A method for regenerating functional retinal ganglion cells using transcription factors

Abstract

The present application belongs to the field of biological medicine research, and specifically provides the use of a transcription factor in one or more of the following: preparation of a retinal disease treatment drug; preparation of a retinal ganglion cell regeneration product; preparation of a product for inducing reprogramming of adult cells into retinal ganglion cells; preparation of a retinal ganglion cell; the transcription factor is selected from any one or more of Brn3B, Sox4, Atoh7, Sox11 and Isl1. The cell material used for the regenerated retinal ganglion cells is the endogenous cells of the self, and compared with the cell transplantation, there is no risk of immune rejection and tumorigenesis; the use of viral expression genes is simple and easy to popularize.

Description

Technical Field

[0001] This invention belongs to the field of biomedical research, specifically relating to a method for regenerating functional retinal ganglion cells using transcription factors. Background Technology

[0002] Retinal ganglion cells are the only neurons in the retina that transmit nerve signals to the brain. Their lesions and death are a major cause of blindness. Diseases related to retinal ganglion cell disorders are very common clinically, mainly including glaucoma and hereditary optic neuropathy.

[0003] According to the latest statistics, there are currently 79.6 million glaucoma patients worldwide, of whom 11.2 million may eventually become blind in both eyes. Epidemiological data in my country shows that the prevalence of glaucoma in people aged 40 and above is 2.3%, with a blindness rate of approximately 30%. It is estimated that by 2020, there will be 21 million glaucoma patients in my country, and the number of people blinded as a result will reach 6.3 million, placing a heavy economic burden on patients' families and society.

[0004] Regenerating retinal ganglion cells to rebuild the neural connection between the retina and the brain is the ideal method for restoring vision to patients blinded by retinal ganglion cell disease, and it is currently a hot topic of competition in the global field of regenerative medicine. Methods for regenerating retinal ganglion cells mainly fall into two categories: one involves transplanting retinal ganglion cells differentiated from embryonic stem cells into animals from outside the body; the other utilizes other cells from the animal retina to regenerate ganglion cells. In addition, some studies attempt to regrow axons in retinal ganglion cells with axonal degeneration but surviving cell bodies, thereby establishing a connection between the retina and the brain.

[0005] Despite extensive work on retinal ganglion cell regeneration, there are currently no successful cases of regenerating functional retinal ganglion cells in adult mammals. This invention represents a breakthrough in this field. Summary of the Invention

[0006] In order to overcome the problems existing in the prior art, the present invention aims to provide a method for regenerating functional retinal ganglion cells using transcription factors.

[0007] To achieve the above-mentioned objectives and other related objectives, the present invention adopts the following technical solution:

[0008] A first aspect of the invention provides the use of transcription factors in one or more of the following, wherein the use is for non-therapeutic purposes:

[0009] 1) Preparation of drugs for the treatment of retinal diseases;

[0010] 2) Preparation of retinal ganglion cell regeneration products;

[0011] 3) Prepare products that induce adult cells to reprogram into retinal ganglion cells;

[0012] 4) Preparation of retinal ganglion cells;

[0013] The transcription factors are selected from any one or more of Brn3B, Sox4, Atoh7, Sox11, and Isl1.

[0014] A third aspect of the present invention provides a method for preparing retinal ganglion cells, comprising at least the following steps: applying transcription factors to adult cells to convert them into retinal ganglion cells; wherein the transcription factors are selected from any one or more of Brn3B, Sox4, Atoh7, Sox11, and Isl1.

[0015] A fourth aspect of the present invention provides a recombinant cell obtained by introducing a polynucleotide or nucleic acid construct capable of expressing a transcription factor into a host cell, wherein the transcription factor is selected from any one or more of Brn3B, Sox4, Atoh7, Sox11, and Isl1.

[0016] The fifth aspect of the present invention provides a product characterized in that the product comprises a transcription factor selected from any one or more of Brn3B, Sox4, Atoh7, Sox11, and Isl1, and the product is suitable for retinal ganglion cell regeneration, inducing adult cell reprogramming into retinal ganglion cells, or treating retinal diseases.

[0017] The sixth aspect of the present invention provides a method for treating retinal diseases, comprising at least the following steps: administering an effective amount of a transcription factor to a subject suffering from a retinal disease, said transcription factor being selected from any one or more of Brn3B, Sox4, Atoh7, Sox11, and Isl1.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The regenerated retinal ganglion cells described in this invention use endogenous cells from the patient's own cells, which eliminate the risk of immune rejection and tumor formation compared to cell transplantation. Furthermore, the use of viral gene expression is simple, easy to implement, and readily applicable.

[0020] This invention utilizes AAV virus as a gene delivery vector to transform one type of nerve cell into another through in vivo cell fate reprogramming, thereby achieving nerve cell regeneration and neural circuit reconstruction for disease treatment and functional recovery. Specifically, it reprograms amacrine and misplaced amacrine cells in the retina into retinal ganglion cells—the only output neurons in the retina—reconstructing the neural connection between the retina and the brain, enabling blind animals or patients to regain their sight. Attached Figure Description

[0021] Figure 1 Retinal neurons possess regenerative capabilities. a, Mouse retinal slice image; Lgr5-positive cells are located in the intermediate cell layer (nuclear layer) of the retina and are a type of fully differentiated amacrine interneurons. b, In Lgr5 EGFP-IRES-CreERT2 In Rosa26-tdTomato mice, Lgr5-positive aneurysmal neurons transform into bipolar cells. EGFP-IRES-CreERT2 In Rosa26-tdTomato mice, Lgr5-positive aneurysms transformed into horizontal cells. Lgr5-positive aneurysms migrated from the nuclear lamina to the retinal ganglion cell layer.

[0022] Figure 2 In mature mice, Lgr5-positive aneurysmal neurons were reprogrammed into retinal ganglion cells. a) In vivo cell reprogramming strategy. b) Structure of the viral vector used for reprogramming. c) Retinal patch of mice injected intravitreal with the control virus; no ganglion cell regeneration was observed. d) Optic nerve slice of mice injected intravitreal with the control virus; no axons of regenerated ganglion cells were observed. e) Image of a retinal patch injected intravitreal with a transcription factor-expressing virus. f) Magnified view of a portion of image e; arrows indicate the axons of successfully regenerated retinal ganglion cells. g) Magnified view of a regenerated retinal ganglion cell.

[0023] Figure 3 Retinal ganglion cells regenerated from Lgr5-positive aneurysmal neurons. a) The regenerated retinal ganglion cells are located in the ganglion cell layer of the retina and extend axons outward from the cell body. b) The axons of the regenerated retinal ganglion cells converge at the optic papilla and grow towards the optic nerve. c) The regenerated retinal ganglion cells express the ganglion cell-specific molecule RBPMS. d) The regenerated retinal ganglion cells express the ganglion cell-specific molecule Brn3A. e) The regenerated retinal ganglion cells express CART, a ganglion cell-specific molecule that is selective for light and dark and for direction.

[0024] Figure 4The regenerated retinal ganglion cells express SMI-32, a molecule specific to alpha ganglion cells.

[0025] Figure 5 The reprogramming of Lgr5-positive aneurysmal neurons into retinal ganglion cells promotes the migration of these cells from the nuclear layer to the ganglion cell layer.

[0026] Figure 6 Regenerated retinal ganglion cells extend axons to the optic nerve and different visual nuclei in the brain. a, Optic nerve. b, Dorsal lateral geniculate nucleus. c, Ventral lateral geniculate nucleus. d, Oliveary pretectal nucleus. e, Superior colliculus. f, Enlarged view of the superior colliculus. gI, PSD-95 histochemical staining of the superior colliculus in a brain slice, showing that the axon terminals of regenerated retinal ganglion cells form synaptic structures with downstream neurons in the superior colliculus.

[0027] Figure 7 The efficiency of different combinations of transcription factors in reprogramming Lgr5-positive aneurysmal neurons into retinal ganglion cells.

[0028] Figure 8 Prokr2 CreERT2 Construction and analysis of knock-in mice. a, Mouse construction strategy diagram. bd, Prokr2 CreERT2 Retinal sections and RBPMS staining images of Rosa26-tdTomato mice. Prokr2-tdTomato positive cells do not express the ganglion cell-specific marker RBPMS. e,Prokr2 CreERT2 Rosa26-tdTomato mouse brain slices. f, RBPMS. e, Prokr2 CreERT2 ; A partial image of the superior colliculus of a Rosa26-tdTomato mouse brain slice. g,Prokr2 CreERT2 Optic nerve slices from Rosa26-tdTomato mice.

[0029] Figure 9 Prokr2-positive misaligned non-long-processed cells are reprogrammed into ganglion cells. a,Prokr2 CreERT2; Rosa26-tdTomato mouse retinal patch. b, magnified view of a. c, retinal patch showing regenerated retinal ganglion cells. d, magnified view of c. e, optic nerve slice. fk, projection of regenerated retinal ganglion cells onto nerve axons in different brain regions. f, lateral geniculate nucleus. g, anterior olivotectal nucleus. h, superficial superior colliculus. I, magnified view of h. j, basal superior colliculus. k, magnified view of j.

[0030] Figure 10 Strategies and efficiency of reprogramming Prokr2-positive misaligned amygdalae into ganglion cells. a, Reprogramming strategies. b, Structure diagram of the AAV expression plasmid used in reprogramming. c, Reprogramming efficiency of different transcription factor combinations.

[0031] Figure 11 Regenerated retinal ganglion cells possess physiological functions in vivo. (ad) In vivo neuronal calcium imaging results. (ad) In vivo neuronal calcium imaging results. (a) Changes in calcium signals at the axonal terminals of regenerated retinal ganglion cells in the superior colliculus of the mouse brain in response to visual stimuli. The three nerve endings in the figure emit nerve signals in response to visual stimuli (on response). (b) The figure shows three nerve endings with off-response. (c) Nerve endings with motor angle selectivity. (d) Nerve endings with motor direction selectivity. (ej) Optogenetic experimental results. (e) Neurotransmitters released by the axonal terminals of regenerated ganglion cells under light stimulation can generate AMPA receptor-mediated excitatory postsynaptic currents (EPSCs) in downstream superior colliculus neurons. (f) Neurotransmitters released by the axonal terminals of regenerated ganglion cells under light stimulation can generate NMDA receptor-mediated excitatory postsynaptic currents (EPSCs) in downstream superior colliculus neurons. (g) Neurotransmitters released by the axonal terminals of regenerated ganglion cells under light stimulation can generate action potentials in downstream superior colliculus neurons. h and i: Statistical analysis of the intensity and number of peaks of excitatory postsynaptic currents (EPSCs) mediated by AMPA receptors in superior colliculus neurons. j: Statistical analysis of the intensity of excitatory postsynaptic currents (EPSCs) mediated by NMDA receptors in superior colliculus neurons.

[0032] Figure 12 This study uses calcium imaging technology to analyze the physiological function of regenerated retinal ganglion cells in live animals. a) Schematic diagram of in vivo calcium imaging. b) Image of axon terminals of regenerated retinal ganglion cells.

[0033] Figure 13 Regeneration and functional analysis of retinal ganglion cells in an animal model of glaucoma. a,Lgr5 EGFP -IRES-CreERT2; Retinal sections of normal Rosa26-tdTomato mice. b,Lgr5 EGFP-IRES-CreERT2 Retinal sections of Rosa26-tdTomato mice 7 days after intraocular pressure injury. c,Lgr5 EGFP-IRES-CreERT2 In Rosa26-tdTomato mice, retinal nerve cells were protected by daily instillation of K-115 eye drops after intraocular pressure injury. Retinal sections were prepared after 7 days. (d,Lgr5) EGFP-IRES-CreERT2 In Rosa26-tdTomato mice, retinal neurons were protected daily with K-115 eye drops after intraocular pressure injury. Seven days later, AAV virus was injected to reprogram Lgr5-positive cells. Retinal sections were prepared six weeks after viral injection. e, No regenerated ganglion axons were found in the optic nerve of the control eye injected with AAV-DIO-EGFP virus. f, Regenerated ganglion axons were found in the optic nerve of the eye injected with AAV expressing transcription factors. gk, Lgr5 EGFP -IRES-CreERT2 Brain slices of Rosa26-tdTomato mice. The left eye of the mice was injected with the control group's AAV-DIO-EGFP virus, while the right eye was injected with AAV expressing transcription factors. Axons from regenerated retinal ganglion cells from the right eye project to the left side of the brain. 1m, Regenerated ganglion cells transmit neural signals to downstream neurons in the superior colliculus. 1, Neurotransmitters released by regenerated ganglion cells activate AMPA receptor-mediated EPSCs in downstream neurons. 2, Neurotransmitters released by regenerated ganglion cells activate NMDA receptor-mediated EPSCs in downstream neurons. 3, Neurotransmitters released by regenerated ganglion cells activate downstream neurons to generate action potentials.

[0034] Figure 14 Diagrams illustrating the establishment of a model of retinal ganglion cell injury using elevated intraocular pressure and the strategy for regenerating ganglion cells in disease model animals. a, b, Histological sections of ganglion cell axons in the optic nerve before and after injury. c, Schematic diagram of the strategy for reprogramming Lgr5-positive amacrine cells into ganglion cells after intraocular pressure injury to endogenous retinal ganglion cells. Detailed Implementation

[0035] This invention marks the first time that retinal ganglion cells have been regenerated in an adult mammal (mouse). It demonstrates that the regenerated ganglion cells can project axons over long distances to the brain, establishing neural connections between the retina and the brain, and possess physiological functions: they can integrate visual signals sensed by upstream neurons in a living animal and transmit these signals to downstream neurons in the brain. This provides experimental evidence for the clinical application of regenerating retinal ganglion cells using the same method to restore vision in blind patients.

[0036] Furthermore, this invention is based on new academic discoveries. For the first time in the world, we have discovered that fully differentiated nerve cells still possess regenerative potential and can transform from one nerve type to other nerve types in normal animals. Although the frequency of this nerve cell type transformation is very low under normal physiological conditions, this regenerative potential of nerve cells can be tapped. By promoting the transformation between nerve types through gene expression methods, the goal of nerve regeneration and repair can be achieved.

[0037] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention. Test methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions or as recommended by the respective manufacturers.

[0038] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art. In addition to the specific methods, apparatus, and materials used in the embodiments, based on the knowledge of the prior art possessed by one of ordinary skill in the art and the description of this invention, any prior art methods, apparatus, and materials similar to or equivalent to those described, apparatus, and materials in the embodiments of this invention may be used to implement the present invention.

[0039] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields.

[0040] As used herein, the term "subject" or "test subject" refers to any animal (e.g., mammals, birds, reptiles, amphibians, fish), including but not limited to humans, non-human primates, rodents, etc., which becomes the recipient of a specific treatment. Generally, when referring to a subject in this text, the terms "subject" and "patient" are used interchangeably.

[0041] When used with the compounds, biologics, or pharmaceutical compositions described herein, the term "effective amount" refers to the amount required to produce the desired therapeutic outcome. For example, an effective amount is the level at which the symptoms of a disease are effectively treated, cured, or relieved because of the disease, and the therapeutic compound, biologic, or pharmaceutical composition is administered. The determination of an effective amount for a specific therapeutic target will depend on a variety of factors, including the disease being treated and its severity and / or stage of development / progress; biological accessibility and the activity of the specific compound, biologic, or pharmaceutical composition used; the route or method of administration and the site of introduction on the subject; the clearance rate and other pharmacokinetic properties of the specific compound or biologic; the duration of treatment; the infection regimen; drugs used in combination with or concurrently with the specific compound, biologic, or pharmaceutical composition; the age, weight, sex, diet, physiological and general health status of the subject; and similar factors well known to those skilled in the art in the relevant field. Depending on the individual being treated, some necessary variations in dosage may occur, and in any case, the appropriate dosage for an individual patient will be determined by a physician or other individual administering the treatment.

[0042] In the text of this invention, the terms "peptide" and "protein" are equivalent and used interchangeably. They refer to any chain of amino acids and include any post-translational modifications thereof (e.g., phosphorylation or glycosylation).

[0043] As used herein, the term "object" refers to any animal (e.g., mammals, birds, reptiles, amphibians, fish), including but not limited to humans, non-human primates, rodents, etc., which becomes the recipient of a specific treatment. Generally, when referring to an object herein, the terms "object" and "patient" are used interchangeably. Additionally, transgenic animals (e.g., transgenic rats and mice) are used in the methods of this invention.

[0044] As used herein, the term "administration" refers to the delivery of a therapeutically effective amount of a chemical or biological compound or pharmaceutical composition to a subject via a route of administration such as intravitreal, intraocular, ocular, subretinal, intrathecal, intravenous, subcutaneous, percutaneous, intradermal, intracranial, or local administration. The chemical or biological compounds of this invention may be administered alone, but may also be administered together with other compounds, excipients, fillers, binders, carriers, or other delivery agents, depending on the chosen route of administration and standard pharmaceutical practice. Administration may be via a carrier or delivery agent, such as injectable solutions, including sterile aqueous or non-aqueous solutions, or saline solutions; creams; lotions; capsules; tablets; granules; pellets; powders; suspensions, emulsions, or microemulsions; patches; micelles; liposomes; vesicles; implants, including microimplants; eye drops; other proteins and peptides; synthetic polymers; microspheres; nanoparticles, etc.

[0045] As used herein, “disease” means disease, symptom, or condition, or any other condition that differs from health or normal biological activity, and these terms are used interchangeably. The term refers to any condition that impairs normal function. Such condition may be caused by sporadic or heritable genetic abnormalities. Such condition may also be caused by non-genetic abnormalities. Such condition may also be caused by damage to an object from environmental factors, such as, but not limited to, cutting, crushing, burning, puncture, stretching, shearing, injection, or other alteration of the object's cells, tissues, organs, or systems.

[0046] As used herein, “treatment” or “manipulation” means to prevent or inhibit, or attempt to prevent or inhibit, the development or progression of a disease, and / or to produce, or attempt to produce a reduction, inhibition, reversion, or relief of the disease and / or its symptoms. As will be understood by those skilled in the art, a variety of clinical and scientific methods and tests can be used to evaluate the development or progression of a disease, and similarly, a variety of clinical and scientific methods and tests can be used to evaluate a reduction, reversion, or relief of the disease or its symptoms. Additionally, treatment can be administered to a subject or cell culture.

[0047] The technical solutions described in this invention can all be used for therapeutic or non-therapeutic purposes.

[0048] An embodiment of the present invention provides the use of transcription factors in one or more of the following:

[0049] 1) Preparation of drugs for the treatment of retinal diseases;

[0050] 2) Preparation of retinal ganglion cell regeneration products;

[0051] 3) Prepare products that induce adult cells to reprogram into retinal ganglion cells;

[0052] 4) Preparation of retinal ganglion cells;

[0053] The transcription factors are selected from any one or more of Brn3B, Sox4, Atoh7, Sox11, and Isl1.

[0054] Furthermore, the transcription factor is of human or mouse origin;

[0055] The retinal disease can be the result of damage to tissues or cells in the central nervous system. The treated retinal disease can also be a neurodegenerative disease (e.g., retinitis pigmentosa). Damaged or neurodegenerative tissues or cells can be ganglion cells, such as retinal ganglion cells or photoreceptor cells. In some embodiments, the treated retinal disease includes ganglion cell degeneration. Such ganglion cell degeneration can be induced by glaucoma.

[0056] That is, optionally, the retinal disease may be selected from retinitis pigmentosa, macular degeneration, glaucoma or genetic optic neuropathy.

[0057] Neurodegenerative diseases that are considered for treatment with the methods described herein can be naturally inherited or sporadic (e.g., occurring in isolated, non-heritable cases). As those skilled in the art will understand, neurodegenerative diseases also include conditions other than retinal neurodegenerative diseases, and the methods, compositions, and remedies of the present invention are considered applicable to other such diseases. Such diseases include Alzheimer's disease, epilepsy, Huntington's disease, Parkinson's disease, amyotrophic lateral sclerosis (ALS), glaucoma, age-related hearing loss, progressive supranuclear palsy, mild cognitive impairment, dementia, spinocerebellar atrophy, etc.

[0058] The retinal ganglion cell regeneration product refers to a product that can induce adult cells to reprogram into retinal ganglion cells.

[0059] Optionally, the transcription factor is in the form of DNA, mRNA, or protein.

[0060] Optionally, the transcription factor may be in the form of a polynucleotide construct containing a gene fragment of the transcription factor.

[0061] The nucleic acid construct can be obtained by cloning a gene fragment of a transcription factor into a known vector.

[0062] The nucleic acid construct can be a plasmid, a viral vector, or a lentiviral vector.

[0063] The preferred vector is the AAV virus.

[0064] Optionally, the transcription factor may also be placed in a recombinant cell containing the aforementioned nucleic acid construct.

[0065] The recombinant cells can be obtained by introducing polynucleotide or nucleic acid constructs that can express transcription factors into host cells.

[0066] The host cell is selected from one or more of aneurysms, misaligned aneurysms, or other cells in the retina.

[0067] Other cells in the retina refer to cells other than those without long process nerve cells and those that are misaligned without long process nerve cells.

[0068] The cDNA sequence of Brn3B is shown in SEQ ID NO: 1 or SEQ ID NO: 6; the cDNA sequence of Sox4 is shown in SEQ ID NO: 2 or SEQ ID NO: 7; the cDNA sequence of Atoh7 is shown in SEQ ID NO: 3 or SEQ ID NO: 8; the cDNA sequence of Sox11 is shown in SEQ ID NO: 4 or SEQ ID NO: 9; and the cDNA sequence of Isl1 is shown in SEQ ID NO: 5 or SEQ ID NO: 10.

[0069] Specifically,

[0070] Mouse DNA sequence:

[0071] Brn3B, SEQ ID NO: 1:

[0072]

[0073] Sox4,SEQ ID NO:2:

[0074]

[0075] Atoh7,SEQ ID NO:3:

[0076] atgaagtcggcctgcaaaccccacggccctccggcgggagctcgcggcgcgcccccgtgcgcgggcgcagccgagcgcgcggtctcgtgcgcggggcccgggcggctggagagcgcggcgcgcaggcgtctggcggccaacgcgcgcgagcggcgccgcatgcaggggctgaacacggcgttcgaccggctgcgcagggtggtgccgcagtggggccaggacaagaagctgtccaagtacgagacactgcagatggcgctcagctacatcatcgcgctcacccgcatcctagccgaagccgagcgggactgggtcgggctgcgctgcgagcagcggggccgcgatcacccctacctccctttcccgggtgctaggctccaggtagaccctgagccctatgggcagaggctcttcggcttccagccggagcccttccccatggccagctaa。

[0077] Sox11,SEQ ID NO:4:

[0078]

[0079] Isl1,SEQ ID NO:5:

[0080]

[0081] Human DNA sequence:

[0082] Brn3B, SEQ ID NO: 6:

[0083]

[0084] Sox4,SEQ ID NO:7:

[0085]

[0086] Atoh7,SEQ ID NO:8:

[0087] atgaagtcctgcaagcccagcggcccgccggcgggagcgcgcgttgcacccccgtgcgcgggcggcaccgagtgcgcgggcacgtgcgccggggccgggcggctggagagcgcggcgcgcaggcgcctggcggccaacgcgcgcgagcgccgccgcatgcaggggctcaacactgccttcgaccgcttacgcagggtggttccccagtggggccaggataaaaagctgtccaagtacgagaccctgcagatggccctgagctacatcatggctctgacccggatcctggccgaggccgagcgattcggctcggagcgggactgggtgggtctccactgtgagcacttcggccgcgaccactacctcccgttcccgggcgcgaagctgccgggcgagagcgagctgtacagccagagactcttcggcttccagcccgagcccttccagatggccacctag。

[0088] Sox11,SEQ ID NO:9:

[0089]

[0090] Isl1,SEQ ID NO:10:

[0091]

[0092] The adult cells are selected from one or more of aneurysms, misaligned aneurysms, or other cells in the retina.

[0093] The product may be a reagent kit, an injection, or a drug.

[0094] The drug also includes one or more conventional pharmaceutically acceptable excipients.

[0095] Typically, in addition to the active ingredient, the drug may also include one or more pharmaceutically acceptable carriers or excipients, depending on the requirements of different dosage forms.

[0096] "Pharmaceutical acceptable" means that when the molecular basis and the composition are properly administered to animals or humans, they do not produce adverse, allergic, or other adverse reactions.

[0097] A "pharmaceutically acceptable carrier or excipient" should be compatible with the active ingredient, meaning it can be miscible with it without significantly reducing the drug's efficacy under normal circumstances. Specific examples of substances that can serve as pharmaceutically acceptable carriers or excipients include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium methylcellulose, ethylcellulose, and methylcellulose; tragacanth gum powder; malt; gelatin; talc; solid lubricants such as stearic acid and magnesium stearate; calcium sulfate; vegetable oils such as peanut oil, cottonseed oil, sesame oil, olive oil, corn oil, and cocoa butter; polyols such as propylene glycol, glycerin, sorbitol, mannitol, and polyethylene glycol; alginic acid; emulsifiers such as Tween; wetting agents such as sodium lauryl sulfate; colorants; flavoring agents; tableting agents; stabilizers; antioxidants; preservatives; pyrogen-free water; isotonic salt solutions; and phosphate buffers, etc. These substances are used as needed to help stabilize the formulation or to improve its activity or bioavailability or to produce an acceptable taste or smell when taken orally.

[0098] A method for preparing retinal ganglion cells according to an embodiment of the present invention includes at least the following steps: applying transcription factors to adult cells to convert them into retinal ganglion cells; wherein the transcription factors are selected from any one or more of Brn3B, Sox4, Atoh7, Sox11 and Isl1.

[0099] In this invention, unless otherwise specified, the drug dosage form is not particularly limited and can be formulated as injections, oral liquids, tablets, capsules, pellets, sprays, etc., and can be prepared by conventional methods. The choice of drug dosage form should be matched with the route of administration.

[0100] The effective dosage of the pharmaceutical preparation of this invention should take into account factors such as the route of administration and the patient's health condition, all of which are within the scope of the skills of a skilled physician.

[0101] Furthermore, the adult cells are selected from one or more of aneurysms, misaligned aneurysms, or other cells in the retina.

[0102] The transcription factor is in the form of DNA, mRNA, or protein.

[0103] The transcription factors are of human or mouse origin.

[0104] The adult cells can be derived from mammals or non-mammals. For example, they can be from reptiles, non-human primates, rodents, humans, etc.

[0105] The cDNA sequence of Brn3B is shown in SEQ ID NO: 1 or SEQ ID NO: 6; the cDNA sequence of Sox4 is shown in SEQ ID NO: 2 or SEQ ID NO: 7; the cDNA sequence of Atoh7 is shown in SEQ ID NO: 3 or SEQ ID NO: 8; the cDNA sequence of Sox11 is shown in SEQ ID NO: 4 or SEQ ID NO: 9; and the cDNA sequence of Isl1 is shown in SEQ ID NO: 5 or SEQ ID NO: 10.

[0106] In one embodiment, the method for preparing the retinal ganglion cells includes at least the following steps: transfecting transcription factor encoding genes into adult cells to obtain retinal ganglion cells.

[0107] The transcription factor encoding the gene was transfected into somatic cells via a recombinant vector.

[0108] The recombinant vector is obtained by inserting the transcription factor encoding gene into an expression vector.

[0109] The expression vector can be a plasmid, a viral vector, or a lentiviral vector.

[0110] Preferably, the expression vector is selected from AAV viral vectors.

[0111] The preparation method can be in vivo or in vitro.

[0112] The in vitro preparation can be as follows: obtaining adult cells, introducing transcription factors into the adult cells, and culturing the adult cells under suitable culture conditions and in a suitable culture medium. The culture medium can be DMEM medium.

[0113] A recombinant cell according to one embodiment of the present invention is obtained by introducing a polynucleotide or nucleic acid construct capable of expressing a transcription factor into a host cell, wherein the transcription factor is selected from any one or more of Brn3B, Sox4, Atoh7, Sox11 and Isl1.

[0114] The host cell is an adult cell. It is selected from one or more of aneurysms, misaligned aneurysms, or other cells in the retina.

[0115] One embodiment of the present invention includes a transcription factor selected from any one or more of Brn3B, Sox4, Atoh7, Sox11, and Isl1. The product is suitable for retinal ganglion cell regeneration, inducing adult cell reprogramming into retinal ganglion cells, or treating retinal diseases.

[0116] The product may be a reagent kit, an injection, or a drug.

[0117] The transcription factor can be in the form of DNA, mRNA, or protein.

[0118] Optionally, the transcription factor may be in the form of a polynucleotide construct containing a gene fragment of the transcription factor.

[0119] The nucleic acid construct can be obtained by cloning a gene fragment of a transcription factor into a known vector.

[0120] The nucleic acid construct can be a plasmid, a viral vector, or a lentiviral vector.

[0121] The preferred vector is the AAV virus.

[0122] Optionally, the transcription factor may also be placed in a recombinant cell containing the aforementioned nucleic acid construct.

[0123] The recombinant cells can be obtained by introducing polynucleotide or nucleic acid constructs that can express transcription factors into host cells.

[0124] Optionally, the transcription factor may be human or mouse-derived.

[0125] The method for treating retinal diseases according to the present invention includes at least the following steps: administering an effective amount of transcription factors to a subject suffering from retinal diseases, said transcription factors being selected from any one or more of Brn3B, Sox4, Atoh7, Sox11, and Isl1.

[0126] The transcription factor is administered in a pharmaceutically acceptable carrier. In some embodiments, the transcription factor is injected into the eye of the recipient, or it may be administered using a sustained-release carrier.

[0127] Optionally, the transcription factor is in the form of DNA, mRNA, or protein.

[0128] The transcription factor can be human or mouse-derived.

[0129] The adult cells are derived from mammals.

[0130] The cDNA sequence of Brn3B is shown in SEQ ID NO: 1 or SEQ ID NO: 6; the cDNA sequence of Sox4 is shown in SEQ ID NO: 2 or SEQ ID NO: 7; the cDNA sequence of Atoh7 is shown in SEQ ID NO: 3 or SEQ ID NO: 8; the cDNA sequence of Sox11 is shown in SEQ ID NO: 4 or SEQ ID NO: 9; and the cDNA sequence of Isl1 is shown in SEQ ID NO: 5 or SEQ ID NO: 10.

[0131] The transcription factor was used to give to the eyes of the test subjects.

[0132] The explanations of the proper nouns or terms used in various subjects of this invention, as well as the embodiments, are generally applicable and will not be repeated here.

[0133] Example 1

[0134] 1.1 Mice and their rearing methods:

[0135] Lgr5 used in this invention EGFP-IRES-CreERT2 Pvalb CreERT2 The Rosa26-tdTomato mouse strain was purchased from Jackson Laboratory. Lgr5 EGFP-IRES-CreERT2 strains of mice and Pvalb CreERT2 Lgr5 mice were obtained by crossing the strain of mice with Rosa26-tdTomato mice. EGFP-IRES-CreERT2 Rosa26-tdTomato mice and Pvalb CreERT2 Rosa26-tdTomato mice.

[0136] Prokr2 CreERT2The mouse strain was constructed in our laboratory at ShanghaiTech University using CRISPR / Cas9 technology via homologous recombination. This mouse strain features a CreERT2-PolyA expression cassette knocked into the ATG site of the Prokr2 gene. The mouse construction process is briefly as follows: A vector containing the CreERT2-PolyA expression cassette and homologous recombination arms was constructed using in-fusion cloning. Cas9 mRNA, gRNA, and the donor vector were microinjected into fertilized eggs of C57BL / 6J mice. After 3.5 days of culture, the fertilized eggs were transplanted into pseudopregnant female mice to obtain F0 generation mice. Long-fragment PCR identification confirmed that F0 generation mice containing the correct homologous recombination were mated with C57BL / 6J mice to obtain positive F1 generation Prokr2 mice. CreERT2 Mice. Prokr2 CreERT2 Prokr2 was obtained by crossing mice with Rosa26-tdTomato mice. CreERT2 Rosa26-tdTomato mice.

[0137] All mice were housed in an SPF-grade animal facility with a 12-hour light-to-dark cycle. CreERT2 was activated by gavage with tamoxifen (0.1–0.2 mg / g body weight). Male and female mice were used in equal proportions, with no sex selection, and all animal experimental procedures were approved by the Animal Care and Use Committee of ShanghaiTech University.

[0138] 1.2 AAV vector construction and viral packaging:

[0139] To express mouse Atoh7, Brn3B, Sox4, Sox11, Isl1 genes and EGFP using adeno-associated virus (AAV), we cloned the cDNA sequences of these genes and EGFP into a CAG promoter-driven, Cre recombinase-dependent expression vector (Addgene#22222), replacing the Arch-GFP sequence in the original vector. When simultaneously expressing a mouse gene and the reporter gene EGFP using an AAV vector, we expressed them simultaneously by placing a P2A fragment between the two DNA fragments.

[0140] Preparation of AAV viral particles: HEK293T cells were co-transfected with an AAV expression plasmid containing the coding gene sequence, a pAAV7m8 serotype plasmid, and a pHelper plasmid using PEI. Cells were collected after 48-72 hours. Viral particles were purified by iodixanol density gradient centrifugation, and viral titers were determined by qPCR. The vectors constructed in this example were found to express the Atoh7+EGFP gene; Brn3B+EGFP gene; Sox4+EGFP gene; Sox11+EGFP gene; and Isl1+EGFP gene, respectively.

[0141] Subvitrectomy with AAV:

[0142] Mice were anesthetized by intraperitoneal injection of a mixture of ketamine (80 mg / kg) and xylazine (8 mg / kg). After anesthesia, the pupils were dilated by instilling phenylepherine hydrochloride ophthalmic solution (2.5%) onto the surface of the eyes, followed by brief anesthesia with 0.5% proparacaine hydrochloride. A small puncture was then performed at the corneal limbus using a sterile needle to release aqueous humor and lower intraocular pressure. 1.5 μL of AAV virus particle suspension was injected into the vitreous cavity using a 34-gauge needle. When injecting multiple AAV viruses in combination, the final concentration of each AAV was maintained at 1 x 10⁻⁶ / mL. 12 Viral particles. The experiment included the following groups:

[0143] Experimental Group 1 (Control Group): Injected with AAV-DIO-EGFP virus.

[0144] Experiment 2: Injected with AAV-DIO-Brn3B virus.

[0145] Experiment 3: Injected with AAV-DIO-Sox4 virus.

[0146] Experiment 4: Injected with AAV-DIO-Brn3B+AAV-DIO-Sox4 virus.

[0147] Experiment 5: Injected with AAV-DIO-Atoh7+AAV-DIO-Brn3B+AAV-DIO-Sox4 virus.

[0148] Experiment 6: Injected with AAV-DIO-Atoh7+AAV-DIO-Brn3B+AAV-DIO-Sox4+AAV-DIO-Sox11+AAV-DIO-Isl1 virus.

[0149] 1.4 Establishment of a mouse glaucoma model:

[0150] An intraocular pressure-induced ischemia-reperfusion model was used to damage retinal ganglion cells in mice, simulating acute angle-closure glaucoma. To achieve this, an injection needle was inserted into the anterior chamber of anesthetized mouse eyes, with the other end connected via a soft tube to a bottle containing physiological saline containing 0.1% heparin. The intraocular pressure was altered by changing the height of the saline bottle. The injury conditions used were: the saline level was 150 cm above the eyeball, and the pressure injury duration was 60 minutes. Under this pressure condition, blood flow in the mouse retina stopped (ischemia), and the needle was removed after 60 minutes to restore blood flow (reperfusion). This injury condition rapidly led to degeneration of retinal ganglion cell axons and cell bodies, and also caused the death of other retinal neurons. To prevent apoptosis of other retinal neurons, the ocular surface of mice was treated with the rock inhibitor Ripasudil (0.4%, dissolved in PBS) once daily after injury.

[0151] 1.5 Immunohistochemical analysis:

[0152] Deeply anesthetized mice were perfused with physiological saline (0.9% NaCl) and 4% PFA, respectively. Eyes, optic nerves, and brains were then harvested and fixed with 4% PFA for 24 hours. The tissues were further dehydrated with 30% sucrose, embedded in OCT, and sectioned into frozen sections with a thickness of 10 μm (eyes and optic nerves) and 30 μm (brain) using a cryostat. Immunohistochemical analysis was performed according to standard procedures. The antibodies used included: retinal ganglion cell-specific antibodies rabbit-anti-RBPMS (Abcam, 1:400), mouse-anti-Brn3a (Santa Cruz Biotechnology, 1:200), α-RGCs-specific antibody rabbit anti-SMI-32 (Abcam, 1:400), photosensitive RGCs-specific antibody rabbit anti-melanopsin (Abcam, 1:500), direction-selective RGCs-specific antibody rabbit anti-CART (cocaine-andamphetamine-regulated transcript, Phoenix Peptide, 1:2500), and postsynaptic membrane-specific antibody mouse anti-PSD95 (Abcam, 1:400). The fluorescently labeled secondary antibody used included: Alexa Fluor647donkey anti-rabbit (IFKine). TM,1:400),Alexa Fluor 647donkey anti-mouse(IFKine TM (1:400), Alexa Fluor 488donkey anti-rabbit (Abcam, 1:400). Tissue sections were imaged using a Zeiss LSM880 confocal microscope, a Nikon turntable (CSU W1 Sora) confocal microscope, and a STEDsp8 microscope after immunofluorescence staining.

[0153] 1.6 In vivo calcium imaging:

[0154] Mice were anesthetized with urethane (1.5 g / kg) and fixed in a stereotactic apparatus. Medicated eye ointment was applied to the surface of the eyes to prevent moisture evaporation and cataract formation. A custom-made titanium plate (Fe3O4 added to the dental cement for light shielding) was fixed to the skull using dental cement, roughly centered on the lambda region and parallel to the long axis of the mouse's body. An opening approximately 3 mm in diameter was made in the cranium at the junction of the superior and inferior colliculi. A 3 mm diameter flap was gently pressed onto the dura mater and sealed with black dental cement to facilitate imaging of the axonal terminals of retinal ganglion cells in the superior colliculi using a two-photon microscope. During two-photon microscopy imaging, a light-shielding cloth was placed above the plate fixing the mouse's head to prevent interference from light from the monitor providing visual stimulation.

[0155] Visual stimuli were generated using the Psychtoolbox tool in Matlab (Mathworks) and presented on an LCD monitor (Dell, 1280×1024 pixels, 75Hz refresh rate) in front of the mouse's eye on the side opposite the surgical site, 15cm away from the mouse's eye. The stimulus consisted of a full-screen sinusoidal moving light and dark raster with a uniform background grayscale (spatial frequency: 0.05 cycles / °, temporal frequency: 2Hz). Each stimulus lasted 1 second, and each stimulus pattern was repeated 5 times, with an interval of 1-2 seconds between stimuli. The raster on the monitor was set with 4 angles, each angle having two movement directions (a total of 8 movement directions). Rasteres at similar angles differed by 45 degrees.

[0156] Two-photon fluorescence imaging of axonal terminals was performed using a LotosScan microscope (LotosScan, Suzhou Institute of Biomedical Engineering and Technology) and a Ti:Sa laser (Chameleon VISION-S, Coherent). The excitation wavelength was fixed at 920 nm, and imaging was performed using a 40X, 0.8NA objective lens (Nikon). The beam size was large enough to fill the back aperture of the 40x objective lens, and images were acquired at a frame rate of 50 Hz.

[0157] Images were analyzed using Matlab (Mathworks) and ImageJ (National Institutes of Health). To address lateral image drift during imaging, TurboR (an ImageJ plugin) was used to process the images based on frame-by-frame alignment using rigid body changes. Axon terminals were manually selected based on their size, shape, and brightness. The time progression of imaging for a single axon terminal was determined by averaging the fluorescence intensity of each frame of the axon terminal. Data were not used if significant brain pulsation was observed during imaging. Background signals caused by the neural fiber network during imaging were removed using previously reported methods. After image correction, the response (Ft, fluorescence intensity of the axon terminal) to each visual stimulus was normalized using the fluorescence intensity (F0) of the axon terminal immediately before the stimulus began. For each visual stimulus, the mean change in fluorescence intensity (ΔF / F) was calculated by averaging the changes in fluorescence intensity caused by all stimuli under the same stimulus condition. Cells exhibiting a visual response were defined by comparing the fluorescence intensity of axon terminals under no stimulus and stimulated conditions using analysis of variance.

[0158] 1.7 In vitro whole-cell recording:

[0159] Mice were deeply anesthetized, and their hearts were then perfused using a cold, oxygen-rich brain slice solution (95% O2, 5% CO2 gas). The brain slice solution consisted of: 92 mM choline chloride, 2.5 mM KCl, 1.2 mM NaH2PO4, 30 mM NaHCO3, 10 mM MgSO4, 0.5 mM CaCl2, 25 mM glucose, 5 mM sodium ascorbate, 3 mM sodium pyruvate, and 2 mM thiourea. The pH of the cutting solution was adjusted to 7.3-7.4, and the osmotic pressure was adjusted to 310-315 mOsm by adding concentrated hydrochloric acid. After removing brain tissue from the skull, the brain tissue, including the epithalamus region, was coronally sliced ​​into sections 300-500 μm thick using a vibrating blade microtome in the cutting solution. The cut brain slices were incubated in the cutting solution at 31-32°C for 15 minutes, and then transferred to a room-temperature, oxygen-rich preservation solution. The preservation solution consisted of: 92 mM NaCl, 30 mM NaHCO3, 1.25 mM NaH2PO4, 2.5 mM KCl, 2 mM MgSO4, 2 mM CaCl2, 25 mM glucose, 20 mM HEPES, 5 mM sodium ascorbate, 3 mM sodium pyruvate, and 2 mM thiourea, with a pH of 7.3-7.4 and an osmotic pressure of 310-315 mOsm. After preservation in the solution for one hour, the slices were transferred to an oxygen-permeable recording solution (119 mM NaCl, 24 mM NaHCO3, 1.25 mM NaH2PO4, 2.5 mM KCl, 2 mM MgSO4, 2 mM CaCl2, and 12.5 mM glucose). Three to five brain slices containing the superior colliculus can usually be prepared from a single mouse, and the middle slice is selected for recording.

[0160] Synaptic responses of neurons in brain slices were recorded using whole-cell patch-clamp techniques with 2-4 MΩ glass electrodes. The electrode solution consisted of: 25 mM potassium gluconate, 20 mM KCl, 0.5 mM EGTA, 10 mM HEPES-NaOH, 10 mM p-creatine, 4 mM ATP-Mg, 0.3 mM GTP, and pH 7.3. Blue light at 470 nm was generated using an LED (Thorlabs, 35 mW / mm²) and localized areas of the brain slice were stimulated through a 40x objective lens (OLYMPUS). The experiment showed that a stimulation time of 5 ms saturated the recorded postsynaptic neuronal responses, with neuronal input resistance between 1 and 5 GΩ and series resistance less than 20 MΩ. The whole-cell patch-clamp recording conditions were as follows: initially, the membrane potential was maintained at -70 mV, blue light stimulation was applied, and AMPA receptor-mediated postsynaptic currents were recorded (at this membrane potential, NMDA receptor activity was blocked by magnesium ions in the solution). The membrane potential was then switched to +55 mV, and mixed currents mediated by both AMPA and NMDA receptors were recorded. Multiple brain slice neurons were recorded to generate a total cell count N. Then, the AMPA receptor antagonist CNQX and the NMDA receptor antagonist D-APV were added to the recording solution for re-recording. All recorded signals were amplified using an Axopatch 700B and digitized using a Digidata 1440 analog-digital board. Stimulation and data acquisition were performed at a frequency of 50 kHz using pClamp software. All instruments and software were purchased from Axon Instruments / Molecular Devices (MolecularDevices, CA).

[0161] 1.8 Experimental Results:

[0162] like Figure 1 As shown, under normal physiological conditions, fully differentiated nerve cells in the retina of adult mammals still possess regenerative potential, can transform from one nerve cell type to other nerve cell types, and can migrate in location.

[0163] like Figure 2 As shown, highly differentiated aneurysmal neurons can be reprogrammed into retinal ganglion cells in the retina of adult mice by expressing one or more combinations of transcription factors. The regenerated retinal ganglion cells possess the typical characteristics of ganglion cells, extending axons towards the optic disc.

[0164] like Figure 3As shown, regenerated retinal ganglion cells are located in the innermost layer of the retina, extending axons toward the optic nerve, and expressing ganglion cell-specific marker molecules (RBPMS and Brn3A) as well as the ganglion cell subtype-specific molecule CART.

[0165] like Figure 4 As shown, some regenerated retinal ganglion cells express the alpha-type ganglion cell-specific marker SMI-32.

[0166] like Figure 5 As shown, after expressing transcription factors that play an important regulatory role in ganglion development in Lgr5-positive aneurysmal interneurons in the intermediate cell layer of the retina, some Lgr5-positive aneurysmal interneurons migrate from the intermediate cell layer to the ganglion cell layer.

[0167] like Figure 6 As shown, regenerated retinal ganglion cells project axons into the optic nerve and different areas of the brain responsible for vision, and form typical presynaptic structures at the axon terminals.

[0168] like Figure 7 As shown, a single transcription factor (Brn3B or Sox4) can reprogram Lgr5-positive amacrine cells into retinal ganglion cells, and the combination of Brn3B and Sox4 greatly improves the efficiency of reprogramming.

[0169] like Figure 8 As shown, this invention introduces a CreERT2-polyA sequence into the Prokr2 gene locus in the mouse genome using CRISP-Cas9-mediated genome editing technology. These genetically engineered mice specifically express the CreERT2 transcriptase in misaligned, processless cells derived from retinal ganglion cells. This genomic modification allows us to regulate these cells and examine whether this type of neuron can be used to regenerate retinal ganglion cells.

[0170] like Figure 9 As shown, misaligned, long-processed cells located in the retinal ganglion cell layer can be reprogrammed into retinal ganglion cells. The newly generated retinal ganglion cells project axons to the optic nerve and brain, establishing neural connections between the retina and the brain.

[0171] like Figure 10 As shown, a combination of two (Brn3B+Sox4) or three (Atoh7+Brn3B+Sox4) transcription factors can effectively reprogram Prokr2-positive misaligned neurons without long processes into retinal ganglion cells.

[0172] like Figure 11As shown, regenerated retinal ganglion cells can integrate the neural signals generated by visual stimuli and transmit these signals to the neuronal nuclei in the brain responsible for vision. These regenerated retinal ganglion cells can also transmit visual electrical signals to downstream neurons in the brain.

[0173] like Figure 12 As shown, using in vivo animal neuroactive calcium imaging technology, we discovered that regenerated retinal ganglion cells can transmit visual neural electrical signals from the retina to the brain in animals.

[0174] like Figure 13 As shown, this invention discovers that even when the original retinal ganglion cells in an animal are completely damaged, the newly generated retinal ganglion cells can still project axons over long distances to the neural nuclei in the brain responsible for vision, and can transmit neural electrical signals to downstream neurons.

[0175] like Figure 14 As shown, the model of retinal ganglion cell axon injury caused by elevated intraocular pressure used in this invention can completely damage the axons of all retinal ganglion cells.

[0176] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any form or substance. It should be noted that those skilled in the art can make various improvements and additions without departing from the method of the present invention, and these improvements and additions should also be considered within the scope of protection of the present invention. Any modifications, alterations, and equivalent changes made by those skilled in the art based on the above-disclosed technical content without departing from the spirit and scope of the present invention are equivalent embodiments of the present invention. Furthermore, any modifications, alterations, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention. sequence list <110> ShanghaiTech University <120> A method for regenerating functional retinal ganglion cells using transcription factors <160> 10 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1236 <212> DNA <213> Artificial Sequence <400> 1 atgatgatga tgtccctgaa cagcaagcag gcgttcagca tgcctcacgc aggcagcctg 60 cacgtggagc ccaagtactc ggcgctacac agtgcctccc cgggctcctc tgcgcccgcg 120 gcgccctcgg ccagttcccc tagcagctcc agcaacgctg gcggcggcgg cggtggcggc 180 ggaggcggag gcggcggcgg ccggagcagc agttccagca gcagtggcag cggcggcagc 240 ggcggcggcg ggggctcgga ggcgatgcgg agagcttgtc ttccaacccc accgagcaat 300 atattcggcg ggctggatga gagtctgctg gcccgtgccg aggctctggc cgccgtggac 360 atcgtctccc agagtaagag ccaccaccac catccgcccc accacagccc cttcaagccg 420 gacgccactt accacaccat gaacaccatc ccgtgcacgt cggcagcctc ctcttcttct 480 gtgcccatct cgcacccgtc cgctctggct ggcacccatc accaccacca ccaccaccat 540 caccaccatc accagccgca ccaggcgctg gagggcgagc tgcttgagca cctaagcccc 600 gggctggccc tgggagctat ggcgggcccc gacggcacgg tggtgtccac tccggctcac 660 gcaccacaca tggccaccat gaaccccatg caccaagcag ccctgagcat ggcccacgca 720 catgggctgc cctcgcacat gggctgcatg agcgacgtgg atgcagaccc gcgggacctg 780 gaggcgttcg ccgagcgttt caagcagcga cgcatcaagc tgggagtgac ccaggcagat 840 gtgggctcgg cgctggccaa cctcaagatc ccgggcgtgg gctcgctcag ccagagcacc 900 atctgcaggt ttgagtctct cacgctgtca cacaacaaca tgatcgcgct caagcccatc 960 ctgcaggcgt ggctggagga agctgagaaa tcccaccgcg agaagctcac taagccggag 1020 ctcttcaatg gcgcggagaa gaagcgcaag cgcacgtcca tcgcggcgcc ggagaagcgc 1080 tctctggaag cctacttcgc catccagcca aggccctcct cggagaagat cgcggccatc 1140 gccgaaaagc tggatctcaa gaaaaatgtg gtgcgcgtct ggttctgcaa ccagaggcag 1200 aaacagaaga gaatgaaata ctctgccggc atttag 1236 <210> 2 <211> 1323 <212> DNA <213> Artificial Sequence <400> 2 atggtacaac agaccaacaa cgcggagaac actgaggctc tgctggccgg ggagagctcg 60 gactcgggcg ccggcctgga gctgggcatc gcgtcctccc cgacgcctgg ctccaccgcg 120 tcgacgggcg gcaaggcgga cgaccccagc tggtgcaaga cgcccagtgg ccacatcaag 180 cggcccatga acgcctttat ggtgtggtcg cagatcgagc ggcgcaagat catggagcag 240 tcgcccgaca tgcacaacgc cgagatctcc aagcggctag gcaaacgctg gaagctgctc 300 aaggacagcg acaagattcc gttcatccag gaggcggagc ggctgcgcct caagcacatg 360 gctgactacc ctgactacaa gtaccggccg cgaaagaagg tgaagtcggg caacgcgggc 420 gcgggatcgg cggccacagc caagccaggg gagaagggcg acaaggtcgc gggcagcagc 480 ggccacgcgg gaagcagcca cgcggggggt ggcgcgggcg gcagctccaa gcccgcgccc 540 aagaagagct gtggccccaa ggtggcgggc agctcggtcg gcaagcccca cgctaagctg 600 gtcccggcgg gcggcagcaa ggcggctgca tcgttctctc cagagcaagc tgccctgctg 660 cccctggggg agcccacggc cgtctacaag gtgcggactc ccagtgcggc cactccggcc 720 gcctcctcct cgccgtccag tgcgctggcc accccagcca aacaccctgc cgacaagaaa 780 gtgaagcgcg tctacctgtt tggaagcctg ggcgcttcgg cgtctcccgt cgggggcctg 840 ggagcgagcg ccgaccccag tgatccactg gggttgtacg aagatggagg cccgggatgc 900 tcgcccgatg gccggagtct gagcggccgc agcagcgcag catcatcgcc agccgccagc 960 cgatcgcccg ctgaccaccg cggctacgcc agcctacgcg cagcctcgcc cgccccgtcc 1020 agcgcgccct cgcacgcgtc ctcctcgctc tcctcgtcct cttcctcctc ctcgggctct 1080 tcgtcgtccg acgacgagtt cgaagacgac ctgctcgacc tgaaccccag ctcaaacttt 1140 gagagcatgt ccctgggcag tttcagctcc tcatcggcgc tcgatcggga cctggatttt 1200 aacttcgaac ccggctcagg ctcccacttc gaattcccgg actattgcac gcccgaggtg 1260 agcgagatga tctcgggaga ttggctggag tccagcatct ctaacctggt cttcacctac 1320 tga 1323 <210> 3 <211> 450 <212> DNA <213> Artificial Sequence <400> 3 atgaagtcgg cctgcaaacc ccacggccct ccggcgggag ctcgcggcgc gcccccgtgc 60 gcgggcgcag ccgagcgcgc ggtctcgtgc gcggggcccg ggcggctgga gagcgcggcg 120 cgcaggcgtc tggcggccaa cgcgcgcgag cggcgccgca tgcaggggct gaacacggcg 180 ttcgaccggc tgcgcagggt ggtgccgcag tggggccagg acaagaagct gtccaagtac 240 gagacactgc agatggcgct cagctacatc atcgcgctca cccgcatcct agccgaagcc 300 gagcgggact gggtcgggct gcgctgcgag cagcggggcc gcgatcaccc ctacctccct 360 ttcccgggtg ctaggctcca ggtagaccct gagccctatg ggcagaggct cttcggcttc 420 cagccggagc ccttccccat ggccagctaa 450 <210> 4 <211> 1188 <212> DNA <213> Artificial Sequence <400> 4 atggtgcagc aggccgagag ctcggaagcc gagagcaacc tgccccggga cgcgctggac 60 accgaggagg gcgagttcat ggcgtgcagc ccggtggccc tggacgagag cgacccggac 120 tggtgcaaga cggcgtcggg ccacatcaaa cggcccatga acgccttcat ggtgtggtcc 180 aagatcgagc gcaggaagat catggagcag tcgcccgaca tgcacaacgc cgagatctcc 240 aagaggctgg gcaagcgctg gaagatgctg aaggacagcg agaagatccc gttcatcagg 300 gaggcggagc gcctgcgcct caagcacatg gctgattatc ccgactacaa gtaccggccg 360 cgcaaaaagc ccaagacgga cccagcggcc aagcccagcg cgggccagag ccccgacaag 420 agcgcggcgg gcgccaaggc agccaagggc cccggcaaga agtgcgccaa gctcaaggcg 480 cctgcgggca aggcgggcgc gggcaaggcg gcgcagccgg gggactgcgc cgcgggcaag 540 gcagccaagt gcgtcttcct ggacgacgac gatgaagacg acgacgaaga tgacgagctg 600 cagctacggc ccaagccgga cgctgacgac gacgacgacg agcccgcgca ctcgcacctg 660 ctgccgccgc cgacgcagca gcaaccccct cagctgctga ggcgctacag cgtggccaag 720 gtccccgcca gccccacgct cagcagtgcc gccgagtccc ccgagggcgc gagcctgtac 780 gacgaagtgc gcgcgggcgg ccggctctac tacagcttca agaacatcac caagcagcag 840 cctccgcccg cgcctcccgc gctgtcgccc gcgtcctccc gctgcgtgtc cacctcctca 900 tccagcggca gcagcagcgg cagcggcgcc gaggatgcag acgacctcat gttcgacctg 960 agcttgaatt tctcccaggg cgcgcacagc gcctgcgagc agccactggg cgcgggagcg 1020 gcggggaacc tgtccctgtc gctggtggat aaggacctgg attccttcag cgagggcagc 1080 ctgggttccc acttcgagtt ccccgactac tgcacgccgg agctgagcga gatgatcgcg 1140 ggggactggc tggaggcga cttctccgac ctggtgttca cgtattga <210> 5 <211> 1050 <212> DNA <213> Artificial Sequence <400> 5 60. atgggagaca tgggcgatcc accaaaaaaa aaacgtctga tttccctgtg tgttggttgc ggcaatcaaa ttcacgacca gtatattctg agggttctc cggatttgga gtggcatgca gcatgtttga aatgtgcgga gtgtaatcag tatttggacg aaagctgtac gtgctttgtt agggatggga aaacctactg taaagagat fathercaggt tgtacgggat caaatgcgcc aagtgcagca tagcttcag caagaacgac ttcgtgatgc gtgcccgctc taaggtgtac cacatcgagt gtttccgctg tgtagcctgc agccgacagc tcatcccggg agcgaattc 360 gccctgcggg aggatgggct tttctgccgt gcagaccacg atgtggtgga gagagccagc 420 ctgggagctg gagaccctct cagtcccttg catccagcgc ggcctctgca aatggcagcc 480 gaacccatct cggctaggca gccagctctg cggccgcacg tccacaagca gccggagaag 540 accacccgag tgcggactgt gctcaacgag aagcagctgc acaccttgcg gacctgctat 600 gccgccaacc ctcggccaga tgcgctcatg aaggagcaac tagtggagat gacgggcctc 660 agtcccagag tcatccgagt gtggtttcaa aacaagcggt gcaaggacaa gaaacgcagc 720 atcatgatga agcagctcca gcagcagcaa cccaacgaca aaactaatat ccaggggatg 780 acaggaactc ccatggtggc tgctagtccg gagagacatg atggtggttt acaggctaac 840 ccagtagagg tgcaaagtta ccagccgccc tggaaagtac tgagtgactt cgccttgcaa 900 agcgacatag atcagcctgc ttttcagcaa ctggtcaatt tttcagaagg aggaccaggc 960 tctaattcta ctggcagtga agtagcatcg atgtcctcgc agctcccaga tacacccaac 1020 agcatggtag ccagtcctat tgaggcatga 1050 <210> 6 <211> 1227 <212> DNA <213> Artificial Sequence <400> 6 atgatgatgt ccctgaacag caagcaggcg tttagcatgc cgcacggcgg cagcctgcac 60 gtggagccca agtactcggc actgcacagc acctcgccgg gctcctcggc tcccatcgcg 120 ccctcggcca gctcccccag cagctcgagc aacgctggtg gtggcggcgg cggcggcggc 180 ggcggcggcg gcggcggagg ccgaagcagc agctccagca gcagtggcag cagcggcggc 240 gggggctcgg aggctatgcg gagagcctgt cttccaaccc caccgagcaa tatattcggc 300 gggctggatg agagtctgct ggcccgcgcc gaggctctgg cagccgtgga catcgtctcc 360 cagagcaaga gccaccacca ccatccaccc caccacagcc ccttcaaacc ggacgccacc 420 taccacacta tgaataccat cccgtgcacg tcggccgcct cttcttcatc ggtgcccatc 480 tcgcaccctt ccgcgttggc gggcacgcac caccaccacc accatcacca ccaccaccac 540 caccaaccgc accaggcgct ggagggcgag ctgctggagc acctgagtcc cgggctggcc 600 ctgggcgcta tggcgggccc cgacggcgct gtggtgtcca cgccggctca cgcgccgcac 660 atggccacca tgaaccccat gcaccaagca gcgctcagca tggcccacgc gcacgggctg 720 ccgtcgcaca tgggctgcat gagcgacgtg gacgccgacc cgcgggacct ggaggcattc 780 gccgagcgct tcaagcagcg acgcatcaag ctgggggtga cccaggcaga tgtgggctcc 840 gcgctggcca acctcaagat ccccggcgtg ggctcgctta gccagagcac catctgcagg 900 ttcgagtccc tcacactgtc ccacaataat atgatcgcgc tcaaacccat cctgcaggca 960 tggctcgagg aggccgagaa gtcccaccgc gagaagctca ccaagcctga actcttcaat 1020 ggcgcggaga agaagcgcaa gcgcacgtcc atcgctgcgc cagagaagcg ctcgctcgaa 1080 gcctactttg ccattcagcc tcggccctcc tctgaaaaga tcgccgccat cgcggagaag 1140 ctggacctga agaaaaacgt ggtgcgcgtc tggttctgca accagaggca gaaacagaaa 1200 agaatgaaat attccgccgg catttag 1227 <210> 7 <211> 1425 <212> DNA <213> Artificial Sequence <400> 7 atggtgcagc aaaccaacaa tgccgagaac acggaagcgc tgctggccgg cgagagctcg 60 gactcgggcg ccggcctcga gctgggaatc gcctcctccc ccacgcccgg ctccaccgcc 120 tccacgggcg gcaaggccga cgacccgagc tggtgcaaga ccccgagtgg gcacatcaag 180 cgacccatga acgccttcat ggtgtggtcg cagatcgagc ggcgcaagat catggagcag 240 tcgcccgaca tgcacaacgc cgagatctcc aagcggctgg gcaaacgctg gaagctgctc 300 aaagacagcg acaagatccc tttcattcga gaggcggagc ggctgcgcct caagcacatg 360 gctgactacc ccgactacaa gtaccggccc aggaagaagg tgaagtccgg caacgccaac 420 tccagctcct cggccgccgc ctcctccaag ccgggggaga agggagacaa ggtcggtggc 480 agtggcgggg gcggccatgg gggcggcggc ggcggcggga gcagcaacgc ggggggagga 540 ggcggcggtg cgagtggcgg cggcgccaac tccaaaccgg cgcagaaaaa gagctgcggc 600 tccaaagtgg cgggcggcgc gggcggtggg gttagcaaac cgcacgccaa gctcatcctg 660 gcaggcggcg gcggcggcgg gaaagcagcg gctgccgccg ccgcctcctt cgccgccgaa 720 caggcggggg ccgccgccct gctgcccctg ggcgccgccg ccgaccacca ctcgctgtac 780 aaggcgcgga ctcccagcgc ctcggcctcc gcctcctcgg cagcctcggc ctccgcagcg 840 ctcgcggccc cgggcaagca cctggcggag aagaaggtga agcgcgtcta cctgttcggc 900 ggcctgggca cgtcgtcgtc gcccgtgggc ggcgtgggcg cgggagccga ccccagcgac 960 cccctgggcc tgtacgagga ggagggcgcg ggctgctcgc ccgacgcgcc cagcctgagc 1020 ggccgcagca gcgccgcctc gtcccccgcc gccggccgct cgcccgccga ccaccgcggc 1080 tacgccagcc tgcgcgccgc ctcgcccgcc ccgtccagcg cgccctcgca cgcgtcctcc 1140 tcggcctcgt cccactcctc ctcttcctcc tcctcgggct cctcgtcctc cgacgacgag 1200 ttcgaagacg acctgctcga cctgaacccc agctcaaact ttgagagcat gtccctgggc 1260 agcttcagtt cgtcgtcggc gctcgaccgg gacctggatt ttaacttcga gcccggctcc 1320 ggctcgcact tcgagttccc ggactactgc acgcccgagg tgagcgagat gatctcggga 1380 gactggctcg agtccagcat ctccaacctg gttttcacct actga 1425 <210> 8 <211> 459 <212> DNA <213> Artificial Sequence <400> 8 atgaagtcct gcaagcccag cggcccgccg gcgggagcgc gcgttgcacc cccgtgcgcg 60 ggcggcaccg agtgcgcggg cacgtgcgcc ggggccgggc ggctggagag cgcggcgcgc 120 aggcgcctgg cggccaacgc gcgcgagcgc cgccgcatgc aggggctcaa cactgccttc 180 gaccgcttac gcagggtggt tccccagtgg ggccaggata aaaagctgtc caagtacgag 240 accctgcaga tggccctgag ctacatcatg gctctgaccc ggatcctggc cgaggccgag 300 cgattcggct cggagcggga ctgggtgggt ctccactgtg agcacttcgg ccgcgaccac 360 tacctcccgt tcccgggcgc gaagctgccg ggcgagagcg agctgtacag ccagagactc 420 ttcggcttcc agcccgagcc cttccagatg gccacctag 459 <210> 9 <211> 1326 <212> DNA <213> Artificial Sequence <400> 9 atggtgcagc aggcggagag cttggaagcg gagagcaacc tgccccggga ggcgctggac 60 acggaggagg gcgaattcat ggcttgcagc ccggtggccc tggacgagag cgacccagac 120 tggtgcaaga cggcgtcggg ccacatcaag cggccgatga acgcgttcat ggtatggtcc 180 aagatcgaac ccaggagaat catggagcag tctccggaca tgcacaacgc cgagatctcc 240 aagaggctgg gcaagcgctg gaaatgctg aagcagcg agaagatccc gttcatccgg 300 gaggcggagc ggctgcggct caagcacatg gccgactacc ccgactacaa gtaccggccc 360 cggaaaaagc caaaatgga cccctcggcc aagcccagcg ccagccagag cccagagaag 420 agcgcggccg gcggcggcgg cgggagcgcg ggcggaggcg cgggcggtgc caagacctcc 480 aagggctcca gcaagaaatg cggcaagctc aaggcccccg cggccgcggg cgccaaggcg 540 ggcgcgggca aggcggccca gtccggggac tacggggcg cgggcgacga ctacgtgctg 600 ggcagcctgc gcgtgagcgg ctcgggcggc ggcggcgcgg gcaagacggt caagtgcgtg 660 720 caggagccgg aggagga cgaggaacca ccgcaccagc agctcctgca gccgccgggg 780 cagcagccgt cgcagctgct gagacgctac aacgtcgcca aagtgcccgc cagccctacg 840 ctgagcagct cggcggagtc ccccgaggga gcgagcctct acgacgaggt gcgggccggc 900 gcgacctcgg gcgccggggg cggcagccgc ctctactaca gcttcaagaa catcaccaag 960 cagcacccgc cgccgctcgc gcagcccgcg ctgtcgcccg cgtcctcgcg ctcggtgtcc 1020 acctcctcgt ccagcagcag cggcagcagc agcggcagca gcggcgagga cgccgacgac 1080 ctgatgttcg acctgagctt gaatttctct caaagcgcgc acagcgccag cgagcagcag 1140 ctggggggcg gcgcggcggc cgggaacctg tccctgtcgc tggtggataa ggatttggat 1200 tcgttcagcg agggcagcct gggctcccac ttcgagttcc ccgactactg cacgccggag 1260 ctgagcgaga tgatcgcggg ggactggctg gaggcgaact tctccgacct ggtgttcaca 1320 tattga 1326 <210> 10 <211> 1050 <212> DNA <213> Artificial Sequence <400> 10 atgggagaca tgggagatcc accaaaaaaa aaacgtctga tttccctatg tgttggttgc 60 ggcaatcaga ttcacgatca gtatattctg agggtttctc cggatttgga atggcatgcg 120 gcatgtttga aatgtgcgga gtgtaatcag tatttggacg agagctgtac atgctttgtt 180 agggatggga aaacctactg taaaagagat tatatcaggt tgtacgggat caaatgcgcc 240 aagtgcagca tcggcttcag caagaacgac ttcgtgatgc gtgcccgctc caaggtgtat 300 cacatcgagt gtttccgctg tgtggcctgc agccgccagc tcatccctgg ggacgaattt 360 gcgcttcggg aggacggtct cttctgccga gcagaccacg atgtggtgga gagggccagt 420 ctaggcgctg gcgacccgct cagtcccctg catccagcgc ggccactgca aatggcagcg 480 gagcccatct ccgccaggca gccagccctg cggccccacg tccacaagca gccggagaag 540 accacccgcg tgcggactgt gctgaacgag aagcagctgc acaccttgcg gacctgctac 600 gccgcaaacc cgcggccaga tgcgctcatg aaggagcaac tggtagagat gacgggcctc 660 agtccccgtg tgatccgggt ctggtttcaa aacaagcggt ggaagcaa gaagcgaagc 720 atcatgatga agcaactcca gcagcagcag cccaatgaca aaataatat ccagggggatg 780 acaggaactc ccatggtggc tgccagtcca gagagacacg acggtggctt acaggctaac 840 ccagtggaag tacaaagtta ccagccacct tggaagtac tgagcgactt cgccttgcag 900 agtgacatag atcagcctgc ttttcagcaa ctggtcaatt tttcagaagg aggaccgggc 960 tctaattcca ctggcagtga agtagcatca atgtcctctc aacttccaga tacacctaac 1020 agcatggtag ccagtcctat tgaggcatga 1050

Claims

1. Use of a transcription factor in the preparation of a product for inducing reprogramming of an adult cell into a retinal ganglion cell, the adult cell being an Lgr5-positive amacrine cell or a Prokr2-positive amacrine neuron; the transcription factor being selected from the group consisting of Brn3B and Sox4; the cDNA sequence of the Brn3B being as shown in SEQ ID NO: 1 or SEQ ID NO: 6; the cDNA sequence of the Sox4 being as shown in SEQ ID NO: 2 or SEQ ID NO:

7.

2. Use according to claim 1, characterized in that, one or more of the following features are also included: a. the transcription factor is of human or murine origin; b. the transcription factor is in protein form; c. the transcription factor is administered to the adult cell to transform it into a retinal ganglion cell; d. the product is a kit or a medicament.

3. A method for preparing a retinal ganglion cell, comprising at least the following steps: administering a transcription factor to an adult cell to transform it into a retinal ganglion cell, the adult cell being an Lgr5-positive amacrine cell or a Prokr2-positive amacrine neuron; the transcription factor being selected from the group consisting of Brn3B and Sox4; the cDNA sequence of the Brn3B being as shown in SEQ ID NO: 1 or SEQ ID NO: 6; the cDNA sequence of the Sox4 being as shown in SEQ ID NO: 2 or SEQ ID NO:

7.

4. The method for preparing retinal ganglion cells as described in claim 3, characterized in that, one or more of the following features are also included: a. the transcription factor is in protein form; b. the transcription factor is of human or murine origin; c. the adult cell is derived from a mammal.

5. The method of claim 3, comprising at least the following steps: transfecting a gene encoding the transcription factor into the adult cell to transform it into a retinal ganglion cell.

6. The method for preparing retinal ganglion cells as described in claim 5, characterized in that, the gene encoding the transcription factor is transfected into the adult cell by means of a recombinant vector, the recombinant vector being obtained by inserting the gene encoding the transcription factor into an expression vector.

7. The method for preparing a retinal ganglion cell according to claim 6, the expression vector being selected from the group consisting of AAV viral vectors.

Images