CD25 antibody

Abstract

Provided herein are antibodies that specifically bind to CD25. Also provided herein are methods of making the antibodies and methods of using the antibodies. For example, the CD25 antibodies can be used therapeutically to treat cancer or autoimmune diseases.

Description

[0001] Cross-references to related applications

[0002] This application claims priority to U.S. Provisional Application Serial No. 62 / 767,405, filed November 14, 2018, the contents of which are hereby incorporated by reference in their entirety. Background Technology

[0003] CD25 is the α-chain of the interleukin-2 (IL-2) receptor and a transmembrane protein present on regulatory T cells and activated T cells. Under normal conditions, regulatory T cells constitutively express CD25 and suppress the proliferation of effector cells. Regulatory T cells maintain a healthy state and suppress effector T cell responses to self-antigens or excessive responses to foreign antigens. In a normal protective immune response, effector T cells proliferate upon contact with foreign antigens and overcome the inhibitory effect of regulatory T cells. However, in proliferative diseases, cancer cells disable healthy immune responses by increasing the number of regulatory T cells, thereby limiting the production of effector T cells targeting them. Additional molecular tools are needed to alter the proliferation of CD25-expressing regulatory T cells, for example, to suppress the immune system for cancer therapy or to upregulate the immune system for autoimmune diseases; this article provides such tools. Summary of the Invention

[0004] This document provides antibodies that specifically bind to CD25 (anti-CD25 antibodies, which are interchangeably referred to herein as CD25 antibodies). These antibodies may be human, chimeric, or humanized. Methods for using and preparing these antibodies are also provided herein. For example, these CD25 antibodies can be used to treat cancer, including administering the antibody or a pharmaceutical composition thereof to a subject in need. Methods for generating the CD25 antibodies described herein are also provided.

[0005] In one respect, this article provides a monoclonal CD25 antibody that binds to human CD25 and has at least one, at least two, at least three, at least four, at least five, or at least six of the following characteristics:

[0006] a. The antibody does not disrupt the binding of the IL-2 ligand to the α chain (CD25) of the IL-2 receptor, and binds to an epitope different from the epitope bound by 7G7B6;

[0007] b. The antibody does not disrupt the binding of the IL-2 ligand to the α chain (CD25) of the IL-2 receptor, but disrupts the trimerization of the β chain, γ chain and α chain (CD25) of the IL-2 receptor;

[0008] c. The antibody disrupts the binding of the IL-2 ligand to the α, β and / or γ chains of the IL-2 receptor and binds to an epitope that is different from the epitope bound by daclizumab or baciliximab.

[0009] d. The antibody exhibits a higher affinity for CD25 at pH below 7.4 compared to its affinity for binding to CD25 at pH 7.4;

[0010] e. The antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A and 5A or Figures 3A, 3B and 5, its humanized form, or an amino acid sequence containing at least 80%, at least 85%, at least 90% or at least 95% sequence identity with it;

[0011] f. The antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B or Figures 4A, 4B, and 6, in its humanized form, or an amino acid sequence containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with it.

[0012] g. The VH of the antibody comprises any one of the amino acid sequences of CDRH1, CDRH2 and CDRH3 contained in the sequences presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, 5A and 6 or in Figures 3A, 3B and 5.

[0013] h. The VL of the CD25 antibody comprises any one of the amino acid sequences of CDRL1, CDRL2, and CDRL3 contained in the sequences presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, 5B, and 7, or in the sequences presented in Figures 4A, 4B, and 6; and

[0014] i. The antibody comprises the amino acid sequences of CDRH1, CDRH2 and CDRH3 of any one of the combinations presented in Table 6 and the amino acid sequences of CDRL1, CDRL2 and CDRL3 of any one of the combinations presented in Table 7.

[0015] In some embodiments, the VH of the antibody comprises an amino acid sequence of CDRH1, CDRH2 and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, 5A or 6, or in the sequences presented in Figures 3A, 3B or 5.

[0016] In some embodiments, the VL of the CD25 antibody comprises an amino acid sequence of the combination of CDRL1, CDRL2, and CDRL3 contained in the sequences presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, 5B, or 7, or in Figures 4A, 4B, or 6.

[0017] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 from any of the combinations presented in Table 6.

[0018] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRL1, CDRL2, and CDRL3 of any of the combinations presented in Table 7.

[0019] In some embodiments, the antibody is a human antibody. In some embodiments, the antibody is a humanized antibody. In some embodiments, the antibody is a chimeric antibody. In some embodiments, the antibody is an antibody fragment. In some embodiments, the antibody also binds to cynomolgus monkey CD25.

[0020] On the other hand, this document provides a method for treating a subject in need, the method comprising administering to the subject a therapeutically effective amount of any of the antibodies or pharmaceutical compositions described herein. In some embodiments, this document provides a method for depleting the number of regulatory T cells in a subject, the method comprising administering to the subject a therapeutically effective amount of any of the antibodies or pharmaceutical compositions described herein. In some embodiments, the subject has cancer; in other embodiments, the subject has an autoimmune-related disease or disorder.

[0021] On the other hand, this article provides a method for depleting the number of regulatory T cells in a sample containing peripheral blood mononuclear cells, the method comprising contacting the sample with any of the antibodies described herein.

[0022] In related aspects, this document provides pharmaceutical compositions or kits comprising any one or more of the antibodies described herein, nucleic acid sequences encoding any one of the antibodies described herein, vectors comprising the nucleic acids, and bacteriophages expressing any one of the antibodies described herein.

[0023] All the foregoing features described herein (including any appended claims, abstract and drawings) and / or all steps of any method or process so disclosed may be combined in any combination except for at least some mutually exclusive combinations of such features and / or steps. Attached Figure Description

[0024] This application can be understood by referring to the following description in conjunction with the accompanying drawings.

[0025] Figure 1 is an exemplary description of the desired characteristics of one of the CD25 antibody classes described herein: a CD25 antibody that blocks only the α chain (CD25) of the IL-2 receptor, does not block IL-2 binding, does not disrupt IL-2-mediated signal transduction, and causes Treg depletion. Data were collected using Fab clones, but as provided herein, in some embodiments, the CD25 antibody is a full-length antibody, i.e., a human IgG1 antibody.

[0026] Figure 2 is an exemplary workflow for CD25 antibody discovery, in vitro testing, and in vivo testing.

[0027] Figures 3A and 3B depict the variable heavy chain (VH) amino acid sequence of an exemplary CD25 antibody of this disclosure.

[0028] Figures 4A and 4B depict the variable light chain (VL) amino acid sequence of an exemplary CD25 antibody of this disclosure.

[0029] Figure 5 depicts the VH amino acid sequence of an exemplary CD25 antibody of this disclosure.

[0030] Figure 6 depicts the VL amino acid sequence of an exemplary CD25 antibody of this disclosure.

[0031] Figure 7 illustrates the identification of non-IL-2 blockers using cross-blocking assays with biosensors.

[0032] Figure 8 depicts the Fab of this disclosure text using a biosensor to illustrate phage expression competing with the IL-2 non-blocking antibody 7G7B6.

[0033] Figure 9 shows that pSTAT5 levels are IL-2 dose-dependent and are inhibited by the IL-2 blocking antibody dalizumab.

[0034] Figure 10 illustrates the effect of D5 Fab on pSTAT5 levels as described in this disclosure. The data indicate that D5 Fab is a partial IL-2 blocker.

[0035] Figure 11 illustrates the effect of different concentrations of D5 Fab on pSTAT5 levels relative to the maximum IL-2 pSTAT5 level.

[0036] Figure 12 depicts the differences in pSTAT5 levels among several Fab clones at 1, 2, and 5 μg / mL compared to controls (IL-2 only, dalizumab (Dac), and 7G7B6).

[0037] Figures 13A-13C depict the differences in Kd and Koff rates among several Fab clones of reformulated human IgG1 antibody (Figure 13A). Compared with commercially available antibodies 7G7B6, dalizumab, and basiliximab, several reformulated clones exhibited better affinity and Koff rates (Figures 13B and 13C).

[0038] Figures 14A-14D show representative data from epitope grouping cross-competition assays against IL-2 and commercially available antibodies 7G7B6, dalizumab, and baliximab using Fab clones of reformulated human IgG1 antibodies. The antibodies exhibited different cross-blocking profiles.

[0039] Figures 15A-15B depict the specific binding of human IgG1 reformatted Fab to CD25+ cell lines SUDHL-1 and HEK IL-2 reporter cells (Figure 15A) and its non-binding to CD25- cell line SUDHL-2 (Figure 15B).

[0040] Figures 16A-16B show representative dose-response curves of human IgG1 reformatted Fab clones against the CD25+ cell line SUDHL-1 compared to commercially available antibodies 7G7B6, dalizumab, and balithiximab (Figure 16A). Several clones showed better EC50 values ​​compared to the IL-2 non-blocker 7G7B6 (Figure 16B).

[0041] Figure 17 shows representative data for reformulated Fab clones of human IgG1 (25 nM) that bind to recombinant cynomolgus CD25 protein. Most clones bind in a dose-dependent manner (starting at 25 nM and diluted 3-fold).

[0042] Figures 18A-18B show the differences in pSTAT5 levels across several individual IgG1 reformatted Fab clones at 5 μg / mL compared to IL-2 levels at 0.1 ng / mL (Figure 18A). Figure 18B shows the pSTAT5 levels as a result of the IL-2 dose-response curves for each antibody at 5 μg / mL (starting from 10 ng / mL and diluted 10-fold). Compared to commercially available antibodies 7G7B6, dalizumab, and balithimab at 0.1 ng / mL, some clones are shown to be better IL-2 blockers and non-blockers.

[0043] Figures 19A-19B show representative data for reformulated Fab clones of human IgG1 at 20 μg / mL that induced cell killing in an ADCC assay using PBMCs as effector cells and SUHL-1 cells as targets (Figure 19A). Starting at 10 μg / mL and with a 5-fold antibody dilution, several clones showed higher ADCC compared to 7G7B6 (Figure 19B). Detailed Implementation

[0044] This document provides antibodies that specifically bind to CD25. These antibodies may be human, chimeric, or humanized. Methods for using and preparing these antibodies are also provided. For example, these CD25 antibodies can be used to treat cancer, including administering the antibody or a pharmaceutical composition thereof to a subject in need. Methods for generating the CD25 antibodies described herein are also provided.

[0045] definition

[0046] Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Any methods and materials similar to or equivalent to those described herein may be used in the practice or testing of this invention, but exemplary methods and materials are described.

[0047] The headings provided herein are not intended to limit the various aspects or embodiments of the invention. Therefore, the terms defined below can be defined more fully by referring to the specification in its entirety.

[0048] The numerical range includes the numbers that define the range.

[0049] As used herein, the term antibody includes, but is not limited to, monoclonal antibodies, polyclonal antibodies, human antibodies, humanized antibodies, non-human antibodies, chimeric antibodies, monovalent antibodies, and antigen-binding fragments of antibodies (e.g., Fab fragments, Fab'2 fragments, or scFV). This document also provides antibody-drug conjugates, bispecific antibodies, and multispecific antibodies exhibiting specificity for CD25. Non-human antibodies (e.g., mouse antibodies) can be “humanized” using conventional techniques (e.g., by introducing changes in the frame region while preserving the mouse CDR).

[0050] The terms “polynucleotide” and “nucleic acid” are used interchangeably herein and refer to polymers of nucleotides of any length, which may be ribonucleotides or deoxyribonucleotides. The terms include, but are not limited to, single-stranded, double-stranded, or multi-stranded DNA or RNA; genomic DNA; cDNA; DNA-RNA hybrids; or polymers comprising purine and pyrimidine bases or other natural, chemically modified, or biochemically modified nucleotide bases, or non-natural or derived nucleotide bases. Unless expressly limited or otherwise stated, the terms cover nucleic acids containing known analogs of natural nucleotides and having similar binding properties, and metabolized in a manner similar to naturally occurring nucleotides.

[0051] When a nucleic acid or amino acid sequence is said to have a certain percentage of “sequence identity” or “identity” with another nucleic acid or amino acid sequence, or is a certain percentage “identical” to another nucleic acid or amino acid sequence, the percentage of bases or amino acids are the same and in the same relative position when the sequences are aligned and compared.

[0052] The terms “individual,” “subject,” and “patient” are used interchangeably herein and refer to any subject requiring treatment or therapy. The subject may be a mammalian subject. Mammal subjects include, for example, humans, non-human primates, rodents (e.g., rats, mice), rabbits (e.g., rabbits), ungulates (e.g., cattle, sheep, pigs, horses, goats, etc.). In some embodiments, the subject is a human. In some embodiments, the subject is a non-human primate. In some embodiments, the subject is a companion animal (e.g., a cat, a dog).

[0053] Antibody

[0054] This article presents antibodies that specifically bind to CD25. These antibodies are capable of binding to the CD25 antigen, either alone or by associating with other molecules on regulatory T cells to form a high-affinity IL-2 receptor.

[0055] In some implementations, the CD25 antibody is a humanized antibody that specifically binds to CD25.

[0056] In some embodiments, the CD25 antibody is a chimeric antibody, such as a mouse-human chimeric antibody, for example, an antibody containing a mouse variable domain and a human constant domain.

[0057] The CD25 antibody in this disclosure can be any of human IgA, IgD, IgE, IgG, or IgM antibodies. The IgA antibody can be IgA1 or IgA2 antibodies. The IgG antibody can be IgG1, IgG2, IgG2a, IgG2b, IgG3, or IgG4 antibodies. Combinations of any of these antibodies can also be prepared and used. In some embodiments, the constant region is of the IgG type, such as human IgG. In some embodiments, the constant region is of the IgG1 type, such as human IgG1.

[0058] In some embodiments, the CD25 antibody exhibits cross-reactivity with more than one species, such as binding specifically to human CD25 and non-human CD25, for example, binding specifically to human CD25 and cynomolgus monkey CD25.

[0059] The KD (affinity constant) of the antibodies provided herein ranges from about 10^-5 to about 10^-14 nM. In some embodiments, the KD of the antibodies provided herein ranges from about 10^-8 to about 10^-12 nM. In exemplary embodiments, the KD of the CD25 antibody is at least about 10^-5 nM, about 10^-6 nM, about 10^-7 nM, about 10^-8 nM, about 10^-9 nM, about 10^-10 nM, about 10^-11 nM, about 10^-12 nM, about 10^-13 nM, or even about 10^-14 nM.

[0060] The Kd (dissociation rate constant) of the antibodies provided in this article ranges from about 10^-2 to about 10^-6 1 / s.

[0061] In some embodiments, the CD25 antibody exhibits the same affinity (KD) for the CD25 antigen at physiological pH (approximately 7.4) and non-physiological pH. In some embodiments, the CD25 antibody exhibits the same dissociation rate (Kd) for the CD25 antigen at physiological pH (approximately 7.4) and non-physiological pH.

[0062] In some embodiments, the CD25 antibody exhibits different affinities (different KD) for the CD25 antigen at physiological pH (approximately 7.4) and non-physiological pH. In some embodiments, the CD25 antibody exhibits different dissociation rate constants (different Kd) for the CD25 antigen at physiological pH (approximately 7.4) and non-physiological pH.

[0063] In some embodiments, the CD25 antibody exhibits a lower affinity (higher KD) for the CD25 antigen at physiological pH (approximately 7.4) compared to pH levels below physiological pH (e.g., pH 7.3, 7.2, 7.1, 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1, or lower). In an exemplary embodiment, the antibody exhibits a higher affinity for the CD25 antigen at a pH of approximately 6.5 compared to the affinity at approximately 7.4. In some embodiments, such antibodies can be used to maintain or exhibit enhanced activity in acidic or hypoxic environments (e.g., tumor microenvironments).

[0064] In some embodiments, the antibody is a non-IL-2 blocking antibody (non-IL-2 blocker), meaning that the binding of the antibody to CD25 does not disrupt or prevent the binding of the IL-2 ligand to CD25 (IL-2α chain) and does not affect IL-2-mediated signal transduction, such as signal transduction via the IL-2 / JAK3 / STAT-5 signaling pathway. In some embodiments, the antibody does not disrupt the binding of the IL-2 ligand to CD25 (IL-2α chain) and binds to an epitope different from the epitope bound by the 7G7B6 antibody. In some embodiments, the antibody does not disrupt the binding of the IL-2 ligand to CD25 (IL-2α chain), but disrupts the trimerization of the β, γ, and α chains (CD25) of the IL-2 receptor.

[0065] In some embodiments, the antibody is an IL-2 blocking antibody (IL-2 blocker), for example, the antibody disrupts or prevents the binding of the IL-2 ligand to the α, β, and / or γ chains of the receptor, and reduces or inhibits IL-2-mediated signal transduction. In some embodiments, the antibody disrupts or prevents the binding of the IL-2 ligand to CD25. In some embodiments, the antibody disrupts or prevents the binding of the IL-2 ligand to CD25 and binds to an epitope different from the epitope bound by daclizumab or balithiumab.

[0066] In some embodiments, the CD25 antibody is a partial blocking antibody (partial IL-2 blocker) that partially but not completely disrupts the binding of the IL-2 ligand to the α chain (CD25), β chain, and / or γ chain of the IL-2 receptor, and / or partially but not completely reduces IL-2-mediated signal transduction.

[0067] In some embodiments, the CD25 antibody disrupts or prevents the heterotrimerization of α, β, and γ IL-2 chains. In some embodiments, the antibody does not block the binding of IL-2 ligands to CD25, but disrupts or prevents the heterotrimerization of α, β, and γ IL-2 chains. In some embodiments, the antibody selectively binds to regulatory T cells. In other embodiments, the antibody selectively binds to T effector cells.

[0068] In some implementations, the binding of the CD25 antibody leads to the depletion of regulatory T cells (Treg) while allowing the expansion of effector T cells (Teff).

[0069] In some embodiments, the antibody binds to CD25 in a trans orientation. In other embodiments, the antibody binds to CD25 in a cis orientation. In still other embodiments, the antibody can bind to CD25 in either a cis or trans configuration.

[0070] In some implementations, the CD25 antibody exhibits a greater binding affinity to CD25 compared to the binding of 7G7B6 (anti-human CD25 and mouse IgG2a Fc receptor; IL-2 non-blocker; BioXcell) to CD25.

[0071] Tables 1A-1L, 2A-2C, 3A-3C, 4A-4B, 5A-5B, 6 and 7, and Figures 3A, 3B, 4A, 4B, 5 and 6 provide exemplary sequences of the CD25 antibodies described herein. It should be noted that the complementarity-determining region (CDR) and frame (FR) sequences shown are based on the IMGT conventions for antibody annotation. However, those skilled in the art can determine other conjugations of the CDR and frame sequences based on the presented VH and VL sequences using other algorithms / conventions for antibody annotation, such as Kabat and Chothia. Therefore, the CDR and FR sequences of this disclosure are not limited to the exemplary CDR and FR sequences annotated in the tables below, but are the CDRs understood and determined by those skilled in the art in view of the sequence of the variable regions.

[0072] Table 1A-D5 VH Sequences

[0073]

[0074] Table 1B-D5 VL Sequences

[0075]

[0076]

[0077] Table 1 C-D11 VH Sequence

[0078]

[0079] Table 1D-D11 VL Sequences

[0080]

[0081]

[0082] Table 1 E-D16 VH Sequence

[0083]

[0084] Table 1F-D16 VL Sequence

[0085]

[0086]

[0087] Table 1 G-D17 VH sequence

[0088]

[0089] Table 1 H-D17 VL Sequences

[0090]

[0091]

[0092] Table 1 I-D34 VH Sequence

[0093]

[0094] Table 1 J-D34 VL Sequence

[0095]

[0096]

[0097] Table 1 K-D36 VH Sequence

[0098]

[0099] Table 1l-D36 VL Sequence

[0100]

[0101]

[0102] Table 2A Exemplary Cloned-Heavy Chain Sequences

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119] Table 2B Exemplary Cloned-Heavy Chain Sequences

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130] Table 2C Exemplary Cloned-Heavy Chain Sequences

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137] Table 3A Exemplary Clones - Light Chain Sequences

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154] Table 3B Exemplary Clones - Light Chain Sequences

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168] Table 3C Exemplary Clones - Light Chain Sequences

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175] Table 4A Exemplary Clonal-Heavy Chain Sequences

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

[0194]

[0195] Table 4B Exemplary Clones - Light Chain Sequences

[0196]

[0197]

[0198]

[0199]

[0200]

[0201]

[0202]

[0203]

[0204]

[0205]

[0206]

[0207]

[0208]

[0209]

[0210] Table 5A Exemplary Clonal-Heavy Chain Sequences

[0211]

[0212]

[0213]

[0214]

[0215]

[0216]

[0217]

[0218]

[0219] Table 5B Exemplary Clones - Light Chain Sequences

[0220]

[0221]

[0222]

[0223]

[0224] Table 6 - Heavy Chain CDR

[0225]

[0226]

[0227]

[0228]

[0229] Table 7 Light Chain CDR

[0230]

[0231]

[0232]

[0233]

[0234] In some embodiments, the CD25 antibody comprises the "VDJ region" heavy chain sequence presented in any of Tables 2A, 2B, and 2C, and the "VJ region" light chain sequence presented in any of Tables 3A, 3B, and 3C, in its humanized form, or an amino acid sequence containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with it. In some embodiments, the antibody comprises a heavy chain variable region sequence (or its humanized form) from a specific antibody clone named with its given "ID" and a light chain variable region sequence (e.g., a light chain from a clone identified with the same "ID") (or its humanized form). Thus, the origin of the antibody clone can be identified by the IDs shown in Tables 2A-2C or Tables 3A-3C. For example, in such embodiments, the CD25 antibody comprises a heavy chain variable region (or its humanized form) of antibody clone “AHH03760” as presented in row 1 of Table 2B and a light chain variable region (or its humanized form) of antibody clone “AHH03760” as presented in row 3 of Table 3B. In other embodiments, the CD25 antibody comprises a heavy chain variable region sequence (or its humanized form) from a specific antibody clone named with its given “ID” and a light chain variable region sequence (e.g., from the light chain of a clone identified with the same “ID”) (or its humanized form) from a different antibody clone.

[0235] In some embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 presented in any one of Tables 2A, 2B, and 2C, and CDRL1, CDRL2, and CDRL3 presented in any one of Tables 3A, 3B, and 3C. In such embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 from a specific antibody clone, and CDRL1, CDRL2, and CDRL3 from the same antibody clone. As discussed above, the origin of the antibody clone can be identified by the IDs shown in Tables 2A-2C or Tables 3A-3C.

[0236] In some embodiments, the CD25 antibody comprises the heavy chain variable region presented in Table 4A, its humanized form, or an amino acid sequence containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity therewith. The variable region may comprise consecutive HFR1, CDRH1, HFR2, CDRH2, HFR3, CDRH3, HRF4 sequences, in their humanized form, or amino acid sequences containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity therewith, for forming the complete variable region. In some embodiments, the CD25 antibody comprises the light chain variable region presented in Table 4B, its humanized form, or an amino acid sequence containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity therewith. The variable region may comprise consecutive LFR1, CDRL1, LFR2, CDRL2, LFR3, CDRL3, and LRF4 sequences for forming the complete variable region, in their humanized form, or amino acid sequences containing at least 80%, 85%, 90%, or 95% sequence identity. In some embodiments, the CD25 antibody comprises a complete heavy chain variable region as presented in Table 4A and a complete light chain variable region as presented in Table 4B, including their humanized form and amino acid sequences containing at least 80%, 85%, 90%, or 95% sequence identity. In some embodiments, the CD25 antibody comprises a heavy chain variable region sequence from a specific antibody clone and a light chain variable region sequence from the same antibody clone, including their humanized form and amino acid sequences containing at least 80%, 85%, 90%, or 95% sequence identity. In some embodiments, the CD25 antibody comprises a heavy chain variable region sequence from a specific antibody clone and a light chain variable region sequence from different antibody clones, including their humanized forms and amino acid sequences containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity. The origin of the antibody clone can be identified by the IDs shown in Tables 4A and 4B.

[0237] In some embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 as presented in Table 4A and CDRL1, CDRL2, and CDRL3 as presented in Table 4B. In some embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 from a specific antibody clone and CDRL1, CDRL2, and CDRL3 from the same antibody clone. In other embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 from a specific antibody clone and CDRL1, CDRL2, and CDRL3 from different antibody clones. As discussed above, the origin of the antibody clone can be identified by the IDs shown in Tables 4A and 4B.

[0238] In some embodiments, the CD25 antibody comprises the heavy chain variable region presented in Table 5A, including its humanized form and an amino acid sequence containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity. The variable region may comprise consecutive HFR1, CDRH1, HFR2, CDRH2, HFR3, CDRH3, and HRF4 sequences for forming the complete variable region, including their humanized forms and an amino acid sequence containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity. In some embodiments, the CD25 antibody comprises the light chain variable region presented in Table 5B, including its humanized form and an amino acid sequence containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity. The variable region may comprise consecutive LFR1, CDRL1, LFR2, CDRL2, LFR3, CDRL3, and LRF4 sequences for forming the complete variable region, including their humanized forms and amino acid sequences containing at least 80%, 85%, 90%, or 95% sequence identity. In some embodiments, the CD25 antibody comprises a complete heavy chain variable region as presented in Table 5A and a complete light chain variable region as presented in Table 5B, including their humanized forms and amino acid sequences containing at least 80%, 85%, 90%, or 95% sequence identity. In some embodiments, the CD25 antibody comprises a heavy chain variable region sequence from a specific antibody clone and a light chain variable region sequence from the same antibody clone, including their humanized forms and amino acid sequences containing at least 80%, 85%, 90%, or 95% sequence identity. In other embodiments, the CD25 antibody comprises a heavy chain variable region sequence from a specific antibody clone and a light chain variable region sequence from different antibody clones, including their humanized forms and amino acid sequences containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity. The origin of the antibody clone can be identified by the IDs shown in Tables 5A and 5B.

[0239] In some embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 as presented in Table 5A and CDRL1, CDRL2, and CDRL3 as presented in Table 5B. In some embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 from a specific antibody clone and CDRL1, CDRL2, and CDRL3 from the same antibody clone. In other embodiments, the CD25 antibody comprises CDRH1, CDRH2, and CDRH3 from a specific antibody clone and CDRL1, CDRL2, and CDRL3 from different antibody clones. As discussed above, the origin of the antibody clone can be identified by the IDs shown in Tables 5A and 5B.

[0240] The CD25 antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or Figures 3A, 3B, and 5, or an amino acid sequence containing at least 80%, 85%, 90%, or 95% sequence identity with it. In some embodiments, the CD25 antibody comprises the amino acid sequence of any one of the further humanized variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or Figures 3A, 3B, and 5.

[0241] The CD25 antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B, or Figures 4A, 4B, and 6, or an amino acid sequence containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with it. In some embodiments, the CD25 antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B, or Figures 4A, 4B, and 6, which have been further humanized using conventional techniques.

[0242] In some embodiments, the CD25 antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, and 5A or Figures 3A, 3B, and 5, in its humanized form, or containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with it; and the CD25 antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B or Figures 4A, 4B, and 6, in its humanized form, or containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with it.

[0243] In some embodiments, the VH of the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, or 5A, or as presented in Figures 3A, 3B, or 5. In some embodiments, the VH of the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 as presented in Table 6.

[0244] In some embodiments, the VL of the CD25 antibody comprises the amino acid sequences of CDRL1, CDRL2, and CDRL3 as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, or 5B, or as presented in Figures 4A, 4B, or 6. In some embodiments, the VL of the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 as presented in Table 7.

[0245] In some embodiments, the VH of the CD25 antibody contains the amino acid sequences of CDRH1, CDRH2, and CDRH3 as presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, or 5A, or as presented in Figures 3A, 3B, or 5; and the VL of the CD25 antibody contains the amino acid sequences of CDRL1, CDRL2, and CDRL3 as presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, or 5B, or as presented in Figures 4A, 4B, or 6. In some embodiments, the VH of the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 as presented in Table 6, and the VL of the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, and CDRH3 as presented in Table 7.

[0246] In some embodiments, the VH of the antibody comprises the CDR1, CDR2, and CDR3 amino acid sequences presented in Table 5A. In some embodiments, the VL of the antibody comprises the CDR1, CDR2, and CDR3 amino acid sequences presented in Table 5B. In some embodiments, the antibody comprises VH and VL, wherein the VH comprises the CDR1, CDR2, and CDR3 amino acid sequences presented in Table 5A, and the VL comprises the CDR1, CDR2, and CDR3 amino acid sequences presented in Table 5B.

[0247] In some embodiments, the antibody comprises the D5 CDR1, CDR2 and CDR3 amino acid sequences, the D5 VH and D5 VL amino acid sequences presented in Tables 1A and 1B, or humanized forms of the D5 VH and D5 VL amino acid sequences presented in Tables 1A and 1B.

[0248] In some embodiments, the antibody comprises the amino acid sequences D11 CDR1, CDR2 and CDR3, the amino acid sequences D11 VH and D11 VL presented in Tables 1C and 1D, or humanized forms of the amino acid sequences D11 VH and D11 VL presented in Tables 1C and 1D.

[0249] In some embodiments, the antibody comprises the amino acid sequences D16 CDR1, CDR2 and CDR3, the amino acid sequences D16 VH and D16 VL presented in Tables 1E and 1F, or humanized forms of the amino acid sequences D16 VH and D16 VL presented in Tables 1E and 1F.

[0250] In some embodiments, the antibody comprises the amino acid sequences D17 CDR1, CDR2 and CDR3, the amino acid sequences D17 VH and D17 VL presented in Tables 1G and 1H, or humanized forms of the amino acid sequences D17 VH and D17 VL presented in Tables 1G and 1H.

[0251] In some embodiments, the antibody comprises the amino acid sequences D34 CDR1, CDR2 and CDR3, the amino acid sequences D34 VH and D34 VL presented in Tables 1I and 1J, or humanized forms of the amino acid sequences D34 VH and D34 VL presented in Tables 1I and 1J.

[0252] In some embodiments, the antibody comprises the amino acid sequences D36 CDR1, CDR2 and CDR3, the amino acid sequences D36 VH and D36 VL presented in Tables 1K and 1L, or humanized forms of the amino acid sequences D36 VH and D36 VL presented in Tables 1K and 1L.

[0253] In some embodiments, the CD25 antibody comprises AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, and AH05286 as presented in Table 5A. The CDRH1, CDRH2, and CDRH3 amino acid sequences of any one of the clones AH4501, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2P1D1.

[0254] In some embodiments, the CD25 antibody comprises AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, and AH05286 as presented in Table 5B. The CDRL1, CDRL2, and CDRL3 amino acid sequences of any one of the clones AH4501, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2P1D1.

[0255] In some embodiments, the CD25 antibody comprises AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, and AH05246 presented in Table 5A. 86. The CDRH1, CDRH2, and CDRH3 amino groups of any one of the clones AH4501, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2P1D1. Acid sequence; and the CD25 antibody comprises AH04507, AH04522, AH04526, AH04527, AH04734, AH04750, AH05214, AH05247, AH05249, AH05251, AH05256, AH05257, AH05258, AH05259, AH05268, AH05271, AH05274, AH05280, AH05285, AH05286, A... as presented in Table 5B. The CDRL1, CDRL2, and CDRL3 amino acid sequences of any one of the clones H4501, AH4502, AH4503, AH4505, AH4509, AH4511, AH4518, AH4523, AH4524, AH4525, D11, D17, D34, D36, D5, BP003-T2P1C4, BP003-T2P1D10, BP003-T2P1D7, BP003-T2P1E3, or BP003-T2P1D1.

[0256] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 of AH04507 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0257] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH04522 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0258] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH04526 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0259] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH04527 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0260] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH04734 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0261] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH04750 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0262] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 of AH05214 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0263] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05247 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0264] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05249 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0265] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05251 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0266] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05256 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0267] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05257 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0268] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05258 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0269] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05259 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0270] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05268 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0271] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05271 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0272] In some embodiments, the CD25 antibody comprises the amino acid sequences CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05274 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0273] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05280 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0274] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05285 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0275] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH05286 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0276] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4501 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0277] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4502 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0278] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4503 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0279] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4505 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0280] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4509 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0281] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4511 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0282] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 of AH4518 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0283] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4523 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0284] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4524 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0285] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of AH4525 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0286] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of D11 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0287] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 of D17 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0288] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of D34 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0289] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 of D36 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0290] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 of D5 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0291] In some embodiments, the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 of BP003-T2P1C4 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0292] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 amino acid sequences of BP003-T2P1D10 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0293] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 amino acid sequences of BP003-T2P1D7 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0294] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 amino acid sequences of BP003-T2P1E3 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0295] In some embodiments, the CD25 antibody comprises the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3 amino acid sequences of BP003-T2P1D1 (presented in Tables 5A and 5B, respectively); in some embodiments, the CD25 antibody is a humanized antibody.

[0296] In some implementations, the CD25 antibody is conjugated for a variety of purposes, including but not limited to treatment and detection / diagnosis.

[0297] This document also provides nucleic acid sequences encoding any CD25 antibodies provided herein. Exemplary nucleic acid sequences encoding the D5, D11, D16, D17, D34, and D36 VH and VL regions are provided in Tables 1A-1L, which can be used in their humanized forms. This document also provides vectors containing any nucleic acid encoding the antibodies described herein, phages containing such vectors, and host cells containing such vectors.

[0298] Antibody production and testing

[0299] Figure 2 is an exemplary non-limiting workflow for CD25 antibody discovery, in vitro testing, and in vivo testing, but those skilled in the art will recognize that alternative methods exist for antibody discovery and testing.

[0300] The CD25 antibodies described herein can be generated by injecting a complete or partial CD25 immunogen into animals (e.g., mice or rabbits). CD25 immunogen-positive B cells from the animals can be collected and used to generate a phage library. In some embodiments, the phage expresses a Fab fragment of a candidate CD25 antibody. The phage can undergo multiple rounds of screening (referred to herein as phage panning), such as screening against successively decreasing concentrations of the CD25 antigen, to select Fab fragments capable of binding CD25 with high affinity. For example, phages can be screened against CD25 antigen-coated beads or, for example, some other substrate. In some embodiments, the screening is performed at a physiological pH (e.g., about pH 7.4). In other embodiments, the screening is performed at a lower pH, such as about pH 6.5, to screen for Fab fragments capable of binding the CD25 antigen at lower pH, for example, for use in therapeutic environments, such as for use in hypoxic, acidic tumor microenvironments.

[0301] The efficacy of the CD25 antibody presented in this paper can be tested using a variety of in vitro, in vivo, ex vivo, and / or cell-based assays.

[0302] In some embodiments, the ability of the CD25 antibody described herein to deplete regulatory T cells can be measured and further selected accordingly. In a particular embodiment, the ability of the CD25 antibody described herein to deplete regulatory T cells in an acidic environment (e.g., at pH levels below physiological pH, such as pH 7.3, 7.2, 7.1, 7.0, 6.9, 6.8, 6.7, 6.6, 6.5, 6.4, 6.3, 6.2, 6.1 or lower) can be measured and further selected accordingly.

[0303] In some implementations, the CD25 antibody described herein can be measured and further selected based on an in vitro pSTAT5 assay, which measures signaling via the IL-2 / IL-2 receptor pathway, and its maintenance indicates that the antibody is not an IL-2 blocking antibody.

[0304] In some implementations, the CD25 antibody described herein can be measured for use in biosensor screening to characterize molecular interactions.

[0305] In some implementations, the CD25 antibody described herein can be measured in response to binding competition with other known CD25 antibodies using a known mechanism.

[0306] In some implementations, the epitope specificity of the CD25 antibody described herein can be determined.

[0307] In some implementations, the ability of the CD25 antibody described herein to act as a non-IL-2 blocker, an IL-2 blocker, or a partial IL-2 blocker can be determined.

[0308] Therapeutic uses

[0309] This article provides CD25 antibodies for therapeutic purposes (e.g., for proliferative disorders or disorders such as cancer or for autoimmune diseases).

[0310] Therefore, this document provides a method for treating cancer, the method comprising administering a therapeutically effective amount of a therapeutic CD25 antibody to a subject in need. In some embodiments, the cancer is a primary cancer. In some embodiments, the cancer is a metastatic cancer. In some embodiments, the cancer involves a solid tumor; in other embodiments, the cancer involves a liquid tumor, such as a blood-based cancer. In an exemplary embodiment, the CD25 antibody is a non-IL-2 blocking antibody.

[0311] Therefore, this document provides a method for treating autoimmune-related diseases or disorders, the method comprising administering a therapeutically effective amount of a therapeutic CD25 antibody to a subject in need. In an exemplary embodiment, the CD25 antibody is an IL-2 blocking antibody.

[0312] As used in this article, a subject refers to any animal classified as a mammal, including humans, livestock and farm animals, as well as zoo, sport, or pet animals such as dogs, horses, rabbits, cattle, pigs, hamsters, gerbils, mice, ferrets, rats, cats, etc. Subjects can be male or female.

[0313] The administration of any therapeutic CD25 antibody described herein may be combined with other known drugs / therapies (e.g., small molecule drugs or biologics). The administration may be sequential or concurrent.

[0314] The therapeutic CD25 antibody described herein can be administered in vivo via intravenous, intratumoral, intracranial, intralesional (e.g., intralesional injection, direct contact diffusion), intracavitary (intraperitoneal, intrapleural, intrauterine, rectal), intraperitoneal, intramuscular, subcutaneous, local, oral, percutaneous, implantation, inhalation, intrathecal, intraventricular, or intranasal administration. In an exemplary embodiment, the administration route is intravenous injection.

[0315] A therapeutically effective dose of the therapeutic antibody will be administered. The appropriate dose of the therapeutic antibody may be determined based on the severity of the cancer, the subject's clinical condition, the subject's clinical history and response to treatment, and the judgment of the attending physician.

[0316] Depending on the route of administration, the dosage of the CD25 antibody provided herein can vary from approximately 1 ng / kg daily up to approximately 1000 mg / kg of the subject's body weight or more. To allow for repeated administration over several days or longer, treatment may continue until the desired symptom suppression is achieved, depending on the severity of the cancer. Dosing regimens are also available depending on the pattern of pharmacokinetic decay desired by the physician. For example, this document provides dosing to individuals one to twenty times per week. In some embodiments, dosing frequencies are three times daily, twice daily, once daily, every other day, once weekly, once every two weeks, once every four weeks, once every five weeks, once every six weeks, once every seven weeks, once every eight weeks, once every nine weeks, once every ten weeks, or once monthly, once every two months, once every three months, or longer. Progression of the therapy can be monitored using routine techniques and assays. The dosing regimen may vary over time regardless of the dosage used.

[0317] Diagnostic uses

[0318] The CD25 antibodies described in this article can be used for diagnostic and detection purposes. Depending on the application, CD25 antibodies can be detected and quantified in vivo or in vitro.

[0319] The CD25 antibody provided in this article can be used in a variety of immunoassays. These immunoassays include, but are not limited to, enzyme-linked immunosorbent assay (ELISA), Western blotting, radioimmunoassay (RIA), flow cytometry, radioimmunoassay, immunofluorescence assay, spectrophotometry, radiography, electrophoresis, high-performance liquid chromatography (HPLC), or thin-layer chromatography (TLC).

[0320] The CD25 antibodies provided herein may contain detectable markers, such as those detectable by spectroscopic, photochemical, biochemical, immunochemical, fluorescent, electrochemical, optical, or chemical methods. Markers useful in this disclosure include, but are not limited to, fluorescent dyes, radioactive markers, enzymes, colorimetric markers, avidin, or biotin.

[0321] In some embodiments, the CD25 antibody is radiolabeled with an isotope that can be used for imaging with nuclear medicine equipment (SPECT, PET, or scintillation).

[0322] Pharmaceutical Composition

[0323] This disclosure provides compositions comprising a therapeutic CD25 antibody, and in some embodiments, the composition is sterile. The pharmaceutical compositions typically comprise an effective amount of the therapeutic antibody in a pharmaceutically acceptable excipient.

[0324] reagent kits and products

[0325] This disclosure also provides kits containing any of the CD25 antibodies described herein, for example, for therapeutic or diagnostic purposes. In some embodiments, the kit further contains components selected from any of the following: secondary antibodies, reagents for immunohistochemical analysis, pharmaceutically acceptable excipients, and instructions for use, and any combination thereof. In some embodiments, the kit contains one or more of the therapeutic compositions described herein, and one or more pharmaceutically acceptable excipients.

[0326] This application also provides articles comprising any of the therapeutic or diagnostic compositions or kits described herein. Examples of articles include vials (e.g., sealed vials).

[0327] The description provided herein illustrates many exemplary configurations, methods, parameters, etc. However, it should be understood that such description is not intended to be a limitation on the scope of this disclosure, but is intended to be provided as a description of exemplary embodiments.

[0328] The following examples are included for illustrative purposes and are not intended to limit the scope of the invention.

[0329] List of implementation plans

[0330] Implementation Scheme 1. A monoclonal CD25 antibody that binds to human CD25 and has at least one of the following characteristics:

[0331] a. The antibody does not disrupt the binding of the IL-2 ligand to the α chain (CD25) of the IL-2 receptor, and binds to an epitope different from the epitope bound by 7G7B6;

[0332] b. The antibody does not disrupt the binding of the IL-2 ligand to the α chain (CD25) of the IL-2 receptor, but disrupts the trimerization of the β chain, γ chain and α chain (CD25) of the IL-2 receptor;

[0333] c. The antibody disrupts the binding of the IL-2 ligand to the α chain (CD25), β chain and / or γ chain of the IL-2 receptor, and binds to an epitope that is different from the epitope bound by dalizumab or baliximab.

[0334] d. The antibody exhibits a higher affinity for CD25 at pH below 7.4 compared to its affinity for binding to CD25 at pH 7.4;

[0335] e. The antibody comprises the amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A and 5A or Figures 3A, 3B and 5, its humanized form, or an amino acid sequence containing at least 80%, at least 85%, at least 90% or at least 95% sequence identity with it;

[0336] f. The antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, and 5B or Figures 4A, 4B, and 6, in its humanized form, or an amino acid sequence containing at least 80%, at least 85%, at least 90%, or at least 95% sequence identity with it.

[0337] g. The VH of the antibody comprises any one of the amino acid sequences of CDRH1, CDRH2 and CDRH3 contained in the sequences presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A, 5A and 6 or in Figures 3A, 3B and 5.

[0338] h. The VL of the CD25 antibody comprises any one of the amino acid sequences of CDRL1, CDRL2, and CDRL3 contained in the sequences presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B, 5B, and 7, or in the sequences presented in Figures 4A, 4B, and 6; and

[0339] i. The antibody comprises the amino acid sequences of CDRH1, CDRH2 and CDRH3 of any one of the combinations presented in Table 6 and the amino acid sequences of CDRL1, CDRL2 and CDRL3 of any one of the combinations presented in Table 7.

[0340] Implementation Scheme 2. The antibody according to Implementation Scheme 1, wherein the antibody has at least two, at least three, at least four, at least five, or at least six of the features provided herein.

[0341] Implementation Scheme 3. The antibody according to Implementation Scheme 1, wherein the antibody does not disrupt the binding of the IL-2 ligand to the α chain (CD25) of the IL-2 receptor, and binds to an epitope different from the epitope bound by 7G7B6.

[0342] Implementation Scheme 4. The antibody according to Implementation Scheme 1, wherein the antibody does not disrupt the binding of the IL-2 ligand to the α chain (CD25) of the IL-2 receptor, but disrupts the trimerization of the β chain, γ chain and α chain (CD25) of the IL-2 receptor.

[0343] Implementation Scheme 5. The antibody according to Implementation Scheme 1, wherein the antibody disrupts the binding of the IL-2 ligand to the IL-2 receptor and binds to an epitope different from the epitope bound by dalizumab or baliximab.

[0344] Implementation Scheme 6. The antibody according to Implementation Scheme 1, wherein the antibody exhibits a higher affinity for binding to CD25 at a pH below 7.4 compared to the affinity for binding to CD25 at a pH of 7.4.

[0345] Implementation Scheme 7. The antibody according to Implementation Scheme 6, wherein the antibody exhibits a higher affinity for binding to CD25 at a pH of approximately 6.5.

[0346] Implementation Scheme 8. An antibody according to any one of Implementation Schemes 1 to 7, wherein the antibody comprises an amino acid sequence of any one of the variable heavy chains presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A and 5A or Figures 3A, 3B and 5, its humanized form, or an amino acid sequence containing at least 80%, at least 85%, at least 90% or at least 95% sequence identity with it.

[0347] Implementation Scheme 9. An antibody according to any one of Implementation Schemes 1 to 8, wherein the antibody comprises the amino acid sequence of any one of the variable light chains presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B and 5B or Figures 4A, 4B and 6, its humanized form, or an amino acid sequence containing at least 80%, at least 85%, at least 90% or at least 95% sequence identity with it.

[0348] Implementation Scheme 10. An antibody according to any one of Implementation Schemes 1 to 7, wherein the VH of the antibody comprises the amino acid sequences of CDRH1, CDRH2 and CDRH3 contained in the sequences presented in Tables 1A, 1C, 1E, 1G, 1I, 1K, 2A, 2B, 2C, 4A or 5A or in Figures 3A, 3B or 5.

[0349] Implementation Scheme 11. An antibody according to any one of Implementation Schemes 1 to 7 and Implementation Scheme 10, wherein the VL of the CD25 antibody comprises the amino acid sequences of CDRL1, CDRL2 and CDRL3 contained in the sequences presented in Tables 1B, 1D, 1F, 1H, 1J, 1L, 3A, 3B, 3C, 4B or 5B or in Figures 4A, 4B or 6.

[0350] Implementation Scheme 12. An antibody according to any one of Implementation Schemes 1 to 10, wherein the CD25 antibody comprises the amino acid sequences of CDRH1, CDRH2 and CDRH3 of any one of the combinations presented in Table 6.

[0351] Implementation Scheme 13. An antibody according to any one of Implementation Schemes 1 to 10, wherein the CD25 antibody comprises the amino acid sequences of CDRL1, CDRL2 and CDRL3 of any one of the combinations presented in Table 7.

[0352] Implementation Scheme 14. An antibody according to any one of Implementation Schemes 1 to 13, wherein the antibody is a human antibody.

[0353] Implementation Scheme 15. An antibody according to any one of Implementation Schemes 1 to 13, wherein the antibody is a humanized antibody.

[0354] Implementation Scheme 16. An antibody according to any one of Implementation Schemes 1 to 13, wherein the antibody is a chimeric antibody.

[0355] Implementation Scheme 17. The antibody according to Implementation Scheme 16, wherein the antibody comprises a mouse variable domain and a human constant domain.

[0356] Implementation Scheme 18. An antibody according to any one of Implementation Schemes 1 to 15, wherein the antibody is an antibody fragment.

[0357] Implementation Scheme 19. An antibody according to any one of Implementation Schemes 1 to 18, wherein the antibody further binds to cynomolgus monkey CD25.

[0358] Implementation Scheme 20. A pharmaceutical composition comprising any one of the antibodies described in Implementation Schemes 1 to 19.

[0359] Implementation Scheme 21. A nucleic acid sequence encoding any one of the antibodies described in Implementation Schemes 1 to 19.

[0360] Implementation Scheme 22. A vector comprising the nucleic acid sequence according to Implementation Scheme 21.

[0361] Implementation Scheme 23. A bacteriophage expressing any one of the antibodies described in Implementation Schemes 1 to 19.

[0362] Implementation Scheme 24. A method of treating a subject in need, the method comprising administering to the subject a therapeutically effective amount of any one of the antibodies described in Implementation Schemes 1 to 19 or a pharmaceutical composition described in Implementation Scheme 20.

[0363] Implementation Scheme 25. A method for depleting the number of regulatory T cells in a subject, the method comprising administering to the subject a therapeutically effective amount of any one of the antibodies described in Implementation Schemes 1 to 19 or a pharmaceutical composition described in Implementation Scheme 20.

[0364] Implementation Scheme 26. The method according to Implementation Scheme 24 or 25, wherein the subject has cancer.

[0365] Implementation Scheme 27. The method according to Implementation Scheme 24 or 25, wherein the subject suffers from an autoimmune-related disease or disorder.

[0366] Implementation Scheme 28. A method for depleting the number of regulatory T cells in a sample containing peripheral blood mononuclear cells, the method comprising contacting the sample with any one of the antibodies described according to Implementation Schemes 1 to 19.

[0367] Implementation Scheme 29. A kit comprising any one of the antibodies described in Implementation Schemes 1 to 19 or the pharmaceutical composition described in Implementation Scheme 20.

[0368] Example

[0369] Example 1: Immunization with CD25

[0370] The full-length CD25 conjugated with KLH was injected into five different BalbC mice. All injections were administered via the tail vein. The immunization regimen is as follows:

[0371] – Day 0: Immunization 1

[0372] – Day 14: Immunity 2

[0373] –Day 28: Immunity 3

[0374] –Day 35: Blood draw

[0375] Spleen cells and leukocytes from four of five mice were used to generate four phage libraries. These phage libraries contained phages expressing antigen-binding (Fab) fragments. More specifically, M13 phage-particle libraries were constructed using materials from immunized animals as follows: (i) Total RNA was extracted from leukocytes and spleen cells; (ii) the VH and VL genes were amplified using specific primers; and (iii) the VH and VL fragments were inserted into GenScript's M13 phage-particle vector via a two-step cloning process. The libraries were >2 x 10^8 in size; had an insertion rate >90%; and an in-frame rate >80%. The libraries were highly diverse and contained >95% unique sequences.

[0376] Example 2: Phage panning targeting CD25 binding

[0377] Three rounds of phage panning were performed on the Fab-containing phage library using an ELISA-based assay. Phages were screened on CD25-coated beads. Each round was performed with a gradually decreasing CD25 concentration. Individual phage clones were expressed in *E. coli* TG1 cells (plated with LB / carbenicillin). Single colonies were incubated in 0.4 ml of 2YT broth at 37°C for 30 min, followed by infection with M13 K07 helper phage at 37°C for 3 h. Then, 50 μg / ml carbenicillin and 10 μg / ml kanamycin were added to the culture, and the culture was incubated overnight at 25°C. Phages were harvested from the culture the following day.

[0378] The following steps were performed to sequence positive clones. Positive clones were cultured overnight, and plasmid DNA was prepared using the Qiagen plasmid small-scale preparation kit. The purified plasmids were submitted to Genewiz and ELIM Biopharmaceuticals for Sanger sequencing. The VH sequence was obtained using sequencing primers (ACGCCTGCGAAGTCACCCAT) or (AGAAACACAAAGTCTACGCCTGCGAAGTCAC). The VL sequence was obtained using sequencing primers (AGCGGATAACAATTTCACACAGGA) or CGGATAACAATTTCACACAG.

[0379] Figures 3A, 3B, 4A, and 4B, and Tables 2A, 2B, 3A, and 3B show the VH and VL sequences of Fab selected after the second round of selection.

[0380] Figures 5 and 6, as well as Tables 2C and 3C, show the VH and VL sequences of Fab selected after the third round of screening.

[0381] Tables 4A, 4B, 5A, and 5B show additional clones following a similar selection scheme.

[0382] Further pH-based phage screening was conducted.

[0383] Example 3: Phage panning targeting CD25 binding at pH 6.5

[0384] Further phage screening was conducted to select Fab candidates that bind CD25 in a lower pH range, thereby selecting conjugates that can bind, for example, in a hypoxic acidic tumor microenvironment.

[0385] Four mouse HuCD25-immunized phage libraries (7807, 7808, 7809, 7810) were transformed by electroporation in TG1 and phages propagated by adding CM13 using a standard phage display protocol (Barbas et al., 2001). After incubation on ice for one hour, the TG1 cultures secreting the phages were PEG-precipitated with PEG / NaCl.

[0386] Phage libraries (7807, 7808, 7809, 7810) were used for pH-specific selection using standard protocols. To deplete antibodies binding with high affinity at physiological pH, negative panning was first performed at pH 7.4 using 3 x 10^11 pfu phages (expressed as 1000 times 10^8) via adsorption for 1 hour on ELISA plates coated with 10 μg / ml full-length CD25 (400 nM) in PBST (pH 7.4). The resulting phage supernatant was collected, and the pH was adjusted to 6.5 with PBST. Subsequent phage panning was performed at pH 6.5.

[0387] After 1 hour of incubation, pre-clean the panning selects with 25 μL of streptavidin-dynabeads (containing no CD25 antigen). Then, add the phage to new, pre-blocked Eppendorf LoBind tubes. Add biotinylated full-length CD25 antigen at a concentration of 100 nM for one hour. Incubate the sample with 25 μL of streptavidin beads at room temperature for one hour. Precipitate the sample and wash 7–9 times with PBST using a magnet / bead. Replace the tube twice to remove residual phage.

[0388] To elute the phages, 800 μL of glycine (pH 2.2) was added to the beads and incubated for no more than ten minutes. They were then neutralized with high pH Tris 9.0. The eluted phages were added to 1 ml of freshly grown TG1 (OD600 approximately 0.5) and incubated for 20–30 minutes. A partial log-dilute series was plated, and the remainder was transferred to 25 ml of 2x YT (2x yeast tryptone broth). These steps were repeated twice more, for a total of three rounds of panning, followed by phage ELISA and Octet screening of the periplasmic extract.

[0389] sequencing

[0390] Positive clones were cultured overnight, and plasmid DNA was prepared using the Qiagen plasmid small-scale preparation kit. The purified plasmids were submitted to Genewiz and ELIM Biopharmaceuticals for Sanger sequencing. The VH sequence was obtained using sequencing primers (ACGCCTGCGAAGTCACCCAT) or (AGAAACACAAAGTCTACGCCTGCGAAGTCAC). The VL sequence was obtained using sequencing primers (AGCGGATAACAATTTCACACAGGA) or (CGGATAACAATTTCACACAG). The VH and VL VDJ alignments, nucleic acid alignments, and amino acid alignments were identified using IMGT HighV-Quest.

[0391] The sequences of the selected Fab clones D5, D11, D16, D17, D34 and D36 are presented in Tables 1A-1L.

[0392] Example 4: Phage ELISA protocol and biosensor / Octet screening

[0393] ELISA / Extract Preparation

[0394] The preparation of phage ELISA for evaluating CD25 binding to Fab phage and periplasmic extracts for Fab Octet screening were performed substantially as described, with modifications documented (Schwimmer et al., 2013).

[0395] The CD25 antigen was diluted in PBS (pH 7.4). For each well of the 96-well plate to be coated, 50 μL of antigen solution containing 1 μg of CD25 was prepared. 50 μL of antigen solution was added to the ELISA plate wells and incubated overnight at 4°C. After incubation, the wells were washed twice with PBS and blocked by adding 200 μL of 1 x PBST 2.0% BSA, and incubated at 25°C for 2 hours. The phage was diluted two-fold in 1 x PBST 1.0% BSA (pH 6.5). 50 μL was added to each well and incubated at room temperature for 5 minutes. The blocking solution was shaken out of the wells, and 50 μL of the diluted phage preparation was added to each well, and incubated at room temperature for 1 hour. The ELISA plate wells were washed 3–5 times with 200 μL of PBST (pH 6.5). Dilute the HRP-conjugated anti-M13 antibody (Abcam, ab50370) 1:5000 with 1 x PBST 1.0% BSA (pH 6.5). Add 50 μL of the diluted secondary antibody conjugate to each well and incubate at room temperature for 1 hour. Wash the ELISA plate wells 3–5 times with 200 μL PBST (pH 6.5). Prepare ECL Lumo substrates (e.g., Supersignal ELISA Pico chemiluminescent substrates) as described in a 1:1 mixture. Add 50 μL of substrate solution to each well, incubate at room temperature for 5–60 minutes, and then read the results.

[0396] Inoculate colonies into 0.03-4 ml of 2xYT 0.2% glucose and 0.1 ml of overnight culture (1 ml culture in a 96-well plate or 4 ml culture in a 14 ml Falcon tube). Incubate them at 37°C at 250-700 rpm for 1.5-2 hours until the OD600 is approximately 0.5-1.0. Induce the culture with 50-400 μL of 0.025-0.1 M IPTG. In some cases, the temperature is lowered to 30°C with shaking at 250 rpm. Then incubate them overnight. The next day, harvest the culture by settling at 3400 rcf for 10-15 minutes. Discard the supernatant.

[0397] Resuspend the culture in 50-75 μL of PPB buffer (30 mM Tris-HCl (pH 8.0), 1 mM EDTA, 20% sucrose) containing 1x Halt protease inhibitor, and incubate on a shaking platform at room temperature for 15 min or at 4°C for 10 min. Resuspend the culture in 150-225 μL of cold ddH2O containing 1x Halt protease inhibitor, and incubate on a shaking platform at room temperature for 1 hour or at 4°C for 1-2 hours. Rotate the lysate suspension at 15000 rcf at 4°C for 10-15 min. Collect the supernatant and dilute it.

[0398] Fab Expression and Purification Protocol

[0399] Inoculate a single *E. coli* colony into a plate containing 0.03–0.5 mL of overnight culture in 50 μL of 2xYT 0.2% glucose or 50 mL of culture and allow it to grow. Incubate the culture at 37°C and 250–700 rpm for 1.5 h. Induce the culture with 50 μL of 25 mM–1 M IPTG. Lower the temperature to 30°C and reduce the rpm to 150. Incubation is performed overnight. Harvest 50 mL of culture or the plate by pelleting at 3400 rcf for 15 min. Discard the supernatant. Place the cell pellet from the 50 mL culture at -80°C for 1 h, while the culture grown in the plate is vortexed with 75 μL of PPB and 1xHalt protease inhibitor (Thermo Fisher Scientific) without EDTA. Shake the plate at 1000 rpm for 10 min at 4°C. Add 225 μL of cold water containing 1x Halt protease inhibitor (Thermo Fisher Scientific) without EDTA to each well. Mix the samples and shake at 1000 rpm at maximum speed for 1–2 hours at 4°C. Rotate the plate at 3500 rpm for 10 min at 4°C. Transfer the supernatant (PPE) to a new plate and store at -20°C. Remove the cell pellet from 50 mL of culture from the freezer and add 5 mL of PBS, 10 mM imidazole, 2.5 mg / mL lysozyme, and 1x Halt protease inhibitor (Thermo Fisher Scientific) without EDTA. Once the pellet is completely thawed / mixed, incubate them at room temperature for 30 min. Centrifuge the lysates at 3400 rcf for 15 min. Transfer the supernatant and discard the pellet. Add 500 μL of Ni-NTA resin (pre-washed and precipitated) or perform Fab purification using a Ni-NTA spinning column. Incubate the cleaned lysates for 30 min–1 h. Spin at 1500 rcf. Wash 5 times with 1 ml PBS and 10 mM imidazole. Discard the buffer after each spin. Add 1 ml PBS and 200 mM imidazole and mix, incubate for 30 minutes and spin at 1500 rcf for 15 minutes. After determining the protein concentration, store the eluted protein at 4°C or 20°C. Zeba columns are used for desalting / buffer replacement.

[0400] Octet / Biosensor Screening at Fab

[0401] For Octet Koff rate screening in the original supernatant, 50 μL of lysate was used in a 384-well Pall ForteBio Octet plate. Data collection was performed on an Octet RED 384 (MD ForteBio). Briefly, human CD25 (1 μg / mL) was ligated to the AR2G tip. For data collection, baseline was assessed in PBST 1% BSA buffer at pH 6.5 for 60 seconds. The tip was then moved to 50 μL of lysate (adjusted to pH 6.5) and association was measured for 300 seconds. Finally, the tip was moved to PBST 1% BSA buffer at pH 6.5. The tip was then regenerated with 200 mM Tris-glycine (pH 2.5) and neutralized with PBST, 1% BSA (pH 6.5). For data analysis, a dual reference (without CD25 on the tip and a blank reference well) was performed on Octet HT 11.0 software for reference subtraction.

[0402] Biosensor assays were performed to determine whether the selected Fab would block the binding of IL-2 to CD25.

[0403] Octet / Biosensor Screening of Human IgG1 Antibodies

[0404] A subset of the selected 40 Fabs was reformatted to contain human IgG1 (referred to herein as human IgG1 antibodies), and data from these were collected. The Fabs selected for reformatting are shown in Tables 5A (heavy chains) and 5B (light chains). Octet RED384 TM The Koff rate and affinity of different reformulated IgG1 antibodies were evaluated using a biolayer interferometer. Purified antibodies were covalently immobilized on an amine-reactive biosensor (…). The sensor was then immersed in run buffer (as a baseline), transferred to wells containing 300 nM full-length CD25, and then transferred back to run buffer. CD25 association and subsequent dissociation were recorded in duplicate. Run buffer-only association (with control sensor drift) and an additional sensor with immobilized IgG from human ND serum (with control nonspecific IgG binding) were used as controls. The observed association and dissociation rates were fitted using a 1:1 binding fit model, and the equilibrium binding constant (KD) was calculated.

[0405] Epitope binning of reformulated human IgG1 antibodies was performed using a classic sandwich assay involving baseline collection, immobilizing the sample antibody on a biosensor, capturing the antigen, and then incubating it with a competitive analyte. The competitive analyte could only bind to the captured CD25 if its binding epitope did not overlap with that of the immobilized antibody. The purified antibody was covalently immobilized on an amine-reactive biosensor (…). The sensor is loaded onto an AR2G plate, and excess reactive esters are blocked by ethanolamine. The sensor is immersed in a run buffer as a baseline, followed by a full-length CD25. The sensor is then transferred to wells containing a competing analyte (IL-2, 7G7B6, balithimab, dalithiazide) or a reference run buffer. If necessary, the sensor is regenerated by exposing it to 0.1M glycine (pH 2.0) for 10 seconds for 3 cycles, followed by a 10-second run buffer.

[0406] result

[0407] Figure 7 illustrates the identification of non-IL-2 blockers and IL-2 blockers (Fab) using a molecular-level cross-blocking assay. CD25 was coated onto the tip of a biosensor and brought into contact with the indicated Fab. IL2 was then added. The increase in signal transduction indicates that Fab and IL2 have different binding sites on CD25.

[0408] Table 8 shows that the tested Fab clones exhibited similar binding kinetics under physiological and acidic pH conditions.

[0409] Table 8

[0410]

[0411]

[0412] Figure 8 depicts the phage expression of the Fab of this disclosure competing with the IL-2 non-blocking antibody 7G7B6. The biosensor tip was coated with antibody 7G7B6 and first contacted with CD25, then with the indicated Fab or balithiumab (a known IL-2 blocking antibody). When 7G7B6 binds to CD25, clones D11, D34, and D36 do not bind. Clones D5, D16, and D17 bind but rapidly detach, indicating possible cross-blocking.

[0413] Figures 13A-13C show the kinetic analysis of Koff rate and affinity for reformulated human IgG1 antibody clones (Figure 13A). The KD values ​​of the antibodies ranged from 4.4E-10 to 8.4E-09, and the Koff values ​​ranged from 6.4E-05 to 1.9E-03. Compared with commercially available antibodies 7G7B6, dalizumab, and basilixumab (Kd values ​​of 2.6E-09, 4.5E-10, and 4.7E-10, respectively, and Koff rates of 2.3E-04, 1.1E-04, and 1.9E-04, respectively), several antibodies exhibited higher affinity (Figure 13B) and Koff values ​​(Figure 13C). In this analysis, clones BP003-T2P1D7, AH0580, AH05268, D36, D11, AH05259, BF003-T2P1D1, and D34 showed better Kd values ​​compared to 7G7B6; clones D17, AH04526, AH04750, AH05285, AH05256, and AH04527 showed better Kd values ​​compared to dalizumab and balithiba (Figure 13B). In this analysis, clones AH05256, AH04527, AH04526, AH05251, AH05285, AH05259, D17, and AH04750 showed better Koff rates compared to 7G7B6 (Figure 13C).

[0414] Figures 14A-14D show epitope grouping to evaluate the binding of reformulated human IgG1 Fab to epitopes that overlap with commercially available anti-human CD25 antibodies 7G7B6, dalizumab, balithiba, and IL-2. The blocking profiles of the clones are as follows: (Figure 14A) blocked by 7G7B6 but not by IL-2, dalizumab, or balithiba; (Figure 14B) blocked by IL-2, dalizumab, and balithiba but not by 7G7B6; (Figure 14C) blocked by 7G7B6 and dalizumab but not by balithiba; (Figure 14D) blocked by IL-2, dalizumab, and balithiba. These blocking profiles indicate that the antibodies bind to different epitopes from different proximity angles.

[0415] Further epitope localization of the functional epitope will be achieved via alanine mutagenesis. This method is used as an orthogonal approach for antibody grouping because it operates on the functional epitope rather than on the structural epitope defined by the competitive assay. Various surface-accessible residue pairs are selected for mutagenesis. Computational modeling is used to confirm that the alanine mutations selected for these assays do not affect overall or local stability.

[0416] Example 5: Combined measurement

[0417] Cell binding assay for CD25-specific binding of human IgG antibodies

[0418] To validate antibody binding to and specificity for CD25 on cells, three cell lines—SUDHL-1 and SUDHL-2 (human large-scale diffuse histiocytic lymphoma cell lines, ATCC) and HEK IL-2 reporter cells (Invivogen)—were used to test CD25 binding. SUDHL-1 and HEK IL-2 reporter cell lines are CD25+ cells, while SUDHL-2 is a CD25- cell line. For each cell line, 100,000 cells were seeded in 96-well round-bottom plates in cell buffer (PBS + 2% HI FBS) and centrifuged. Antibody concentrations of 1–10 μg / mL were used to test binding for each antibody. Cells were resuspended in 100 μL antibody / well and incubated on ice for 20 min. After incubation, cells were centrifuged at 300 x g for 5 min at room temperature, resuspended, and washed with ice-cold cell buffer. Cells were then stained with anti-human Fc secondary antibody conjugated to AF647 (Biolegend) and incubated in the dark on ice for 20 min. Cells were centrifuged, washed, and resuspended in cold cell buffer containing DAPI, and analyzed by flow cytometry (Cytoflex, Becton Dickinson). DAPI+ cells were excluded from the analysis. Mean fluorescence intensity was calculated using the median (FlowJo, TreeStar).

[0419] Recombinant CD25 cynomolgus monkey conjugate of human IgG1 clone

[0420] To test binding to recombinant cynomolgus monkey (cyno) CD25, microtiter plates were coated overnight at 4°C with 80 μL of 1 μg / mL Cyno CD25 in 50 mM sodium carbonate (pH 9.6). The next day, the protein was removed from the wells and blocked with 200 μL of PBS / 0.1% BSA / 0.05% Tween 20. The plates were incubated at room temperature for 1 hour. Human IgG1 reformatted Fab clone (human IgG1 antibody) was serially diluted 3-fold in PBT buffer, starting at 25 nM, and added to the plates and incubated at room temperature for 1 hour. The plates were then washed, followed by the addition of a 1:2500 dilution of HRP conjugate anti-Fab antibody. The plates were washed 5–10 times with PBS / Tween 20 to remove nonspecific conjugates. TMB peroxidase substrate and peroxidase solution were added, and the plates were incubated for the required time to develop with the final addition of 80 μL of ELISA stop solution. Then, an OD measurement was performed at 450 nM using a reader (SpectraMax iD3 reader, Molecular Devices).

[0421] Figures 15A-15B show the validated and specific binding of all antibody clones (10 μg / mL) to two CD25+ cell lines, SUDHL-1 and HEK cells, as well as the validated and non-binding on the CD25-SUDHL-2 cell line. Additionally, most antibodies bound similarly to the controls 7G7B6, dalizumab, and balithiba.

[0422] Figures 16A-16B show the dose-response curves of clones that bound to the SUDHL-1CD25+ cell line starting at 10 μg / mL and serially diluted 5-fold (Figure 16A). Most clones bound in a dose-dependent manner and had better EC50 values ​​compared to commercially available 7G7B6 (Figure 16B, Table 9), with clone names referring to those presented in the table above in this disclosure. Several clones in Table 9 showed better EC50 values ​​compared to 7G7B6.

[0423] Table 9

[0424]

[0425]

[0426] Figure 17 shows the dose-response curves for several clones that bind to recombinant cyno CD25. Dalizumab and balithimab were used as positive controls.

[0427] Example 6: pSTAT5 assay using primary cells

[0428] pSTAT5 assay for screening the biological activity of Fab clones on highly purified human regulatory T cells

[0429] The IL-2 / JAK3 / STAT-5 signaling pathway is involved in the survival and expansion of Tregs. This pathway initiates and maintains the expression of the transcription factor Foxp3 (crucial for the repressive activity of Tregs). When IL-2 binds to IL-2R, JAK proteins are activated; these are tyrosine kinases that bind to the cytoplasmic region of the IL-2 receptor. This initiates transphosphorylation at specific tyrosine residues, creating docking sites for the recruitment and phosphorylation of STAT proteins. The dimerized and phosphorylated STATs are then translocated to the nucleus to bind to specific DNA sequences, thereby regulating the transcription of several target genes in Tregs, such as Foxp3 and CD25.

[0430] In this embodiment, the function of selected Fabs when binding to CD25 on primary human regulatory T cells was evaluated. This assay allows for the determination of which are IL-2 blockers, non-blockers, and partial blockers, and their potency, based on pSTAT5 levels. Controls used for the assay included known IL-2 blockers (dalizumab) and IL-2 non-blockers (7G7B6). First, fresh PBMCs were isolated from the leukopenia system chamber (Stanford Blood Center). An equal volume of cell buffer (PBS + 2% HI FBS) was added to each blood sample and then to a Ficoll Paque filled with 50 mL SepMate conical tubes (StemCell Technologies), following standard protocols for PBMC isolation using SepMate tubes. To isolate human regulatory T cells from PBMCs, the EasySep Human CD4+CD127 Low CD25+ Regulatory T Cell Isolation Kit (Stem Cell Technologies) and the Regulatory Human CD4+CD25+ T Cell Kit (Dynabeads) were used. Each isolation kit protocol was designed for magnetic cell isolation. Treg isolation was confirmed by staining cells with anti-human CD4, CD25, and CD127 antibodies and intracellular Foxp3 staining (BD Biosciences). For pSTAT5 assay, 100,000 Tregs were plated in 96-well round-bottom plates and centrifuged. Antibody concentrations of 1–5 μg / mL were used. Tregs were resuspended in 50 μL of antibody per well and incubated at 37°C for 15 min. Next, IL-2 dilutions were prepared in cell culture medium, starting at 100 ng / mL and diluted 10-fold. IL-2 dilutions were added to wells at 50 μL / well and incubated at 37°C for 10 min. After incubation, the plates were centrifuged at 300 x g for 5 min at room temperature and resuspended in 100 μL / well of room temperature fixation buffer (BD Biosciences) and incubated at room temperature for 15 min. Cell rotation was slowed and cells were resuspended in cold cell buffer (PBS + 2% HIFBS). Cells were then resuspended in 100 μL / well of ice-cold permeabilization buffer (BD Biosciences) and incubated on ice for 15 minutes. Cells were washed with cell buffer and resuspended in 50 μL of prepared pSTAT5 antibody for flow cytometry analysis (Cytoflex, Becton Dickinson).

[0431] pSTAT5 assay for biological activity of antibody clones used in screening with HEK IL-2 reporter cells.

[0432] In this embodiment, the HEK IL-2 reporter cell line (Invivogen) was used to test clones. This cell line was generated by Invivogen to monitor activation of the JAK-STAT pathway via IL-2 binding. To obtain the fully active human IL-2 signaling pathway, a reporter cell line was generated by stably transfecting HEK293 cells with the human IL-2Rα, IL-2Rβ, and IL-2Rγ genes, as well as the JAK3 and STAT5 genes. This assay presents a high-throughput method for evaluating IL-2 physiology and characterization based on pSTAT5 levels in the presence of IL-2 with the addition of antibodies and competitors, using IL-2 blockers, non-blockers, and partial blockers. Controls used for the assay included known IL-2 blockers (dalizumab and balithimab) and a non-blocker of IL-2 (7G7B6). For the pSTAT5 assay, 100,000 cells were plated in 96-well round-bottom plates and centrifuged. Antibody concentrations of 1–5 μg / mL were used. HEK cells were resuspended in 50 μL antibody / well and incubated at 37°C for 15 min. Next, IL-2 dilutions were prepared in cell culture medium, starting at 10 ng / mL and diluted 10-fold. IL-2 dilutions were added to wells at 50 μL / well and incubated at 37°C for 10 min. After incubation, the plates were centrifuged at 300 x g for 5 min at room temperature and resuspended in 100 μL / well of room temperature fixation buffer (BD Biosciences) and incubated at room temperature for 15 min. Cell rotation was slowed and cells were resuspended in cold cell buffer (PBS + 2% HI FBS). Cells were then resuspended in 100 μL / well of ice-cold permeabilization buffer (BD Biosciences) and incubated on ice for 15 min. Cells were washed with cell buffer and resuspended in 50 μL of prepared pSTAT5 antibody for flow cytometry analysis (Cytoflex, Becton Dickinson). The percentage of pSTAT5+ cells was quantified based on the parental population, and the values ​​were normalized to IL-2 at a concentration of 10 ng / mL.

[0433] result

[0434] Figure 9 shows that pSTAT5 signaling is IL-2 dose-dependent and is inhibited by dalizumab (an IL-2 blocker). pSTAT5 levels are dose-dependent with higher IL-2 doses increasing pSTAT5 levels, while lower IL-2 levels produce lower pSTAT5 levels. Furthermore, when the anti-human IL-2 antibody dalizumab is added at a fixed concentration of 2 μg / mL, it inhibits the JAK / STAT5 signaling pathway, resulting in lower pSTAT5 levels.

[0435] Figures 10 and 11 show the D5 Fab assay in the pSTAT5 assay. The data in Figure 10 show that the pSTAT5 assay was able to distinguish the differences in D5 Fab activity at 1, 2, and 5 μg / mL compared to dalizumab and IL-2 alone. At different concentrations of D5, the level of pSTAT5 decreased in a dose-dependent manner, indicating that even at the lowest concentration of 1 μg / mL, D5 partially blocked the binding of IL-2 to IL-2R. Data are presented as raw MFI levels (mean fluorescence intensity) and by comparing the pSTAT5 level with the maximum pSTAT5 level produced by the highest dose of IL-2 (100 ng / mL) (Figure 11).

[0436] Figure 12 shows preliminary Fab screening data from one donor. This assay from one donor shows differences in pSTAT5 levels among several Fab clones at 1, 2, and 5 μg / mL compared to controls (IL-2 only, daclizumab (Dac, IL-2 blocker), and 7G7B6 (non-IL-2 blocker)). Some clones appear to be better IL-2 non-blockers than 7G7B6, while others are better IL-2 blockers than daclizumab. Complete IL-2 non-blockers are expected to have pSTAT5 levels similar to IL-2 and are not expected to be concentration-dependent. Data are presented as raw MFI levels (mean fluorescence intensity) and by comparing pSTAT5 levels relative to the maximum pSTAT5 levels produced by 7G7B6. Additionally, the data can be used to observe differences in IC50 potency values ​​of Fab clones (Table 10).

[0437] Table 10

[0438]

[0439] Subsequent assays will include Fab forms of dalizumab and 7G7B6, as well as testing the same Fab clones on multiple donors. Additionally, pSTAT5 assays will be performed at lower pH levels (pH 6.4–6.7) to generalize clonal activity at physiological pH levels relative to the pH of the tumor microenvironment.

[0440] Figures 18A-18B show the functional characterization of reformulated human IgG1 clones (at 5 μg / mL) as IL-2 blockers, non-blockers, and partial blockers, by measuring pSTAT5 in the HEK IL-2 reporter cell line, starting at 10 ng / mL and serially diluted 10-fold. At an IL-2 concentration of 0.1 ng / mL (closer to physiological levels), clones such as AH04503 and AH04750 are better IL-2 blockers than daclizumab or balithiba, while at 5 μg / mL, clones AH05280 and AH02571 can be better non-blockers of IL-2 than 7G7B6 (A). Clones AH05251 and AH05257 are examples of partial IL-2 blockers (Figure 18A). The IL-2 dose-response curves clearly depict the clones that act as non-blockers of IL-2 and those that act as blockers of IL-2, with 7G7B6 shifting the curve to the left and dalizumab and baliximab shifting the curve to the right, respectively (Figure 18B).

[0441] pSTAT5 studies can continue to test these antibody clones using primary Tregs and multiple donors.

[0442] Example 7: Antibody-dependent cytotoxicity (ADCC)

[0443] Functional cell killing assays ADCC and ADCP

[0444] One mechanism of Treg depletion is through antibody-dependent cytotoxicity (ADCC). This is a cell-mediated immune defense mechanism that typically leads to cell death triggered by the recognition of antibodies by immune / effective cells that bind to specific antigens on target cells. To initiate ADCC, antibodies with human Fc subclass IgG1 are typically selected for their effector function due to their ability to bind to three Fc receptors expressed on immune cells such as NK cells, monocytes, and granulocytes: FcγRI (CD64), FCγRII (CD32), and FcγRIIIA (CD16). NK cells primarily express FcγRIIIA and are considered the main effector cells in ADCC.

[0445] In this embodiment, ADCC was quantified using a colorimetric assay based on a lactate dehydrogenase (LDH) cytotoxicity plate (ThermoFisher). In this assay, LDH release is proportional to the amount of cell killing. Lactate dehydrogenase (LDH) is a cytoplasmic enzyme present in all cells and released when the plasma membrane is damaged. Extracellular LDH in the culture medium was quantified by a coupled enzymatic reaction in which LDH catalyzes the conversion of lactate to pyruvate via the reduction of NAD+ to NADH. By adding a flavoproteinase, NADH is reduced to tetrazolium salt (INT) to form a formazan product measurable at 490 nm. Controls for the assay included rituximab (an anti-CD20 antibody) on human Raji lymphoma cell lines and dalizumab (both antibodies are known to induce ADCC) on SUDHL-1 cells. Additional controls included non-glycosylated human IgG1 as a negative control and non-fucosylated human IgG1 as a positive control. As the initial screening, reformulated clones were tested in ADCC analysis at a concentration (10 μg / mL) using PBMCs from a single donor. Human PBMCs (ASTARTE Biologics) were thawed the day before and cultured overnight in X-VIVO 15 or 20 medium (Lonza) at 37°C in a 5% CO2 incubator. On the day of the experiment, PBMCs and SUDHL-1 target cells were counted and resuspended in serum-free X-VIVO 15 (Lonza, phenol red) medium. Antibody dilutions were prepared starting at 10 μg / mL and serially diluted 5-fold. Target cells were then plated at 50 μL / well in 96-well white flat-bottomed opaque plates (CORNING Ref #3917), and 10 μL / well of antibody dilution was added to the target cells. The plates were incubated at 37°C in a 5% CO2 incubator for 30 min. After incubation, PBMCs were added to the target cells (50 μL / well). For control target cells used in spontaneous and maximum LDH release calculations, 50 μL / well of assay medium (X-VIVO15, phenol red-free) was added. Co-incubation (ADCC induction) was performed by incubating the plates at 37°C and 5% CO2 for 4 h. 45 min before the end of co-incubation, 10% Triton X100 solution (in PBS) was added to the wells to calculate maximum LDH release (10 μL / well, 11x dilution factor). After incubation, 50 μL / well of reaction substrate was plated into 96-well plates (clear flat bottom), and then 50 μL / well of the supernatant from the assay plate was transferred to the reaction substrate. The plates were developed in the dark at room temperature for 30 min. After incubation, 50 μL / well of stop solution was added, and absorbance at 490 nm and 680 nm was measured using a plate reader (SpectraMax iD3 plate reader, Molecular Devices).

[0446] In addition, a functional antibody-dependent phagocytosis (ADCP) assay will be performed to test the activity of macrophages in phagocytizing Treg cells after antibody binding. This may be another mechanism of Treg depletion. The Fc receptor FCγRIIa (CD32b) on macrophages is considered a major inducer of ADCP. In this assay, primary Tregs will be used as target cells, and macrophages derived from human monocytes will be used as effector cells. PBMCs will be isolated from the leukopenia system chamber (Stanford Blood Center) for monocyte isolation using CD14 microbeads (Miltenyi Biotec), and Treg isolation will be performed using the Regulatory Human CD4+CD25+ T Cell Kit (Dynabeads) and the Human Treg Cell Differentiation Kit (R&D Systems). Monocytes will be cultured in medium with human serum or M-CSF for 5–7 days. On days 5–7, macrophages were co-cultured for 2–4 hours with pre-labeled Tregs (labeled with a fixable viability dye (Invitrogen)) at a 10:1 effector to target ratio, with the addition of anti-CD25 antibody and a control, and fixed with fixation buffer (BD Bioscienes). Macrophages were stained with CD14 to identify macrophages from the labeled Tregs, and phagocytic populations defined as CD14+ and Treg-labeled+ populations were analyzed using flow cytometry. Anti-CD25 antibody was also expected to induce ADCP.

[0447] result

[0448] Figures 19A-19B show the functional ADCC activity of all reformulated clones. In the initial screening, clones bound to CD25+ cells and induced ADCC, with cell killing ranging from 18.2% to 26.7% lysis (Raji cell killing was used as a reference; (Figure 19A)). To validate these findings, dose-response curves were repeated with the selected clones. The results showed that ADCC activity ranged from 2 to 6-fold relative to baseline lysis, with clones AH04511, AH05274, D11, D34, and D36 inducing the most potent ADCC and exhibiting greater potency than the 7G7B6 antibody, as measured by the fold change relative to background lysis percentage.

[0449] Subsequent studies will include additional donors of PBMCs and NK cells as effectors for functional ADCC killing assays.

[0450] Example 8: Functional characterization of CD25 antibody

[0451] In vitro characterization

[0452] Subsequent in vitro characterization will include T cell activation and Treg inhibition studies to evaluate the effect of CD25 antibody on T effector cell responses in the absence and presence of Treg cells. Readings for activation will include intracellular granzyme B, proliferation, and the release of cytokines (e.g., IL-2, IFNγ, TNF-α). Specifically, primary human T cells (T conv cells) from healthy donors and donors with specific antigen responses (e.g., human cytomegalovirus or influenza antigen) will be labeled with cell proliferation dyes (e.g., ThermoFisher) and treated with different concentrations of CD25 and control antibodies (1–10 μg / mL), followed by activation with CD3 / CD28 beads and incubation with and without Treg cells at 37°C and 5% CO2 for 48–72 hours. To evaluate T cell activation, supernatant was collected for cytokine analysis, and cells were stained with fixable viability dyes (e.g., Thermofisher) and surface anti-human T cell markers CD3, CD4, CD8, CD45RA, and CD25. Cells were then fixed and permeabilized to stain for intracellular granzyme B and Foxp3. Flow cytometry was used to analyze granzyme B-positive and proliferating cells.

[0453] In vivo characterization

[0454] In vivo activity of CD25 antibodies using a mouse xenograft tumor model. These experiments will help differentiate CD25 antibodies based on CD25+ tumor depletion via ADCC and / or ADCP. Candidate antibodies will be generated as mouse IgG2a isotype antibodies and used in immunodeficient RAG- / - knockout mice (with functional NK and APC cells, but no mature B or T lymphocytes). Animals will be subcutaneously implanted with CD25+ human cell lines (e.g., SUDHL-1, a CD25+ anaplastic large cell lymphoma). Tumors of various sizes (tactile, 100–500 mm3) can be used to differentiate between antibodies. Animals will be treated with different doses of CD25 antibodies (e.g., 1–10 mg / kg, three times a week or once a day), and changes in body weight and TGI will be monitored.

[0455] Drug efficacy and MOA study in humanized mice xenograft tumor models.

[0456] Efficacy and mechanism of action will be established by testing more potent antibodies that inhibit tumor growth through Treg depletion and increase intratumoral Teff / Treg ratio, as well as increased T effector cell activity, in various human tumor models (e.g., hepatocellular carcinoma, breast cancer, melanoma, gastric cancer, NSCLC, and colon cancer). Some studies may include the use of triple-negative breast cancer cell line MDA-MB-231, gastric cancer cell line, melanoma cell line A375, and hepatocellular carcinoma cell line Huh-7, as well as human PDX models, which have been well characterized and have shown an association between invasive Tregs and tumor growth, and / or have been treated with PD-1 antibody combinations in humanized mice implanted with human PBMCs and / or CD34+ cells. In these models, tumors will be subcutaneously implanted until they reach a size ranging from palpable to 100–500 mm3 and treated with various doses of CD25 antibodies and dosing schedules (e.g., 1–10 mg / kg, three times weekly or once daily). Animal health scores, body weight, tumor growth, and immunophenotypic analysis of blood and tumors will be performed using flow cytometry, Meso Scale Discovery multiplate, and histology to characterize tumor and immune cell composition, tumor-infiltrating cells, and cytokine secretion.

[0457] Combination studies of mouse xenograft tumor models in humanized mice. Following the identification of lead candidates and indications based on efficacy and MOA studies, we will conduct combination studies using a wide variety of agents to enhance immunogenicity and activation of other pathways for immune activation (e.g., chemotherapy, checkpoint inhibitors, TLR agonists, vaccines). Combination experiments will be conducted in similar tumor models used in the efficacy and MOA studies.

[0458] All patents, patent applications, publications, documents, web links and articles cited in this article are incorporated herein by reference in their entirety.

Claims

1. A monoclonal CD25 antibody that binds to human CD25 and has the following characteristics: The antibody does not disrupt the binding of the IL-2 ligand to the α chain of the IL-2 receptor, and binds to an epitope different from the epitope bound by 7G7B6. The complementarity-determining regions (CDRs) of the light chain are: CDRL1: QDISNY, CDRL2: NAK, and CDRL3: QHHYDTPYT; and the CDRs of the heavy chain are: CDRH1: GYTFTDYA, CDRH2: ISTYSGDA, and CDRH3: ARGVTFDY. The antibody also exhibits cross-reactivity with cynomolgus monkey CD25.

2. The antibody according to claim 1, wherein the antibody is a human antibody.

3. The antibody according to claim 1, wherein the antibody is a humanized antibody.

4. The antibody according to claim 1, wherein the antibody is a chimeric antibody.

5. The antibody according to claim 4, wherein the antibody comprises a mouse variable domain and a human constant domain.

6. The antibody according to any one of claims 1 to 4, wherein the antibody is an antigen-binding fragment of an antibody.

7. A pharmaceutical composition comprising an antibody according to any one of claims 1 to 6.

8. A nucleic acid encoding an antibody according to any one of claims 1 to 6.

9. A vector comprising the nucleic acid according to claim 8.

10. A bacteriophage expressing an antibody according to any one of claims 1 to 9.

11. A kit comprising an antibody according to any one of claims 1 to 6 or a pharmaceutical composition according to claim 7.

Images