNA woven sheets (2HT-DNA-PNNB) stored in human plasma at 37°C for 10 minutes to 24 hours.

[0064] Figures 35A to 35C include representative 2D models of four designs of RNA origami including two aptamers (Fss12; A) on a 31-nucleotide single-stranded RNA linker. Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B to C). Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively.

[0065] Figures 36A to 36C include representative 2D models of four designs of RNA origami including four aptamers (2H-RNA-2211; A). Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B to C). Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively, and green rectangles indicate anastomosing loop motifs.

[0066] Figures 37A to 37C include representative 2D models of four designs of RNA origami including two aptamers and three A-form double helices (3H-RNA-2NN1; A). Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B to C). Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively, and yellow and green rectangles indicate tetraloop and anastomosing loop motifs, respectively.

[0067] Figures 38A to 38C include representative 2D models of four designs of RNA origami including two aptamers and four A-form double helices (4H-RNA-2NN1; A). Computational analysis of RNA origami folding analyzed by mfold RNA and NUPACK software (B to C). Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively, and yellow and green rectangles indicate tetraloop and anastomosing loop motifs, respectively.

[0068] Fig.39 Included are representative images characterizing DNA template amplification. Lanes 1 and 8: DNA marker; Lane 2: Fss12; Lane 3: 2H-DNA-NNNN; Lane 4: 2H-DNA-2NN1; Lane 5: 2H-DNA-2211; Lane 6: 3H-DNA-2NN1; and Lane 7: 4H-DNA-2NN1.

[0069] Fig.40 Included are representative images of RNA origami characterization by denaturing acrylamide gel electrophoresis. Lanes 1 and 8: ssRNA markers; Lane 2: 31-nucleotide linked aptamer (Fss12); Lane 3: 2HF-RNA-NNNN; Lane 4: 2HF-RNA-2NN1; Lane 5: 2HF-RNA-2211; Lane 6: 3HF-RNA-2NN1; Lane 7: 4HF-RNA-2NN1.

[0070] Figures 41A to 41D include representative images of RNA origami characterizing RNA origami with aptamers binding to thrombin by 6% native acrylamide gel electrophoresis. RNA origami was incubated with thrombin for 1 hour at 37°C prior to characterization (A). The gels in (A) and (B) are the same gels and were run at 150V for 3 hours. The gels in (C) and (D) are the same gels and were run at 150V for 6 hours. Gels stained with nucleic acids, ethidium bromide (A and C). Gels stained with proteins, Coomassie blue (B and D). Negative and positive values ​​indicate the absence and presence of thrombin, respectively.

[0071] Figures 42A to 42B include representative images of specific binding assays of two aptamers (Fss12) linked by 31 nucleotides to four different proteins by native acrylamide gel electrophoresis. Lane 1: Fss12. Lane 2: Fss12 incubated with thrombin. Lane 3: Fss12 incubated with Factor IXa. Lane 4: Fss12 incubated with Factor Xa; and Lane 5: Fss12 incubated with BSA. 6% native PAGE gels were run at 150 for 3 hours. Gel stained with nucleic acids, ethidium bromide (A). Gel stained with proteins, Coomassie blue (B). (A) and (B) are the same gel.

[0072] Figures 43A to 43B include representative images of specific binding assays of 2HF-RNA-2211 with four different proteins by native acrylamide gel electrophoresis. Lane 1: 2HF-RNA-2211. Lane 2: 2HF-RNA-2211 incubated with thrombin. Lane 3: 2HF-RNA-2NN1 incubated with Factor IXa. Lane 4: 2HF-RNA-2211 incubated with Factor Xa; and Lane 5: 2HF-RNA-2211 incubated with BSA. 6% native PAGE gels were run at 150 for 3 hours. Gel stained with nucleic acids, ethidium bromide (A). Gel stained with proteins, Coomassie blue (B). (A and B). (A) and (B) are the same gel.

[0073] Figures 44A to 44B include representative images of specific binding assays of 3HF-RNA-2NN1 with four different proteins by native acrylamide gel electrophoresis. Lane 1: 3HF-RNA-2NN1. Lane 2: 3HF-2NN1 incubated with thrombin. Lane 3: 3HF-RNA-2NN1 incubated with Factor IXa. Lane 4: 3HF-RNA-2NN1 incubated with Factor Xa; and Lane 5: 3HF-RNA-2NN1 incubated with BSA. 6% native PAGE gels were run at 150 for 6 hours. Gel stained with nucleic acids, ethidium bromide (A). Gel stained with proteins, Coomassie blue (B). (A) and (B) are the same gel.

[0074] Figures 45A to 45B include representative images of specific binding assays of 4HF-RNA-2NN1 with four different proteins by native acrylamide gel electrophoresis. Lane 1: 2HF-RNA-4NN1. Lane 2: 4HF-RNA-2NN1 incubated with thrombin. Lane 3: 4HF-RNA-2NN1 incubated with Factor IXa. Lane 4: 2HF-RNA-4NN1 incubated with Factor Xa; and Lane 5: 4HF-RNA-2NN1 incubated with BSA. 6% native PAGE gels were run at 150 for 6 hours. Gel stained with nucleic acids, ethidium bromide (A). Gel stained with proteins, Coomassie blue (B). (A) and (B) are the same gel.

[0075] Fig.46 Representative results from experiments testing long-term storage of RNA origami are included. The average anticoagulant activity of freshly prepared 2HF-RNA-2NN1 samples was compared to samples stored at 4°C for up to 90 days. The results show that the RNA origami anticoagulant is stable and active for at least 3 months after storage at 4°C.

[0076] Fig.47 Representative results of testing the anticoagulant activity of free aptamers, aptamers connected by ssRNA and RNA origami including aptamers by aPTT determination. Except for 2HF-RNA-2211, the final concentration of all designs of anticoagulants is 500nM. The final concentration of 2HF-RNA-2211 is 400nM. The results show that the anticoagulant activity of 2 aptamers (Fss12) connected to ssRNA is higher than that of a mixture of free aptamers and free aptamers. In addition, the anticoagulant activity of the two aptamers included in the RNA origami (2HF-RNA-2NN1) is greater than that of the aptamer (Fss12) connected by ssRNA. Further, the RNA origami (2HF-RNA-2211) including four aptamers shows the highest anticoagulant activity (more than twice the activity of 2HF-RNA-2NN1).

[0077] Fig.48 Included are representative results of experiments on the concentration-dependent clotting time of an RNA origami comprising two RNA aptamers (2HF-RNA-2NN1) and an RNA origami comprising four RNA aptamers (2HF-RNA-2211). For 2HF-RNA-2211 at a concentration of 400 nM, the clotting time reached the maximum limit (999 seconds measured using a coagulometer). Surprisingly, the anticoagulant activity of 2HF-RNA-2211 (4 aptamers) was more than twice that of 2HF-RNA-2NN1 (2 aptamers).

[0078] Fig.49 Included are representative results of testing the anticoagulant activity of RNA origami comprising two RNA aptamers (2NN1) and 2 (2HF), 3 (3HF) or 4 (4HF) helical structures. The results indicate that 2HF, 3HF and 4HF RNA origami comprising two RNA aptamers all exhibited anticoagulant activity.

[0079] Figures 50A to 50B include representative results of reversal of thrombin inhibition. Clotting time (A) and anticoagulant activity (B) are shown.

[0080] Fig.51 Included are representative results of experiments testing the reversal of thrombin activity by adding DNA or PNA antidotes. The anticoagulant activity of the 2HF-2NN1 origami anticoagulant was used as a control sample. DNA or PNA antidotes (9 equivalents) were incubated with RNA origami. The inhibitory activity of the PNA antidotes was higher than that of the DNA antidotes. DETAILED DESCRIPTION

[0081] Embodiments of the present disclosure provide nucleic acid-based anticoagulants that combine RNA aptamers with RNA origami structures that are produced as 2'-fluoro-modified transcripts. The novel anticoagulants disclosed herein have demonstrated many times higher activity than free aptamers. Single-molecule constructs are advantageous for use as surgical anticoagulants and have a high enough molecular weight to greatly reduce rapid renal clearance. The nucleic acid anticoagulants disclosed herein will have fewer severe side effects than currently used small molecule blood diluents. In addition, embodiments of the present disclosure include nucleic acid antidotes made from complementary DNA that counteract the anticoagulant activity.

[0082] Nucleic acid therapeutics represent an alternative solution to current pharmaceutical anticoagulants ( Figure 2A to 2E and Figure 3). DNA and RNA aptamers can adopt structures that bind to specific target molecules and have been developed to bind to thrombin and interrupt the coagulation cascade. Their advantages include: greater biocompatibility that minimizes side effects, a larger therapeutic window, and the availability of antidotes. The antidote contains natural nucleic acids (DNA / RNA) or non-natural nucleic acids (such as PNA) that are complementary to the aptamer and can unfold the aptamer. This brings advantages to clinical applications that require rapid and robust anticoagulation. However, these aptamers exhibit poor pharmacokinetics due to their small size (less than 30KDa); they are quickly cleared by the kidneys after circulation, and therefore require more concentrated doses to be effective.

[0083] Embodiments of the present disclosure include novel functional RNA origami that can bind to thrombin and prevent coagulation ( Figure 4 ). In one embodiment, two aptamers are placed on RNA origami to increase binding affinity and reduce necessary dosage by increasing local concentration of RNA aptamers. The biocompatible nature of RNA and the availability of antidotes can similarly allow precise treatment while minimizing negative side effects. Due to the higher molecular weight (e.g., over 80 kDa), RNA origami circulates longer in the human body than free aptamers. The RNA origami anticoagulant compositions and systems disclosed herein provide a viable alternative to current clinical anticoagulants by providing a more controllable solution with fewer side effects.

[0084] The section headings as used in this section and the entire disclosure herein are for organizational purposes only and are not intended to be limiting.

[0085] 1. Definition

[0086] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those of ordinary skill in the art are generally understood. In the event of a conflict, the present document (including definitions) shall prevail. Although methods and materials similar or equivalent to those described herein can be used in the practice or test of the present disclosure, preferred methods and materials are described below. All publications, patent applications, patents and other references mentioned herein are incorporated herein by reference in their entirety. The materials, methods and examples disclosed herein are illustrative only and are not intended to be restrictive.

[0087] As used herein, the terms "comprises," "including," "having," "may," "containing," and variations thereof are intended to be open-ended transitional phrases, terms, or words that do not exclude additional behavior or structural possibilities. The singular forms "a," "an," and "the" include plural references unless the context clearly indicates otherwise. Whether or not explicitly stated, the present disclosure also contemplates other embodiments that "comprise," "consist of," and "consist essentially of," the embodiments or elements presented herein.

[0088] For the purpose of expressing a numerical range herein, each intervening value between the numerical range with the same degree of precision is expressly contemplated. For example, for a range of 6 to 9, in addition to 6 and 9, the values ​​7 and 8 are also contemplated, and for a range of 6.0 to 7.0, the values ​​6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are expressly contemplated.

[0089] For the purpose of expressing a numerical range herein, each intervening value between the numerical range with the same degree of precision is expressly contemplated. For example, for a range of 6 to 9, in addition to 6 and 9, the values ​​7 and 8 are also contemplated, and for a range of 6.0 to 7.0, the values ​​6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are expressly contemplated.

[0090] As used herein, "conrrelated to" means compared to.

[0091] The term "aptamer" generally refers to an oligonucleotide of a single defined sequence or a mixture of such oligonucleotides, wherein the mixture retains the property of specifically binding to a target molecule. Thus, as used herein, "aptamer" refers to both singular and plural sequences of oligonucleotides. The term "aptamer" generally refers to a single-stranded or double-stranded nucleic acid that is capable of binding to a protein or other molecule and thereby interfering with the function of the protein or other molecule.

[0092] The term "single-stranded" oligonucleotide generally refers to an oligonucleotide containing a single covalently linked series of nucleotide residues.

[0093] The term "oligomer" or "oligonucleotide" includes an RNA or DNA sequence of more than one nucleotide in the form of a single strand or duplex, and specifically includes short sequences (such as dimers and trimers) in the form of a single strand or duplex, which can be intermediates in the production of specific binding oligonucleotides. The "modified" form used in the candidate pool contains at least one non-natural residue. "Oligonucleotide" or "oligomer" generally refers to: polydeoxyribonucleotides (containing 2'-deoxy-D-ribose or its modified form), such as DNA; polyribonucleotides (containing D-ribose or its modified form), such as RNA; and any other type of polynucleotide, which is a purine or pyrimidine base, or a modified purine or pyrimidine base or an abasic nucleotide N-glycoside or C-glycoside. "Oligonucleotide" or "oligomer" can also be used to describe artificial synthetic polymers similar to RNA and DNA, including but not limited to oligomers of peptide nucleic acids (PNA).

[0094] An "RNA aptamer" is an aptamer comprising ribonucleoside units."RNA aptamer" is also meant to encompass RNA analogs as disclosed herein.

[0095] The term "coagulation factor" generally refers to a factor that functions in either or both of the intrinsic and extrinsic coagulation cascades.

[0096] The term "RNA analogue" or "RNA derivative" or "modified RNA" generally refers to a polymeric molecule which, in addition to containing ribonucleosides as its units, comprises at least one of the following: 2'-deoxy; 2'-halo (including 2'-fluoro); 2'-amino (preferably unsubstituted or mono- or di-substituted); 2'-mono-, di- or tri-halomethyl; 2'-O-alkyl; 2'-O-halo-substituted alkyl; 2'-alkyl; azido; phosphorothioate; thiol; methylphosphonate; fluorescein; rhodamine; pyrene; biotin; xanthine; hypoxanthine; 2,6-diaminopurine ... 1-5 alkyl group substituted 2-hydroxy-6-mercaptopurine and pyrimidine bases; basic linkers; 3'-deoxyadenosine and other available "chain terminators" or "non-extendable" analogs (at the 3'-end of the RNA); or labels (such as 32 P. 33 P, etc.). All of the foregoing can be incorporated into RNA using standard synthetic techniques disclosed herein.

[0097] The terms "binding activity" and "binding affinity" generally refer to the tendency of a ligand molecule to bind or not bind to a target. The energetics of these interactions are of great significance in terms of "binding activity" and "binding affinity" because they can include the concentration of the interacting partners, the rate at which these partners are able to associate, and the definition of the relative concentrations of bound and free molecules in solution.

[0098] "Sequence identity" refers to the monomer subunits of two polymer sequences (e.g., peptides, polypeptides, nucleic acids, etc.) that have the same order of combination. The term "sequence similarity" refers to the degree to which two polymer sequences (e.g., peptides, polypeptides, nucleic acids, etc.) have similar polymer sequences. For example, similar amino acids are those that share the same biophysical characteristics and can be grouped into, for example, the following families: acidic (e.g., aspartic acid, glutamic acid), basic (e.g., lysine, arginine, histidine), non-polar (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), and uncharged polarity (e.g., glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine). "Percent sequence identity" (or "percent sequence similarity") is calculated by: (1) comparing the two best aligned sequences over a comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window); (2) determining the number of positions containing identical (or similar) monomers (e.g., the same amino acid appears in both sequences, similar amino acids appear in both sequences) to obtain the number of matched positions; (3) dividing the number of matched positions by the total number of positions in the comparison window (e.g., the length of the longer sequence, the length of the shorter sequence, a specified window); and (4) multiplying the result by 100 to obtain the percent sequence identity or percent sequence similarity. For example, if peptide A and peptide B are both 20 amino acids long and the amino acids at all positions except position 1 are identical, then peptide A and peptide B have 95% sequence identity. If the amino acids at different positions share the same biophysical characteristics (e.g., both are acidic), then peptide A and peptide B will have 100% sequence similarity. As another example, if peptide C is 20 amino acids in length and peptide D is 15 amino acids in length, and 14 of the 15 amino acids of peptide D are identical to those in a portion of peptide C, then peptides C and D have 70% sequence identity, but peptide D has 93.3% sequence identity over the best comparison window with peptide C. For the purposes of calculating "percent sequence identity" (or "percent sequence similarity") herein, any gap in the aligned sequences is considered a non-match at that position.

[0099] Embodiments of the present disclosure provide a single-stranded nucleic acid molecule having an A-type double helix structure and at least one crossover region, at least one anastomotic loop region, and at least one nucleic acid aptamer having anticoagulant activity. According to these embodiments, the single-stranded nucleic acid molecule can be a DNA molecule or an RNA molecule, or any derivative or combination thereof.

[0100] In some embodiments, the single-stranded nucleic acid molecule can be an RNA molecule including at least one nucleoside with a 2′-modification. In some embodiments, the single-stranded RNA origami molecule of the present disclosure can include at least one 2′-fluoro-dCTP or 2′-fluoro-dUTP or one other nucleoside with a 2′-modification (such as 2′-amino or 2′-O-methyl) or a backbone phosphate group (such as thiophosphate) chemical modification.

[0101] In some embodiments, the single-stranded nucleic acid molecule includes at least one tetracyclic region comprising a tetranucleotide motif. In some embodiments, the single-stranded nucleic acid molecule includes one to three tetracyclic regions, each of which includes a tetranucleotide motif. In some embodiments, the single-stranded nucleic acid molecule includes one to four aptamers with anticoagulant activity. According to these embodiments, each of the one to four aptamers replaces one of the at least one tetracyclic region. In some embodiments, the single-stranded nucleic acid molecule does not include a tetracyclic region.

[0102] In some embodiments, the single-stranded nucleic acid molecule includes at least one anastomotic loop region, and the at least one anastomotic loop region is a 180° anastomotic loop region. In some embodiments, the single-stranded nucleic acid molecule includes a 180° anastomotic loop region. In some embodiments, the single-stranded nucleic acid molecule does not include an anastomotic loop region.

[0103] In some embodiments, the single-stranded nucleic acid molecule includes a single-stranded RNA joint region. In some embodiments, the nucleic acid aptamer can be connected to one or both ends of the single-stranded RNA joint region. In some embodiments, the single-stranded nucleic acid molecule does not include anastomosis loop region or tetracyclic region.

[0104] In some embodiments, the single-stranded nucleic acid molecule includes at least one helical structure (e.g., A-type double helix structure). In some embodiments, the single-stranded nucleic acid molecule includes at least two helical structures. In some embodiments, the single-stranded nucleic acid molecule includes at least three helical structures. In some embodiments, the single-stranded nucleic acid molecule includes at least four helical structures. In some embodiments, the single-stranded nucleic acid molecule includes five or more helical structures. In some embodiments, the single-stranded nucleic acid molecule includes at least one helical structure separating two or more nucleic acid aptamers. In some embodiments, at least one helical structure separating two or more nucleic acid aptamers includes at least one nucleic acid aptamer. In some embodiments, at least one helical structure separating two or more nucleic acid aptamers does not include a nucleic acid aptamer.

[0105] In some embodiments, the nucleic acid molecule is an RNA molecule having at least 80% sequence identity to SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 85% sequence identity to SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 90% sequence identity to SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 95% sequence identity to SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 96% sequence identity to SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 97% sequence identity to SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 98% sequence identity to SEQ ID NO: 1. In some embodiments, the nucleic acid molecule is an RNA molecule having at least 99% sequence identity to SEQ ID NO: 1.

[0106] In some embodiments, the anticoagulant activity of the at least one nucleic acid aptamer comprises inhibition of one or more of Factor XIIa, Factor XIIIa, Factor XIa, Factor IXa, Factor Xa, and von Willebrand Factor. In some embodiments, nucleic acid aptamers that can be included in the RNA origami molecules disclosed herein include any aptamers involved in regulating blood coagulation, including but not limited to: ARC183 / HD1 (targeting FIIa); HD22 (targeting FIIa); HD1-22 (targeting FIIa); Tog25 (targeting FII); R9d14t (targeting FII / FIIa); 11F7t (targeting FXa); 16.3 (targeting FVIIa); 7S-1 / 7S-2 (targeting FVII); 9.3t (targeting FIXa); R4cXII-1 (targeting FXII / FXIIa); NU172 (targeting thrombin); REG1 (targeting FIX / FIXa); REG2 (targeting FIX / FIXa); ARC1779 (targeting von Willebrand factor); and ARC19499 (targeting TFPI).

[0107] In some embodiments, the anticoagulant activity of the at least one nucleic acid aptamer comprises thrombin inhibition. In some embodiments, the at least one nucleic acid aptamer comprises an antithrombin RNA R9D-14T In some embodiments, the at least one nucleic acid aptamer comprises an antithrombin Toggle-25 tRNA aptamer or a derivative thereof. In some embodiments, the nucleic acid aptamer capable of binding to thrombin exosite 1 is an RNA R9D-14T Aptamer or its derivative. In some embodiments, the nucleic acid aptamer capable of binding to thrombin exosite 2 is a Toggle-25t RNA aptamer or its derivative.

[0108] In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 1000 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 900 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 800 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 700 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 500 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 400 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 100 to about 300 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 150 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 150 to about 500 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 150 to about 400 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 150 to about 300 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 200 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 225 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 250 to about 600 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 200 to about 500 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 200 to about 450 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 200 to about 400 nucleotides. In some embodiments, the nucleic acid molecule is an RNA molecule comprising about 200 to about 350 nucleotides.

[0109] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule comprising a nucleic acid aptamer capable of binding to thrombin exosite 1 and a nucleic acid aptamer capable of binding to thrombin exosite 2, wherein the nucleic acid aptamer capable of binding to thrombin exosite 1 replaces the tetraloop region 1 of the RNA molecule, and the nucleic acid aptamer capable of binding to thrombin exosite 2 replaces the tetraloop region 2 of the RNA molecule (2HO-RNA-12NN or 2HF-RNA-12NN). In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 97% sequence identity with SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO: 2. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO:2.

[0110] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule comprising a nucleic acid aptamer capable of binding to thrombin exosite 1 and a nucleic acid aptamer capable of binding to thrombin exosite 2, wherein the nucleic acid aptamer capable of binding to thrombin exosite 1 replaces the tetraloop region 1 of the RNA molecule, and the nucleic acid aptamer capable of binding to thrombin exosite 2 replaces the tetraloop region 3 of the RNA molecule (2HO-RNA-1N2N or 2HF-RNA-1N2N). In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 97% sequence identity with SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO: 3. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO:3.

[0111] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule comprising a nucleic acid aptamer capable of binding to thrombin exosite 2 and a nucleic acid aptamer capable of binding to thrombin exosite 1, wherein the nucleic acid aptamer capable of binding to thrombin exosite 2 replaces the tetraloop region 1 of the RNA molecule, and the nucleic acid aptamer capable of binding to thrombin exosite 1 replaces the tetraloop region 4 of the RNA molecule (2HO-RNA-2NN1 or 2HF-RNA-2NN1). In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 97% sequence identity with SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO: 4. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO:4.

[0112] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule (Fss12) comprising a nucleic acid aptamer capable of binding to thrombin exosite 2 linked to one end of a single-stranded RNA linker and a nucleic acid aptamer capable of binding to thrombin exosite 1 linked to the other end of a single-stranded RNA linker. In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 97% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 98% sequence identity with SEQ ID NO: 5. In some embodiments, the RNA molecule has at least 99% sequence identity with SEQ ID NO: 5.

[0113] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule comprising two nucleic acid aptamers capable of binding to thrombin exosite 2 and two nucleic acid aptamers capable of binding to thrombin exosite 1, wherein the two nucleic acid aptamers capable of binding to thrombin exosite 2 each replace the tetraloop regions 1 and 2 of the RNA molecule, and the two nucleic acid aptamers capable of binding to thrombin exosite 1 each replace the tetraloop regions 3 and 4 of the RNA molecule (2H-2211). In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 97% sequence identity with SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO: 6. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO: 6.

[0114] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule comprising a nucleic acid aptamer capable of binding to thrombin exosite 2, a nucleic acid aptamer capable of binding to thrombin exosite 1, and an A-type double helix structure, wherein the nucleic acid aptamer capable of binding to thrombin exosite 2 replaces the tetraloop region 1 of the RNA molecule, the nucleic acid aptamer capable of binding to thrombin exosite 1 replaces the tetraloop region 4 of the RNA molecule, and the A-type double helix structure separates the nucleic acid aptamer capable of binding to thrombin exosite 2 from the nucleic acid aptamer capable of binding to thrombin exosite 1 (3H-2NN1). In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 96% sequence identity with SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 97% sequence identity to SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO: 7. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO: 7.

[0115] In some embodiments, the single-stranded nucleic acid molecule is an RNA molecule comprising a nucleic acid aptamer capable of binding to thrombin exosite 2, a nucleic acid aptamer capable of binding to thrombin exosite 1, and two A-type double helical structures, wherein the nucleic acid aptamer capable of binding to thrombin exosite 2 replaces the tetraloop region 1 of the RNA molecule, the nucleic acid aptamer capable of binding to thrombin exosite 1 replaces the tetraloop region 4 of the RNA molecule, and the two A-type double helical structures separate the nucleic acid aptamer capable of binding to thrombin exosite 2 from the nucleic acid aptamer capable of binding to thrombin exosite 1 (4H-2NN1). In some embodiments, the RNA molecule has 80% sequence identity with SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 85% sequence identity with SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 90% sequence identity with SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 95% sequence identity with SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 96% sequence identity to SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 97% sequence identity to SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 98% sequence identity to SEQ ID NO: 8. In some embodiments, the RNA molecule has at least 99% sequence identity to SEQ ID NO: 8.

[0116] Embodiments of the present disclosure also include DNA molecules encoding any of the single-stranded nucleic acid molecules described herein. As will be appreciated by those of ordinary skill in the art based on the present disclosure, the DNA molecules encoding any of the single-stranded nucleic acid molecules described herein can be single-stranded or double-stranded, and can serve as a template for generating any of the single-stranded nucleic acid molecules described herein. The DNA template can be a part of an expression plasmid or other construct for in vivo and / or in vitro biochemical reactions.

[0117] Embodiments of the present disclosure also include anticoagulant compositions. According to these embodiments, the composition includes a single-stranded nucleic acid molecule and a pharmaceutically acceptable excipient, solvent, carrier or diluent, the single-stranded nucleic acid molecule comprising an A-type double helix structure and at least one crossover region, at least one anastomotic loop region, and at least one nucleic acid aptamer with anticoagulant activity. In some embodiments, the single-stranded nucleic acid molecule additionally comprises at least one tetracyclic region. As will be appreciated by those of ordinary skill in the art based on the present disclosure, the composition can be administered to a subject or patient according to a treatment regimen to regulate blood coagulation and / or treat a disease condition in the context of a surgical procedure.

[0118] Embodiments of the present disclosure also include systems for regulating coagulation. According to these embodiments, the system includes any one of the single-stranded nucleic acid molecules described herein and at least one single-stranded nucleic acid antidote that can be bound to at least a portion of any one of the single-stranded nucleic acid molecules described herein, and the at least one single-stranded nucleic acid antidote offsets the anticoagulant activity of these single-stranded nucleic acid molecules. As those of ordinary skill in the art will recognize based on the present disclosure, the system can be used to treat a subject or patient according to a treatment regimen to regulate blood coagulation and / or treat a disease condition under the background of a surgical operation.

[0119] In some embodiments, the at least one nucleic acid antidote is a DNA molecule, an RNA molecule, an O-methyl RNA molecule, a fluoro-modified RNA molecule, a PNA molecule, an LNA molecule, or a combination or derivative thereof. In some embodiments, the at least one nucleic acid antidote binds to at least a portion of any of the single-stranded nucleic acid molecules described herein in a reverse complementary manner. In some embodiments, the at least one nucleic acid antidote binds to at least one nucleic acid aptamer of any of the single-stranded nucleic acid molecules described herein to counteract the anticoagulant activity.

[0120] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present disclosure should have the meanings commonly understood by those of ordinary skill in the art. For example, any terms and techniques used in conjunction with cell and tissue culture, molecular biology, immunology, microbiology, genetics, protein and nucleic acid chemistry, and hybridization described herein are those terms and techniques well known and commonly used in the art. The meaning and scope of the terms should be clear; however, if there is any potential ambiguity, the definitions provided herein take precedence over any dictionary or external definitions. Further, unless the context requires otherwise, singular terms should include plural terms, and plural terms should include singular terms.

[0121] 2. Design and Methods

[0122] Embodiments of the present disclosure include methods for designing and generating single-stranded nucleic acid molecules comprising nucleic acid aptamers having various therapeutic functions such as, but not limited to, anticoagulant activity. In some embodiments, the single-stranded nucleic acid molecules of the present disclosure include RNA molecules (RNA origami) comprising nucleic acid aptamers having anticoagulant activity. According to these embodiments, the present disclosure provides general steps for designing RNA origami, which include: (i) creating a 3D model, (ii) converting to a 2D model, (iii) generating a text file design from the 2D model, and (iv) analyzing the RNA sequence.

[0123] In some embodiments of RNA origami design, the A-form of the RNA double helix is ​​used (FIGs. 5A to 5B). The geometry of the helix helps determine where to place the double crossover. The design can use multiple motifs. For example, the use of anastomosing loop motifs can allow multi-helical structures to be distributed in a single-stranded path. In some embodiments, 180° anastomosing loops can be used. In addition, a tetraloop motif can be used; a tetraloop is a small tetranucleotide motif that caps the ends of the structure. The presence of the tetraloop can serve to stabilize the overall structure of the RNA molecule.

[0124] According to the method described herein, a 3D model of an RNA origami molecule can be created. For example, a 2-helix RNA origami structure is created and includes a thrombin RNA aptamer. Bioinformatics software can be used to generate files for each of the motifs, including but not limited to RNA double helices, four rings, 180 ° anastomosis loops, and RNA thrombin aptamers. Typically, a file corresponding to an A-type RNA double helix is ​​first generated because it is the basis of all other motifs. Next, a file corresponding to a 180 ° anastomosis loop ( FIG. 5B ) is added, followed by a file corresponding to the four rings, which in some cases can be extracted from a larger file ( FIG. 6A to 6B ). Finally, files corresponding to exosite 1 and exosite 2 RNA aptamers are added; again, in some cases, these files can be extracted from a larger source ( FIG. 7A to 7B ).

[0125] Once all motif files have been obtained, they can be assembled and aligned using programs such as Chimera (cgl.ucsf.edu / chimera). For example, two A-type RNA helices can be aligned, as shown in Figure 8A. Next, the nucleotides in which the crossover is located can be identified, such as with alternative coloring, which promotes the visualization of the location where the crossover is to be placed. After aligning the RNA helices, all motifs including tetraloops, anastomosing loops, and RNA aptamers can be inserted into the alignment panel (Figure 8B). The next step involves converting the structure into a single-stranded structure, which can be performed using various bioinformatics software (e.g., andersen-lab.dk), such as Fig. 9 shown.

[0126] The method of the present disclosure also includes converting the 3D model of the RNA origami molecule into a 2D model using the files described above and an appropriate software program (e.g., Assemble2 software), such as Fig.10 The 2D model is then transcribed into a text file or similar format. To generate the nucleotide sequence of the single-stranded RNA origami molecule, appropriate software (e.g., NUPACK.org) is used, and the 2D experimental file is then run through a tracking script (e.g., Anderson-lab.dk). The output code of the tracking script is shown in Fig.11A and the generated output RNA sequence is shown in Fig. 11B middle.

[0127] The method of the present disclosure also includes analyzing RNA sequences generated by software (e.g., NUPACK). In order to test the appropriate folding of RNA origami molecules, NUPACK and mfold are used. The sequence can be analyzed to select the best sequence that ensures appropriate sequence folding. For example, a sequence with suitable folding is typically a sequence with low ΔG, less than 65% GC%, and low normalized ensemble defect (NED). The less secondary structure a sequence has, the more likely it is to fold appropriately. In order to optimize the sequence, manual editing of the sequence can be performed, including but not limited to changing the position of GC base pairing to remove undesirable structures.

[0128] Embodiments of the present disclosure also include designs and methods for including nucleic acid aptamers in single-stranded nucleic acid origami molecules. Nucleic acid aptamers that can be included in single-stranded RNA origami molecules of the present disclosure can be made of RNA, DNA, PNA, or any derivatives thereof. For example, as further described herein, RNA origami molecules can include one or more nucleic acid aptamers, such as RNA aptamers that specifically bind to proteins involved in blood coagulation and regulate them. In some embodiments, the RNA aptamer exhibits anticoagulant activity by inhibiting one or more coagulation proteins, including but not limited to one or more of thrombin, factor XIIa, factor XIIIa, factor XIa, factor IXa, factor Xa, and von Willebrand factor. In some embodiments, the RNA aptamer exhibits antithrombin activity that prevents blood coagulation and prevents symptoms such as thrombosis. In some embodiments, the antithrombin RNA aptamer included in the single-stranded RNA origami molecules of the present disclosure is an RNA that binds prothrombin and thrombin at exosite 1. R9D-14T Aptamer ((A) below) and Toggle-25 aptamer binding to thrombin exosite 2 (B) below).

[0129]

[0130] Other nucleic acid aptamers that can be included in the RNA origami molecules disclosed herein include any aptamer involved in regulating blood coagulation, including but not limited to: ARC183 / HD1 (targeting FIIa); HD22 (targeting FIIa); HD1-22 (targeting FIIa); Tog25 (targeting FII); R9d14t (targeting FII / FIIa); 11F7t (targeting FXa); 16.3 (targeting FVIIa); 7S-1 / 7S-2 (targeting FVII); 9.3t (targeting FIXa); R4cXII-1 (targeting FXII / FXIIa); NU172 (targeting thrombin); REG1 (targeting FIX / FIXa); REG2 (targeting FIX / FIXa); ARC1779 (targeting von Willebrand factor); and ARC19499 (targeting TFPI).

[0131] To improve and optimize the anticoagulant activity, one to four aptamers are included in the RNA origami molecule at four different positions. For example, the double helix RNA origami (2HO-RNA-XXXX) provides four possible positions for RNA aptamers, one aptamer at each tetraloop, such as Figures 12A to 12B shown.

[0132] In some embodiments, it is determined that the binding activity of the dual RNA aptamer included in the RNA origami molecule depends at least in part on the distance between the two aptamers and the flexibility of each aptamer at different positions on the RNA origami. According to these embodiments, four configurations of the RNA aptamer are designed by including the RNA aptamer in the RNA origami, as shown in Figures 13A to 13D. For the purpose of naming, a four-digit number is added after the specific RNA origami used, such as 2HO-RNA-XXXX (no aptamer; SEQ ID NO: 1). Depending on the aptamer and the placement position, X can be replaced by a number or letter corresponding to the specific aptamer. For example, the exosite 1 binding RNA aptamer and the exosite 2 binding RNA aptamer are referred to as "1" and "2", respectively. (No aptamer is defined as "N".) Therefore, 2HO-RNA-1N2N refers to the exosite 1 binding aptamer placed at position 1 on the 2-helix RNA origami and the exosite 2 binding aptamer 2 tethered to position 3 on the origami. All four designs are depicted in Figures 13A to 13D. In subsequent experiments, the 2HO-RNA-NNNN molecule was used as a negative control.

[0133] The folding of these RNA origami structures was computationally analyzed using online software (mfold; see unafold.rna.albany.edu) and NUPACK (see nupack.org), as shown in Figures 14 to 17. The anastomosing loop formation is not shown in the simulations.

[0134] According to these embodiments, the length of the single-stranded RNA origami structure without aptamers is about 200 nucleotides, and when two aptamers are included in the RNA origami, its length is about 500 nucleotides. As will be appreciated by one of ordinary skill in the art based on the present disclosure, single-stranded RNA molecules with or without aptamers can be synthesized chemically, enzymatically, or using cell-based techniques. For example, T7 RNA polymerase can be used for RNA production via in vitro and in vivo transcription. In some embodiments, double-stranded DNA can be used as a template. For example, a DNA template can be engineered to contain a blueprint of RNA origami and a T7 promoter located at the 5′ end of the sequence.

[0135] In some embodiments, both modified and unmodified RNA origami structures can be generated. For example, the single-stranded RNA origami molecules of the present disclosure may include at least one nucleoside with a 2′-modification. In some embodiments, the single-stranded RNA origami molecules of the present disclosure may include at least one 2′-fluoro-dCTP or 2′-fluoro-dUTP or one other nucleoside with a 2′-modification (such as 2′-amino or 2′-O-methyl) or a backbone phosphate group (such as thiophosphorothioate) chemical modification.

[0136] The design and method described above can be applied to the construction of all nucleic acid molecules described herein, including those embodied in the examples and the accompanying drawings. As those of ordinary skill in the art will recognize based on the present disclosure, the design and method described above can also be used for example to generate the change of nucleic acid molecules described herein with respect to desired function (e.g., antithrombin activity).

[0137] 3. Example

[0138] It will be apparent to those skilled in the art that other suitable modifications and adaptations of the disclosed method described herein are readily applicable and understandable, and can be implemented using suitable equivalents without departing from the scope of the disclosure or the aspects and examples disclosed herein. Having now described the disclosure in detail, the disclosure will be more clearly understood by reference to the following examples, which are intended only to illustrate some aspects and embodiments of the disclosure and should not be considered to limit the scope of the disclosure. The disclosures of all journal references, U.S. patents, and publications referred to herein are hereby incorporated by reference in their entirety.

[0139] The present disclosure has several aspects, illustrated by the following non-limiting examples.

[0140] Example 1

[0141] DNA templated from G-block was amplified by polymerase chain reaction (PCR). DNA sequences were amplified and used for transcription. Each sequence was double-stranded DNA, and each had different aptamers placed, as shown in Figures 12 to 17 and Figures 35 to 39. The sequence without aptamers was used as a negative control. DNA templates were amplified from G-block by PCR for in vitro production. All DNA sequences were successfully amplified with high yields for transcription. Fig.18 and Fig.39 A 1% agarose gel with clear bands of the correct size for all amplified DNA sequences is shown. Each amplification typically yielded approximately 30 to 60 ng / ul of DNA after purification.

[0142] RNA origami was generated from amplified DNA. RNA origami was then generated by transcription. Two types of RNA origami were generated: (i) non-modified RNA origami and (ii) modified RNA origami. To generate modified RNA origami, 2′-fluoro-dCTP and -dUTP were replaced with regular CTP and UTP, and a mutant T7 RNA polymerase (Y639F) was used instead of native T7 polymerase. The difference in RNA transcribed with and without DTT can be seen in Fig.19 Thereafter, DTT was added to each transcription reaction.

[0143] Size-based analysis of RNA origami structures. Non-modified RNA and modified RNA were generated. All DNA sequences except 2H-12NN were transcribed into modified and unmodified RNA. The RNA was labeled as "2HO-RNA-XXXX" for unmodified two-helix RNA with various aptamer placements, and "2HF-RNA-XXXX" for modified two-helix RNA with various aptamer placements. RNA aptamers bound to exosite 1 and 2 were labeled "1" and "2", respectively. Fig. 20 Shown are modified and unmodified RNA bands for NNNN, 2NN1 and 1N2N sequences run through a 6% denaturing acrylamide gel at 20 W for 1 hour. Fig.21 Unmodified transcripts for NNNN and 1N2N and modified transcripts for all four sequences are shown. Fig. 20 In contrast, adding small amounts of RNA to Fig.21 After thermal annealing, a native gel was run to characterize the folded structure. Fig. 22 Shown is an example of a 6% native acrylamide gel with 2HO-RNA-2NN1 thermally annealed samples and a 1 kb DNA ladder run at 150 V for 3 hours.

[0144] Experiments were also performed to characterize the nucleic acid constructs embodied in Figures 35 to 38. Figures 35A to 35C include a representative 2D model of two aptamers included in a single-stranded RNA linker of 31 nucleotides (Fss12; Figure 35A). Figures 36A to 36C include a representative 2D model of RNA origami (2H-RNA-2211; Figure 36A), which includes four aptamers. Figures 37A to 37C include a representative 2D model of RNA origami (3H-RNA-2NN1; Figure 37A), which includes two aptamers and three A-type double helical structures. And Figures 38A to 38C include a representative 2D model of RNA origami (4H-RNA-2NN1; Figure 38A), which includes two aptamers and four A-type double helical structures. The computational analysis of the RNA origami folding of the above embodiments was analyzed using mfold RNA and NUPACK software. Purple and blue rectangles represent exosite 1 and exosite 2 binding aptamers, respectively, and yellow and green rectangles indicate tetraloop and anastomosing loop motifs, respectively.

[0145] In summary, these results provide a wide range of changes and flexibility for the construction of effective nucleic acid-based anticoagulant therapeutic agents. Specifically, these results also show the ability to produce both modified and unmodified RNA origami structures that are combined with thrombin exosites 1 and 2. This is done by amplifying the DNA sequence, then transcribing and heating annealing to produce RNA origami structures. As shown in Figures 12 to 17 and Figures 35 to 38, eight types of origami structures are produced, each with different aptamer placements (or no aptamer as a control; see Figures 13 A to 13D), and each is characterized by gel electrophoresis. Fluorine-modified NTPs and mutant T7 polymerases are used to create stable modified RNAs in blood plasma. In vitro production allows a large number of structures to be produced, creating materials that are enough to cause coagulation in blood plasma.

[0146] Example 2

[0147] Anticoagulant activity. Coagulation in human blood is the result of a series of complex reactions between various proteins in the blood, known as the blood coagulation cascade (BCC). The aptamer used herein binds to one of the proteins in the BCC, namely thrombin. By binding to thrombin, the aptamer included in the RNA origami inhibits BCC and delays coagulation. The origami uses two different aptamers to bind to the exosites 1 and 2 on the thrombin protein, thereby preventing BCC. The relative inhibition of BCC can be tested on a coagulometer using an aPTT assay. The coagulometer measures the time required for coagulation to occur after artificial induction using CaCl2. Using this method, the coagulation regulating efficacy of the single-stranded nucleic acid molecules described herein can be determined.

[0148] For the anticoagulation assay, four aptamer arrangements of both DNA and RNA were tested in a Diagnostica Stago ST4 coagulometer. The resulting data collected confirmed that no anticoagulant activity was found for the unmodified RNA origami in all aptamer arrangement designs, as the 2HN RNA origami showed the same clotting time as the standard buffer. These results also confirmed that the unmodified RNA origami was unstable in human plasma. However, the modified RNA origami showed a striking activity compared to the unmodified RNA sheet, with clotting times between 150 and 260 seconds. In addition, DNA aptamers present on DNA sheets were tested, which showed the same trend of anticoagulant activity as previously reported, and had similar activity magnitudes. The activity of all sheets tested is provided in Fig.23 middle.

[0149] The results showed that the modified RNA had similar or better effects than the DNA fragments, and the data fell within the standard deviation. Although the degree varied, 12NN, 1N2N, 2NN1( Fig.23 and 48 ) and 2211( Fig.47 and 48 ) RNA structures showed significant anticoagulant activity. The RNA origami with RNA aptamers performed as well as, if not better than, their DNA counterparts. The observed binding also further confirmed that the modified RNA is stable in human plasma.

[0150] Example 3

[0151] Specificity test. In the complex environment of the coagulation cascade and human plasma, many proteins and small molecules are involved and present in the blood. Therefore, the specific binding of the capture molecule to its target is important. Thrombin contains two active sites called exosite 1 and 2 for activating the coagulation pathway. In order to inhibit the activity of thrombin, a thrombin RNA aptamer is used, as further described herein. A functional RNA origami molecule containing two aptamers that bind to thrombin for inhibiting the coagulation process is designed. In order to test the specificity of thrombin binding to RNA origami, thrombin, factor IXa and factor Xa involved in the coagulation cascade are used together with bovine serum albumin (BSA). The binding of RNA origami-protein complexes is characterized by gel electrophoresis mobility shift assay.

[0152] The binding complex of RNA thrombin aptamer included in RNA origami (Th-RNA origami) to thrombin was tested using gel electrophoresis mobility shift assay. Eight designs of RNA origami (one without thrombin aptamer and seven with thrombin aptamer) were examined. RNA origami without thrombin aptamer (2HF-RNA-NNNN) could not bind to thrombin. All seven designs of thrombin RNA origami (2HF-RNA-12NN, 1N2N, 2NN1, Fss12, 2HF-2211, 3HF-2NN1 and 4HF-2NN1) incubated with thrombin migrated slower than RNA origami in the absence of thrombin ( Fig.24 and 41). In addition, the protein-stained gel showed that the smear pattern band of the thrombin protein appeared at the same position of the RNA-thrombin complex in the nucleic acid-stained gel. These results indicate that the RNA origami with RNA thrombin aptamers binds to thrombin.

[0153] The specificity of the Th-RNA origami with two proteins involved in the coagulation cascade (factors IXa and Xa) and one common protein (bovine serum albumin, BSA) was tested. To test the specificity, the RNA origami was incubated with the proteins at 37°C for one hour and characterized by native acrylamide gel electrophoresis. The non-aptamer present on the RNA origami (2HF-RNA-NNNN) was unable to bind to all four proteins ( Fig.25 All seven designs of RNA origami with RNA thrombin aptamers (2HF-RNA-12NN, 1N2N, 2NN1, Fss12, 2HF-2211, 3HF-2NN1, and 4HF-2NN1) showed specific binding to thrombin, as shown in Figure 2 Figures 26 to 28 And the results are shown in Figures 42 to 45.

[0154] In addition, the specific binding of thrombin DNA aptamers placed on a DNA braided sheet to the thrombin protein was tested. A 2-helix-DNA braided sheet (2HT) was used. For the DNA sheet, two aptamers called "Apt-P" and "Apt-B" were extended on each design that bound to thrombin exosites 1 and 2. The DNA sheet called "NNNN" did not contain any aptamers. For the 2HT-DNA-BPNN construct, aptamers B and P were extended from positions 1 and 2 on the DNA braided sheet ( Fig.29 ). These results indicate that thrombin binding to 2HT-DNA-NNNN was not observed.

[0155] The binding of 2HF-RNA and 2HT-DNA containing two and four aptamers to thrombin was evaluated using gel electrophoresis mobility shift assay. These results demonstrate that both RNA origami and DNA woven sheets with aptamers bind specifically to thrombin. In addition, no nonspecific binding of RNA origami to nonspecific targets (Factor IXa, Xa and BSA) was found ( Figures 26 to 28 and 42 to 45).

[0156] As further described herein, the nucleic acid constructs embodied in Figures 35 to 38 demonstrate that effective anticoagulant activity can be achieved using single-stranded RNAs linked to aptamers without tetraloop or anastomosing loop motifs (Figures 35A to 35C) when compared to using double-stranded RNA origami platforms with one or more of these motifs. Effective anticoagulant activity can also be achieved using RNA origami platforms with four aptamers but without tetraloops (Figures 36A to 36C). In addition, effective anticoagulant activity can also be achieved using RNA origami platforms with two aptamers and 2, 3, or 4 helical structures separating the aptamers.

[0157] Example 4

[0158] Stability test. RNA is a functional biomolecule that plays a key role in cell biology such as gene regulation. RNA is stable under cellular physiological conditions, but generally has a short half-life in human plasma (see figure below). In order to use functional RNA for therapeutic purposes, the stability of RNA is one of the main challenges. The 2' modification of ribose has been widely used to improve the stability of RNA under nuclease conditions such as human plasma. It has been previously reported that 2'-fluoro and 2'-amino modified nucleosides incorporated into ribozymes can resist ribonuclease degradation. Importantly, 2'-fluoro-dCTP and 2'fluoro-dUTP do not affect the catalytic activity of ribozymes. Therefore, 2'-fluoro-CTP and -UTP are selected as building blocks for the in vitro production of RNA origami.

[0159]

[0160] As shown above: (A) natural nucleotide, cytidine-5′-triphosphate (CTP) and (B to D) modified nucleotides: (B) 2′-fluoro-2′-deoxycytidine-5′-triphosphate (2′F-dCTP), (C) 2′-amino-2′-deoxycytidine-5′-triphosphate (2′-amino-dCTP) and (D) 2′-O-methylcytidine-5′-triphosphate (2′-O-methyl-CTP). Cytosine, ribose, triphosphate and 2′ modification are represented by green, blue, orange and yellow rectangles, respectively.

[0161] To test the stability of RNA origami in ribonuclease A, unmodified and modified RNA origami were incubated with ribonuclease A (10 and 500 μg / ml) at 37°C for 10 minutes to up to 24 hours. The integrity of the RNA origami was characterized by using denaturing gel electrophoresis (Figures 30-31). As the results show, in a solution containing ribonuclease, the unmodified RNA origami degraded within 10 minutes (Figure 30B). In 10 μg / ml ribonuclease, 2′-fluoro-CTP and -UTP modified RNA origami were stable for at least 6 hours (Figure 30A). At a high concentration of ribonuclease A (500 μg / ml), the modified RNA origami was stable for 30 minutes, as shown in Figure 31A.

[0162] For therapeutic applications, the stability of anticoagulants in human plasma is important. Human plasma contains multiple components, such as deoxyribonucleases (DNases) and ribonucleases that degrade DNA and RNA structures. Here, the resistance of RNA origami and DNA sheets in combined human plasma was tested. Denaturing gel electrophoresis was used to characterize the integrity of nucleic acid nanostructures. RNA origami and DNA sheets were incubated with human plasma at various time points from 10 minutes to a maximum of 24 hours. In human plasma, 2′-fluorine-modified RNA origami was stable within 24 hours, as shown in Figures 32A to 32B. The intensity of the RNA appearing at the top band in Figure 32A shows that in human plasma, a certain amount of RNA origami is still bound to thrombin. The unmodified RNA origami degraded in less than 10 minutes ( Fig.33 In human plasma, the DNA woven sheets were stable for 6 hours ( Fig.34 ). These results indicate that 2′-fluoro-modified RNA origami are more stable than DNA sheets in human plasma.

[0163] Natural RNA origami is degraded by ribonucleases in less than 10 minutes. In order to utilize functional RNA origami for therapeutic applications, the stability of RNA origami is important. These results show that in ribonuclease A, 2′-fluoro-modified RNA origami is stable for at least 6 hours. In addition, in human plasma, the modified RNA origami is stable for 24 hours, which is more stable than DNA sheets. The stability of 2′-fluoro-modified RNA origami in human plasma for 24 hours indicates that RNA origami is a promising biomolecule for use in therapeutic applications.

[0164] The storage stability of the nucleic acid aptamer constructs disclosed herein was also tested, such as Fig.46In one embodiment, the storage buffer used includes 20 mM HEPES (pH 7.4), 150 mM NaCl, and 2 mM CaCl2. As will be appreciated by one of ordinary skill in the art based on this disclosure, the composition of the storage buffer may vary by up to ±25% depending on the context in which the aptamer construct is stored. For example, Fig.46 As shown, the average anticoagulant activity of freshly prepared 2HF-RNA-2NN1 samples was compared with samples stored for up to 90 days at 4° C. The results indicate that the RNA origami anticoagulant is stable and active for at least 3 months after storage at 4° C.

[0165] According to these embodiments, the nucleic acid aptamer construct of the present disclosure can be stored in a temperature range of room temperature to -20 ° C without significant loss of anticoagulant activity. In some embodiments, before long-term storage, the nucleic acid aptamer construct of the present disclosure can be directly dissolved in a storage buffer and / or lyophilized in water (e.g., ultrapure water). In some embodiments, the nucleic acid aptamer construct of the present disclosure is first dissolved in a storage buffer or dissolved in water, and then lyophilized and stored. Before use, the nucleic acid aptamer construct can be reconstructed and allowed to fold appropriately for a period of time (e.g., 30 minutes). In other embodiments, before lyophilization, the nucleic acid aptamer construct of the present disclosure can be allowed to fold appropriately in a storage buffer. Before use, water or buffer can be added to dissolve the lyophilized construct, which will usually be functional and immediately available.

[0166] Example 5

[0167] Reversal of thrombin inhibition. Control of the coagulation cascade provides benefits for surgical and disease applications. Chemical-based anticoagulants have been developed and are often used, but due to their small therapeutic window (narrow concentration difference between therapeutic and toxic doses), patients need to be constantly monitored to prevent dangerous side effects such as hemorrhage and bleeding. An alternative solution is nucleic acid-based anticoagulants, which never cause hemorrhage and can be terminated by available antidotes.

[0168] The antidote for aptamer-based anticoagulants can be a short chain of single-stranded nucleic acid (DNA and PNA) with a nucleotide sequence complementary to the aptamer sequence. Previous studies have shown that thrombin activity can be reversed, inhibited and reactivated by adding ssDNA antidotes. This can also be demonstrated with DNA aptamers on DNA sheets. Compared with free aptamers, RNA origami with RNA aptamers provide high anticoagulant activity (as shown herein). Due to the need to interrupt the tight thrombin binding and stable folding of aptamers, the reversal of thrombin inhibition may be challenging. Here, the recovery of coagulation activity is checked by adding an antidote, which is the complementary counterpart of the outer site-1 and -2 binding aptamers. During medical procedures and disease treatment, this antidote mechanism for regulating the coagulation cascade can provide huge benefits.

[0169] As shown in Figures 50A to 50B, an antidote made of DNA of two aptamers was designed for 2HF-RNA-2NN1. After incubating the RNA origami with plasma and other reagents for aPTT assay, the antidote was added and the whole sample was further incubated for 5 minutes.

[0170] The data show that reversal of activity is possible with the addition of the antidote, as the antidote assay showed an average clotting time of approximately 85 seconds, during which time 80% was recovered (20% of thrombin was still inhibited). Incomplete reversal may be due to less effective antidote against strand invasion of one of the two aptamers or to differences in the concentration of antidote required to counteract thrombin binding. In addition, if Fig.51 As shown, peptide nucleic acid (PNA) antidotes to 2HF-RNA-2NN1 are also effective and significantly more potent than their DNA-based counterparts.

[0171] It has been shown that 2HF-RNA-2NN1 origami can also effectively inhibit and delay coagulation at concentrations as low as 0.5 μM. However, another benefit of RNA origami and RNA aptamer design is the ease of administering antidotes to the aptamers, allowing surgeons, for example, to terminate anticoagulation. Using the ssDNA antidote, the activity of thrombin can be restored by about 80%, or using the PNA antidote, by at least 80%, as demonstrated.

[0172] 4. Materials and Methods

[0173] Amplification of G-Block sequences was performed. Reaction buffer, forward and reverse primers, dNTPs, DNA polymerase, and nuclease-free water were added to the PCR tube at the concentrations shown in Table 1. DNA polymerase was added last, and the samples were pipetted to mix.

[0174] Table 1: G-block PCR concentrations and volumes.

[0175] Final concentration Reaction buffer (x) 1 Forward primer (μM) 0.5 Reverse primer (μM) 0.5 dNTP(mM) 0.2 DNA template (μl / 50μl) 2 DNA polymerase (unit / μl) 0.02 Nuclease-free water To the desired volume

[0176] Place the samples in a thermal cycler and perform PCR using the following protocol:

[0177]

[0178] After PCR, a small volume of amplified DNA samples (about 2-5 μl) are used to test in 1% agarose gel. DNA is run for 30 minutes next to 1kb ladder (Promega) at 150V. The gel is then observed under ultraviolet light (ProteinSimple instrument). If suitable band size is observed, then the remaining DNA sample is used for solution purification using GFX DNA purification kit (GE Healthcare). The purified solution of about 1 μl is used for analysis using Nanodrop3000c spectrophotometer (ThermoFisher Scientific). Record the concentration for further use, and retain DNA and mark it (2H-XXXX) for subsequent transcription.

[0179] Then carry out unmodified transcription. All contents (excluding RNAT7 polymerase) found in Table 2 below are mixed in PCR tubes. It should be noted that the DTT used is mixed in the laboratory to ensure freshness. Finally, RNAT7 polymerase is added, and the sample is pipetted to mix. Samples are synthesized on ice to try to slow down enzymes (such as ribonucleases) that have a negative impact on RNA production. After all components have been added and mixed, the sample is placed in a thermal cycler and incubated at 37°C for 4 to 16 hours, and then maintained at 4°C.

[0180] Table 2: Unmodified transcript contents and concentrations.

[0181] Final concentration Transcription NEB Buffer (x) 1 Fresh DTT (mM) 5 NTP (mM each) 2.5 DNA template (ng) 120 RNA T7 polymerase (μl / 50μl) 2.5 Nuclease-free water To the desired volume

[0182] For fluoro-modified transcription, the same protocol as above was followed, but using the contents found in Table 3 below:

[0183] Table 3: Fluoro-modified transcript content and concentration.

[0184] Final concentration Transcription NEB Buffer (x) 1 Fresh DTT (mM) 10 Modified NTP (mM each) 2.5 DNA template (ng) 120 Mutated RNA T7 polymerase (μl / 50μl) 2.5 Nuclease-free water To the desired volume

[0185] After transcription, a small volume of sample (about 5 μl) was used for observation in a 6% acrylamide denaturing gel. The sample was run at 20W next to the nucleic acid maker for 1 hour. The gel was then observed under UV light to check for the correct length. If the sequence length was correct and the desired band was present, the sample was then purified using the Monarch RNA Clean-Up kit. About 31 μl of elution buffer was used for purification, and 1 μl of sample was used for analysis using the Nanodrop 3000c. The optical density (A260) was recorded, and the molar concentration of the sample was calculated according to Beer's law.

[0186] The samples were then thermally annealed by heating at 95°C for 5 minutes, followed by cooling at -20°C for 3 minutes. 5X DNA Flake Buffer was then added, and the samples were heated to 37°C for 30 minutes. The samples were diluted to the desired volume using 1X DNA Flake Buffer for further use.

[0187] The APPT clotting assay evaluated the clotting time of pooled human plasma with DNA / RNA chips with anticoagulant aptamers. Approximately 16.67 μL of both 5 μM RNA and DNA chip samples were tested in 50 μL of pooled human plasma, 50 μL of aPTT reagent, and 50 μL of CaCl2 solution.

[0188] For specificity assays, heat-annealed RNA origami or DNA woven sheets (5 pmol) were dissolved in 1X annealing buffer and incubated with protein (25 pmol) at 37°C for 1 hour. The samples were run on 6% acrylamide gel electrophoresis at 150 V for 3 hours in 1X TBE as running buffer. The gel was stained with ethidium bromide for nucleic acid staining and visualized under UV light. The gel was then further stained with Coomassie blue for protein staining and imaged with a ProteinSimple instrument.

[0189] To fold RNA origami, unmodified and modified RNA origami were dissolved in nuclease-free water and heated at 95°C for 5 minutes and rapidly cooled at -20°C for 3 minutes. The samples were then mixed with 5X annealing buffer to reach the concentration at 1X buffer and annealed at 37°C for 30 minutes. Finally, 1x buffer was added to the folded RNA origami to reach the desired concentration. The folded RNA origami (1 μl, 5 μM) was mixed with ribonuclease A (1 μl each of 10 and 500 μg / ml) or human plasma (3 μl) and incubated at 37°C for various time periods from 10 minutes to 24 hours. The integrity of the RNA origami was characterized by denaturing gel electrophoresis. For denaturing gel electrophoresis, the gel was pre-run at 20 W for 15 minutes and the sample was run at 20 W for 1 hour. Finally, the gel was stained with ethidium bromide for nucleic acid staining. The nucleic acid bands were visualized under the UV light of the ProteinSimple instrument.

[0190] For the antidote test, a coagulation test was run in an activated partial thromboplastin time (APTT) assay using an ST4 coagulometer (Diagnostica Stago). Approximately 50 μL of combined human plasma (George King Bio-Medical) was added to each cuvette, mixed with 50 μL of aPTT reagent (TriniClot), and incubated at 37°C for 5 minutes. Then 13.67 μL of 6.09 μM RNA origami sample or buffer was added, and incubated for another 5 minutes at 37°C. After five minutes, 3.00 μL of DNA or PNA antidote was added, and incubated for another 5 minutes at 37°C. To activate coagulation, 50 μL of CaCl2 solution was added. The final concentration of the RNA sample was 0.5 μM. The coagulation time was then measured by machine and recorded.

[0191] 5. Sequence

[0192] The present disclosure provides the following nucleic acids, as cited herein.

[0193] RNA-NNNN (SEQ ID NO: 1)

[0194]

[0195] RNA-12NN (SEQ ID NO: 2)

[0196]

[0197] RNA-1N2N (SEQ ID NO: 3)

[0198]

[0199] RNA-2NN1 (SEQ ID NO: 4)

[0200]

[0201]

[0202] Fss12 (SEQ ID NO: 5)

[0203]

[0204] 2H-2211 (SEQ ID NO: 6)

[0205]

[0206] 3H-2NN1 (SEQ ID NO: 7)

[0207]

[0208] 4H-2NN1 (SEQ ID NO: 8)

[0209]

[0210]

[0211] The Gblock sequence is provided below (T7 promoter in bold).

[0212] 2H-DNAGblock-NNNN (SEQ ID NO: 9)

[0213]

[0214] 2H-DNAGblock-12NN (SEQ ID NO: 10)

[0215]

[0216] 2H-DNAGblock-1N2N (SEQ ID NO: 11)

[0217]

[0218]

[0219] 2H-DNAGblock-2NN1 (SEQ ID NO: 12)

[0220]

[0221] DNAGblock-Fss12 (SEQ ID NO: 13)

[0222]

[0223] 2H-DNAGblock-2211 (SEQ ID NO: 14)

[0224]

[0225] 3H-DNAGblock-2NN1 (SEQ ID NO: 15)

[0226]

[0227]

[0228] 4H-DNAGblock-2NN1 (SEQ ID NO: 16)

[0229]

[0230] The DNA and PNA antidote sequences are provided below.

[0231] Anti_Ex1_A06 (SEQ ID NO: 17)

[0232] GTCTGCCTCGTACATTGGCT

[0233] Anti_Ex2_Full (SEQ ID NO: 18)

[0234] GGGTAAGTACTTCAGCTTTGTTCCC

[0235] Anti_Ex1_PNA_A06 (SEQ ID NO: 19)

[0236] GTCTGCCTCGTACATTGGCT

[0237] Anti_Ex2_PNA_19nt(SEQ ID NO: 20)

[0238] GTACTTCAGCTTTGTTCCC

[0239] It will be apparent to those skilled in the art that other suitable modifications

[0240] It should be understood that the foregoing detailed description and accompanying examples are illustrative only and should not be taken as limiting the scope of the present disclosure, which is defined solely by the appended claims and their equivalents.

[0241] Various changes and modifications to the disclosed embodiments will be apparent to those skilled in the art. Such changes and modifications, including but not limited to those related to the chemical structures, substituents, derivatives, intermediates, syntheses, compositions, formulations or methods of use of the present disclosure, may be made without departing from the spirit and scope of the present disclosure. Sequence Listing <110> University of North Carolina <120> Compositions and methods related to nucleic acid anticoagulants <130> NCSU-37060.601 <150> US 62 / 750,900 <151> 2018-10-26 <160> 20 <170> PatentIn version 3.5 <210> 1 <211> 210 <212> RNA <213> Artificial sequence <220> <223> Synthetic <400> 1 gggagaucga gcgacuuccg acuucggucg ggagucgggc uagucaucuu cggaugauua 60 gccgcuggug aagccuccac gccagccucg gucucccgca guaggaucgg acugaaggag 120 gcacgguccc agccgaagug ucuugcuucg gcaaggcacu uuggcugcua gacuggcugg 180 cuucggccag cuaguuuagg auucuaugc 210 <210> 2 <211> 279 <212> RNA <213> Artificial sequence <220> <223> Synthetic <400> 2 gggagaucga gcgacuuccg acuucggucg ggagucgggc uagucaucgg gaacaaagcu 60 gaaguacuua cccgaugauu agccgcuggu gaagccucca cgccagccuc ggucucccgc 120 aguaggaucg gacugaagga ggcacggucc cagccgaagu gucuggcggu cgaucacaca 180 guucaaacgu aauaagccaa uguacgaggc agacgacucg ccaggcacuu uggcugcuag 240 acuggcuggc uucggccagc uaguuuagga uucuauugc 279 <210> 3 <211> 279 <212> RNA <213> Artificial sequence <220> <223> Synthetic <400> 3 gggagaucga gcgacuuccg acgggaacaa agcugaagua cuuacccguc gggagucggg 60 cuagucaucu ucggaugauu agccgcuggu gaagccucca cgccagccuc ggucucccgc 120 aguaggaucg gacugaagga ggcacggucc cagccgaagu gucuggcggu cgaucacaca 180 guucaaacgu aauaagccaa uguacgaggc agacgacucg ccaggcacuu uggcugcuag 240 acuggcuggc uucggccagc uaguuuagga uucuauugc 279 <210> 4 <211> 285 <212> RNA <213> Artificial sequence <220> <223> Synthetic <400> 4 gggagaucga gcgacuuccg acuucggucg ggagucgggc uagucaucuu cggaugauua 60 gccgcuggug aagccuccac gccagccucg gucucccgca guaggaucgg acugaaggag 120 gcacgguccc agccgaagug ucuugcggga acaaagcuga aguacuuacc cgcaaggcac 180 uuuggcugcu agacuggcug gcggcggucg aucacacagu ucaaacguaa uaagccaaug 240 uacgaggcag acgacucgcc gccagcuagu uuaggauucu auugc 285 <210> 5 <211> 114 <212> RNA <213> Artificial sequence <220> <223> Synthetic <400> 5 gggaacaaag cugaaguacu uacccaccuu accacuccaccucacucacc uauuacggcg 60 gucgaucaca caguucaaac guaauaagcc aauguacgag gcagacgacu cgcc 114 <210> 6 <211> 378 <212> RNA <213> Artificial sequence <220> <223> Synthetic <400> 6 gggagaucga gcgacuuccg acucuggcgg ucgaucacac aguucaaacg uaauaagcca 60 auguacgagg cagacgacuc gccagagucg ggagucgggc uagucaucag gcacgggaac 120 aaagcugaag uacuuacccg ugccugauga uuagccgcug gugaagccuc cacgccagcc 180 ucggucuccc gcaguaggau cggacugaag gaggcacggu cccagccgaa gugucuugcg 240 ggaacaaagc ugaaguacuu acccgcaagg cacuuuggcu gcuagacugg cuggcggcgg 300 ucgaucacac aguucaaacg uaauaagcca auguacgagg cagacgacuc gccgccagcu 360 aguuuaggau ucuauugc 378 <210> 7 <211> 385 <212> RNA <213> Artificial sequence <220> <223> Synthetic <400> 7 ggaaaugaug ccgaguugac gcuucggcgu cagcucgccc uguggccuag uucgcuaggu 60 cacagacauc uuggcguucg cgccaggaug ucucgcccaa uuccguaggg cgaggguagc 120 caaauccaga ggcuagcauu auuuccgauc uaggaucgcg uugagaacug gauacucaac 180 agcgguaaac ggaaaaccgc ucagccgaag ugucuugcgg gaacaaagcu gaaguacuua 240 cccgcaaggc acuuuggcug gccacgcguc guauucguac ggcgcgugcu agacuggcug 300 gcggcggucg aucacacagu ucaaacguaa uaagccaaug uacgaggcag acgacucgcc 360 gccagcuagu uuaggauucu agauc 385 <210> 8 <211> 485 <212> RNA <213> Artificial sequence <220> <223> Synthetic <400> 8 ggaaaugaug ccgaguugac gcuucggcgu cagcucgccc uguggccuag uucgcuaggu 60 cacagccgac cauugcguuu cgacgcagug gucacaucuu ggcguucgcg ccaggauguc 120 ucgcccaauu ccguagggcg aggggaccca aaucccuagg gucgguagcc aaauccagag 180 gcuagcauua uuuccgaucu aggaucgcgu ugagaacugg auacucaacc guggcauaaa 240 gggauaaugc caagcgguaa acggaaaacc gcucagccga agugucuugc gggaacaaag 300 cugaaguacu uacccgcaag gcacuuuggc ugcguggcgu uacaguucgc ugugacgcca 360 gccacgcguc guauucguac ggcgcgugcu agacuggcug gcggcggucg aucacacagu 420 ucaaacguaa uaagccaaug uacgaggcag acgacucgcc gccagcuagu uuaggauucu 480 agauc 485 <210> 9 <211> 261 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 9 cactttcagc cctcttatcc tcggcggatc cttctaatac gactcactat agggagatcg 60 agcgacttcc gacttcggtc gggagtcggg ctagtcatct tcggatgatt agccgctggt 120 gaagcctcca cgccagcctc ggtctcccgc agtaggatcg gactgaagga ggcacggtcc 180 cagccgaagt gtcttgcttc ggcaaggcac tttggctgct agactggctg gcttcggcca 240 gctagtttag gattctattg c 261 <210> 10 <211> 330 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 10 cactttcagc cctcttatcc tcggcggatc cttctaatac gactcactat agggagatcg 60 agcgacttcc gacttcggtc gggagtcggg ctagtcatcg ggaacaaagc tgaagtactt 120 acccgatgat tagccgctgg tgaagcctcc acgccagcct cggtctcccg cagtaggatc 180 ggactgaagg aggcacggtc ccagccgaag tgtctggcgg tcgatcacac agttcaaacg 240 taataagcca atgtacgagg cagacgactc gccaggcact ttggctgcta gactggctgg 300 cttcggccag ctagtttagg attctattgc 330 <210> 11 <211> 330 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 11 cactttcagc cctcttatcc tcggcggatc cttctaatac gactcactat agggagatcg 60 agcgacttcc gacgggaaca aagctgaagt acttacccgt cgggagtcgg gctagtcatc 120 ttcggatgat tagccgctgg tgaagcctcc acgccagcct cggtctcccg cagtaggatc 180 ggactgaagg aggcacggtc ccagccgaag tgtctggcgg tcgatcacac agttcaaacg 240 taataagcca atgtacgagg cagacgactc gccaggcact ttggctgcta gactggctgg 300 cttcggccag ctagtttagg attctattgc 330 <210> 12 <211> 336 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 12 cactttcagc cctcttatcc tcggcggatc cttctaatac gactcactat agggagatcg 60 agcgacttcc gacttcggtc gggagtcggg ctagtcatct tcggatgatt agccgctggt 120 gaagcctcca cgccagcctc ggtctcccgc agtaggatcg gactgaagga ggcacggtcc 180 cagccgaagt gtcttgcggg aacaaagctg aagtacttac ccgcaaggca ctttggctgc 240 tagactggct ggcggcggtc gatcacacag ttcaaacgta ataagccaat gtacgaggca 300 gacgactcgc cgccagctag tttaggattc tattgc 336 <210> 13 <211> 165 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 13 cactttcagc cctcttatcc tcggcggatc cttctaatac gactcactat agggaacaaa 60 gctgaagtac ttacccacct taccactcca cctcactcac ctattacggc ggtcgatcac 120 acagttcaaa cgtaataagc caatgtacga ggcagacgac tcgcc 165 <210> 14 <211> 429 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 14 cactttcagc cctcttatcc tcggcggatc cttctaatac gactcactat agggagatcg 60 agcgacttcc gactctggcg gtcgatcaca cagttcaaac gtaataagcc aatgtacgag 120 gcagacgact cgccagagtc gggagtcggg ctagtcatca ggcacgggaa caaagctgaa 180 gtacttaccc gtgcctgatg attagccgct ggtgaagcct ccacgccagc ctcggtctcc 240 cgcagtagga tcggactgaa ggaggcacgg tcccagccga agtgtcttgc gggaacaaag 300 ctgaagtact tacccgcaag gcactttggc tgctagactg gctggcggcg gtcgatcaca 360 cagttcaaac gtaataagcc aatgtacgag gcagacgact cgccgccagc tagtttagga 420 ttctattgc 429 <210> 15 <211> 472 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 15 cggccagtga attcgagctc ggtacccggg agatctcact ttcagccctc ttatcctcgg 60 ccgatccttc taatacgact cactatagga aatgatgccg agttgacgct tcggcgtcag 120 ctcgccctgt ggcctagttc gctaggtcac agacatcttg gcgttcgcgc caggatgtct 180 cgcccaattc cgtagggcga gggtagccaa atccagaggc tagcattatt tccgatctag 240 gatcgcgttg agaactggat actcaacagc ggtaaacgga aaaccgctca gccgaagtgt 300 cttgcgggaa caaagctgaa gtacttaccc gcaaggcact ttggctggcc acgcgtcgta 360 ttcgtacggc gcgtgctaga ctggctggcg gcggtcgatc acacagttca aacgtaataa 420 gccaatgtac gaggcagacg actcgccgcc agctagttta ggattctaga tc 472 <210> 16 <211> 572 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 16 cggccagtga attcgagctc ggtacccggg agatctcact ttcagccctc ttatcctcgg 60 ccgatccttc taatacgact cactatagga aatgatgccg agttgacgct tcggcgtcag 120 ctcgccctgt ggcctagttc gctaggtcac agccgaccat tgcgtttcga cgcagtggtc 180 acatcttggc gttcgcgcca ggatgtctcg cccaattccg tagggcgagg ggacccaaat 240 ccctagggtc ggtagccaaa tccagaggct agcattattt ccgatctagg atcgcgttga 300 gaactggata ctcaaccgtg gcataaaggg ataatgccaa gcggtaaacg gaaaaccgct 360 cagccgaagt gtcttgcggg aacaaagctg aagtacttac ccgcaaggca ctttggctgc 420 gtggcgttac agttcgctgt gacgccagcc acgcgtcgta ttcgtacggc gcgtgctaga 480 ctggctggcg gcggtcgatc acacagttca aacgtaataa gccaatgtac gaggcagacg 540 actcgccgcc agctagttta ggattctaga tc 572 <210> 17 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 17 gtctgcctcg tacattggct 20 <210> 18 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 18 gggtaagtac ttcagctttg ttccc 25 <210> 19 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 19 gtctgcctcg tacattggct 20 <210> 20 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 20 gtacttcagc tttgttccc 19

Claims

1. A single-stranded nucleic acid molecule comprising: at least one A-form double helix and at least one crossover region; at least one anastomotic ring region, wherein the at least one anastomotic ring region is a 180° anastomotic ring region; At least one four-ring area; and one to four nucleic acid aptamers with anticoagulant activity; The nucleic acid molecule is an RNA molecule consisting of at least one of SEQ ID NOs: 1-8. 2 . The nucleic acid molecule according to claim 1 , wherein the nucleic acid molecule is an RNA molecule comprising at least one nucleoside having a 2′-modification.

3. A nucleic acid molecule according to claim 1 or claim 2, wherein the nucleic acid molecule consists of SEQ ID NO: 2 and comprises: a nucleic acid aptamer capable of binding to thrombin exosite 1; and Aptamers capable of binding to exosite 2 of thrombin.

4. The nucleic acid molecule according to claim 1 or claim 2, wherein the nucleic acid molecule consists of SEQ ID NO: 3 and comprises: a nucleic acid aptamer capable of binding to thrombin exosite 1; and Aptamers capable of binding to exosite 2 of thrombin.

5. The nucleic acid molecule according to claim 1 or claim 2, wherein the nucleic acid molecule consists of SEQ ID NO: 4 and comprises: a nucleic acid aptamer capable of binding to thrombin exosite 2; and Aptamers capable of binding to thrombin exosite 1.

6. The nucleic acid molecule according to claim 1 or claim 2, wherein the nucleic acid molecule consists of SEQ ID NO: 5 and comprises: a nucleic acid aptamer capable of binding to thrombin exosite 2 attached to one end of a single-stranded RNA linker; and A nucleic acid aptamer capable of binding to thrombin exosite 1 is attached to the other end of the single-stranded RNA linker.

7. The nucleic acid molecule according to claim 1 or claim 2, wherein the nucleic acid molecule consists of SEQ ID NO: 6 and comprises: two nucleic acid aptamers capable of binding to thrombin exosite 2; and Two nucleic acid aptamers capable of binding to exosite 1 of thrombin.

8. The nucleic acid molecule according to claim 1 or claim 2, wherein the nucleic acid molecule consists of SEQ ID NO: 7 and comprises: a nucleic acid aptamer capable of binding to thrombin exosite 2; a nucleic acid aptamer capable of binding to thrombin exosite 1; and At least one A-type double helix structure separates the nucleic acid aptamer capable of binding to thrombin exosite 2 from the nucleic acid aptamer capable of binding to thrombin exosite 1.

9. The nucleic acid molecule according to claim 1 or claim 2, wherein the nucleic acid molecule consists of SEQ ID NO: 8 and comprises: a nucleic acid aptamer capable of binding to thrombin exosite 2; a nucleic acid aptamer capable of binding to thrombin exosite 1; and At least two A-type double helix structures separate the nucleic acid aptamer capable of binding to thrombin exosite 2 from the nucleic acid aptamer capable of binding to thrombin exosite 1.

10. The nucleic acid molecule according to any one of claims 3 to 9, wherein the nucleic acid aptamer capable of binding to thrombin exosite 1 is RNA R9D-14T Aptamer, and wherein the nucleic acid aptamer capable of binding to thrombin exosite 2 is a Toggle-25t RNA aptamer.

11. A DNA molecule encoding any one of the single-stranded nucleic acid molecules according to any one of claims 1 to 10.

12. An anticoagulant composition comprising: Any one of the single-stranded nucleic acid molecules according to any one of claims 1 to 10; and Pharmaceutically acceptable excipients.

13. An anticoagulant composition comprising: Any one of the single-stranded nucleic acid molecules according to any one of claims 1 to 10; and A pharmaceutically acceptable solvent.

14. An anticoagulant composition comprising: Any one of the single-stranded nucleic acid molecules according to any one of claims 1 to 10; and A pharmaceutically acceptable carrier.

15. An anticoagulant composition comprising: Any one of the single-stranded nucleic acid molecules according to any one of claims 1 to 10; and A pharmaceutically acceptable diluent.

16. A system for regulating coagulation, the system comprising: Any one of the single-stranded nucleic acid molecules according to any one of claims 1 to 10; and At least one single-stranded nucleic acid antidote capable of binding to at least a portion of any one of the single-stranded nucleic acid molecules of any one of claims 1 to 10 to counteract the anticoagulant activity of the single-stranded nucleic acid molecule of any one of claims 1 to 10.

17. The system of claim 16, wherein the at least one single-stranded nucleic acid antidote is a DNA molecule, an RNA molecule, or a combination or derivative thereof.

18. The system of claim 16, wherein the at least one single-stranded nucleic acid antidote is an O-methyl RNA molecule or a fluoro-modified RNA molecule.

19. The system of claim 16, wherein the at least one single-stranded nucleic acid antidote is a PNA molecule or a LNA molecule.

20. The system of any one of claims 16-19, wherein the at least one single-stranded nucleic acid antidote binds in a reverse-complementary manner to at least a portion of any one of the single-stranded nucleic acid molecules of any one of claims 1 to 10.

21. The system of any one of claims 16-20, wherein the at least one single-stranded nucleic acid antidote binds to a nucleic acid aptamer of any one of the single-stranded nucleic acid molecules of any one of claims 1 to 10 to counteract the anticoagulant activity.

Images