Engineered tcrs and methods of making same

Abstract

The purpose of this invention is to provide a modified T-cell receptor (TCR) that does not elicit an antigenic response and enables the CD3 subunit to remain on the cell membrane and function. This invention relates to a modified TCR comprising a first polypeptide and a second polypeptide, wherein the first polypeptide is a polypeptide containing the constant region of human TCRα or a fragment of the constant region but not the variable region of human TCRα, and the second polypeptide is a polypeptide containing the constant region of human TCRβ or a fragment of the constant region but not the variable region of human TCRβ.

Description

Technical Field

[0001] This invention relates to the modification of TCR and its manufacturing method. Background Technology

[0002] T cells are one of the immune cells derived from hematopoietic stem cells. T cells express the α chain (TCRα) and β chain (TCRβ) of the T cell receptor (TCR) on their cell surface. TCRα and TCRβ form a heterodimer. TCRα and TCRβ contain variable and constant regions, respectively, exhibiting sequence diversity. They specifically recognize the major histocompatibility complex (MHC)-peptide complex on target cells through an antigen recognition site formed by the variable region of the TCRα / TCRβ heterodimer. Furthermore, it is believed that the antigen recognition site of the TCRα / TCRβ heterodimer also identifies whether the target cell is self or non-self, thereby participating in non-self recognition responses (allogeneic reactions) in vivo.

[0003] Furthermore, the TCRα / TCRβ heterodimer forms a complex with CD3 subunits (CD3ε, CD3δ, CD3γ, and CD3ζ). The TCRα / TCRβ heterodimer itself is specialized for recognizing and binding antigens, but it lacks signal transduction capabilities. Instead, various adaptor molecules, co-receptors, or enzyme molecules aggregate in response to TCR-mediated antigen recognition, leading to phosphorylation and activation of the intracellular region of the CD3 subunits. This further transduces the antigen stimulation signal downstream. This TCR / CD3 complex signal not only functions as a survival or exclusion signal in positive or negative selection for immature T cells during T cell differentiation in the thymus, but also as an activation or proliferation signal for T cells that mature in the thymus and migrate to the periphery.

[0004] T cells are broadly classified into helper T cells and cytotoxic T cells. T cell therapy methods utilizing the anti-tumor effects of cytotoxic T cells are under development. As a T cell therapy using autologous T cells, CAR-T therapy, which expresses chimeric antigen receptors (CARs) on T cells to treat tumors, infections, etc., has been put into practical use and approved as a cell therapy in Europe and the United States. In the future, to reduce the burden on patients associated with T cell collection and to improve T cell quality and reduce manufacturing costs, allogeneic T cell therapy methods will be needed.

[0005] However, in the case of allogeneic T-cell therapy, the diverse TCRα / TCRβ heterodimers possessed by allogeneic T cells can cause strong allogeneic reactions, leading to tissue damage and the development of graft-versus-host disease (GVHD). Currently, to address this issue, attempts have been made to reduce or eliminate allogeneic reactions through treatments such as knocking down or deleting the TCR gene (Non-Patent Literature 1 and 2).

[0006] In addition, in recent years, as a means to produce homogeneous and highly functional T cell preparations without relying on donors, a method for inducing T cells by differentiating induced pluripotent stem (iPS) cells established using allogeneic T cells has been proposed (Non-Patent Literature 3, 4 and 5).

[0007] Furthermore, in order to provide T cell preparations derived from allogeneic iPS cells more universally, a method has been proposed to utilize an iPS cell bank established from blood cells (non-T cells) of donors that possess, in a homozygous manner, a human leukocyte antigen (HLA) haplotype as the human MHC (Non-Patent Document 6).

[0008] It is generally believed that for iPS cells derived from non-T cells to efficiently differentiate into T cells, it is important to reprogram the functional TCR locus during the differentiation process and stimulate the resulting TCR / CD3 complex in vitro to promote proliferation and survival (Non-Patent Literature 7).

[0009] Existing technical documents

[0010] Non-patent literature

[0011] Patent Document 1: Okamoto S. et al, Cancer Res. 69:9003-9011, 2009

[0012] Non-patent literature 2: Qasim W. et al, Sci Transl Med. 9, 2017

[0013] Non-patent literature 3: Nishimura T. et al, Cell Stem Cell. 12:114-226, 2013

[0014] Non-patent literature 4: Vizcardo R. et al, Cell Stem Cell. 12:31-36, 2013

[0015] Non-patent literature 5: Themeli M. et al, Nat. Biotechnol. 31:928-33, 2013

[0016] Non-patent literature 6: Jin Zixin, Latest Medical Journal 69:724-733, 2014

[0017] Non-patent literature 7: Mingawa et al., Cell Stem Cell. 23:1-9, 2018 Summary of the Invention

[0018] The problem that the invention aims to solve

[0019] However, if the TCR gene is knocked down or eliminated, the CD3 subunit cannot be maintained on the cell membrane surface, thus preventing the entry of TCR / CD3 complex-mediated proliferation and survival signals. This means that, for example, CD3 agonist antibodies used to expand donor-derived T cell preparations in vitro will no longer be effective, posing a challenge to the efficient production and formulation of cell drugs containing allogeneic T cells.

[0020] In the aforementioned research, in order for desired T cells to proliferate and survive via CD3 signaling at the appropriate time, it is desirable to express a TCRα / TCRβ complex on the cell surface. Furthermore, in order to avoid eliciting non-self recognition responses caused by allogeneic T cells, it is desirable that the TCRα / TCRβ complex does not recognize non-self antigens such as non-self HLA-peptide complexes.

[0021] Therefore, the object of the present invention is to provide a modified TCR that does not induce antigenic response and is able to maintain the CD3 subunit on the cell membrane to mediate CD3 signal transduction.

[0022] Methods for solving problems

[0023] To address the aforementioned issues, the inventors designed TCRα and TCRβ deletion variants that cause the variable and constant regions to be partially deleted, respectively. These combinations of deletion variants were introduced into 293T cells that stably expressed the CD3 subunit and Jurkat cells that had their endogenous TCR knocked out, thereby verifying whether CD3 subunit expression could be observed on the cell membrane surface.

[0024] As a result, modified TCRs containing a variable region lacking TCRα but containing a constant region of TCRα or a fragment thereof, and modified TCRs containing a variable region lacking TCRβ but containing a constant region of TCRβ or a fragment thereof, can maintain CD3 subunits on the cell membrane. Furthermore, it has been found that T cell activation can be induced by stimulating CD3 molecules presented to the cell surface using this modified TCR. In other words, it has been discovered that by expressing this modified TCR in T cells where endogenous TCR expression is suppressed or absent, a TCR / CD3 complex-mediated stimulus response can be achieved without inducing antigenic responsiveness, thus completing this invention.

[0025] That is, the present invention provides the following invention.

[0026] 1. A modified T-cell receptor (TCR) comprising a first polypeptide and a second polypeptide, wherein,

[0027] The first polypeptide is a polypeptide containing the constant region of human T cell receptor α (TCRα) or a fragment of the constant region but not the variable region of human TCRα.

[0028] The second polypeptide is a polypeptide containing the constant region of human T cell receptor β (TCRβ) or a fragment of the constant region but not the variable region of human TCRβ.

[0029] 2. The modified TCR according to 1 above, wherein the constant region of the human TCRα or a fragment thereof is a polypeptide described in any one of (A1) to (A3) below.

[0030] (A1) A polypeptide consisting of an amino acid sequence represented by any of the sequence numbers 1 to 11;

[0031] (A2) A polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to any of the amino acid sequences shown in sequence numbers 1 to 11;

[0032] (A3) A polypeptide consisting of an amino acid sequence in which one or more amino acids are replaced, inserted, deleted and / or added in any of the amino acid sequences shown in sequence numbers 1 to 11.

[0033] 3. The modified TCR according to 1 or 2 above, wherein the constant region of the human TCRβ or a fragment thereof is a polypeptide described in any one of (B1) to (B3) below.

[0034] (B1) A polypeptide consisting of an amino acid sequence represented by any of the sequence numbers 12 to 24;

[0035] (B2) A polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to any of the amino acid sequences shown in sequence numbers 12 to 24;

[0036] (B3) A polypeptide consisting of an amino acid sequence in which one or more amino acids are replaced, inserted, deleted and / or added in any of the amino acid sequences shown in sequence numbers 12 to 24.

[0037] 4. The modified TCR according to any one of 1 to 3 above, wherein the constant region or fragment of the human TCRα and the constant region or fragment of the human TCRβ are polypeptides described in any one of (a1) to (a8) below.

[0038] (a1) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 12, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 12, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 12; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 1 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 1 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 1 to 11.

[0039] (a2) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 13, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 13, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 13; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in Serial No. 1 or 2, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 1 or 2, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 1 or 2.

[0040] (a3) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 14, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 14, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 14; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 1 to 3 and 5 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 1 to 3 and 5 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 1 to 3 and 5 to 11.

[0041] (a4) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 19, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 19, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 19; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in Serial No. 10 or 11, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 10 or 11, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 10 or 11.

[0042] (a5) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 21, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 21, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added in the amino acid sequence shown in Serial No. 21; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 7 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 7 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added in the amino acid sequence shown in any of Serial Nos. 7 to 11.

[0043] (a6) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 22, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 22, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added in the amino acid sequence shown in Serial No. 22; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 4 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 4 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added in the amino acid sequence shown in any of Serial Nos. 4 to 11.

[0044] (a7) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 23, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 23, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added in the amino acid sequence shown in Serial No. 23; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 4 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 4 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added in the amino acid sequence shown in any of Serial Nos. 4 to 11.

[0045] (a8) The constant region or fragment of the aforementioned human TCRβ is a polypeptide consisting of the amino acid sequence shown in Serial No. 24, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 24, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 24; the constant region or fragment of the aforementioned human TCRα is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 4 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 4 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 4 to 11.

[0046] 5. The modified TCR according to any one of 1 to 4 above, wherein the constant region or fragment of the human TCRα and the constant region or fragment of the human TCRβ are polypeptides described in any one of (b1) to (b7) below.

[0047] (b1) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 12, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 12, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 12; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in any of Serial Nos. 1 to 11, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 1 to 11, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 1 to 11.

[0048] (b2) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 13, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 13, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 13; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in Serial No. 2, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 2, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 2.

[0049] (b3) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 14, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 14, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 14; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 1 to 3 and 10, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 1 to 3 and 10, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 1 to 3 and 10.

[0050] (b4) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 21, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 21, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 21; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in any of Serial Nos. 8 to 11, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 8 to 11, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 8 to 11.

[0051] (b5) The constant region or fragment of the aforementioned human TCRβ is a polypeptide consisting of the amino acid sequence shown in Serial No. 22, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 22, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 22; the constant region or fragment of the aforementioned human TCRα is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 4 and 6 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 4 and 6 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 4 and 6 to 11.

[0052] (b6) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 23, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 23, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 23; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in any of Serial Nos. 4 and 7 to 11, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 4 and 7 to 11, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 4 and 7 to 11.

[0053] (b7) The constant region or fragment of the aforementioned human TCRβ is a polypeptide consisting of the amino acid sequence shown in Serial No. 24, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 24, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 24; the constant region or fragment of the aforementioned human TCRα is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 4 and 6 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 4 and 6 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 4 and 6 to 11.

[0054] 6. The modified TCR according to any one of 1 to 5 above, wherein the constant region or fragment of the human TCRα and the constant region or fragment of the human TCRβ are polypeptides described in any one of (c1) to (c5) below.

[0055] (c1) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 12, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 12, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 12; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in any of Serial Nos. 1 to 11, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 1 to 11, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 1 to 11.

[0056] (c2) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 14, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 14, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 14; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in Serial No. 1, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 1, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 1.

[0057] (c3) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 22, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 22, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 22; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 8 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 8 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 8 to 11.

[0058] (c4) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 23, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 23, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 23; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 8 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 8 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 8 to 11.

[0059] (c5) The constant region or fragment of the aforementioned human TCRβ is a polypeptide consisting of the amino acid sequence shown in Serial No. 24, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 24, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 24; the constant region or fragment of the aforementioned human TCRα is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 8 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 8 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 8 to 11.

[0060] 7. The modified TCR according to any one of 1 to 6 above, wherein the first polypeptide comprises at least one of the AB ring, C chain, DE ring and F chain selected from the constant region of the human TCRα.

[0061] 8. The modified TCR according to any one of 1 to 7 above, wherein the second polypeptide comprises at least one selected from the constant region of the human TCRβ, including helix 3, CC ring, helix 4F chain and FG ring.

[0062] 9. The modified TCR according to any one of 1 to 8 above, wherein the first polypeptide comprises at least a portion of the extracellular region, the transmembrane region and the intracellular region of the constant region of the human TCRα, and the second polypeptide comprises at least a portion of the extracellular region, the transmembrane region and the intracellular region of the constant region of the human TCRβ.

[0063] 10. A modified TCR comprising a first polypeptide and a second polypeptide, wherein,

[0064] The first polypeptide is a polypeptide containing the constant region of human TCRα or a fragment of the constant region but not the variable region of human TCRα.

[0065] The second polypeptide is a polypeptide containing the constant region of human TCRβ or a fragment of the constant region but not the variable region of human TCRβ.

[0066] The proportion of CD3-positive cells in T cells that have been introduced with the above-mentioned modified TCR, including pluripotent stem cells, hematopoietic stem cells / hematopoietic progenitor cells, or T cells after knocking down or deleting the endogenous TCRα gene and endogenous TCRβ gene, is more than 1%.

[0067] 11. The modified TCR according to any one of 1 to 10 above, wherein the proportion of CD3-positive cells in pluripotent stem cells, hematopoietic stem cells / hematopoietic progenitor cells, or T cells after knocking down or knocking out the endogenous TCRα gene and the endogenous TCRβ gene respectively is more than twice the proportion of CD3-positive cells in the corresponding cells without the modified TCR.

[0068] 12. The modified TCR according to any one of 1 to 11 above, wherein the pluripotent stem cells or hematopoietic stem cells / hematopoietic progenitor cells introduced with the modified TCR show the same or greater T cell differentiation capacity compared with the corresponding cells introduced with the full-length TCR.

[0069] 13. The modified TCR according to any one of 1 to 12 above, wherein the allogeneic reactivity of non-T cell-derived pluripotent stem cells, hematopoietic stem cells / hematopoietic progenitor cells, or T cells after knocking down or knocking out the endogenous TCRα gene and the endogenous TCRβ gene, respectively, is reduced compared with the corresponding cells after the full-length TCR is introduced.

[0070] 14. The modified TCR according to any one of 1 to 13 above is able to maintain the CD3 subunit on the cell membrane.

[0071] 15. The modified TCR described in 14 above is capable of transducing TCR / CD3 complex-related signals into the cell.

[0072] 16. The modified TCR according to 14 or 15 above is capable of transducing TCR / CD3 complex-related signals into the cell via the CD3 subunit held on the cell membrane.

[0073] 17. The modified TCR according to 16 above, which activates T cells by transducing TCR / CD3 complex-related signals into the cell via the CD3 subunit held on the cell membrane.

[0074] 18. The modified TCR according to any one of 1 to 17 above, for expression in pluripotent stem cells, hematopoietic stem cells / hematopoietic progenitor cells, or T cells after knockdown or knockout of endogenous TCRα and endogenous TCRβ genes, respectively.

[0075] 19. The modified TCR according to 18 above, which is used to express in pluripotent stem cells or hematopoietic stem cells / hematopoietic progenitor cells to differentiate pluripotent stem cells or hematopoietic stem cells / hematopoietic progenitor cells into T cells.

[0076] 20. The modified TCR according to 18 above, used to produce T cells capable of performing the above-described modified TCR / CD3 complex-mediated stimulus response by expressing it in pluripotent stem cells, hematopoietic stem cells / hematopoietic progenitor cells, or T cells after knockdown or deletion of the endogenous TCRα gene and the endogenous TCRβ gene.

[0077] 21. The modified TCR according to any one of 1 to 20 above, wherein the pluripotent stem cells are non-T cell-derived pluripotent stem cells or T cell-derived pluripotent stem cells after knocking down or deleting the endogenous TCRα gene and the endogenous TCRβ gene.

[0078] 22. A cell that expresses any of the modified TCRs described in any one of 1 to 21 above.

[0079] 23. The cell described in 22 above, wherein the cell expressing the modified TCR is a T cell.

[0080] 24. A pharmaceutical composition comprising cells expressing any one of the modified TCRs described in any one of 1 to 21 above.

[0081] 25. A method for manufacturing cells expressing a modified TCR, wherein the modified TCR comprises a first polypeptide and a second polypeptide, the manufacturing method comprising the following steps (a) to (c).

[0082] (a) Steps for preparing cells;

[0083] (b) The steps of preparing expression vectors of polynucleotides containing a first polypeptide encoding a constant region or a fragment of human TCRα and a variable region containing human TCRα, and expression vectors of polynucleotides containing a second polypeptide encoding a constant region or a fragment of human TCRβ and a variable region containing human TCRβ.

[0084] (c) Transform the cells prepared in step (a) using the expression vector prepared in step (b).

[0085] 26. A method for manufacturing cells expressing a modified TCR, wherein the modified TCR comprises a first polypeptide and a second polypeptide, the manufacturing method comprising the following steps (a') to (c').

[0086] (a') Steps for preparing cells;

[0087] (b') The step of preparing an expression vector containing a polynucleotide encoding a first polypeptide containing a constant region or a fragment of human TCRα and a variable region containing human TCRα and a second polypeptide encoding a constant region or a fragment of human TCRβ and a variable region containing human TCRβ.

[0088] (c') The step of transforming the cells prepared in step (a') with the expression vector prepared in step (b').

[0089] 27. The manufacturing method according to 25 or 26 above, wherein the cells in step (a) or (a') are pluripotent stem cells, hematopoietic stem cells / hematopoietic progenitor cells, or T cells after knocking down or knocking out the TCRα and TCRβ genes.

[0090] 28. The manufacturing method according to any one of 25 to 27 above, wherein the cells expressing modified TCR are T cells for immune cell therapy.

[0091] 29. A method for producing T cells, comprising the steps of: expressing the modified TCR of any one of 1 to 21 into pluripotent stem cells or hematopoietic stem cells / hematopoietic progenitor cells, thereby differentiating them into T cells.

[0092] 30. A method for manufacturing T cells, comprising the step of expressing the modified TCR described in any one of 1 to 21 in T cells derived from pluripotent stem cells, hematopoietic stem cells / hematopoietic progenitor cells, or T cells after knocking down or deleting endogenous TCRα and endogenous TCRβ genes, respectively.

[0093] The resulting T cells are T cells capable of performing the above-described modified TCR / CD3 complex-mediated stimulus response.

[0094] 31. A method of immunotherapy, comprising the steps of causing pluripotent stem cells to express the modified TCR described in any one of 1 to 21 above to differentiate them into T cells, and administering the resulting T cells to a subject.

[0095] 32. A method for immunotherapy, comprising the steps of: causing T cells after knocking down or knocking out endogenous TCRα and endogenous TCRβ genes to express the modified TCR described in any one of 1 to 21, and administering the obtained T cells to a subject.

[0096] 33. A method of immunotherapy, comprising the steps of causing hematopoietic stem cells / progenitor cells to express the modified TCR described in any one of 1 to 21 above to differentiate them into T cells, and administering the obtained T cells to a subject.

[0097] 34. The modified TCR according to any one of 1 to 21 above, used for immunotherapy.

[0098] 35. A pluripotent stem cell-derived T cell for use in immunotherapy, wherein the pluripotent stem cell-derived T cell is obtained by differentiating pluripotent stem cells into T cells by expressing the modified TCR described in any one of 1 to 21 above.

[0099] 36. A T cell for use in immunotherapy, said T cell being obtained by expressing the modified TCR described in any one of 1 to 21 above in T cells after knocking down or knocking out the endogenous TCRα gene and the endogenous TCRβ gene, respectively.

[0100] 37. A T cell derived from hematopoietic stem cells / hematopoietic progenitor cells for use in immunotherapy, wherein the T cell derived from hematopoietic stem cells / hematopoietic progenitor cells is obtained by differentiating hematopoietic stem cells / hematopoietic progenitor cells into T cells by expressing the modified TCR described in any one of 1 to 21 above.

[0101] 38. The use of the modified TCR described in any one of 1 to 21 above in the manufacture of compositions for immune cell therapy.

[0102] 39. The use of pluripotent stem cell-derived T cells in the manufacture of compositions for immune cell therapy, wherein the pluripotent stem cell-derived T cells are obtained by differentiating pluripotent stem cells into T cells by expressing the modified TCR described in any one of 1 to 21 above.

[0103] 40. Use of T cells in the manufacture of compositions for immune cell therapy, wherein the T cells are obtained by expressing the modified TCR described in any one of 1 to 21 above by knocking down or deleting the endogenous TCRα gene and the endogenous TCRβ gene, respectively.

[0104] 41. Use of T cells in the manufacture of compositions for immune cell therapy, wherein the T cells are obtained by differentiating hematopoietic stem cells / progenitor cells into T cells by expressing the modified TCR described in any one of 1 to 21 above.

[0105] 42. A nucleic acid encoding a modified TCR as described in any one of 1 to 21 above.

[0106] 43. A vector comprising the nucleic acid described in 42 above.

[0107] 44. A method for manufacturing a pharmaceutical composition, wherein the nucleic acid described in 42 above or the carrier described in 43 above is used.

[0108] 45. A pharmaceutical composition comprising the nucleic acid described in 42 above or the carrier described in 43 above.

[0109] Invention Effects

[0110] The modified TCR of the present invention comprises a first polypeptide and a second polypeptide, wherein the first polypeptide contains the constant region of human TCRα or a fragment thereof, and the second polypeptide contains the constant region of human TCRβ or a fragment thereof, thereby enabling the retention of the CD3 subunit on the cell membrane. Furthermore, the first and second polypeptides of the modified TCR of the present invention do not contain the variable regions of TCRα and TCRβ, respectively, thereby eliminating antigen recognition capability. By expressing the modified TCR of the present invention into T cells whose endogenous TCR expression is suppressed or absent, it is possible to create T cells that do not elicit antigen responsiveness but are capable of undergoing a modified TCR / CD3 complex-mediated stimulus response. Attached Figure Description

[0111] Figure 1 This is a schematic diagram of a full-length TCR sequence and a modified TCR sequence.

[0112] Figure 2 A diagram showing the amino acid sequence information of ba1.

[0113] Figure 3 A diagram showing the amino acid sequence information of ba2 to ba9.

[0114] Figure 4 A diagram showing the amino acid sequence information of ba10 to ba18.

[0115] Figure 5 This figure shows the expression of CD3E when various ba vectors and mock (blank control) vectors are introduced into 293T cells that stably express CD3, analyzed by flow cytometry.

[0116] Figure 6 This figure is obtained by numerically representing the expression level of CD3E when various ba and mock vectors are introduced into 293T cells that stably express CD3 using MFI.

[0117] Figure 7 This is a graph showing the expression of CD3D when various ba and mock vectors are introduced into 293T cells that stably express CD3, analyzed by flow cytometry.

[0118] Figure 8 This figure is obtained by numerically representing the expression level of CD3D when various ba and mock vectors are introduced into 293T cells that stably express CD3 using MFI.

[0119] Figure 9 This is a graph showing the expression of CD3E when various ba and mock vectors are introduced into Jurkat cells with knocked-out endogenous TCRs, analyzed by flow cytometry.

[0120] Figure 10This figure represents the numerical representation of CD3E expression levels when various ba and mock vectors are introduced into Jurkat cells with knocked-out endogenous TCRs using MFI.

[0121] Figure 11 This is a graph showing the expression of CD3D when various ba and mock vectors are introduced into Jurkat cells with knocked-out endogenous TCRs, analyzed by flow cytometry.

[0122] Figure 12 This figure represents the numerical representation of CD3D expression levels when various ba and mock vectors are introduced into Jurkat cells with knocked-out endogenous TCRs using MFI.

[0123] Figure 13 The figure is a result of flow cytometry analysis of changes in responsiveness to OKT3 antibody stimulation caused by the knockout of endogenous TCRs, using the upregulation of CD69 expression, a marker of activated T cells, as an indicator.

[0124] Figure 14 This is a graph showing the expression of CD69 in Jurkat cells with knocked-out endogenous TCR after the introduction of various ba and mock vectors and stimulation with OKT3 antibody, analyzed by flow cytometry.

[0125] Figure 15 The figure is obtained by numerically representing the expression level of CD69 when various ba and mock vectors are introduced into Jurkat cells with knocked-out endogenous TCR and stimulated with OKT3 antibody using MFI.

[0126] Figure 16 A schematic diagram showing a portion of the N-terminal amino acid sequence of the extracellular region of modified TCRα and the structure of that amino acid sequence is presented. The amino acid sequence with an asterisk (*) at the N-terminus represents a portion of a known human TCRα amino acid sequence (documented in Protein Data Bank ID: 3QJF; https: / / www.rcsb.org / pdb / explore / remediatedSequence.do?structureId=3QJF).

[0127] Figure 17A schematic diagram showing a portion of the N-terminal amino acid sequence of the extracellular region of modified TCRβ and the structure of that amino acid sequence is presented. The amino acid sequence with an asterisk (*) at the N-terminus represents a portion of a known human TCRβ amino acid sequence (documented in Protein Data Bank ID: 3QJF; https: / / www.rcsb.org / pdb / explore / remediatedSequence.do?structureId=3QJF).

[0128] Figure 18 The average CD3 positivity rate (n=3) of cells introduced with various modified TCR expression vectors is shown.

[0129] Figure 19 (A) is a graph showing the results of expression analysis of CD3 and CD45 in FF-WJs524. Figure 19 (B) is a graph showing the results of expression analysis of CD8β and CD8α in FF-WJs524.

[0130] Figure 20 (A) is a graph showing the results of culturing on DLL4 and recombinant human fibrin fragment (Retronectin) for 21 days. Figure 20 (B) is a graph showing the expression analysis results of CD8β and CD8α. Detailed Implementation

[0131] [TCR Modification]

[0132] The modified TCR of the present invention is a modified TCR comprising a first polypeptide and a second polypeptide, characterized in that the first polypeptide is a polypeptide containing a constant region of human TCRα or a fragment of the constant region but not a variable region of human TCRα, and the second polypeptide is a polypeptide containing a constant region of human TCRβ or a fragment of the constant region but not a variable region of human TCRβ.

[0133] The TCRα gene consists of a variable region (V region), a linker region (J region), and a constant region (C region). On the other hand, the TCRβ locus consists of a V region, a variable region (D region), a J region, and a C region. The TCR loci are reprogrammed on the genome during T cell differentiation.

[0134] The V and J regions in TCRα, and the V, D, and J regions in TCRβ are linked in various combinations, and irregular insertions or deletions of bases occur in each linking region, thereby forming functional and highly diverse variable part exons.

[0135] Furthermore, during gene transcription, the variable exon is linked to the C region exon via RNA splicing, thereby forming the full-length TCR gene mRNA. Subsequently, the TCRα and TCRβ polypeptides, which are translated into proteins, form a heterodimer, and the TCR is presented to the cell membrane surface.

[0136] The TCRα and TCRβ polypeptides each have a variable region and a constant region, a transmembrane region, and an intracellular region, respectively, which are extracellular regions. Hereinafter, the constant region in this invention refers to the C-region sequence for genes and the sequence excluding the variable region domain (non-variable region) for polypeptides.

[0137] It is known that the constant region gene of TCRα is of one type (TRAC gene), while the constant region gene of TCRβ is of two types (TRBC1 gene and TRBC2 gene). During TCRβ locus reprogramming, either TRBC1 or TRBC2 is selected. Based on sequence information extracted from IMGT (the international ImMunoGeneTics information system), the TRBC1 and TRBC2 genes differ by only 5 amino acids in their amino acid sequences. Furthermore, the C-terminus of TRBC2 is only 2 amino acids longer than that of TRBC1. The two genes show high sequence homology, but their functional differences are still unknown.

[0138] Examples of amino acid sequences that constitute the constant region of human TCRα include, for example, the amino acid sequence shown in sequence number 1.

[0139] Furthermore, the amino acid sequence that is a segment of the constant region of human TCRα can be any amino acid sequence as long as it is a part of the constant region of human TCRα, such as any of the amino acid sequences shown in sequence numbers 2 to 11.

[0140] As one embodiment of the constant region or fragment of human TCRα in this invention, the polypeptide described in any one of (A1) to (A3) below can be listed.

[0141] (A1) A polypeptide consisting of an amino acid sequence represented by any of the sequence numbers 1 to 11;

[0142] (A2) A polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to any of the amino acid sequences shown in sequence numbers 1 to 11;

[0143] (A3) A polypeptide consisting of an amino acid sequence in which one or more amino acids are replaced, inserted, deleted and / or added in any of the amino acid sequences shown in sequence numbers 1 to 11.

[0144] Examples of amino acid sequences that constitute the constant region of human TCRβ include, for example, the amino acid sequence shown in sequence number 12.

[0145] The amino acid sequence of the constant region fragment of human TCRβ in this invention can be any amino acid sequence as long as it is a partial sequence of the constant region of human TCRβ, such as any of the amino acid sequences shown in sequence numbers 13 to 24.

[0146] As a form of the constant region or a fragment of the human TCRβ, the polypeptide described in any of the following (B1) to (B3) can be listed.

[0147] (B1) A polypeptide consisting of an amino acid sequence represented by any of the sequence numbers 12 to 24;

[0148] (B2) A polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to any of the amino acid sequences shown in sequence numbers 12 to 24;

[0149] (B3) A polypeptide consisting of an amino acid sequence in which one or more amino acids are replaced, inserted, deleted and / or added in any of the amino acid sequences shown in sequence numbers 12 to 24.

[0150] As long as the modified TCR of the present invention achieves the effects of the present invention, the length of the amino acid sequence of the constant region or fragment of the human TCRα or the constant region or fragment of the human TCRβ described above can also be changed, including modified TCRs derived from human TCRs that have incorporated variations based on single nucleotide polymorphisms (SNPs). Furthermore, as long as the modified TCR of the present invention achieves the effects of the present invention, it also includes modified TCRs that have undergone known modifications for the purpose of improving TCR function (e.g., modifications described in Michael S. Kuhns et al., Immunity. 26:357-369, 2007, Aswin Natarajan et al., Cell Reports. 14:2833-2845, 2016, or Schamel W. Wolfgang et al. Immunological Reviews. 291:8-25, 2019).

[0151] For peptides with amino acid sequences having one or more amino acid substitutions, insertions, deletions, and / or additions in the target amino acid sequence, site-specific mutations can be introduced into DNA encoding, for example, a peptide containing amino acid sequences from sequence numbers 1 to 24, using site-directed mutagenesis (described in Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989; Current Protocols in Molecular Biology, John Wiley & Sons. 1987-1997; Nucleic Acids Research. 10, 6487, 1982; Proc. Natl. Acad. Sci. USA. 79, 6409, 1982; Gene, 34:315, 1985; Nucleic Acids Research. 13:4431, 1985; or Proc. Natl. Acad. Sci. USA. 82:488, 1985).

[0152] There is no particular limitation on the range of one or more substitutions, insertions, deletions, and / or additions of one or more amino acids in the amino acid sequence. For example, if 100 amino acids in the amino acid sequence are defined as a unit, then the unit contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids, preferably about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, and more preferably about 1, 2, 3, 4, or 5.

[0153] Amino acid deletion refers to the removal or disappearance of amino acid residues in a sequence; amino acid substitution refers to the replacement of amino acid residues in a sequence with other amino acid residues; and amino acid insertion or addition refers to the addition of new amino acid residues before, after, or within a sequence.

[0154] As a specific way of replacing one or more amino acids, there is, for example, the replacement of one or more amino acids by other chemically similar amino acids. Examples include replacing one hydrophobic amino acid with another hydrophobic amino acid, or replacing one polar amino acid with another polar amino acid having the same charge. In this art, such chemically similar amino acids are known for each amino acid.

[0155] Specific examples include nonpolar (hydrophobic) amino acids such as alanine, valine, glycine, isoleucine, leucine, proline, tryptophan, phenylalanine, and methionine. Polar (neutral) amino acids include serine, threonine, tyrosine, glutamine, asparagine, and cysteine. Positively charged basic amino acids include arginine, histidine, and lysine. Additionally, negatively charged acidic amino acids include aspartic acid and glutamic acid.

[0156] As an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added to the amino acid sequence of the target protein, examples can be made of amino acid sequences that have a certain degree or more sequence identity with the amino acid sequence of the target protein. Examples of examples are amino acid sequences that have a sequence identity of 60% or more, preferably 65% ​​or more, preferably 70% or more, preferably 75% or more, preferably 80% or more, preferably 85% or more, more preferably 90% or more, and even more preferably 95% or more.

[0157] As one aspect of the modified TCR of the present invention, it is preferred that the constant region or fragment of the constant region of the above-mentioned human TCRα and the constant region or fragment of the above-mentioned human TCRβ are modified TCRs of the polypeptides described in any one of (a1) to (a8) below.

[0158] (a1) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 12, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 12, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 12; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 1 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 1 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 1 to 11.

[0159] (a2) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 13, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 13, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 13; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in Serial No. 1 or 2, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 1 or 2, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 1 or 2.

[0160] (a3) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 14, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 14, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 14; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 1 to 3 and 5 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 1 to 3 and 5 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 1 to 3 and 5 to 11.

[0161] (a4) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 19, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 19, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 19; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in Serial No. 10 or 11, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 10 or 11, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 10 or 11.

[0162] (a5) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 21, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 21, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added in the amino acid sequence shown in Serial No. 21; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 7 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 7 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added in the amino acid sequence shown in any of Serial Nos. 7 to 11.

[0163] (a6) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 22, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 22, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added in the amino acid sequence shown in Serial No. 22; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 4 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 4 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added in the amino acid sequence shown in any of Serial Nos. 4 to 11.

[0164] (a7) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 23, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 23, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added in the amino acid sequence shown in Serial No. 23; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 4 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 4 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted and / or added in the amino acid sequence shown in any of Serial Nos. 4 to 11.

[0165] (a8) The constant region or fragment of the aforementioned human TCRβ is a polypeptide consisting of the amino acid sequence shown in Serial No. 24, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 24, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 24; the constant region or fragment of the aforementioned human TCRα is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 4 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 4 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 4 to 11.

[0166] Furthermore, among the modified TCRs of the polypeptides described in (a1) to (a8) above, it is preferable to use the modified TCR of the polypeptide described in any one of (b1) to (b7) below.

[0167] (b1) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 12, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 12, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 12; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in any of Serial Nos. 1 to 11, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 1 to 11, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 1 to 11.

[0168] (b2) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 13, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 13, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 13; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in Serial No. 2, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 2, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 2.

[0169] (b3) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 14, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 14, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 14; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 1 to 3 and 10, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 1 to 3 and 10, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 1 to 3 and 10.

[0170] (b4) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 21, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 21, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 21; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in any of Serial Nos. 8 to 11, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 8 to 11, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 8 to 11.

[0171] (b5) The constant region or fragment of the aforementioned human TCRβ is a polypeptide consisting of the amino acid sequence shown in Serial No. 22, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 22, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 22; the constant region or fragment of the aforementioned human TCRα is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 4 and 6 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 4 and 6 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 4 and 6 to 11.

[0172] (b6) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 23, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 23, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 23; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in any of Serial Nos. 4 and 7 to 11, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 4 and 7 to 11, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 4 and 7 to 11.

[0173] (b7) The constant region or fragment of the aforementioned human TCRβ is a polypeptide consisting of the amino acid sequence shown in Serial No. 24, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 24, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 24; the constant region or fragment of the aforementioned human TCRα is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 4 and 6 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 4 and 6 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 4 and 6 to 11.

[0174] Furthermore, among the modified TCRs of the polypeptides described in (b1) to (b7) above, it is preferable to use the modified TCR of the polypeptide described in any one of (c1) to (c5) below.

[0175] (c1) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 12, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 12, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 12; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in any of Serial Nos. 1 to 11, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 1 to 11, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 1 to 11.

[0176] (c2) The constant region or fragment of the aforementioned human TCRβ is a polypeptide composed of the amino acid sequence shown in Serial No. 14, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 14, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 14; the constant region or fragment of the aforementioned human TCRα is a polypeptide composed of the amino acid sequence shown in Serial No. 1, a polypeptide composed of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 1, or a polypeptide composed of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 1.

[0177] (c3) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 22, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 22, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 22; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 8 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 8 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 8 to 11.

[0178] (c4) The constant region of the aforementioned human TCRβ or the segment thereof is a polypeptide consisting of the amino acid sequence shown in Serial No. 23, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 23, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 23; the constant region of the aforementioned human TCRα or the segment thereof is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 8 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 8 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 8 to 11.

[0179] (c5) The constant region or fragment of the aforementioned human TCRβ is a polypeptide consisting of the amino acid sequence shown in Serial No. 24, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in Serial No. 24, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in Serial No. 24; the constant region or fragment of the aforementioned human TCRα is a polypeptide consisting of the amino acid sequence shown in any of Serial Nos. 8 to 11, a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to the amino acid sequence shown in any of Serial Nos. 8 to 11, or a polypeptide consisting of an amino acid sequence in which one or more amino acids are substituted, inserted, deleted, and / or added in the amino acid sequence shown in any of Serial Nos. 8 to 11.

[0180] In the modified TCR of the present invention, the first polypeptide preferably includes at least one of the AB ring, C chain, DE ring and F chain selected from the constant region of human TCRα.

[0181] Preferably, the constant region of human TCRα contains the AB ring, C chain, DE ring and F chain in sequence, but they can also be contained in different orders.

[0182] The AB ring is, for example, a structure composed of amino acid sequences from positions 14 to 20 of the amino acid sequence shown in Serial No. 1. The C chain is, for example, a structure composed of amino acid sequences from positions 29 to 40 of the amino acid sequence shown in Serial No. 1. The DE ring is, for example, a structure composed of amino acid sequences from positions 52 to 57 of the amino acid sequence shown in Serial No. 1. The F chain is, for example, a structure composed of amino acid sequences from positions 67 to 81 of the amino acid sequence shown in Serial No. 1.

[0183] In the modified TCR of the present invention, the second polypeptide preferably comprises at least one of the following selected from the constant region of human TCRβ: helix 3, CC ring, helix 4F chain, and FG ring.

[0184] Preferably, the constant region of human TCRβ contains helical 3, CC ring, helical 4F chain and FG ring in sequence, but they can also be contained in a different order.

[0185] Helix 3 is, for example, a structure composed of amino acid sequences from positions 20 to 26 of the amino acid sequence shown in Serial Number 12. The CC ring is, for example, a structure composed of amino acid sequences from positions 49 to 54 of the amino acid sequence shown in Serial Number 12. The F chain of helix 4 is, for example, a structure composed of amino acid sequences from positions 88 to 93 of the amino acid sequence shown in Serial Number 12. The FG ring is, for example, a structure composed of amino acid sequences from positions 105 to 113 of the amino acid sequence shown in Serial Number 12.

[0186] In the modified TCR of the present invention, the first polypeptide preferably includes at least a portion of the extracellular region, transmembrane region and intracellular region of the constant region of human TCRα, and the second polypeptide includes at least a portion of the extracellular region, transmembrane region and intracellular region of the constant region of human TCRβ.

[0187] The extracellular region of the constant region of human TCRα is, for example, a region consisting of amino acid sequences from positions 1 to 117 of the amino acid sequence shown in Serial No. 1. The transmembrane region of the constant region of human TCRα is, for example, a region consisting of amino acid sequences from positions 118 to 139 of the amino acid sequence shown in Serial No. 1. As a preferred method of including at least a portion of the extracellular region of the constant region of human TCRα, it may include, for example, at least amino acids from positions 82 to 117 of the region consisting of amino acid sequences from positions 1 to 117 of the amino acid sequence shown in Serial No. 1. The intracellular region of the constant region of human TCRα is, for example, a region consisting of amino acid sequences from positions 140 to 141 of the amino acid sequence shown in Serial No. 1.

[0188] The extracellular region of the constant region of human TCRβ is, for example, a region consisting of amino acid sequences from positions 1 to 146 of the amino acid sequence shown in Serial No. 12. The transmembrane region of the constant region of human TCRβ is, for example, a region consisting of amino acid sequences from positions 147 to 172 of the amino acid sequence shown in Serial No. 12. As a preferred method for including at least a portion of the extracellular region of the constant region of human TCRβ, it may include, for example, at least amino acids from positions 114 to 146 of the region consisting of amino acid sequences from positions 1 to 146 of the amino acid sequence shown in Serial No. 12. The intracellular region of the constant region of human TCRβ is, for example, a region consisting of amino acid sequences from positions 173 to 179 of the amino acid sequence shown in Serial No. 12.

[0189] Additionally, polypeptides comprising, for example, the amino acid sequences of the constant region or fragments of human TCRα, or the amino acid sequences of the constant region or fragments of human TCRβ (e.g., described in Protein Data Bank ID: 3QJF; https: / / www.rcsb.org / pdb / explore / remediatedSequence.do?structureId=3QJF) disclosed in known databases such as the Protein Data Bank are also included in the polypeptides of the present invention.

[0190] In the constant region of wild-type TCRα or wild-type TCRβ, cysteine ​​residues in their respective amino acid sequences form disulfide bonds to link the two chains. Similarly, the modified TCR of the present invention can also have additional cysteine ​​residues in the first and second polypeptides to form disulfide bonds in the amino acid sequence of the constant region or fragment of the constant region. Furthermore, the first and second polypeptides can also be modified to form additional disulfide bonds intra- and / or inter-chain, thereby improving the stability of the modified TCR.

[0191] With the above-described structure, the modified TCR of the present invention can associate with the CD3 and CD3ζ chains of mammals, which have three different chains (γ, δ, and ε), thereby retaining the CD3 subunit on the cell membrane. The CD3 subunit plays an important role in signal transduction from the TCR to the cell. The modified TCR of the present invention transduces TCR / CD3 complex-related signals into the cell via the CD3 subunits retained on the cell membrane, thereby activating T cells.

[0192] The proportion of CD3-positive cells in pluripotent stem cells, hematopoietic stem cells / hematopoietic progenitor cells, or T cells after knockdown or deletion of the endogenous TCRα and TCRβ genes, respectively, introduced with the modified TCR of the present invention, is preferably 1% or more, 3% or more, 5% or more, 10% or more, or 15% or more, more preferably 20% or more, further preferably 40% or more, particularly preferably 60% or more, especially preferably 75% or more, and most preferably 80% or more. If the proportion of CD3-positive cells is at least 1%, a sufficient stimulus response is obtained mediated by the modified TCR / CD3 complex. As described in the examples below, the proportion of CD3-positive cells can be evaluated by investigating the proportion of CD3D-positive cells or CD3E-positive cells using flow cytometry.

[0193] From the viewpoint of obtaining a sufficient stimulus response mediated by the modified TCR / CD3 complex, the proportion of CD3-positive cells in pluripotent stem cells, hematopoietic stem cells / hematopoietic progenitor cells, or T cells in which the modified TCR of the present invention has been incorporated is preferably 2 times or more, more preferably 5 times or more, further preferably 10 times or more, and particularly preferably 20 times or more, of the proportion of CD3-positive cells in the corresponding cells.

[0194] Pluripotent stem cells or hematopoietic stem cells / hematopoietic progenitor cells infused with the modified TCR of the present invention preferably exhibit T cell differentiation capacity equal to or greater than that of cells infused with a full-length TCR (wild-type TCR). T cell differentiation capacity can be evaluated by the method described later for determining whether T cells remain in an undifferentiated state.

[0195] It is generally believed that the antigen recognition site formed by the variable region of the TCRα / TCRβ heterodimer identifies whether the target cell is self or non-self. The first and second polypeptides of the modified TCR of this invention do not contain the variable regions of TCRα and TCRβ, respectively, resulting in the loss of antigen recognition ability and reduced or absent / absent allogeneic reactivity.

[0196] In addition, the modified TCR of the present invention may contain a signal peptide at the N-terminus.

[0197] The modified TCR of the present invention can preferably be used for the following purposes: expression in pluripotent stem cells, hematopoietic stem cells / hematopoietic progenitor cells, or T cells after knockdown or deletion of endogenous TCRα and endogenous TCRβ genes, respectively; expression in pluripotent stem cells or hematopoietic stem cells / hematopoietic progenitor cells to differentiate them into T cells; expression in pluripotent stem cells, hematopoietic stem cells / hematopoietic progenitor cells, or T cells after knockdown or deletion of endogenous TCRα and endogenous TCRβ genes, respectively to produce T cells capable of performing a modified TCR / CD3 complex-mediated stimulus response; etc.

[0198] [Cells expressing modified TCRs and their manufacturing methods]

[0199] In this invention, there are no particular limitations on the method of introducing a modified TCR into cells to create cells expressing the modified TCR, and known methods can be used appropriately. Examples include methods of introducing the modified TCR into cells in the form of a polynucleotide encoding the modified TCR; or methods of introducing the modified TCR into cells in the form of a protein.

[0200] As one method of manufacturing a TCR-encoding polynucleotide introduced into a cell, a method including steps (a) to (c) or steps (a') to (c') can be listed.

[0201] (a) Steps for preparing cells;

[0202] (b) The steps of preparing expression vectors of polynucleotides containing a first polypeptide encoding a constant region or a fragment of human TCRα and a variable region containing human TCRα, and expression vectors of polynucleotides containing a second polypeptide encoding a constant region or a fragment of human TCRβ and a variable region containing human TCRβ.

[0203] (c) Transform the cells prepared in step (a) using the expression vector prepared in step (b).

[0204] (a') Steps for preparing cells;

[0205] (b') The step of preparing an expression vector containing a polynucleotide encoding a first polypeptide containing a constant region or a fragment of human TCRα and a variable region containing human TCRα and a second polypeptide encoding a constant region or a fragment of human TCRβ and a variable region containing human TCRβ.

[0206] (c') The step of transforming the cells prepared in step (a') with the expression vector prepared in step (b').

[0207] There are no particular restrictions on the types of polynucleotides; they can be selected based on the gene insertion method, and can be either DNA or RNA.

[0208] Polynucleotides that encode the constant region of human TCRα or segments thereof can be listed, for example, the polynucleotides described in (i) to (v) below.

[0209] (i) A polynucleotide consisting of the base sequence shown in any of sequence numbers 25–35;

[0210] (ii) A polynucleotide having more than 90% sequence identity with the base sequence shown relative to any of sequence numbers 25-35;

[0211] (iii) A polynucleotide consisting of a base sequence that hybridizes under stringent conditions with the base sequence shown in any of sequence numbers 25 to 35 or the complementary nucleotide sequence of that base sequence.

[0212] (iv) A polynucleotide encoding a polypeptide consisting of an amino acid sequence represented by any of the sequence numbers 1 to 11;

[0213] (v) A polynucleotide encoding a polypeptide consisting of an amino acid sequence having more than 90% sequence identity with respect to any of the amino acid sequences shown in sequence numbers 1 to 11.

[0214] Examples of polynucleotides that encode the constant region of human TCRβ or segments thereof include, for example, the polynucleotides described in (vi) to (x) below.

[0215] (vi) A polynucleotide consisting of a base sequence represented by any of the sequence numbers 36 to 48;

[0216] (vii) Polynucleotides that have more than 90% sequence identity with the base sequence shown relative to any of sequence numbers 36-48;

[0217] (viii) A polynucleotide consisting of a base sequence that hybridizes under stringent conditions with the base sequence shown in any of sequence numbers 36 to 48 or the complementary base sequence of that sequence.

[0218] (ix) encodes a polynucleotide of a polypeptide consisting of an amino acid sequence represented by any of the sequences 12 to 24;

[0219] (x) encodes a polynucleotide of a polypeptide consisting of an amino acid sequence that has more than 90% sequence identity with respect to any of the amino acid sequences shown in sequence numbers 12 to 24.

[0220] Examples of base sequences that can hybridize under strict conditions include, for instance, polynucleotide base sequences that can hybridize obtained by using a polynucleotide containing the target base sequence as a probe, such as colony hybridization, plaque hybridization, Southern blotting, or DNA microarray.

[0221] Specifically, examples of DNA base sequences that can be identified include those obtained by using a filter or slide immobilized with a DNA sequence derived from a colony or plaque undergoing hybridization, or a PCR product or oligoDNA containing that DNA sequence, at 65°C in the presence of 0.7–1.0 mol / L sodium chloride (e.g., described in Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989; Current Protocols in Molecular Biology, John Wiley & Sons, 1987–1997; or DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford University, 1995). Following this, the filter or slide is washed at 65°C with 0.1–2 times the concentration of SSC solution (a 1-fold concentration SSC solution consists of 150 mmol / L sodium chloride and 15 mmol / L sodium citrate).

[0222] As a polynucleotide containing a base sequence for hybridization under strict conditions, examples include DNA with a certain or higher sequence identity to the base sequence of a polynucleotide containing the base sequence of a target gene used as a probe. Examples include DNA with at least 60% homology to the target base sequence, preferably DNA with at least 80% homology, and more preferably DNA with at least 95% homology. Additionally, examples include DNA containing the following base sequences, where, when 100 bases are considered as a unit, the target gene base sequence contains one to several, preferably 1 to 40, preferably 1 to 35, preferably 1 to 30, preferably 1 to 25, preferably 1 to 20, more preferably 1 to 15, and more preferably 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, and even more preferably 1, 2, 3, 4, or 5 base substitutions, insertions, deletions, and / or additions.

[0223] Base deletion refers to the loss or disappearance of a base in a sequence; base substitution refers to the replacement of a base in a sequence with another base; base insertion or addition refers to the addition of a new base.

[0224] Gene polymorphism is frequently observed in the base sequences of proteins-encoding genes in eukaryotes. In the case of the gene base sequences used in this invention, the base sequences of genes whose base sequences have undergone minor variations due to such polymorphism are also included.

[0225] In this invention, sequence identity refers to the consistency between two sequences, meaning that the same nucleotide or amino acid is accurately present at the same position in two nucleotide or protein sequences when the two sequences are aligned and compared. Therefore, when two proteins show 90% identity, it means that 90% of all amino acid residues in the corresponding protein are exactly the same.

[0226] Unless otherwise stated, the sequence consistency values ​​in this invention can be values ​​calculated using sequence consistency retrieval procedures known to those skilled in the art. For base sequences, values ​​calculated using default parameters in BLAST (e.g., as described in J. Mol. Biol., 215, 403, 1990) can be used. For amino acid sequences, values ​​calculated using default parameters in BLAST2 (e.g., as described in Nucleic Acids Res., 25, 3389, 1997, Genome Res., 7, 649, 1997, or http: / / www.ncbi.nlm.nih.gov / Education / BLASTinfo / information3.html) or pairwise sequence alignment based on the Needleman-Wunsch algorithm can be used.

[0227] As default parameters, examples include: G (cost to open gap) is 5 for base sequences and 11 for amino acid sequences; -E (cost to extend gap) is 2 for base sequences and 1 for amino acid sequences; -q (penalty for nucleotide mismatch) is -3; -r (reward for nucleotide match) is 1; -e (expect value) is 10; -W (wordsize) is 11 residues for base sequences and 3 residues for amino acid sequences; -y (dropoff(X) for blastextensions in bits) is 20 for blastn and 7 for other programs; -X (dropoff value for gapped alignment in bits) is 15; -Z (final X dropoff value for gapped alignment in bits) is... The number of bits is 50 in the case of blastn and 25 in programs other than blastn (e.g., described at http: / / www.ncbi.nlm.nih.gov / blast / htmL / blastcgihelp.html).

[0228] Gene introduction can be performed using methods commonly used in the field, and such methods are not particularly limited. For example, the gene of the present invention can be introduced by infecting the cells to be introduced with a viral vector such as a retrovirus, lentivirus, or adenovirus. Alternatively, it can be integrated into a non-viral vector such as a plasmid, bacterial vector, or epithelial vector, and then introduced into the cells to be introduced via transfection, electroporation, liposomes, calcium phosphate co-precipitation, DEAE dextran method, or microinjection.

[0229] Furthermore, the gene of this invention can be inserted into any genomic DNA site in a cell. For example, it can be freely introduced using genome editing technologies such as transcription activator-like effector nucleases (TALENs), CRISPR (clustered regulatory interspaced short palindromic repeats) / Cas9, or transposon methods. Alternatively, the gene of this invention can be introduced into cells and expressed using artificial chromosome vectors or similar methods.

[0230] When multiple genes are introduced, such as those encoding the constant region of human TCRα or a fragment thereof, and those encoding the constant region of human TCRβ or a fragment thereof, each gene can be configured under the control of an independent promoter and inserted into the same vector or different vectors. Alternatively, an expression cassette can be created that connects the genes via intercalation sequences and uses a single promoter.

[0231] The intercalation sequence mentioned above is not limited and can include, for example, internal ribosome entry site (IRES) sequences or 2A peptide sequences (described in Szymczak et al., Expert Opin. Biol. Ther., 2005, 5:627-638). The 2A peptide is a virally derived peptide sequence of approximately 20 amino acid residues. When multiple genes are linked using the 2A peptide, due to the ribosomal skip mechanism during translation, the glycine and proline residues at the C-terminus of the 2A peptide are not linked, thus cleaving and expressing each polypeptide.

[0232] As one method for manufacturing a modified TCR in the form of a protein, methods can be listed such as synthesizing the modified TCR from the aforementioned polynucleotides via a protein synthesis system and taking it into the cell, thereby expressing the modified TCR on the cell surface. Methods for introducing proteins into target cells can be listed such as methods using protein delivery reagents, methods using protein delivery domain (PTD) fusion proteins, electroporation, microinjection, or the methods described in Shimono K, et al., Protein Sci. 18(10):2160-71, 2009.

[0233] [Import cells with modified TCRs]

[0234] Examples of cells that can be used to introduce and modify TCRs include pluripotent stem cells, hematopoietic stem cells / hematopoietic progenitor cells, or T cells with the endogenous TCRα gene and endogenous TCRβ gene knocked down or eliminated.

[0235] In this invention, pluripotent stem cells refer to stem cells existing in an organism that possess the pluripotency to differentiate into a majority of cells and also have proliferative capacity, including at least any cells capable of differentiating / inducing into T cells used in this invention. Pluripotent stem cells are preferably derived from mammals, and more preferably from humans.

[0236] In this invention, "source" refers to the origin from which it is obtained. For example, pluripotent stem cells derived from mammals refer to pluripotent stem cells obtained from mammals.

[0237] Pluripotent stem cells are not particularly limited and include, for example, embryonic stem (ES) cells, embryonic stem cells derived from cloned embryos obtained through nuclear transfer (ntES) cells, sperm stem cells (GS cells), embryonic germ cells (EG cells), induced pluripotent stem cells (iPS) cells, pluripotent stem cells derived from cultured fibroblasts or umbilical cord blood, or pluripotent stem cells derived from bone marrow stem cells (Muse cells), etc. In this invention, from the viewpoint that the manufacturing process can obtain the pluripotent stem cells without destroying the embryo or egg, iPS cells are preferred, and human iPS cells are more preferred.

[0238] The pluripotent stem cells of the present invention are preferably pluripotent stem cells that do not possess endogenous TCRα and endogenous TCRβ genes, and more preferably pluripotent stem cells derived from non-T cells, or pluripotent stem cells derived from T cells after knocking down or deleting endogenous TCRα and endogenous TCRβ genes. Examples include induced pluripotent stem cells (T-iPS cells) derived from T cells after knocking down or deleting endogenous TCRα and endogenous TCRβ genes.

[0239] The methods for manufacturing iPS cells are well-known in the field, and can be achieved by introducing initialization factors into any somatic cell. Examples of initialization factors include genes or gene products such as Oct3 / 4, Sox2, Sox1, Sox3, Sox15, Sox17, Klf4, Klf2, c-Myc, N-Myc, L-Myc, Nanog, Lin28, Fbx15, ERas, ECAT15-2, Tcl1, beta-catenin, Lin28b, Sall1, Sall4, Esrrb, Nr5a2, Tbx3, or Glis1. These initialization factors can be used alone or in combination.

[0240] Examples of combinations of initialization factors include International Publication No. 2007 / 069666, International Publication No. 2008 / 118820, International Publication No. 2009 / 007852, International Publication No. 2009 / 032194, International Publication No. 2009 / 058413, International Publication No. 2009 / 057831, International Publication No. 2009 / 075119, and International Publication No. 2009 / 079. No. 007, International Publication No. 2009 / 091659, International Publication No. 2009 / 101084, International Publication No. 2009 / 101407, International Publication No. 2009 / 102983, International Publication No. 2009 / 114949, International Publication No. 2009 / 117439, International Publication No. 2009 / 126250, International Publication No. 2009 / 126251, International Publication No. International Publication No. 2009 / 126655, International Publication No. 2009 / 157593, International Publication No. 2010 / 009015, International Publication No. 2010 / 033906, International Publication No. 2010 / 033920, International Publication No. 2010 / 042800, International Publication No. 2010 / 050626, International Publication No. 2010 / 056831, International Publication No. 2010 / 06895 No. 5, International Publication No. 2010 / 098419, International Publication No. 2010 / 102267, International Publication No. 2010 / 111409, International Publication No. 2010 / 111422, International Publication No. 2010 / 115050, International Publication No. 2010 / 124290, International Publication No. 2010 / 147395, International Publication No. 2010 / 147612, Huangfu D,et al.,Nat.Biotechnol.,26:795-797,2008,Shi Y,et al.,Cell Stem Cell,2:525-528,2008,Eminli S,et al.,StemCells.26:2467-2474,2008,Huangfu D,et al., Nat. Biotechnol. 26: 1269-1275, 2008, ShiY, et al., Cell Stem Cell, 3, 568-574, 2008, Zhao Y, et al., Cell Stem Cell, 3: 475-479, 2008, Marson A, Cell Stem Cell, 3, 132-135, 2008, Feng B, et al. al., Nat. Cell Biol. 11: 197-203, 2009, RL Judson et al., Nat. Biotechnol.Combinations described in the following journals: ,27:459-461,2009; Lyssiotis CA, et al., Proc Natl Acad Sci US A.106:8912-8917,2009; Kim JB, et al., Nature.461:649-643,2009; Ichida JK, et al., Cell Stem Cell.5:491-503,2009; Heng JC, et al., Cell Stem Cell.6:167-74,2010; Han J, et al., Nature.463:1096-100,2010; Mali P, et al., Stem Cells.28:713-720,2010; or Maekawa M, et al., Nature.474:225-9,2011, etc.

[0241] There are no particular restrictions on the somatic cells used in the manufacture of iPS cells. Examples include fetal somatic cells, neonatal somatic cells, mature healthy or unhealthy somatic cells, primary cultured cells, passaged cells, or lineage cells.

[0242] Examples of somatic cells include (1) tissue stem cells such as neural stem cells, hematopoietic stem cells, mesenchymal stem cells, or dental pulp stem cells (e.g., somatic stem cells), (2) tissue progenitor cells such as hematopoietic progenitor cells, or (3) blood cells (e.g., peripheral blood cells, umbilical cord blood cells), myeloid cells, lymphocytes, epithelial cells, endothelial cells, muscle cells, fibroblasts (e.g., skin cells), hair cells, hepatocytes, gastric mucosal cells, intestinal cells, spleen cells, pancreatic cells (e.g., pancreatic exocrine cells), brain cells, lung cells, kidney cells, or adipocytes. Somatic cells other than T cells (non-T cells) are preferred, but T cells may also be used.

[0243] There are no particular restrictions on the T cells used as the aforementioned somatic cells, but T cells that express CD3 and at least one of CD4 and CD8 are preferred.

[0244] Examples of such T cells include helper T cells, cytotoxic T cells, regulatory T cells, naive T cells, stem cell-like memory T cells (TSCM), central memory T cells (TCM), effector memory T cells, or terminal effector T cells.

[0245] Helper T cells are CD4-positive cells, which are further classified into Th1 cells, Th2 cells and Th17 cells based on the cytokines they express (e.g., described in J Allergy Clin. Immunol., 135(3):626-635, 2012).

[0246] Examples of Th1 cells include cells expressing IFN-γ, IL-2, or TNF-α. Examples of Th2 cells include cells expressing IL-4, IL-5, IL-6, IL-10, or IL-13. Examples of Th17 cells include cells expressing IL-17 or IL-6.

[0247] Cytotoxic T cells are CD8 positive cells, and like helper T cells, they are further classified into Tc1 cells and Tc2 cells, etc., based on the cytokines they express.

[0248] Examples of Tc1 cells include cells expressing IFN-γ, IL-2, or TNF-α. Examples of Tc2 cells include cells expressing IL-4, IL-5, IL-6, IL-10, or IL-13.

[0249] As regulatory T cells, CD4(+)CD25(+)FoxP3(+) cells are preferred examples.

[0250] Preferred initial T cells include, for example, CD4(+)CD45RA(+)CD62L(+)CCR7(+) cells, CD8(+)CD45RA(+)CD62L(+)CCR7(+) cells, CD4(+)CCR7(+)CD45RA(+)CD95(-)CD45RO(-) cells, or CD8(+)CCR7(+)CD45RA(+)CD95(-)CD45RO(-) cells, etc.

[0251] Preferred examples of stem cell-like memory T cells include CD4(+)CD45RA(+)CD62L(+)CCR7(+)CD95(+) cells, CD8(+)CD45RA(+)CD62L(+)CCR7(+)CD95(+) cells, CD4(+)CCR7(+)CD45RA(+)CD95(+)CD45RO(+) cells, or CD8(+)CCR7(+)CD45RA(+)CD95(+)CD45RO(+) cells.

[0252] As central memory T cells, preferred examples include CD4(+)CD45RA(-)CD62L(+)CCR7(+)CD95(+) cells, CD8(+)CD45RA(-)CD62L(+)CCR7(+)CD95(+) cells, CD4(+)CCR7(+)CD45RA(-)CD45RO(+) cells, or CD8(+)CCR7(+)CD45RA(-)CD45RO(+) cells, etc.

[0253] Examples of effector memory T cells include, for example, CD4(+)CCR7(-)CD45RA(-)CD45RO(+) cells or CD8(+)CCR7(-)CD45RA(-)CD45RO(+) cells.

[0254] Preferred examples of terminal effector T cells include CD4(+)CD45RA(+)CD62L(-) cells or CD8(+)CD45RA(+)CD62L(-) cells.

[0255] The preferred T cells used as somatic cells are undifferentiated T cells. Examples of undifferentiated T cells, listed in descending order of degree of undifferentiation, include naive T cells, stem cell-like memory T cells, and central memory T cells. From the viewpoint of maintaining the undifferentiated state of cells, enhancing proliferation, or ensuring the sustainability of the organism, naive T cells or stem cell-like memory T cells are particularly preferred.

[0256] Highly undifferentiated T cells exhibit high efficacy in immunotherapy. The preferred T cells used as somatic cells for immunotherapy are T cells specifically designed for this purpose.

[0257] Methods for determining whether T cells remain undifferentiated include those that detect the expression of undifferentiated markers and / or fail to detect the expression of differentiation markers, those that detect the expression of various other markers (genes, proteins), and those that observe cell morphological characteristics. For example, CCR7 is used as a marker of undifferentiated cells in peripheral blood (e.g., described in Nature Reviews Immunology, 18:363-373, 2018).

[0258] When using T cells as the somatic cells described above, it is preferable to use T cells with knockdown or deletion of the endogenous TCRα gene and the endogenous TCRβ gene.

[0259] Endogenous TCRα and TCRβ genes refer to: TCRα and TCRβ genes present in T cells of a knockdown or knockout target; TCRα and TCRβ genes derived from T cells of a knockdown or knockout target; and TCRα and TCRβ genes derived from T cells of the same species as the knockdown or knockout target's T cells. A knockdown gene is defined as either reducing the transcription of a specific gene or inhibiting the translation of a specific gene. A knockout gene is defined as either disrupting the base sequence of a specific gene or inhibiting gene expression.

[0260] As a method for producing T cells by knocking down or knocking out the endogenous TCRα gene and the endogenous TCRβ gene respectively, as described in this invention, known methods such as introducing small interfering RNA (siRNA) targeting the gene into the cell to inhibit gene expression can be used (as described in Non-Patent Document 1). As a method for producing T cells by knocking down or knocking out the endogenous TCRα gene and the endogenous TCRβ gene respectively, known methods such as using genome editing technologies such as TALEN or CRISPR / Cas9 to cause frameshifting in the gene region and disrupt the coding sequence of the gene can be used (as described in Non-Patent Document 2).

[0261] In this invention, there are no particular restrictions on the source of the collected somatic cells, but mammals are preferred, and humans are more preferred. When using the human-derived T cells of this invention for blood transfusion, from the viewpoint of making the type of human leukocyte antigen (HLA) easily compatible with the patient receiving the blood transfusion, the somatic cells that serve as the source of iPS cells are preferably isolated from the recipient of the blood transfusion.

[0262] Existing cell lines can be used as iPS cells. For example, human iPS cell lines include 253G1 (RIKEN Cell Bank No. HPS0002), 201B7 (RIKEN Cell Bank No. HPS0063), 409B2 (RIKEN Cell Bank No. HPS0076), 454E2 (RIKEN Cell Bank No. HPS0077), HiPS-RIKEN-1A (RIKEN Cell Bank No. HPS0003), HiPS-RIKEN-2A (RIKEN Cell Bank No. HPS0009), HiPS-RIKEN-12A (RIKEN Cell Bank No. HPS0029), and Nips-B2 (RIKEN Cell Bank No. HPS0223).

[0263] Examples of cells used to introduce the modified TCR of this invention include hematopoietic stem cells / hematopoietic progenitor cells. These cells can be collected from bone marrow, umbilical cord blood, or mobilized peripheral blood. These sources can be from the patient themselves, related donors, or unrelated donors—all healthy individuals.

[0264] In addition, T cells with endogenous TCRα and endogenous TCRβ genes knocked down or eliminated can also be listed as cells in which the modified TCR of the present invention is introduced.

[0265] The methods for producing T cells, endogenous TCRα and endogenous TCRβ genes, gene knockdown and gene knockout, and the methods for producing T cells by knocking down or knocking down endogenous TCRα and endogenous TCRβ genes are the same as those described above.

[0266] As cells for introducing the modified TCR of the present invention, cells pre-introduced with a chimeric antigen receptor (CAR) can also be used. Here, CAR refers to a fusion protein comprising an extracellular domain that binds to an antigen and an intracellular domain derived from a polypeptide different from the extracellular domain. Examples of CARs include fusion proteins that combine an antigen recognition site of an antibody against a specific antigen [e.g., the light chain (L chain) and heavy chain (H chain) of the variable region] with an intracellular domain of a T cell receptor such as CD3 and an intracellular domain of a co-stimulatory molecule such as CD28 or 4-1BB (e.g., described in Japanese Patent Application Publication No. 2015-509716).

[0267] The antigen recognition site of a CAR can be selected based on the target antigen, thereby enabling the creation of T cells specific to the target antigen. For example, when using CD19 as the antigen, a CAR can be created by cloning the antigen recognition site of an anti-CD19 antibody and binding it to the intracellular domain of the CD3 molecule (e.g., described in Cancer Res., 66:10995-11004, 2006). Furthermore, by selecting the type or number of co-stimulatory molecules bound, the intensity or duration of activation can be controlled (e.g., described in Mol Ther., 17:1453-1464, 2009).

[0268] By introducing CARs, cells infused with the modified TCRs of this invention can be endowed with specificity for target antigens. Furthermore, by introducing CARs, antigen molecules can be directly recognized, and a high immune response can be elicited even in tumors with downregulated HLA cluster I gene expression.

[0269] Differentiation of pluripotent stem cells or primary hematopoietic stem cells / hematopoietic progenitor cells with introduced modified TCRs into T cells.

[0270] Regarding the method for differentiating T cells from pluripotent stem cells with modified TCRs as described in this invention, known methods can be used. Specifically, for example, as a method for manufacturing CD8 positive cells, the method described in International Publication No. 2016 / 076415 can be cited, and as a method for manufacturing CD4CD8 double-positive T cells, the method described in International Publication No. 2017 / 221975 can be cited.

[0271] Regarding the method of differentiating T cells from primary hematopoietic stem cells / hematopoietic progenitor cells, it can be carried out by the same or similar method as the method of differentiating T cells from pluripotent stem cells described above (e.g., described in Induction of T-cell development from human cord blood hematopoietic stem cells by Delta-like1 in vitro; Blood, 105(4):1431-1439, 2005).

[0272] [Therapeutic agents, pharmaceutical compositions, methods of immunotherapy]

[0273] The modified TCR, the cell expressing the modified TCR, the nucleic acid encoding the first and second polypeptides constituting the modified TCR, or the expression vector containing the nucleic acid of the present invention can each be used as a therapeutic agent. This therapeutic agent can be used alone or in combination with other drugs and treatment methods that can be used to treat cancer, autoimmune diseases, or heart disease, etc.

[0274] Other possible drugs and treatments are not particularly limited, but can include, for example, molecularly targeted drugs, chemotherapy, radiofrequency ablation, surgical therapy, hepatic artery (chemo)embolization, radiation therapy, heavy ion beam therapy, radioisotope therapy, hepatic artery perfusion chemotherapy, peptide vaccine therapy, or other immune cell therapies. The therapeutic agents of this invention and the other drugs mentioned above can be administered simultaneously or separately. Furthermore, they can be administered via the same route of administration or via different routes of administration.

[0275] Furthermore, the aforementioned therapeutic agents can also be formulated alone or in combination with other active ingredients into pharmaceutical compositions or compositions for immunotherapy. In addition to the therapeutic agents and other active ingredients of the present invention, pharmaceutically acceptable carriers, buffers, or stabilizers that are commonly used in this field depending on the route of administration can be included as components in the pharmaceutical composition. Examples of carriers include physiological saline, phosphate-buffered saline, glucose solution, or buffered physiological saline, but are not limited to these. Salts, sugars, or sugar alcohols can also be used as additives. It should be noted that, given the nature of the present invention, the therapeutic agents and pharmaceutical compositions of the present invention are intended to be administered in a liquid form; therefore, they need to be formulated in a form that can maintain the stability of the active ingredients.

[0276] The therapeutic agents and pharmaceutical compositions of the present invention can be administered topically or systemically, and there are no particular limitations on the route of administration; for example, they can be administered intravenously. Alternatively, they can be administered by injection or infusion to the affected area or vicinity of the affected area. The dosage and frequency of administration of the therapeutic agents or pharmaceutical compositions of the present invention vary depending on the patient's weight, sex, age, or severity of disease, and are not particularly limited.

[0277] Examples of methods for immunocellular therapy according to the present invention include: methods comprising the steps of expressing the modified TCR of the present invention into T cells by non-T cell-derived pluripotent stem cells, and administering the resulting cells to a subject; methods comprising the steps of expressing the modified TCR of the present invention into T cells by knocking down or deleting the endogenous TCRα gene and the endogenous TCRβ gene, respectively, and administering the resulting cells to a subject; methods comprising the steps of expressing the modified TCR of the present invention into hematopoietic stem cells / hematopoietic progenitor cells, and the resulting T cells to a subject; and methods comprising the steps of expressing the modified TCR of the present invention into T cells by knocking down or deleting the endogenous TCRα gene and the endogenous TCRβ gene, respectively, and administering the resulting cells to a subject, etc.

[0278] Regarding the T cells used for drug administration, the obtained T cells can be administered directly, or they can be administered in the form of the aforementioned formulated drug composition.

[0279] The present invention will be described in detail below based on embodiments, but the implementation of the present invention is not limited to these embodiments.

[0280] Example

[0281] [Example 1]

[0282] For 293T cells, the ability of CD3 subunit molecules to be retained by the modified TCR was analyzed.

[0283] First, a full-length TCR expression vector was constructed. The full-length TCRα and TCRβ genes were derived from the TKT3v1-7 iPS cell line (provided by the University of Tokyo, described in Nishimura et al., Cell Stem Cell. 12:774-786, 2013), an iPS cell line established by introducing Yamanaka factor into T cells. The full-length base sequence of TCRα used in the examples is shown in sequence number 25, and the full-length base sequence of TCRβ is shown in sequence number 36. RNA was extracted from T cells differentiated from the TkT3v1-7 line, and the 5' and 3' RACE cDNAs of the TCRα and TCRβ genes were obtained using the SMARTer RACE 5' / 3' kit (Takara Bio). The full-length cDNA sequence information was obtained by Sanger sequencing of the cDNA products.

[0284] The TCR expression vector was constructed as follows: The product obtained by sequentially ligating the TCRβ and TCRα chains using the SGSG linker-T2A peptide sequence was cloned upstream of the IRES of the pEF1α-IRES-hKO1 (humanized codon-type Kusabira Orange) vector (hereinafter referred to as the mock vector) using the In-Fusion HD cloning kit (Clontech). This full-length TCR expression vector is referred to as the ba1 vector.

[0285] Next, an modified TCR expression vector with the variable region missing was constructed. Downstream of the signal peptides encoding TCRα and TCRβ sequences, the constant region sequences of each TCR sequence were linked in-frame, and the resulting sequence was used as the variable region-deficient TCR gene. This was cloned into a mock vector in the same manner as the ba1 vector, thus constructing the expression vector (ba2 vector).

[0286] Furthermore, modified TCR expression vectors were constructed by periodically deleting constant regions in addition to the variable regions of TCRα and TCRβ sequences. Based on existing literature (recorded in Kuhns et al., Immunity. 26:357-369, 2007; Natarajan et al., Cell Rep. 14:2833-2845, 2016), four regions—AB loop, C chain, DE loop, and F chain—were extracted from the constant region of TCRα, and four regions—helix 3, CC loop, helix 4F chain, and FG loop—were extracted from the constant region of TCRβ. Modified TCR sequences in various patterns were designed with the following constant region sequences linked in-frame downstream of the signal peptide encoding the TCRα and TCRβ sequences. These constant region sequences were created by periodically deleting bases from the 5' end to eliminate amino acid regions. The modified TCR sequences were cloned into the aforementioned mock vectors to construct expression vectors (ba3–ba18 vectors).

[0287] The above schematic diagrams of the full-length and modified TCR sequences are shown below. Figure 1 The amino acid sequence information of ba1 (sequence number 49) is shown below. Figure 2 The amino acid sequence information of ba2 to ba9 (sequence numbers 50 to 57) is shown below. Figure 3 The amino acid sequence information of ba10–ba18 (sequence numbers 58–66) is shown below. Figure 4 .

[0288] Based on the known cDNA sequence information of each CD3 subunit (CD3E: NM_000733.3; CD3G: NM_000073.2; CD3D: NM_000732.4; CD247(CD3Z): NM_198053.2), a CD3 expression vector for expression in 293T cells was constructed. The product obtained by ligating these CD3 subunit sequences and the EGFP gene with the GSG adapter-T2A peptide sequence (CD3E-T2A-CD3G-T2A-CD3D-T2A-CD3Z-T2A-EGFP) was cloned into the pEF1α expression vector.

[0289] Stable CD3-expressing 293T cells were established. 293T cells (#ACC635) were obtained from DSMZ. For maintenance culture of 293T cells, 293T medium [containing Dulbeco modified Igor medium (NACALAI TESQUE), 10% FBS (Access Cell Culture), and 10 μg / mL gentamicin sulfate (NACALAI TESQUE)] was used. For passage, 293T cells were washed once with PBS (NACALAI TESQUE) and then dissected with trypsin / EDTA solution (Sigma). After transfecting the CD3 expression vector into 293T cells using Lipofectamine 2000 (ThermoFisher), the cells were repeatedly purified and amplified using a SH800 cell sorter (SONY), thereby establishing a stable CD3-EGFP expression line.

[0290] Various ba vectors were introduced into the CD3-EGFP stable expression line to verify whether CD3E and CD3D molecules were maintained on the cell surface. After transfecting the CD3-EGFP stable expression line with various ba vectors and mock vectors using Lipofectamine 2000, cells were recovered after 2 days. The recovered cells were washed with FACS buffer [containing PBS (NACALAI TESQUE), 2% FBS (Access Cell Culture), and 1 mM EDTA (Invitrogen)]. For CD3E staining, PE / Cy7-labeled anti-human CD3E antibody (clone: ​​UCHT1) (BioLegend) was added to the cells; for CD3D staining, APC-labeled anti-human CD3D antibody (clone: ​​7D6) (Invitrogen) was added. Cells were incubated in the dark at 4°C for 30 minutes. After washing the cells with FACS buffer, DAPI (Dongjin Chemical Research Institute) was added to stain dead cells. FACS analysis was performed using a cell sorter SH800.

[0291] The expression profile of CD3E in the EGFP-positive, hKO1-positive, and DAPI-negative fractions is shown in... Figure 5 The numerical data obtained using MFI (Mean Fluorescence Intensity) are shown below. Figure 6 CD3E expression was observed in cells introduced with the full-length TCR (ba1). CD3E expression on the cell surface was also confirmed with the introduction of modified TCRs ba2–ba18, but the expression level varied depending on the type of modified TCR.

[0292] The expression spectrum of CD3D is shown in Figure 7 The numerical data obtained using MFI will be presented in Figure 8 CD3D expression was observed in cells introduced with the full-length TCR (ba1). Similar to CD3E, although CD3D expression on the cell surface was confirmed by introducing modified TCRs of ba2–ba18, the expression level varied depending on the type of modified TCR.

[0293] The above results indicate that the artificial TCR / CD3 reconstruction experiment in 293T cells can screen out modified TCRs that can effectively maintain CD3 subunit expression on the cell surface.

[0294] The validation results for ba1–ba18 clarified that the expression levels of CD3E and CD3D on the cell surface change according to the deletion pattern of the TCR gene. Specifically, ba2, ba3, ba7, ba8, ba9, ba10, ba17, and ba18 have the same level of CD3E and CD3D retention capacity as ba1.

[0295] [Example 2]

[0296] For Jurkat cells, the ability of the CD3 subunit molecules retained by the modified TCR was analyzed.

[0297] To analyze the CD3 subunit retention capacity resulting from the modified TCR under conditions closer to physiological realities, Jurkat cells (#ACC282) (DSMZ), a cell line used as a T cell line, were employed. Jurkat cells were maintained in Jurkat medium [containing RPMI 1640 (NACALAI TESQUE), 10% FBS (Access Cell Culture), and 10 μg / mL gentamicin sulfate (NACALAI TESQUE)]. Passaging was performed by aliquoting appropriate amounts of Jurkat cells and suspending them in fresh Jurkat medium.

[0298] Jurkat cells, a T-cell lineage, possess endogenous TCR genes with reconstructed TCRα and TCRβ genes. Therefore, introducing a modified TCR gene into wild-type Jurkat cells (hereinafter referred to as the WT line) may result in a chimeric TCR molecule with the endogenous TCR gene, making it impossible to accurately determine the CD3 subunit retention capacity resulting from the modified TCR. Therefore, an attempt was made to perform a double knockout of the endogenous TCRα and TCRβ genes in Jurkat cells using genome editing.

[0299] Genome editing was performed targeting the genes encoding the constant region of the TCRα chain (TRAC gene) and the genes encoding the constant region of the TCRβ chain (TRBC gene), and knockout was achieved via frameshift. The genome editing utilized the Alt-RCRISPR-Cas9 System (IDT) to directly introduce a complex of Cas9 protein and guide RNA into cells. Target sequences (20mer upstream of NGG) were extracted from publicly available literature: TRAC: gagaatcaaaatcggtgaat (Sequence No. 67) (described in Osborn et al., Mol Ther, 2017); TRBC (common to TRBC1 and TRBC2): caaacacagcgacctcgggt (Sequence No. 68) (described in Legut et al., Blood. 131(3):311-322, 2018).

[0300] After forming the Cas9 / guide RNA complex according to the procedure instructions, the Cas9 / guide RNA complex was introduced into Jurkat cells via electroporation using 4D-Nucleofector (Lonza) and SE Cell Line 4D-Nucleofector X Kit L (Lonza) (introduction procedure: CL-120).

[0301] First, a Cas9 / guide RNA complex for knocking out the TRAC gene was introduced into the WT cell line. After amplification and culture, the cells were stained with APC-labeled anti-human TCRα / β antibody (clone: ​​IP26) (BioLegend) and PE / Cy7-labeled anti-human CD3E antibody (clone: ​​UCHT1) (BioLegend), and a TCR-negative and CD3E-negative fraction was observed. This fraction was purified using a cell sorter and amplified, followed by the introduction of a Cas9 / guide RNA complex for knocking out the TRBC gene. After amplification and culture, a vector expressing only the full-length TCRα chain was transiently introduced into the cells, and staining was performed using APC-labeled anti-human TCRα / β antibody and PE / Cy7-labeled anti-human CD3E antibody, and a TCR-negative and CD3E-negative fraction was observed. This fraction was considered to represent a successful knockout of the TCRβ gene, and was purified using a cell sorter and amplified.

[0302] Finally, a vector expressing only the full-length TCRα chain or a vector expressing only the full-length TCRβ chain was transiently introduced into the cells. Staining was performed using APC-labeled anti-human TCRα / β antibody and PE / Cy7-labeled anti-human CD3E antibody. The results showed that in both cases, TCR-negative and CD3E-negative fractions were present with approximately 99% purity. Using the above methods, a double knockout strain of the TCRα and TCRβ genes (hereinafter referred to as the dKO strain) was established.

[0303] Various ba vectors were introduced into the dKO cell line to verify the retention of CD3E and CD3D molecules on the cell surface. After introducing various ba and mock vectors via electroporation as described above, cells were recovered after 2 days. The recovered cells were washed with FACS buffer. For CD3E staining, PE / Cy7-labeled anti-human CD3E antibody was added to the cells; for CD3D staining, APC-labeled anti-human CD3D antibody was added. Cells were incubated in the dark at 4°C for 30 minutes. After washing with FACS buffer, DAPI was added to stain dead cells. FACS analysis was performed using an SH800 cell sorter.

[0304] The expression profile of CD3E in the DAPI negative fraction is shown in... Figure 9 The numerical data obtained using MFI will be presented in Figure 10 CD3E expression was observed in cells introduced with the full-length TCR (ba1). CD3E expression was also confirmed on the cell surface with the introduction of modified TCRs ba2–ba18, but the expression level varied depending on the type of modified TCR.

[0305] The expression spectrum of CD3D is shown in Figure 11 The numerical data obtained using MFI will be presented in Figure 12 CD3D expression was observed in cells after the full-length TCR (ba1) was introduced. Similar to CD3E, CD3D expression on the cell surface was confirmed by introducing modified TCRs from ba2 to ba18, but the expression level varied depending on the type of modified TCR.

[0306] The above demonstrates that by using the dKO line of Jurkat cells, which possesses properties similar to T cells, it is possible to screen for modified TCRs that can effectively maintain CD3 subunit expression on the cell surface. The validation results for ba1–ba18 show that the expression levels of CD3E and CD3D on the cell surface change according to the deletion pattern of the TCR gene. The validation results for ba1–ba18 also revealed that, although not as high as ba1, ba7, ba8, and ba9 also support high levels of CD3E and CD3D expression on the cell surface in Jurkat cells.

[0307] [Example 3]

[0308] We used the dKO cell line of Jurkat cells to analyze the signal transduction capacity resulting from the modified TCR.

[0309] Examples 1 and 2 show that each of the designed modified TCRs exhibits variations in its ability to support the expression of CD3 subunits on the cell surface. Next, we will verify the signal transduction to T cells mediated by CD3 molecules presented to the cell surface via the modified TCRs.

[0310] CD69 is a representative cell surface marker of activated T cells, and its expression is induced early in response to T cell stimulation of the TCR / CD3 complex (documented in Ziegler et al., Stem Cells. 12(5):456-65, 1994). Jurkat cells are also known to enhance CD69 expression in response to stimulation by CD3 / CD28 antibody-bound beads (documented in Tomkowicz et al., PLoS One, 2015). Therefore, if CD69 expression is enhanced due to CD3 stimulation when CD3 molecules are maintained on the cell surface by modifying the TCR, it indicates that TCR modification is functionally useful in T cell signal transduction.

[0311] Jurkat cells (WT and dKO lines) were stimulated with OKT3, an antibody acting as an anti-CD3E agonist, to verify whether CD69 expression was enhanced. 100 μL of purified Ultra-LEAF anti-human CD3 antibody (clone: ​​OKT3) (BioLegend), diluted to 10 μg / mL with PBS (NACALAI TESQUE), was added to each well of a 96-well plate used for adhesion cells, and the plates were incubated overnight at 37°C.

[0312] After removing the supernatant, WT or dKO cells were seeded onto plates washed twice with PBS (hereinafter referred to as immobilized OKT3 plates) and incubated overnight at 37°C. Cells were recovered and washed with FACS buffer. Alexa Fluor 647-labeled anti-human CD69 antibody (clone: ​​FN50) (BioLegend) was added to the cells, and the cells were incubated in the dark at 4°C for 30 minutes. After washing the cells with FACS buffer, DAPI was added to stain dead cells. FACS analysis was performed using a SH800 cell sorter. The results are shown below. Figure 13 .

[0313] like Figure 13As shown, CD69 expression was upregulated in the WT strain upon OKT3 stimulation, while no enhanced CD69 expression was observed in the dKO strain. This indicates that the dKO strain, which exhibits no CD3 expression due to TCR double knockout, also lacks responsiveness to CD3 stimulation.

[0314] Then, a modified TCR was introduced into the dKO cell line to verify whether OKT3-mediated enhancement of CD69 expression occurred. Similar to Example 2, various ba and mock vectors were introduced into the dKO cell line via electroporation, and the cells were recovered the following day and seeded on immobilized OKT3 plates. The cells were recovered the following day, and CD69 expression analysis was performed using the same steps as described above. The expression profile of DAPI-negative CD69 fractions is shown below. Figure 14 The numerical data obtained using MFI will be presented in Figure 15 .

[0315] like Figure 14 and Figure 15 As shown, CD69 expression was observed in cells introduced with the full-length TCR (ba1). CD69 expression on the cell surface was also confirmed with the introduction of modified TCRs ba2–ba18, but the expression level varied depending on the type of modified TCR.

[0316] The above indicates that the modified TCR not only has the function of maintaining CD3 molecules on the cell membrane surface, but also has the function of transducing TCR / CD3 complex signals into the cell by using agonist antibodies and other stimuli to present CD3 molecules on the cell surface.

[0317] [Example 4]

[0318] The FACS analysis results of the CD3E protein obtained in Example 1 were used to reanalyze the CD3E positivity rate caused by CD1-18 in the CD3-EGFP stable expression strain. FlowJo was used for the analysis. The average values ​​for N=2 are shown in Table 1.

[0319] [Table 1]

[0320]

[0321] [Example 5]

[0322] The local presence of CD3 protein on the cell surface induced by TCRα and TCRβ modifications was evaluated using 293T cells with forced CD3 expression. As demonstrated in Examples 1 and 2, 293T cells stably expressing the CD3 subunit (forced CD3 expression 293T cells) showed higher sensitivity compared to Jurkat cells with knocked-out endogenous TCRs; therefore, forced CD3 expression 293T cells were used for analysis in Example 5.

[0323] First, the sequences of TCRα and TCRβ were designed and modified. Referring to publicly available literature (Michael S. Kuhns et al., Immunity. 26:357-369, 2007; Aswin Natarajan et al., Cell Reports. 14:2833-2845, 2016), the amino acids of TCRα and TCRβ, which have been reported to interact with CD3 proteins, were confirmed.

[0324] In addition, the crystal structures of TCRα and TCRβ proteins were confirmed using the open-source molecular mapping tool PyMOL. The crystal structures of TCRα and TCRβ proteins were based on publicly available information (Protein Data Bank ID: 3QJF).

[0325] The N-terminal portions of the extracellular amino acid sequences of the modified TCRα and modified TCRβ proteins are shown below. Figure 16 and Figure 17 In addition, the amino acid sequences of the modified TCRα and its fragment are shown in Tables 2 and 8, and the amino acid sequences of the modified TCRβ and its fragment are shown in Tables 3 and 9.

[0326] [Table 2]

[0327]

[0328] [Table 3]

[0329]

[0330] It should be noted that the amino acid sequences of TCRα and TCRβ in ba2–ba18 are selected from the modified TCRα and its fragment shown in Tables 2 and 8, and the modified TCRβ and its fragment shown in Tables 3 and 9, respectively. The correspondence between the amino acid sequences of the modified TCRα and its fragment shown in Tables 2 and 8, and the modified TCRβ and its fragment shown in Tables 3 and 9 and the amino acid sequences of TCRα and TCRβ in ba2–ba18 is shown in Table 4.

[0331] [Table 4]

[0332]

[0333] Plasmid vectors expressing the designed modified TCRα and modified TCRβ were constructed. Using ba2 as a template, PCR was performed by adding Kpn1 to the 5' end and Xho1 to the 3' end of each of the αCR and βCR vectors, followed by amplification. The pcDNA3.1(+) mammalian expression vector (Thermo Fisher Scientific) was broken with Kpn1 and Xho1, and the amplified DNA was cloned. Then, using αCR and βCR as templates, α1–10 and β1–12 were generated by inverse PCR. The primers used in the inverse PCR are shown in Table 5. PCR was performed using PrimeSTAR GXL polymerase, and the DNA sequence was confirmed by sequence analysis of the obtained plasmid DNA. The base sequences of the DNA encoding modified TCRα are shown in Tables 6, 10, and 11, and the base sequences of the DNA encoding modified TCRβ are shown in Tables 7, 12, and 13.

[0334] [Table 5]

[0335]

[0336] [Table 6]

[0337]

[0338] [Table 7]

[0339]

[0340] [Table 8]

[0341]

[0342] [Table 9]

[0343]

[0344] [Table 10]

[0345]

[0346] [Table 11]

[0347]

[0348] [Table 12]

[0349]

[0350] [Table 13]

[0351]

[0352] A modified TCR expression vector was introduced into the CD3-EGFP stable expression line to verify whether the CD3 molecule was maintained on the cell surface. Using Lipofectamine 2000 (Invitrogen), various modified TCRα and TCRβ vectors were co-transfected into the CD3-EGFP stable expression line with pEF1α-IRES-hKO1 (the mock vector in Example 1) as a transfection marker.

[0353] Cells co-transfected with empty pcDNA3.1(+) vector and pEF1α-IRES-hKO1 were used as controls. Cells recovered after 2 days were washed with FACS buffer [containing PBS (NACALAI TESQUE), 2% FBS (Access CellCulture), and 1 mM EDTA (Invitrogen)].

[0354] For CD3 staining, APC-labeled anti-human CD3 antibody (clone: ​​UCHT1) (BioLegend) was added to cells, and the cells were incubated in the dark at 4°C for 30 minutes. After washing the cells with FACS buffer, propidium iodide was added to stain dead cells. FACS analysis was performed using BD LSR Fortessa. The CD3 positivity rate in EGFP(+)KO(+) cells was analyzed using FlowJo9. The mean value for N=3 is shown in the figure. Figure 18 .

[0355] Depend on Figure 18 The results shown lead to the insights described in (1) to (13).

[0356] (1) All modified TCRs with βCR and each modified TCRα showed high CD3 recruitment activity of over 80%.

[0357] (2) Modified TCRs containing β1 and each modified TCRα showed CD3 recruitment activity of 7.42-43.1%. Among them, modified TCRαs combined with αCR and α1 showed sufficiently high CD3 recruitment activity of over 20%.

[0358] (3) Modified TCRs containing β2 and each modified TCRα showed CD3 recruitment activity ranging from 13.3% to 71%. Among them, when combined with modified TCRαs other than α3, they showed sufficiently high CD3 recruitment activity of over 20%.

[0359] (4) Modified TCRs containing β3 and each modified TCRα showed 1.12-6.63% CD3 recruitment activity.

[0360] (5) Modified TCRs containing β4 and each modified TCRα showed CD3 recruitment activity of 1.02-8.97%.

[0361] (6) Modified TCRs containing β5 and each modified TCRα showed CD3 recruitment activity of 0.99-8.97%.

[0362] (7) Modified TCRs containing β6 and each modified TCRα showed CD3 recruitment activity of 0.94-10.1%.

[0363] (8) Modified TCRs containing β7 and each modified TCRα showed CD3 recruitment activity of 3.58-30.1%. Among them, the combination with α9-10 showed sufficiently high CD3 recruitment activity of more than 20%.

[0364] (9) Modified TCRs containing β8 and each modified TCRα showed 1.81-18.1% CD3 recruitment activity.

[0365] (10) Modified TCRs containing β9 and each modified TCRα showed CD3 recruitment activity of 5.28-69.2%. Among them, the combination with α8-10 showed sufficiently high CD3 recruitment activity of more than 20%.

[0366] (11) Modified TCRs containing β10 and each modified TCRα showed CD3 recruitment activity of 9.23-85.1%. Among them, the combination with α3-10 showed sufficiently high CD3 recruitment activity of more than 20%.

[0367] (12) Modified TCRs containing β11 and each modified TCRα showed CD3 recruitment activity ranging from 12.3% to 81.7%. Among them, the combination with α3-10 showed sufficiently high CD3 recruitment activity of over 20%.

[0368] (13) Modified TCRs containing β12 and each modified TCRα showed CD3 recruitment activity ranging from 11.5% to 80.6%. Among them, the combination with α3-10 showed sufficiently high CD3 recruitment activity of over 20%.

[0369] Based on the above results, using most of the evaluated combinations of various modified TCRα and modified TCRβ, CD3 protein recruitment on the cell surface was observed. Furthermore, it was clarified that the expression level of CD3 on the cell surface changes through TCR gene deletion patterns.

[0370] [Example 6]

[0371] Retroviral vectors ba1, ba2, ba4, and ba9, used as TCR modifiers, were constructed. EcoRI and NotI excision inserts upstream of the IRES in the ba1, ba2, ba4, and ba9 vectors (pEF1α-IRES-hKO1) constructed in Example 1 were subcloned into pMY-IRES-EGFP (hereinafter referred to as pMY-IG, CellBiolabs, Inc.) fragmented with EcoRI and NotI. To prepare the retroviruses, ba1-pMY-IG, ba2-pMY-IG, ba4-pMY-IG, ba9-pMY-IG, and Empty-pMY-IG were transfected into GP2-293 packaging cells (Takara Bio) along with the VSV-G vector (Takara Bio) using Lipofectamine 2000. Two days later, the cell supernatant containing the retroviruses was recovered, and concentrated retroviruses were prepared using the Retro-X Concentrator (Takara Bio).

[0372] [Example 7]

[0373] To verify the ability of ba1 and ba2, as modified TCRs, to induce T cells from iPS cells. First, hematopoietic progenitor cells (HPCs) were induced from umbilical cord blood-derived iPS cell lines (FF-WJs524, FF-WJs527) that were confirmed not to be derived from T cells, for the introduction of genes from ba1 and ba2. For the maintenance of iPS cells, StemFit AK02N medium (Ajinomoto) was used for iPS cells without a feeder layer.

[0374] On culture surfaces coated with iMatrix-511, iPS cells were exfoliated using a stripping agent [1×TrypLE Select (ThermoFisher Scientific) diluted to 1 / 2 with PBS, with the addition of 0.5 mol / L EDTA solution (pH 8, Nacalai tesque), resulting in a final concentration of 0.5×TrypLE Select, 0.75 mM EDTA]. The cells were then passaged and cultured in StemFit AK02N medium supplemented with 10 μM Y-27632 (37°C, 5% CO2). The medium was changed the following day using StemFit AK02N. This procedure was repeated weekly to maintain the iPS cells.

[0375] Next, iPS cells were induced to differentiate using the embryoid body formation method, thereby creating HPCs. After peeling off iPS cells without a feeder layer using 0.5×TrypLESelect and 0.75mM EDTA, they were cultured at 2–3×10⁻⁶ mcg / mL. 5Cells were seeded in 6-well plates that had undergone ultra-low adhesion treatment (CORNING).

[0376] Cultured on Stemfit AK02N medium supplemented with 10 μM Y-27632 (Nacalai tesque) and 10 μM CHIR99021 (TocrisBioscience) under hypoxic conditions (5% O2) (Day 0). The next day, cultured on StemPro34 medium (EB medium) supplemented with 1× insulin, transferrin, selenium solution (Thermo Fisher Scientific), 1× Glutamax (Thermo Fisher Scientific), 0.2× PSG, 45 mM monothioglycerol (Wako), and 50 μg / ml PAA (Wako) with the addition of 50 ng / ml BMP-4 (Miltenyi Biotec), 50 ng / ml VEGF-165A (Wako), and 50 ng / ml bFGF (Wako) (Day 1, 5% O2).

[0377] The following day, cells were cultured with 6 μM SB431542 (Wako) (Day 2, 5% O2). Two days later, they were cultured in EB medium supplemented with 50 ng / ml VEGF-165A, 50 ng / ml bFGF, and 50 ng / ml SCF (Day 4, 5% O2). Two days later, they were cultured in EB medium supplemented with 50 ng / ml VEGF-165A, 50 ng / ml bFGF, 50 ng / ml SCF, 30 ng / ml TPO (Wako), and 10 ng / ml FLT3L (Wako) (Day 6). The medium was changed every 2–3 days, and cells were cultured at 5% CO2 until day 13. Cells were recovered and cryopreserved using Tc cryoprotectant.

[0378] After introducing modified TCRba1 and ba2 genes into the obtained HPCs, they differentiated into CD3(+)CD45(+) T cells. Specifically, to introduce retroviruses, frozen HPCs were thawed and cultured in EB medium supplemented with 50 ng / ml VEGF-165A, 50 ng / ml bFGF, 50 ng / ml SCF, 30 ng / ml TPO (Wako), and 10 ng / ml FLT3L (Wako) (day -2).

[0379] The following day, 2–4 × 10⁻⁶ mg / ml of recombinant human fibrin fragment (100 μg / ml, Takara Bio) was injected into 48-well plates coated with the fragment at a rate of 2–4 × 10⁻⁶ mg / ml. 4Cells thawed one day before cell / well seeding. Then, modified TCRba1, ba2 or empty retroviruses were added and cultured in EB medium supplemented with 50 ng / ml VEGF-165A, 50 ng / ml bFGF, 50 ng / ml SCF, 30 ng / ml TPO (Wako), and 10 ng / ml FLT3L (Wako) (day -1).

[0380] The following day, cells were reseeded into 48-well plates coated with DLL4 (5 μg / ml, R&D Systems) and recombinant human fibrin fragment (5 μg / ml, Takara Bio). The cells were cultured in alpha-MEM medium supplemented with 50 ng / ml SCF (Wako), 50 ng / ml IL-7 (Wako), 50 ng / ml Flt3L (Wako), 100 ng / ml TPO (Wako), 30 μM SDF-1α (Wako), 15 μM SB203580 (TocrisBioscience), 55 μM 2-mercaptoethanol (Wako), 50 μg / ml PAA, 15% FCS, and 1% PSG (day 0).

[0381] Fresh plates coated with DLL4 and recombinant human fibrin fragments were prepared weekly, and cells were reseeded. The culture medium was changed every 2–3 days. Cells were cultured until day 21. Differentiated cells (day 21) were co-stained with CD3-BV510 (BioLegend) and CD45-APC-Cy7 (BioLegend). After washing, the cells were resuspended in FACS buffer containing propidium iodide (PI). Analysis was performed using a BD LSRFortessa cytometer (BD Bioscience). The positivity rates of CD3 and CD45 in the PI(-)GFP(+) cell population were analyzed using FlowJo9.

[0382] As a representative example of the expression analysis results of CD3 and CD45, the results of FF-WJs524 are shown below. Figure 19 (A). For example Figure 19 As shown in (A), no CD3 expression was observed in the empty cell sample, while CD3 expression was observed in cells introduced with ba1 and ba2 (ba1: 99.8%, ba2: 50.4%). The expression of the CD45 leukocyte marker was observed in the empty, ba1, and ba2 cells.

[0383] Next, CD8β(+)CD8α(+) were induced into mature T cells. Specifically, cells containing the aforementioned CD3(+)CD45(+) T cells were introduced at a rate of 1–10 x 10⁻⁶ cells / cells. 4Cells were seeded in 48-well plates and cultured in alpha-MEM medium supplemented with 500 ng / ml anti-CD3 antibody OKT3 (eBioscience), 10 nM dexamethasone (Dekisart R, Fuji Pharma), 10 ng / ml IL-7 (Wako), 50 μg / ml PAA, 15% FCS, and 1% PSG (day 0). After 3 days, the medium was changed to 10 ng / ml IL-7 (Wako), 50 μg / ml PAA, 15% FCS, and 1% PSG, and the cells were cultured again (day 3). After 7 days, cell counts were performed using trypan blue staining (day 10).

[0384] Regarding cell proliferation during the 10 days from day 0 to day 10, the empty control showed a 0.38-fold and 0.165-fold increase (results for FF-WJs524 and FF-WJs527, respectively. The same applies below.), while ba1 showed a 5.13-fold and 2.21-fold increase in cell proliferation, and ba2 showed a 1.55-fold and 4.25-fold increase.

[0385] The expression of CD8β and CD8α, markers of mature T cells, was analyzed only in cells in which fully modified TCRs ba1 and ba2 were introduced. Specifically, co-staining was performed using CD3-BV510, CD45-APC-Cy7, CD4-BV421 (BioLegend), CD8beta-PE-Cy7 (eBioscience), and CD8α-APC (BioLegend). After washing, the cells were resuspended in FACS buffer containing propidium iodide. Analysis was performed using a BD LSRFortessa cell counter (BD Bioscience). The positivity rate of CD8β and CD8α in the PI(-)GFP(+)CD3(+)CD45(+)CD4(-) cell population was analyzed using FlowJo9.

[0386] As a representative example of the expression analysis results of CD8β and CD8α, the results of FF-WJs524 are shown below. Figure 19 (B). Both ba1 and ba2 cells expressed CD8β and CD8α (Ba1: 100%, Ba2: 99.5%).

[0387] The above results indicate that, similar to ba1, which is composed of the full-length TCRα / TCRβ, the modified TCR ba2, composed of TCRα / TCRβ without the variable domain, is also useful in the induction of pluripotent stem cells into mature T cells. Specifically, it demonstrates that mature T cells can be induced by introducing ba1 and ba2 via the CD3 antibody OKT3. Therefore, the modified TCR not only maintains CD3 molecules on the cell membrane surface but also transduces the TCR / CD3 complex signal into the cell by stimulating CD3 molecules presented on the cell surface using agonist antibodies or similar stimuli.

[0388] [Example 8]

[0389] T cell induction capacity was evaluated using ba4, a modified TCR with part of the TCRβ homeostasis domain removed, and ba9, a modified TCR with part of the TCRα homeostasis domain removed. After introducing ba4 and ba9 into the HPC gene of the iPS cell line FF-WJs524, differentiation induction and analysis were performed using the same method as in Example 7. Results after culturing DLL4 and recombinant human fibrin fragments for 21 days are shown below. Figure 20 (A)

[0390] like Figure 20 As shown in (A), no CD3 expression was observed in empty cells (0.94%), while CD3 expression was observed in cells introduced with ba4 and ba9 (ba4: 38.3%, ba9: 99.5%). The expression of the CD45 leukocyte marker was observed in empty cells, ba4 cells, and ba9 cells.

[0391] Next, differentiation was induced in mature T cells with CD8β(+)CD8α(+).

[0392] The expression analysis results of CD8β and CD8α are shown in Figure 20 (B). For example Figure 20 As shown in (B), both ba4 and ba9 expressed CD8β and CD8α in the cells (ba4: 100%, ba2: 99.7%).

[0393] The results above indicate that, similar to ba1 and ba2, modified TCRs lacking a portion of the constant domain are also useful in inducing differentiation from pluripotent stem cells or totipotent stem cells into mature T cells. Furthermore, ba4 showed the lowest CD3 positivity rate in the reanalysis of Example 1 (Example 4) and the lowest level of CD3 positivity rate in Supplementary Example 2. However, in this example, ba4 was able to induce differentiation into mature T cells. This demonstrates that modified TCRs capable of recruiting CD3 on the cell surface, even in small quantities, are useful in inducing differentiation into mature T cells. It also suggests that, not limited to the modified TCRs shown in this invention, modified TCRs obtained by various modifications to the TCRα and TCRβ constant domains possess CD3 recruitment activity.

[0394] As can be seen from the above, the modified TCR not only has the function of maintaining CD3 molecules on the cell membrane surface, but also has the function of transducing the TCR / CD3 complex signal into the cell by using agonist antibodies and other stimuli to present CD3 molecules on the cell surface.

[0395] Industrial availability

[0396] For pluripotent stem cells and hematopoietic stem cells / progenitor cells to efficiently differentiate into T cells, it is crucial to induce functional TCR loci reprogramming at the appropriate time during differentiation, and to promote proliferation and survival by stimulating the resulting TCR / CD3 complex in vitro. However, pluripotent stem cells without reprogrammed TCR loci are predicted to be unable to efficiently generate functional TCRs during differentiation, which could significantly reduce T cell production efficiency. Even when TCR loci are reprogrammed, the antigen specificity of the generated TCR molecules is random, thus posing challenges not only in terms of homogeneity as a cell preparation but also in terms of safety, such as the potential for unpredictable allogeneic reactions after transplantation into patients.

[0397] The modified TCR of this invention enables the CD3 subunit to remain on the cell membrane. Therefore, during the differentiation of pluripotent stem cells into T cells, if the modified TCR is expressed in the original pluripotent stem cells or progenitor cells undergoing differentiation, the signals required for T cell maturation and proliferation can be freely transduced at any time through stimulation mediated by the modified TCR / CD3 complex, resulting in the promotion of T cell differentiation induction. Similarly, even after differentiation into T cells, stimulation of the modified TCR / CD3 complex can appropriately induce T cell proliferation. Furthermore, the antigen recognition ability of the modified TCR of this invention is lost, therefore the possibility of allogeneic reactions after transplantation of cell preparations is considered extremely low. Therefore, by using the modified TCR of this invention, homogeneous T cells can be efficiently induced from pluripotent stem cells.

[0398] Furthermore, it is believed that the size of the gene encoding the modified TCR of the present invention is compact compared to the full-length TCR gene, thus enabling it to handle all forms of gene introduction, including gene introduction via expression vectors or viral vectors, augmentative vectors or transposon vectors, gene insertion into desired genomic regions via genome editing technology, modification of the TCR locus itself, and gene loading into artificial chromosome vectors.

[0399] The present invention has been described in detail using specific methods, but various changes and modifications can be made without departing from the intent and scope of the invention, as will be apparent to those skilled in the art. It should be noted that this application is based on Japanese Patent Application No. 2018-242733, filed on December 26, 2018, the entire contents of which are incorporated herein by reference. sequence list <110> KIRIN HOLDINGS KABUSHIKI KAISHA Kyoto University, a national university corporation <120> Modified TCR and its manufacturing method <130> W527533 <150> JP2018-242733 <151> 2018-12-26 <160> 92 <170> PatentIn version 3.5 <210> 1 <211> 141 <212> PRT <213> Homo sapiens <400> 1 Asn Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser Lys 1 5 10 15 Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr 20 25 30 Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Thr 35 40 45 Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala 50 55 60 Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser 65 70 75 80 Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp[[ID=ll]] 85 90 95 Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe 100 105 110 Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala 115 120 125 Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 130 135 140 <210> 2 <211> 132 <212> PRT <213> Homo sapiens <400> 2 Tyr Gln Leu Arg Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe 1 5 l0 15 Thr Asp Phe Asp Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp 20 25 30 Val Tyr Ile Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe 35 40 45 Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys 50 55 60 Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro 65 70 75 80 Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu 85 90 95 Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg 100 105 110 Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg 115 120 125 Leu Trp Ser Ser 130 <210> 3 <211> 121 <212> PRT <213> Homo sapiens <400> 3 Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr Asn Val Ser Gln 1 5 10 15 Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Thr Val Leu Asp Met 20 25 30 Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys 35 40 45 Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu 50 55 60 Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val 65 70 75 80 Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser 85 90 95 Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu 100 105 110 Leu Met Thr Leu Arg Leu Trp Ser Ser 115 120 <210> 4<00009​​​​​​​​​​​​​​​​​​​​​​​​Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe 65 70 75 80 Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala 85 90 95 Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 100 105 <210> 5 <211> 101 <212> PRT <213> Homo sapiens <400> 5 Asp Val Tyr Ile Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp 1 5 10 15 Phe Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala 20 25 30 Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe 35 40 45 Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe 50 55 60 Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe 65 70 75 80 Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu 85 90 95 Arg Leu Trp Ser Ser 100 <210> 6 <211> 92 <212> PRT <213> Homo sapiens <400> 6 Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala Trp 1 5 10 15 Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile 20 25 30 Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val 35 40 45 Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln 50 55 60 Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly 65 70 75 80 Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 85 90 <210> 7 <211> 84 <212> PRT <213> Homo sapiens <400> 7 Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys 1 5 10 15<Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro 20 25 30 Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu 35 40 45 Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg 50 55 60 Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg 65 70 75 80 Leu Trp Ser Ser <210> 8 <211> 76 <212> PRT <213> Homo sapiens <400> 8 Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile 1 5 10 15 Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val 20 25 30 Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln 35 40 45 Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly 50 55 60 Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 65 70 75 <210> 9 <211> 69 <212> PRT <213> Homo sapiens <400> 9 Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe 1 5 10 15 Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe 20 25 30 Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe 35 40 45 Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu 50 55 60 Arg Leu Trp Ser Ser 65 <210> 10 <211> 65 <212> PRT <213> Homo sapiens <400> 10 Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu 1 5 10 15 Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr 20 25 30 Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu 35 40 45 Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser 50 55 60 Ser 65 <210> 11 <211> 60 <212> PRT <213> Homo sapiens <400> 11 Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val 1 5 10 15 Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln 20 25 30 Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly 35 40 45 Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 50 55 60 <210> 12 <211> 179 <212> PRT <213> Homo sapiens <400> 12 Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro 1 5 |0 15 Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu 20 25 30 Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn Note: There seems to be a small formatting issue in the original text where "45" should probably be "45". Also, in the translation of ID=46, "|0" is likely a typo in the original and should be "10". I've translated it as it is but noted these potential errors. 35 40 45 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys 50 55 60 Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu 65 70 75 80 Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys 85 90 95 Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp 100 105 110 Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg 115 120 125 Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser 130 135 140 Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala 145 150 155 160 Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp 165 170 175 Ser Arg Gly <210> 13 <211> 163 <212> PRT <213> Homo sapiens <40​Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu 1 5 10 15 Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 20 25 30 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys 35 40 45 Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu 50 55 60 Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys 65 70 75 80 Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp 85 90 95 Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg 100 105 110 Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser 115 120 125 Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala 130 135 140 Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp 145 150 155 160 Ser Arg Gly <210> 14 <211> 153 <212> PRT <213> Homo sapiens <400> 14 Ala Thr Leu Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu 1 5 10 15 Leu Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr 20 25 30 Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr 35 40 45 Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro 50 55 60 Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn 65 70 75 80 Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser 85 90 95 Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr 100 105 110 Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly 115 120 125 Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala 130 135 140 Met Val Lys Arg Lys Asp Ser Arg Gly 145 150 <210> 15 <211> 139 <212> PRT <213> Homo sapiens <400> 15 Val Glu Leu Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val 1 5 10 15 Ser Thr Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser 20 25 30 Arg Tyr Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln 35 40 45 Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser 50 55 60 Glu Asn Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile 65 70 75 80 Val Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu 85 90 95 Ser Tyr Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu 100 105 110 Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu 115 120 125 Met Ala Met Val Lys Arg Lys Asp Ser Arg Gly 130 135 <210> 16 <211> 133 <212> PRT <213> Homo sapiens <400> 16 Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro 1 5 10 15 Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser 20 25 30 Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe 35 40 45 Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr 50 55 60 Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp 65 70 75 80 Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val 85 90 95 Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu 100 105 110 Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg 115 120 125 Lys Asp Ser Arg Gly 130 <210> 17 <211> 124 <212> PRT <213> Homo sapiens <400> 17 Val Ser Thr Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp 1 5 10 15 Ser Arg Tyr Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp 20 25 30 Gln Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu 35 40 45 Ser Glu Asn Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln 50 55 60 Ile Val Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser 65 70 75 80 Glu Ser Tyr Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile 85 90 95 Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val 100 105 110 Leu Met Ala Met Val Lys Arg Lys Asp Ser Arg Gly 115 120 <​​​​​<213> Homo sapiens <400> 18 Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu Arg Val Ser 1 5 10 15 Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln 20 25 30 Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp Arg Ala Lys 35 40 45 Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys 50 55 60 Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser Ala Thr Ile 65 70 75 80 Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val 85 90 95 Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp Ser Arg Gly 100 105 110 <210> 19 <211> 101 <212> PRT <213> Homo sapiens <400> 19 Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe 1 5 10 15 Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr 20 25 30 Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp 35 40 45 Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val 50 55 60 Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu 65 70 75 80 Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg 85 90 95 Lys Asp Ser Arg Gly 100 <210> 20 <211> 92 <212> PRT <213> Homo sapiens <400> 20 Gln Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu [[ID=]36]1 5 10 15 Ser Glu Asn Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln 20 25 30 Ile Val Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser 35 40 45 Glu Ser Tyr Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile 50 55 60 Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val 65 70 75 80 Leu Met Ala Met Val Lys Arg Lys Asp Ser Arg Gly 85 90 <210> 21 <211> 86 <212> PRT <213> Homo sapiens <400> 21 Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp 1 5 10 15 Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala 20 25 30 Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly 35 40 45 Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr 50 55 60 Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys 65 70 75 80 Arg Lys Asp Ser Arg Gly 85 <210> 22 <211> 79 <212> PRT <213> Homo sapiens <400> 22 Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro 1 5 10 15 Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly 20 25 30 Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser Ala Thr Ile Leu 35 40 45 Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val Ser 50 55 60 Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp Ser Arg Gly 65 70 75 <210> 23 <211> 72 <212> PRT <213> Homo sapiens <400> 23 Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala 1 5 10 15 Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln 20 25 30 Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys 35 40 45​Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met 50 55 60 Val Lys Arg Lys Asp Ser Arg Gly 65 70 <210> 24 <211> 66 <212> PRT <213> Humans (Homo sapiens) <400> 24 Only Lys Pro Only Thr Gln Ile Only Only Only Only Glu Only Trp Gly Arg Only 1 5 10 15 Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gly Val Leu Ser Ala 20 25 30 Thr with Tyr Glu and Gly with Lys Fragment Thr with Tyr Fragment Val 35 40 45 Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp Ser 50 55 60 Arg Gly 65 <210> 25 <211> 423 <212> DNA <213> Humans (Homo sapiens) <400> 25 atatccaga accctgaccc tgccgtgtac cagctgagag actctaaatc cagtgacaag 60 tctgtctgcc tattcaccga ttttgattcaacaatg tgtcacaag class 120 gatgtgtata tcacagacaa aactgtgcta gacatgaggt ctatggactt caagagcaac 180 agtgctgtgg cctggagcaa caaatctgac tttgcatgtg caaacgcctt caacaacagc 240 attattccag aagacacctt cttccccagc ccagaaagtt cctgtgatgt caagctggtc 300 gagaaaagct ttgaaacaga tacgaaccta aactttcaaa acctgtcagt gattgggttc 360 cgaatcctcc tcctgaaagt ggccgggttt aatctgctca tgacgctgcg gctgtggtcc 420 agc 423 <210> 26 <211> 396 <212> DNA <213> Homo sapiens <400> 26 taccagctga gagactctaa atccagtgac aagtctgtct gcctattcac cgattttgat 60 tctcaaacaa atgtgtcaca aagtaaggat tctgatgtgt atatcacaga caaaactgtg 120 ctagacatga ggtctatgga cttcaagagc aacagtgctg tggcctggag caacaaatct 180 gactttgcat gtgcaaacgc cttcaacaac agcattattc cagaagacac cttcttcccc 240 agcccagaaa gttcctgtga tgtcaagctg gtcgagaaaa gctttgaaac agatacgaac 300 ctaaactttc aaaacctgtc agtgattggg ttccgaatcc tcctcctgaa agtggccggg 360 tttaatctgc tcatgacgct gcggctgtgg tccagc 396 <210> 27 <211> 363 <212> DNA <213> Homo sapiens <400> 27 tctgtctgcc tattcaccga ttttgattct caaacaaatg tgtcacaaag taaggattct 60 gatgtgtata tcacagacaa aactgtgcta gacatgaggt ctatggactt caagagcaac 120 agtgctgtgg cctggagcaa caaatctgac tttgcatgtg caaacgcctt caacaacagc 180 attattccag aagacacctt cttccccagc ccagaaagtt cctgtgatgt caagctggtc 240 gagaaaagct ttgaaacaga tacgaaccta aactttcaaa acctgtcagt gattgggttc 300 cgaatcctcc tcctgaaagt ggccgggttt aatctgctca tgacgctgcg gctgtggtcc 360 agc 363 <210> 28 <211> 327 <212> DNA <213> Homo sapiens[[ID=!]] <400> 28 aatgtgtcac aaagtaagga ttctgatgtg tatatcacag acaaaactgt gctagacatg 60 aggtctatgg acttcaagag caacagtgct gtggcctgga gcaacaaatc tgactttgca 120 tgtgcaaacg ccttcaacaa cagcattatt ccagaagaca ccttcttccc cagcccagaa 180 agttcctgtg atgtcaagct ggtcgagaaa agctttgaaa cagatacgaa cctaaacttt 240 caaaacctgt cagtgattgg gttccgaatc ctcctcctga aagtggccgg gtttaatctg 300 ctcatgacgc tgcggctgtg gtccagc 327 <210> 29 <211> 303 <212> DNA <213> Homo sapiens <400> 29 gatgtgtata tcacagacaa aactgtgcta gacatgaggt ctatggactt caagagcaac 60 agtgctgtgg cctggagcaa caaatctgac tttgcatgtg caaacgcctt caacaacagc 120 attattccag aagacacctt cttccccagc ccagaaagtt cctgtgatgt caagctggtc 180 gagaaaagct ttgaaacaga tacgaaccta aactttcaaa acctgtcagt gattgggttc 240 cgaatcctcc tcctgaaagt ggccgggttt aatctgctca tgacgctgcg gctgtggtcc 300 agc 303 <210> 30 <211> 276 <212> DNA <213> Homo sapiens <400> 30 ctagacatga ggtctatgga cttcaagagc aacagtgctg tggcctggag caacaaatct 60 gactttgcat gtgcaaacgc cttcaacaac agcattattc cagaagacac cttcttcccc 120 agcccagaaa gttcctgtga tgtcaagctg gtcgagaaaa gctttgaaac agatacgaac 180 ctaaactttc aaaacctgtc agtgattggg ttccgaatcc tcctcctgaa agtggccggg 240 tttaatctgc tcatgacgct gcggctgtgg tccagc 276 <210> 31 <211> 254 <212> DNA <213> Homo sapiens <400> 31 aagagcaaca gtgctgtggc ctggagcaac aaatctgact ttgcatgtgc aaacgccttc 60 aacaacagca ttattccaga agacaccttc ttccccagcc cagaaagttc ctgtgatgtc 120 aagctggtcg agaaaagctt tgaaacagat acgaacctaa actttcaaaa cctgtcagtg 180 attgggttcc gaatcctcct cctgaaagtg gccgggttta atctgctcat gacgctgcgg 240 ctgtggtcca gc 254 <210> 32 <211> 228 <212> DNA It should be noted that there may be some inaccuracies in the translation of DNA sequences as they are often specific genetic codes and might need more context for a more precise rendering in a biological sense. But this translation adheres to the requirements of preserving tags and line breaks.<213> Homo sapiens <400> 32 agcaacaaat ctgactttgc atgtgcaaac gccttcaaca acagcattat tccagaagac 60 accttcttcc ccagcccaga aagttcctgt gatgtcaagc tggtcgagaa aagctttgaa 120 acagatacga acctaaactt tcaaaacctg tcagtgattg ggttccgaat cctcctcctg 180 aaagtggccg ggtttaatct gctcatgacg ctgcggctgt ggtccagc 228 <210> 33 <211> 207 <212> DNA <213> Homo sapiens <400> 33 tgtgcaaacg ccttcaacaa cagcattatt ccagaagaca ccttcttccc cagcccagaa 60 agttcctgtg atgtcaagct ggtcgagaaa agctttgaaa cagatacgaa cctaaacttt 120 caaaacctgt cagtgattgg gttccgaatc ctcctcctga aagtggccgg gtttaatctg 180 ctcatgacgc tgcggctgtg gtccagc 207 <210> 34 <211> 195 <212> DNA <213> Homo sapiens <400> 34 ttcaacaaca gcattattcc agaagacacc ttcttcccca gcccagaaag ttcctgtgat 60 gtcaagctgg tcgagaaaag ctttgaaaca gatacgaacc taaactttca aaacctgtca 120 gtgattgggt tccgaatcct cctcctgaaa gtggccgggt ttaatctgct catgacgctg 180 cggctgtggt ccagc 195 <210> 35 <211> 180 <212> DNA <213> Homo sapiens <400> 35 attccagaag acaccttctt ccccagccca gaaagttcct gtgatgtcaa gctggtcgag 60 aaaagctttg aaacagatac gaacctaaac tttcaaaacc tgtcagtgat tgggttccga 120 atcctcctcc tgaaagtggc cgggtttaat ctgctcatga cgctgcggct gtggtccagc 180 <210> 36 <211> 537 <212> DNA <213> Homo sapiens <400> / 36 gaggacctga aaaacgtgtt cccacccgag gtcgctgtgt ttgagccatc agaagcagag 60 atctcccaca cccaaaaggc cacactggtg tgcctggcca caggcttcta ccccgaccac 120 gtggagctga gctggtgggt gaatgggaag gaggtgcaca gtggggtcag cacagacccg 180 cagcccctca aggagcagcc cgccctcaat gactccagat actgcctgag cagccgcctg 240 agggtctcgg ccaccttctg gcagaacccc cgcaaccact tccgctgtca agtccagttc tacgggctct cggagatga cgagtggacc caggataggg ccaaacctgt cacccagatc gtcagcgccg aggcctgggg tagagcagac tgtggcttca cctccgagtc ttaccagcaa 420 ggggtcctgt ctgccaccat cctctatgag atcttgctag ggaaggccac cttgtatgcc 480 gtgctggtca gtgccctcgt gctgatggcc atggtcaaga gaaaggattc cagaggc 537 <210> 37 <211> 489 <212> DNA <213> Man (Homo sapiens) <400> 37 60. tcagaagcag agatctccca cacccaaaag gccacactgg tgtgcctggc cacaggcttc taccccgacc acgtggagct gagctggtgg gtgaatggga aggaggtgca cagtggggtc 120 agcacagacc cgcagcccct caagaccc cccgccctca atgactccag atactgcctg agcagccgcc tgagggtctc ggccaccttc tggcagaacc cccgcaacca cttccgctgt 240 caagtccagt tctacgggct ctcggagaat gacgagtgga cccaggatag ggccaaacct gtcacccaga tcgtcagcgc cgaggcctgg ggtagcag actgtggctt cacctccgag 360 tcttaccagc aaggggtcct gtctgccacc atcctctatg agatcttgct agggaaggcc 420 accttgtatg ccgtgctggt cagtgccctc gtgctgatgg ccatggtcaa gagaaaggat tccagaggc 489 <210> 38 <211> 459 <212> DNA <213> Man (Homo sapiens) <400> 38 gccacactgg tgtgcctggc cacaggcttc taccccgacc acgtggagct gagctggtgg gtgaatggga aggaggtgca cagtggggtc agcacagacc cgcagcccct caaggagcag cccgccctca atgactccag atactgcctg agcagccgcc tgagggtctc ggccaccttc 180 tggcagaacc cccgcaacca cttccgctgt caagtccagt tctacgggct ctcggagaat gacgagtgga cccaggatag ggccaaacct gtcacccaga tcgtcagcgc cgaggcctgg ggtaggcag actgtggctt cacctccgag tcttaccagc aaggggtcct gtctgccacc 360 atcctctatg agatcttgct agggaaggcc accttgtatg ccgtgctggt cagtgccctc 420 gtgctgatgg ccatggtcaa gagaaggat tccagaggc <210> 39 <211> 417 <212> DNA <213> Man (Homo sapiens) <400> 39 gtggagctga gctggtgggt gaatgggag gaggtgcaca gtggggtcag cacagacccg cagcccctca aggagcagcc cgccctcaat gactccagat actgcctgag cagccgcctg 120 agggtctcgg ccaccttctg gcagaacccc cgcaaccact tccgctgtca agtccagttc 180 tacgggctct cggagatga cgagtggacc caggataggg ccaaacctgt cacccagatc gtcagcgccg aggcctgggg tagagcagac tgtggcttca cctccgagtc ttaccagcaa ggggtcctgt ctgccaccat cctctatgag atcttgctag ggaaggccac cttgtatgcc 360 gtgctggtca gtgccctcgt gctgatggcc atggtcaaga gaaaggattc cagaggc 417 <210> 40 <211> 399 <212> DNA <213> Man (Homo sapiens) <400> 40 gtgaatggga aggaggtgca cagtggggtc agcacagacc cgcagcccct caaggagcag cccgccctca atgactccag atactgcctg agcagccgcc tgagggtctc ggccaccttc 120 tggcagaacc cccgcaacca cttccgctgt caagtccagt tctacgggct ctcggagaat 180 gacgagtgga cccaggatag ggccaaacct gtcacccaga tcgtcagcgc cgaggcctgg 240 ggtagagcag actgtggctt cacctccgag tcttaccagc aaggggtcct gtctgccacc 300 atcctctatg agatcttgct agggaaggcc accttgtatg ccgtgctggt cagtgccctc 360 gtgctgatgg ccatggtcaa gagaaaggat tccagaggc 399 <210> 41 <211> 372 <212> DNA <213> Homo sapiens <400> 41 gtcagcacag acccgcagcc cctcaaggag cagcccgccc tcaatgactc cagatactgc 60 ctgagcagcc gcctgagggt ctcggccacc ttctggcaga acccccgcaa ccacttccgc 120 tgtcaagtcc agttctacgg gctctcggag aatgacgagt ggacccagga tagggccaaa 180 cctgtcaccc agatcgtcag cgccgaggcc tggggtagag cagactgtgg cttcacctcc 240 gagtcttacc agcaaggggt cctgtctgcc accatcctct atgagatctt gctagggaag 300 gccaccttgt atgccgtgct ggtcagtgcc ctcgtgctga tggccatggt caagagaaag 360 gattccagag gc 372 <210> 42 <211> 336 <212> DNA <213> Homo sapiens <400> 42 gccctcaatg actccagata ctgcctgagc agccgcctga gggtctcggc caccttctgg 60 cagaaccccc gcaaccactt ccgctgtcaa gtccagttct acgggctctc ggagaatgac 120 gagtggaccc aggatagggc caaacctgtc acccagatcg tcagcgccga ggcctggggt 180 agagcagact gtggcttcac ctccgagtct taccagcaag gggtcctgtc tgccaccatc 240 ctctatgaga tcttgctagg gaaggccacc ttgtatgccg tgctggtcag tgccctcgtg 300 ctgatggcca tggtcaagag aaaggattcc agaggc 336 <210> 43 <211> 303 <212> DNA <213> Homo sapiens <400> 43 cgcctgaggg tctcggccac cttctggcag aacccccgca accacttccg ctgtcaagtc 60 cagttctacg ggctctcgga gaatgacgag tggacccagg atagggccaa acctgtcacc 120 cagatcgtca gcgccgaggc ctggggtaga gcagactgtg gcttcacctc cgagtcttac 180 240. cagcaagggg tcctgtctgc caccatcctc tatgagatct tgctaggga ggccaccttg tatgccgtgc tggtcagtgc cctcgtgctg atggccatgg tcaagagaaa ggattccaga ggc 303 <210> 44 <211> 276 <212> DNA <213> Man (Homo sapiens) <400> 44 cagaacccc gcaaccactt ccgctgtcaa gtccagttct acgggctctc ggagaatgac gagtggaccc aggatagggc caaacctgtc acccagatcg tcagcgccga ggcctggggt 120 180. aggcagact gtggcttcac ctccgagtct taccagcag gggtcctgtc tgccaccatc 240. ctctatgaga tcttgctagg gaaggccacc ttgtatgccg tgctggtcag tgccctcgtg ctgatggcca tggtcaagag aaaggattcc agaggc 276 <210> 45 <211> 258 <212> DNA <213> Man (Homo sapiens) <400> 45 ttccgctgtc aagtccagtt ctacgggctc tcggagaatg acgagtggac ccaggatagg gccaaacctg tcacccagat cgtcagcgcc gaggcctggg gtagagcaga ctgtggcttc 120 acctccgagt cttaccagca aggggtcctg tctgccacca tcctctatga gatcttgcta gggaaggcca ccttgtatgc cgtgctggtc agtgccctcg tgctgatggc catggtcaag 240 agaaaggatt ccagaggc <210> 46 <211> 237 <212> DNA <213> Man (Homo sapiens) <400> 46 tacgggctct cggagaatga cgagtggacc caggataggg ccaaacctgt cacccagatc gtcagcgccg aggcctgggg tagagcagac tgtggcttca cctccgagtc ttaccagcaa ggggtcctgt ctgccaccat cctctatgag atcttgctag ggaaggccac cttgtatgcc 180 gtgctggtca gtgccctcgt gctgatggcc atggtcaaga gaaaggattc cagaggc 237 <210> 47 <211> 216 <212> DNA <213> Man (Homo sapiens) <400> 47 gagtggaccc aggatagggc caaacctgtc acccagatcg tcagcgccga ggcctggggt 120. aggcagact gtggcttcac ctccgagtct taccagcag gggtcctgtc tgccaccatc ctctatgaga tcttgctagg gaaggccacc ttgtatgccg tgctggtcag tgccctcgtg 180 ctgatggcca tggtcaagag aaaggattcc agaggc 216 <210> 48 <211> 198 <212> DNA <213> Homo sapiens <400> 48 gccaaacctg tcacccagat cgtcagcgcc gaggcctggg gtagagcaga ctgtggcttc 60 acctccgagt cttaccagca aggggtcctg tctgccacca tcctctatga gatcttgcta 120 gggaaggcca ccttgtatgc cgtgctggtc agtgccctcg tgctgatggc catggtcaag 180 agaaaggatt ccagaggc 198 <210> 49 <211> 606 <212> PRT <213> Artificial Sequence <220> <223> Amino acid sequence of ba1 <400> 49 Met Leu Ser Leu Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Ala Val Ile Ser Gln Lys Pro Ser Arg Asp Ile Cys Gln Arg Gly Thr 20 25 30 Ser Leu Thr Ile Gln Cys Gln Val Asp Ser Gln Val Thr Met Met Phe 35 40 45 Trp Tyr Arg Gln Gln Pro Gly Gln Ser Leu Thr Leu Ile Ala Thr Ala 50 55 60 Asn Gln Gly Ser Glu Ala Thr Tyr Glu Ser Gly Phe Val Ile Asp Lys 65 70 75 80 Phe Pro Ile Ser Arg Pro Asn Leu Thr Phe Ser Thr Leu Thr Val Ser 85 90 95 Asn Met Ser Pro Glu Asp Ser Ser Ile Tyr Leu Cys Ser Val Asp Gly 100 105 110 Gln Gly Asn Thr Gly Glu Leu Phe Phe Gly Glu Gly Ser Arg Leu Thr 115 120 125 Val Leu Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe 130 135 140 Glu Pro Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val 145 150 155 160 Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp 165 170 175 Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro 180 185 190 Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser 195 200 205 Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe 210 215 220 Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr 225 230 235 240 Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp 245 250 255 Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val 260 265 270 Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu 275 280 285 Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg 290 295 300 Lys Asp Ser Arg Gly Ser Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu 305 310 315 320 Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Cys Pro Gly 325 330 335 Phe Leu Trp Ala Leu Val Ile Ser Thr Cys Leu Glu Phe Ser Met Ala 340 345 350 Gln Thr Val Thr Gln Ser Gln Pro Glu Met Ser Val Gln Glu Ala Glu 355 360 365 Thr Val Thr Leu Ser Cys Thr Tyr Asp Thr Ser Glu Ser Asp Tyr Tyr 370 375 380 Leu Phe Trp Tyr Lys Gln Pro Pro Ser Arg Gln Met Ile Leu Val Ile 385 390 395 400 Arg Gln Glu Ala Tyr Lys Gln Gln Asn Ala Thr Glu Asn Arg Phe Ser 405 410 415 Val Asn Phe Gln Lys Ala Ala Lys Ser Phe Ser Leu Lys Ile Ser Asp 420 425 430 Ser Gln Leu Gly Asp Ala Ala Met Tyr Phe Cys Ala Tyr Trp Ser Asn 435 440 445 Asn Asn Ala Arg Leu Met Phe Gly Asp Gly Thr Gln Leu Val Val Lys 450 455 460 Pro Asn Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser 465 470 475 480 Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln 485 490 495 Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys 500 505 510 Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val 515 520 525 Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn 530 535 540 Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys 545 550 555 560 Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn 565 570 575 Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val 580 585 590 Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 595 600 605 <210> 50 <211> 379 <212> PRT <213> artificial sequence <220> <223> ba2's amino acid sequence <400> 50 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro 20 25 30 Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu 35 40 45 Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 50 55 60 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys 65 70 75 80 Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu 85 90 95 Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys 100 105 110 Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp 115 120 125 Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg 130 135 140 Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser 145 150 155 160 Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala 165 170 175 Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp 180 185 190 Ser Arg Gly Ser Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys 195 200 205 Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Cys Pro Gly Phe Leu 210 215 220 Trp Ala Leu Val Ile Ser Thr Cys Leu Glu Phe Ser Met Ala Asn Ile 225 230 235 240 Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser Lys Ser Ser 245 250 255 Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr Asn Val 260 265 270 Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Thr Val Leu 275 280 285 Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala Trp Ser 290 295 300 Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile 305 310 315 320 Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val Lys 325 330 335 Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn 340 345 350 Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly Phe 355 360 365 Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 370 375 <210> 51 <211> 353 <212> PRT <213> Artificial sequence <220> <223> Amino acid sequence of ba3 <400> 51 Met Leu Ser Leu Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Ala Thr Leu Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu 20 25 30 Leu Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr 35 40 45 Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr [[ID=,33]]50 55 60 Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro )) 65 70 75 80 Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn 85 90 95 Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser 100 105 110 Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr 115 120 125 Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly 130 135 140 Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala 145 150 155 160 Met Val Lys Arg Lys Asp Ser Arg Gly Ser Gly Ser Gly Glu Gly Arg 165 170 175 Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met 180 185 190 Ala Cys Pro Gly Phe Leu Trp Ala Leu Val Ile Ser Thr Cys Leu Glu 195 200 205 Phe Ser Met Ala Asn Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu 210 215 220 Arg Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe 225 230 235 240 Asp Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile 245 250 255 Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn 260 265 270 Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala 275 280 285 Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu 290 295 300 Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr 305 310 315 320 Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu 325 330 335 Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser 340 345 350 Serum <210> 52 <211> 324 <212> PRT <213> artificial sequence <220> <223> ba4's amino acid sequence <400> 52 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Val Ser Thr Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp 20 25 30 Ser Arg Tyr Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp 35 40 45 Gln Asn Pro Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu 50 55 60 Ser Glu Asn Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln 65 70 75 80 Ile Val Ser Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser 85 90 95 Glu Ser Tyr Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile 100 105 110 Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val 115 120 125 Leu Met Ala Met Val Lys Arg Lys Asp Ser Arg Gly Ser Gly Ser Gly 130 135 140 Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro 145 150 155 160 Gly Pro Met Ala Cys Pro Gly Phe Leu Trp Ala Leu Val Ile Ser Thr 165 170 175 Cys Leu Glu Phe Ser Met Ala Asn Ile Gln Asn Pro Asp Pro Ala Val 180 185 190 Tyr Gln Leu Arg Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe 195 200 205 Thr Asp Phe Asp Ser Gln Thr Asn Val Ser Gln Ser Lys Asp Ser Asp 210 215 220 Val Tyr Ile Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe 225 230 235 240 Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys 245 250 255 Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro 260 265 270 Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu 275 280 285 Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg 290 295 300 Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg 305 310 315 320 Leo Trp Serum Serum <210> 53 <211> 286 <212> PRT <213> artificial sequence <220> <223> ba5's amino acid sequence <400> 53 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp 20 25 30 Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala 35 40 45 Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly 50 55 60 Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr 65 70 75 80 Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys 85 90 95 Arg Lys Asp Ser Arg Gly Ser Gly Ser Gly Glu Gly Arg Gly Ser Leu 100 105 110 Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Cys Pro 115 120 125 Gly Phe Leu Trp Ala Leu Val Ile Ser Thr Cys Leu Glu Phe Ser Met 130 135 140 Ala Asn Ile Gln Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser 145 150 155 160 Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln 165 170 175 Thr Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys 180 185 190 Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val 195 200 205 Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn 210 215 220 Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys 225 230 235 240 Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn 245 250 255 Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val 260 265 270 Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 275 280 285 <210> 54 <211> 266 <212> PRT <213> artificial sequence <220> <223> ba6's amino acid sequence <400> 54 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg Ala 20 25 30 Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser Ala 35 40 45 Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val 50 55 60 Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp Ser 65 70 75 80 Arg Gly Ser Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly 85 90 95 Asp Val Glu Glu Asn Pro Gly Pro Met Ala Cys Pro Gly Phe Leu Trp 100 105 110 Ala Leu Val Ile Ser Thr Cys Leu Glu Phe Ser Met Ala Asn Ile Gln 115 120 125 Asn Pro Asp Pro Ala Val Tyr Gln Leu Arg Asp Ser Lys Ser Ser Asp 130 135 140 Lys Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr Asn Val Ser 145 150 155 160 Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Thr Val Leu Asp 165 170 175 Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala Trp Ser Asn 180 185 190 Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro 195 200 205 Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu 210 215 220 Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu 225 230 235 240 Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn 245 250 255 Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 260 265 <210> 55 <211> 359 <212> PRT <213> artificial sequence <220> <223> ba7's amino acid sequence <400> 55 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro 20 25 30 Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu 35 40 45 Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 50 55 60 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys 65 70 75 80 Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu 85 90 95 Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys 100 105 110 Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp 115 120 125 Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg 130 135 140 Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser 145 150 155 160 Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala 165 170 175 Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp 180 185 190 Ser Arg Gly Ser Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys 195 200 205 Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Cys Pro Gly Phe Leu 210 215 220 Trp Ala Leu Val Ile Ser Thr Cys Leu Glu Phe Ser Met Ala Ser Val 225 230 235 240 Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr Asn Val Ser Gln Ser Lys 245 250 255 Asp Ser Asp Val Tyr Ile Thr Asp Lys Thr Val Leu Asp Met Arg Ser 260 265 270 Met Asp Phe Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp 275 280 285 Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr 290 295 300 Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys 305 310 315 320 Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile 325 330 335 Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met 340 345 350 Thr Leu Arg Leu Trp Ser Ser 355 <210> 56 <211> 339 <212> PRT <213> artificial sequence <220> <223> ba8's amino acid sequence <400> 56 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro 20 25 30 Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu 35 40 45 Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 50 55 60 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys 65 70 75 80 Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu 85 90 95 Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys 100 105 110 Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp 115 120 125 Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg 130 135 140 Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser 145 150 155 160 Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala 165 170 175 Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp 180 185 190 Ser Arg Gly Ser Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys 195 200 205 Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Cys Pro Gly Phe Leu 210 215 220 Trp Ala Leu Val Ile Ser Thr Cys Leu Glu Phe Ser Met Ala Asp Val 225 230 235 240 Tyr Ile Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys 245 250 255 Ser Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala 260 265 270 Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser 275 280 285 Pro Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr 290 295 300 Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile 305 310 315 320 Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu 325 330 335 Trp Serum Serum <210> 57 <211> 322 <212> PRT <213> artificial sequence <220> <223> ba9's amino acid sequence <400> 57 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro 20 25 30 Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu 35 40 45 Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 50 55 60 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys 65 70 75 80 Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu 85 90 95 Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys 100 105 110 Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp 115 120 125 Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg 130 135 140 Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser 145 150 155 160 Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala 165 170 175 Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp 180 185 190 Ser Arg Gly Ser Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys 195 200 205 Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Cys Pro Gly Phe Leu 210 215 220 Trp Ala Leu Val Ile Ser Thr Cys Leu Glu Phe Ser Met Ala Lys Ser 225 230 235 240 Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn 245 250 255 Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro 260 265 270 Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp 275 280 285 Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu 290 295 300 Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp 305 310 315 320 Serum Serum <210> 58 <211> 298 <212> PRT <213> artificial sequence <220> <223> ba10's amino acid sequence <400> 58 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Glu Asp Leu Lys Asn Val Phe Pro Pro Glu Val Ala Val Phe Glu Pro 20 25 30 Ser Glu Ala Glu Ile Ser His Thr Gln Lys Ala Thr Leu Val Cys Leu 35 40 45 Ala Thr Gly Phe Tyr Pro Asp His Val Glu Leu Ser Trp Trp Val Asn 50 55 60 Gly Lys Glu Val His Ser Gly Val Ser Thr Asp Pro Gln Pro Leu Lys 65 70 75 80 Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr Cys Leu Ser Ser Arg Leu 85 90 95 Arg Val Ser Ala Thr Phe Trp Gln Asn Pro Arg Asn His Phe Arg Cys 100 105 110 Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn Asp Glu Trp Thr Gln Asp 115 120 125 Arg Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg 130 135 140 Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser 145 150 155 160 Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala 165 170 175 Val Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp 180 185 190 Ser Arg Gly Ser Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys 195 200 205 Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Cys Pro Gly Phe Leu 210 215 220 Trp Ala Leu Val Ile Ser Thr Cys Leu Glu Phe Ser Met Ala Ile Pro 225 230 235 240 Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu 245 250 255 Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu 260 265 270 Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn 275 280 285 Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 290 295 <210> 59 <211> 333 <212> PRT <213> artificial sequence <220> <223> ba11's amino acid sequence <400> 59 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Ala Thr Leu Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu 20 25 30 Leu Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr 35 40 45 Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr 50 55 60 Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro 65 70 75 80 Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn 85 90 95 Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser 100 105 110 Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr 115 120 125 Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly 130 135 140 Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala 145 150 155 160 Met Val Lys Arg Lys Asp Ser Arg Gly Ser Gly Ser Gly Glu Gly Arg 165 170 175 Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met 180 185 190 Ala Cys Pro Gly Phe Leu Trp Ala Leu Val Ile Ser Thr Cys Leu Glu 195 200 205 Phe Ser Met Ala Ser Val Cys Leu Phe Thr Asp Phe Asp Ser Gln Thr 210 215 220 Asn Val Ser Gln Ser Lys Asp Ser Asp Val Tyr Ile Thr Asp Lys Thr 225 230 235 240 Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala 245 250 255 Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser 260 265 270 Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp 275 280 285 Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe 290 295 300 Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala 305 310 315 320 Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 325 330 <210> 60 <211> 313 <212> PRT <213> Artificial sequence <220> <223> amino acid sequence of ba12 <400> 60 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Ala Thr Leu Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu 20 25 30 Leu Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr 35 40 45 Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr 50 55 60 Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro 65 70 75 80 Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn 85 90 95 Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser 100 105 110 Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr 115 120 125 Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly 130 135 140 Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala 145 150 155 160 Met Val Lys Arg Lys Asp Ser Arg Gly Ser Gly Ser Gly Glu Gly Arg 165 170 175 Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met 180 185 190 Ala Cys Pro Gly Phe Leu Trp Ala Leu Val Ile Ser Thr Cys Leu Glu 195 200 205 Phe Ser Met Ala Asp Val Tyr Ile Thr Asp Lys Thr Val Leu Asp Met 210 215 220 Arg Ser Met Asp Phe Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys 225 230 235 240 Ser Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu 245 250 255 Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val 260 265 270 Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser 275 280 285 Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu 290 295 300 Leu Met Thr Leu Arg Leu Trp Ser Ser 305 310 <210> 61 <211> 296 <212> PRT <213> artificial sequence <220> <223> ba13's amino acid sequence <400> 61 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Ala Thr Leu Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu 20 25 30 Leu Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr 35 40 45 Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr 50 55 60 Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro 65 70 75 80 Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn 85 90 95 Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser 100 105 110 Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr 115 120 125 Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly 130 135 140 Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala 145 150 155 160 Met Val Lys Arg Lys Asp Ser Arg Gly Ser Gly Ser Gly Glu Gly Arg 165 170 175 Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met 180 185 190 Ala Cys Pro Gly Phe Leu Trp Ala Leu Val Ile Ser Thr Cys Leu Glu 195 200 205 Phe Ser Met Ala Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys Ser 210 215 220 Asp Phe Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp 225 230 235 240 Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val Glu 245 250 255 Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser Val 260 265 270 Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu 275 280 285 Met Thr Leu Arg Leu Trp Ser Ser 290 295 <210> 62 <211> 272 <212> PRT <213> artificial sequence <220> <223> ba14's amino acid sequence <400> 62 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Ala Thr Leu Val Cys Leu Ala Thr Gly Phe Tyr Pro Asp His Val Glu 20 25 30 Leu Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr 35 40 45 Asp Pro Gln Pro Leu Lys Glu Gln Pro Ala Leu Asn Asp Ser Arg Tyr 50 55 60 Cys Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gln Asn Pro 65 70 75 80 Arg Asn His Phe Arg Cys Gln Val Gln Phe Tyr Gly Leu Ser Glu Asn 85 90 95 Asp Glu Trp Thr Gln Asp Arg Ala Lys Pro Val Thr Gln Ile Val Ser 100 105 110 Ala Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Glu Ser Tyr 115 120 125 Gln Gln Gly Val Leu Ser Ala Thr Ile Leu Tyr Glu Ile Leu Leu Gly 130 135 140 Lys Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala 145 150 155 160 Met Val Lys Arg Lys Asp Ser Arg Gly Ser Gly Ser Gly Glu Gly Arg 165 170 175 Gly Ser Leu Leu Thr Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met 180 185 190 Ala Cys Pro Gly Phe Leu Trp Ala Leu Val Ile Ser Thr Cys Leu Glu 195 200 205 Phe Ser Met Ala Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu Ser 210 215 220 Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr Asn 225 230 235 240 Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu Leu 245 250 255 Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser Ser 260 265 270 <210> 63 <211> 246 <212> PRT <213> artificial sequence <220> <223> amino acid sequence of ba15 <400> 63 Met Leu Ser Leu Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg Ala 20 25 30 Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser Ala 35 40 45 Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val 50 55 60 Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp Ser 65 70 75 80 Arg Gly Ser Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly 85 90 95 Asp Val Glu Glu Asn Pro Gly Pro Met Ala Cys Pro Gly Phe Leu Trp 100 105 110 Ala Leu Val Ile Ser Thr Cys Leu Glu Phe Ser Met Ala Ser Val Cys 115 120 125 Leu Phe Thr Asp Phe Asp Ser Gln Thr Asn Val Ser Gln Ser Lys Asp 130 135 140 Ser Asp Val Tyr Ile Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met 145 150 155 160 Asp Phe Lys Ser Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe 165 170 175 Ala Cys Ala Asn Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe 180 185 190 Phe Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser 195 200 205 Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly 210 215 220 Phe Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr 225 230 235 240 Leo Arg Leo Trp Ser Ser 245 <210> 64 <211> 226 <212> PRT <213> artificial sequence <220> <223> ba16's amino acid sequence <400> 64 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg Ala 20 25 30 Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser Ala 35 40 45 Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val 50 55 60 Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp Ser 65 70 75 80 Arg Gly Ser Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly 85 90 95 Asp Val Glu Glu Asn Pro Gly Pro Met Ala Cys Pro Gly Phe Leu Trp 100 105 110 Ala Leu Val Ile Ser Thr Cys Leu Glu Phe Ser Met Ala Asp Val Tyr 115 120 125 Island Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser 130 135 140 Asn Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn 145 150 155 160 Ala Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro 165 170 175 Glu Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp 180 185 190 Thr Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu 195 200 205 Leu Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp 210 215 220 Sir Sir 225 <210> 65 <211> 209 <212> PRT <213> artificial sequence <220> <223> amino acid sequence of ba17 <400> 65 Met Leu Ser Leu Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg Ala 20 25 30 Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser Ala 35 40 45 Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val 50 55 60 Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp Ser 65 70 75 80 Arg Gly Ser Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly 85 90 95 Asp Val Glu Glu Asn Pro Gly Pro Met Ala Cys Pro Gly Phe Leu Trp 100 105 110 Ala Leu Val Ile Ser Thr Cys Leu Glu Phe Ser Met Ala Lys Ser Asn 115 120 125 Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala 130 135 140 Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu 145 150 155 160 Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr 165 170 175 Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu 180 185 190 Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser 195 200 205 Serum <210> 66 <211> 185 <212> PRT <213> artificial sequence <220> <223> ba18's amino acid sequence <400> 66 Met Leu Ser Leu Leu Leu Leu Leu Gly Leu Gly Ser Val Phe Ser 1 5 10 15 Ala Lys Pro Val Thr Gln Ile Val Ser Ala Glu Ala Trp Gly Arg Ala 20 25 30 Asp Cys Gly Phe Thr Ser Glu Ser Tyr Gln Gln Gly Val Leu Ser Ala 35 40 45 Thr Ile Leu Tyr Glu Ile Leu Leu Gly Lys Ala Thr Leu Tyr Ala Val 50 55 60 Leu Val Ser Ala Leu Val Leu Met Ala Met Val Lys Arg Lys Asp Ser 65 70 75 80 Arg Gly Ser Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly 85 90 95 Asp Val Glu Glu Asn Pro Gly Pro Met Ala Cys Pro Gly Phe Leu Trp 100 105 110 Ala Leu Val Ile Ser Thr Cys Leu Glu Phe Ser Met Ala Ile Pro Glu 115 120 125 Asp Thr Phe Phe Pro Ser Pro Glu Ser Ser Cys Asp Val Lys Leu Val 130 135 140 Glu Lys Ser Phe Glu Thr Asp Thr Asn Leu Asn Phe Gln Asn Leu Ser 145 150 155 160 Val Ile Gly Phe Arg Ile Leu Leu Leu Lys Val Ala Gly Phe Asn Leu 165 170 175 Leu Met Thr Leu Arg Leu Trp Ser Ser 180 185 <210> 67 <211> 20 <212> DNA <213> Artificial sequence <220> <223> TRAC base sequence <400> 67 gagaatcaaa atcggtgaat 20 <210> 68 <211> 20 <212> DNA <213> Artificial sequence <220> <223> TRBC base sequence <400> 68 caaacacagc gacctcgggt 20 <210> 69 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 69 taccagctga gagactctaa atcc 24 <210> 70 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 70 tctgtctgcc tattcaccga ttttg 25 <210> 71 <211> 30 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 71 aatgtgtcac aaagtaagga ttctgatgtg 30 <210> 72 <211> 31 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 72 gatgtgtata tcacagacaa aactgtgcta g 31 <210> 73 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 73 ctagacatga ggtctatgga cttcaag 27 <210> 74 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 74 aagagcaaca gtgctgtggc c 21 <210> 75 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 75 agcaacaaat ctgactttgc atgtg 25 <210> 76 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 76 tgtgcaaacg ccttcaacaa cag 23 <210> 77 <211> 27 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 77 ttcaacaaca gcattattcc agaagac 27 <210> 78 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 78 attccagaag acaccttctt cccc 24 <210> 79 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 79 tcagaagcag agatctccca caccc 25 <210> 80 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 80 gccacactgg tgtgcctggc c 21 <210> 81 <211> twenty one <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 81 gtggagctga gctggtgggt g 21 <210> 82 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 82 gtgaatggga aggaggtgca cagtg 25 <210> 83 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 83 gtcagcacag acccgcagcc cc 22 <210> 84 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 84 gccctcaatg actccagata ctgcc 25 <210> 85 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 85 cgcctgaggg tctcggccac 20 <210> 86 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 86 cagaaccccc gcaaccactt cc 22 <210> 87 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 87 ttccgctgtc aagtccagttctacg 25 <210> 88 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 88 tacgggctct cggagaatga cg 22 <210> 89 <211> 26 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 89 gagtggaccc aggatagggc caaacc 26 <210> 90 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 90 gccaaacctg tcacccagat cgtc 24 <210> 91 <211> 25 <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 91 agccatgcta aattcaagac aggtg 25 <210> 92 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Oligonucleotides used for primer synthesis <400> 92 actgaacaca gagcctagtc ccag 24

Claims

1. An engineered T cell receptor (TCR) comprising a first polypeptide and a second polypeptide, wherein, the first polypeptide is a polypeptide consisting of a constant region of human T cell receptor alpha (TCRa) or a fragment of the constant region and not containing a variable region of human TCRa, the second polypeptide is a polypeptide consisting of a constant region of human T cell receptor beta (TCRp) or a fragment of the constant region and not containing a variable region of human TCRp, the engineered TCR has lost antigen recognition ability, the constant region of human TCRa or a fragment of the constant region and the constant region of human TCRp or a fragment of the constant region are polypeptides described in any one of (1) to (17) below: (1) the constant region of human TCRp or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCRa or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (2) the constant region of human TCRp or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCRa or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (3) the constant region of human TCRp or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 17, and the constant region of human TCRa or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (4) the constant region of human TCRp or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 21, and the constant region of human TCRa or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (5) the constant region of human TCRp or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCRa or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (6) the constant region of human TCRp or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCRa or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3; (7) the constant region of human TCRp or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCRa or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5; (8) the constant region of human TCRp or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCRa or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 7; (9) the constant region of human TCRp or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCRa or a fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 11; (10) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3; (11) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5; (12) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 7; (13) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 11; (14) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3; (15) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5; (16) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 7; (17) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO:

11.

2. The engineered TCR of claim 1, wherein, The proportion of CD3-positive cells in the pluripotent stem cell, hematopoietic stem cell / hematopoietic progenitor cell into which the modified TCR has been introduced, or T cell in which the endogenous TCR α gene and the endogenous TCR β gene have been knocked down or knocked out, respectively, is 1% or more.

3. The engineered TCR of claim 1, wherein, The proportion of CD3-positive cells in the pluripotent stem cell, hematopoietic stem cell / hematopoietic progenitor cell into which the modified TCR has been introduced, or T cell in which the endogenous TCR α gene and the endogenous TCR β gene have been knocked down or knocked out, respectively, is 2 times or more relative to the proportion of CD3-positive cells in the corresponding cell into which the modified TCR has not been introduced.

4. The engineered TCR of claim 1, wherein, The pluripotent stem cell or hematopoietic stem cell / hematopoietic progenitor cell into which the modified TCR has been introduced shows equal or more T cell differentiation ability compared with the corresponding cell into which a full-length TCR has been introduced.

5. The engineered TCR of claim 1, wherein, The allogenic reactivity of a non-T cell-derived pluripotent stem cell, a hematopoietic stem cell / hematopoietic progenitor cell, or a T cell in which an endogenous TCRa gene and an endogenous TCR gene have been knocked down or knocked out, into which the modified TCR is introduced, is reduced compared to a corresponding cell into which a full-length TCR is introduced.

6. The modified TCR according to claim 1, which is capable of holding a CD3 subunit on a cell membrane.

7. The modified TCR according to claim 6, which is capable of transducing a TCR / CD3 complex-related signal into a cell.

8. The modified TCR according to claim 7, which is capable of transducing a TCR / CD3 complex-related signal into a cell mediated by the CD3 subunit held on the cell membrane.

9. The modified TCR according to claim 8, which activates a T cell by transducing a TCR / CD3 complex-related signal into a cell mediated by the CD3 subunit held on the cell membrane.

10. The modified TCR according to claim 1, which is used for expression in a pluripotent stem cell, a hematopoietic stem cell / hematopoietic progenitor cell, or a T cell in which an endogenous TCRa gene and an endogenous TCR gene have been knocked down or knocked out.

11. The modified TCR according to claim 10, which is used for expression in a pluripotent stem cell or a hematopoietic stem cell / hematopoietic progenitor cell to differentiate the pluripotent stem cell or the hematopoietic stem cell / hematopoietic progenitor cell into a T cell.

12. The modified TCR according to claim 10, which is used for expression in a pluripotent stem cell, a hematopoietic stem cell / hematopoietic progenitor cell, or a T cell in which an endogenous TCRa gene and an endogenous TCR gene have been knocked down or knocked out to produce a T cell capable of a stimulation response mediated by the modified TCR / CD3 complex.

13. The engineered TCR of claim 2, wherein, The pluripotent stem cell is a non-T cell-derived pluripotent stem cell or a T cell-derived pluripotent stem cell in which an endogenous TCRa gene and an endogenous TCR gene have been knocked down or knocked out.

14. A cell expressing the modified TCR according to any one of claims 1 to 13, the cell expressing the modified TCR being a pluripotent stem cell, a hematopoietic stem cell / hematopoietic progenitor cell, or a T cell.

15. The cell of claim 14, wherein, The cell expressing the modified TCR is a T cell.

16. A pharmaceutical composition containing a cell expressing the modified TCR according to any one of claims 1 to 13.

17. A method of manufacturing a cell expressing the engineered TCR of any one of claims 1-13, wherein, The modified TCR comprises a first polypeptide and a second polypeptide, the antigen recognition ability of the modified TCR being lost, the first polypeptide being a polypeptide composed of a constant region of human T cell receptor a (TCRa) or a fragment of the constant region and not containing a variable region of human TCRa, the second polypeptide being a polypeptide composed of a constant region of human T cell receptor β (TCRβ) or a fragment of the constant region and not containing a variable region of human TCRβ, the constant region of human TCRa or the fragment of the constant region and the constant region of human TCRβ or the fragment of the constant region being a polypeptide described in any one of (1) to (17) below: the constant region of human TCRa or the fragment of the constant region and the constant region of human TCRβ or the fragment of the constant region being a polypeptide described in any one of (1) to (17) below: (1) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (2) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (3) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 17, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (4) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 21, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (5) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (6) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3; (7) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5; (8) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 7; (9) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 11; (10) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3; (11) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5; (12) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 7; (13) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 14, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 11; (14) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 24, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 3; (15) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 24, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 5; (16) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 24, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 7; (17) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 24, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 11, the manufacturing method includes the following steps (a) to (c): (a) a step of preparing a cell; (b) a step of separately preparing an expression vector containing a polynucleotide encoding a first polypeptide, and an expression vector containing a polynucleotide encoding a second polypeptide; (c) a step of transforming the cell prepared in step (a) using the expression vectors prepared in step (b).

18. A method of manufacturing a cell expressing the engineered TCR of any one of claims 1-13, wherein, the modified TCR includes a first polypeptide and a second polypeptide, and the antigen recognition ability of the modified TCR is lost, the first polypeptide is a polypeptide consisting of a constant region of human T cell receptor α (TCR α) or a fragment thereof and does not contain a variable region of human TCR α, the second polypeptide is a polypeptide consisting of a constant region of human T cell receptor β (TCR β) or a fragment thereof and does not contain a variable region of human TCR β, the constant region of human TCR α or the fragment thereof and the constant region of human TCR β or the fragment thereof are any of the polypeptides described in (1) to (17) below: (1) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 12, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1; (2) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 14, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1; (3) the constant region of human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 17, and the constant region of human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence represented by SEQ ID NO: 1; (4) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 21, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (5) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 1; (6) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3; (7) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5; (8) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 7; (9) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 12, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 11; (10) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3; (11) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5; (12) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 7; (13) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 14, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 11; (14) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 3; (15) the constant region of human TCR β or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24, and the constant region of human TCR α or the fragment of the constant region is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 5; (16) the constant region of the human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24, and the constant region of the human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 7; (17) the constant region of the human TCR β or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 24, and the constant region of the human TCR α or the fragment thereof is a polypeptide consisting of the amino acid sequence shown in SEQ ID NO: 11, the manufacturing method includes the following steps (a') to (c'): (a') a step of preparing a cell; (b') a step of preparing an expression vector containing a polynucleotide encoding a first polypeptide and a polynucleotide encoding a second polypeptide; (c') a step of transforming the cell prepared in the step (a') with the expression vector prepared in the step (b').

19. The manufacturing method according to claim 17 or 18, wherein, the cell in the step (a) or (a') is a pluripotent stem cell, a hematopoietic stem cell / hematopoietic progenitor cell, or a T cell in which a TCR α gene and a TCR β gene are knocked down or knocked out.

20. The manufacturing method according to claim 17 or 18, wherein, the cell expressing the engineered TCR is a T cell for immunocellular therapy.

21. A method for manufacturing a T cell, comprising a step of causing a pluripotent stem cell or a hematopoietic stem cell / hematopoietic progenitor cell to express the engineered TCR according to any one of claims 1 to 13, and differentiating it into a T cell.

22. A method for manufacturing a T cell, comprising a step of causing a pluripotent stem cell, a hematopoietic stem cell / hematopoietic progenitor cell, or a T cell in which an endogenous TCR α gene and an endogenous TCR β gene are respectively knocked down or knocked out to express the engineered TCR according to any one of claims 1 to 13, the obtained T cell is a T cell capable of a stimulation response mediated by the engineered TCR / CD3 complex.

23. The engineered TCR according to any one of claims 1 to 13 for use in immunocellular therapy.

24. A pluripotent stem cell-derived T cell for use in immunocellular therapy, which is obtained by causing a pluripotent stem cell to express the engineered TCR according to any one of claims 1 to 13, and differentiating it into a T cell.

25. A T cell for use in immunocellular therapy, which is obtained by causing a T cell in which an endogenous TCR α gene and an endogenous TCR β gene are respectively knocked down or knocked out to express the engineered TCR according to any one of claims 1 to 13.

26. A hematopoietic stem cell / hematopoietic progenitor cell-derived T cell for use in immunocellular therapy, which is obtained by causing a hematopoietic stem cell / hematopoietic progenitor cell to express the engineered TCR according to any one of claims 1 to 13, and differentiating it into a T cell.

27. A composition for immunocellular therapy, containing the engineered TCR according to any one of claims 1 to 13.

28. A composition for immunocellular therapy, containing a pluripotent stem cell-derived T cell, which is obtained by causing a pluripotent stem cell to express the engineered TCR according to any one of claims 1 to 13, and differentiating it into a T cell.

29. A composition for immunocellular therapy, which contains T cells obtained by causing T cells in which an endogenous TCRa gene and an endogenous TCR gene have been knocked down or knocked out, respectively, to express the engineered TCR according to any one of claims 1 to 13.

30. A composition for immunocellular therapy, which contains T cells obtained by causing hematopoietic stem cells / hematopoietic progenitor cells to differentiate into T cells by causing them to express the engineered TCR according to any one of claims 1 to 13.

31. A nucleic acid encoding the engineered TCR according to any one of claims 1 to 13.

32. A vector comprising the nucleic acid according to claim 31.

33. A pharmaceutical composition comprising the nucleic acid according to claim 31 or the vector according to claim 32.

Images