Regulators of chromosome 9 open reading frame 72 gene expression and uses thereof

By designing zinc finger protein fusion protein to target and inhibit the transcription of mutant alleles of the C9orf72 gene, the treatment difficulties of C9orf72-related diseases were solved and effective treatment of ALS and FTD was achieved.

CN113766921BActive Publication Date: 2025-08-15SANGAMO THERAPEUTICS INC
View PDF 68 Cites 0 Cited by

Patent Information

Application Number
CN202080031118.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2020-01-23
Filing Date
2020-04-23
Publication Date
2025-08-15
Estimated Expiration
2040-04-23

AI Technical Summary

Technical Problem

There is currently a lack of effective treatments for C9orf72-related diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), which are caused by amplification of hexanucleotide repeats in the C9orf72 gene, resulting in RNA aggregation point formation and RNA metabolism disruption.

Method used

Develop a fusion protein based on zinc finger protein to target the intron segment of the mutant allelic allele of the C9orf72 gene, inhibit its sense and antisense transcription, and reduce the production of pathogenic RNA. The fusion protein comprises a zinc finger protein domain and a transcriptional inhibitor domain delivered to nerve cells by recombinant adeno-associated virus, specifically binding to and inhibit transcription of mutant alleles.

Benefits of technology

Effectively inhibits the transcription of the mutant C9orf72 allele, reduces the production of pathogenic RNA, and potentially treats ALS and FTD, providing treatments for these diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003318897490000321
    Figure BDA0003318897490000321
  • Figure BDA0003318897490000331
    Figure BDA0003318897490000331
  • Figure BDA0003318897490000341
    Figure BDA0003318897490000341
Patent Text Reader

Abstract

The present disclosure provides compositions and methods for modulating C9orf72 gene transcription in patients in need thereof, including patients with C9orf72-related diseases such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Cross-reference to related applications

[0002] This application claims priority to U.S. patent applications 62 / 837,523, filed April 23, 2019, and 61 / 964,844, filed January 23, 2020. The disclosures of these priority applications are incorporated herein by reference.

[0003] Sequence Listing

[0004] This application contains a sequence listing, which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. The ASCII format was created on April 21, 2020, is named 025297_WO017_SL.txt, and is 19,880 bytes in size. Background of the Invention

[0006] The chromosome 9 open reading frame 72 (C9orf72) gene encodes a protein found abundantly in neurons. The C9orf72 protein is thought to play an important role in endosomal trafficking. Although the function of the C9orf72 protein is not fully understood, recent data suggest that it plays a role in membrane trafficking along the endolysosomal pathway by regulating the function of Rab proteins.

[0007] The C9orf72 gene contains a hexanucleotide segment (G4C2; SEQ ID NO: 1) in intron 1. This segment can be repeated up to 30 times in tandem without discernible biological effects. However, repeats exceeding 30 times, a phenomenon known as hexanucleotide expansion, can lead to C9orf72-related disorders (Renton et al., Neuron (2011) 72: 257-68; Douglas, Non-coding RNA Res. (2018) 3: 178-87). This expansion produces an autosomal dominant phenotype, and patients are usually heterozygous for the expanded allele. The hexanucleotide expansion appears to cause the formation of RNA foci in cells, leading to sequestration of RNA-binding proteins and disruption of RNA metabolism. Hexanucleotide expansion also appears to result in the production of non-native proteins containing dipeptide repeats (DPRs) from potentially all six frames in both the sense and antisense directions via AUG-independent translation (Freibaum and Taylor, Front Mol Neurosci. (2017) 10:35; Douglas, supra). These proteins tend to aggregate (Gendron et al., Acta Neuropathol. (2013) 126:829). DPRs have been reported as inclusion bodies in postmortem brain material from patients with C9orf72-related diseases (Riemslagh et al., Acta Neuropathol Commun. (2019) 7:39).

[0008] C9orf72-related disorders include amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD). ALS is characterized by progressive muscle weakness, loss of muscle mass, and a gradual decline in the ability to move, speak, swallow, and / or breathe. ALS has an annual incidence of 1 to 3 cases per 100,000 people and is the most common adult-onset motor neuron disease. For most patients, the disease is fatal within three to five years of the first symptoms. Mutations in the C9orf72 gene are responsible for approximately 30% to 40% of familial ALS cases in the United States and Europe, and 5% to 10% of sporadic ALS cases. Some patients with C9orf72-related ALS also develop a condition called C9 frontotemporal dementia (FTD), or C9FTD, a neurodegenerative disease that affects personality, behavior, and language (Benussi et al., Front Aging Neurosci. (2015) 7:171). Subjects with both conditions were diagnosed with ALS-FTD.

[0009] There are no effective treatments for C9orf72-associated disorders. Therefore, there is an urgent need to develop effective therapies for these disorders. SUMMARY OF THE INVENTION

[0011] The present disclosure provides human C9orf72 transcriptional regulators based on zinc finger proteins and uses of these regulators in treating C9orf72-related disorders. In one aspect, the present disclosure provides fusion proteins comprising a zinc finger protein (ZFP) domain and a transcriptional repressor domain, wherein the ZFP domain binds to a target region in an intronic segment (intron 1a) between exons 1a and 1b of a mutant allele of the human C9orf72 gene. The mutant allele has an expanded G4C2 (SEQ ID NO: 1) repeat sequence region in intron 1a, and the fusion protein targets this expanded repeat sequence region. The mutant allele may contain more than 30 tandem G4C2 repeat sequences (e.g., more than 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 repeat sequences). The wild-type allele may contain no more than 30 such repeats (eg, no more than 25, 20, 15, 10, or 5 repeats).

[0012] In some embodiments, the fusion protein inhibits transcription of the repeat-containing RNA transcript (e.g., mRNA) from the mutant allele and does not inhibit transcription of the wild-type RNA transcript (e.g., mRNA) from the gene.

[0013] In some embodiments, the ZFP domain binds to a sense sequence in the target region, wherein the sense sequence comprises one to three tandem repeats of the hexanucleotide GGGGCC (SEQ ID NO: 1), GGGCCG (SEQ ID NO: 2), GGCCGG (SEQ ID NO: 3), GCCGGG (SEQ ID NO: 4), CCGGGG (SEQ ID NO: 5), or CGGGGC (SEQ ID NO: 6). In certain embodiments, the fusion protein inhibits sense transcription from the mutant allele in human cells. In specific embodiments, the fusion protein inhibits sense transcription from the C9orf721a promoter and does not inhibit sense transcription from the C9orf721b promoter.

[0014] In some embodiments, the ZFP domain binds to an antisense sequence in the target region, wherein the antisense sequence comprises one to three tandem repeats of the hexanucleotide GGCCCC (SEQ ID NO: 7), GCCCCG (SEQ ID NO: 8), CCCCGG (SEQ ID NO: 9), CCCGGC (SEQ ID NO: 10), CCGGCC (SEQ ID NO: 11), or CGGCCC (SEQ ID NO: 12). In certain embodiments, the fusion protein inhibits antisense transcription from a mutant allele in human cells.

[0015] In some embodiments, the fusion protein inhibits both sense and antisense transcription from a mutant C9orf72 allele in human cells. In some embodiments, the fusion protein preferentially inhibits the mutant C9orf72 allele over the wild-type C9orf72 allele.

[0016] In other embodiments, the fusion protein inhibits sense and / or antisense transcription from the mutant allele by at least about 30%, 40%, 75%, 90%, or 95%.

[0017] In some embodiments, the fusion protein has one or more ZFP domains, each optionally comprising six zinc fingers; binds to a target sequence shown in Table 1; and / or comprises six zinc fingers (ordered F1 to F6), each zinc finger comprising a DNA binding (recognition) helix sequence shown in a single column of Table 1, optionally comprising one or more mutations to residues outside the recognition helix region as indicated in Table 1. In other embodiments, the fusion protein binds to a target sequence and comprises zinc fingers corresponding to an SBS ID as shown in Table 1, said zinc fingers comprising a DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 78021, 75114, 75115, 74969, 79895, 79898, 74986, 79899, ​​79901, 79902, 79904, 79916, 75027, or 79921.

[0018] In some embodiments, the fusion protein has one or more transcriptional repressor domains, each of which optionally comprises a KRAB domain amino acid sequence from human KOX1, such as described further below. In specific embodiments, the ZFP domain is linked to the transcriptional repressor domain via a peptide linker.

[0019] In another aspect, the present disclosure provides a nucleic acid construct comprising the coding sequence of one or more of the fusion proteins described herein, wherein the coding sequence is optionally operably linked to a transcriptional regulatory element. In some embodiments, the transcriptional regulatory element comprises a mammalian promoter that is constitutively active or inducible in brain cells, and wherein the promoter is optionally a human synapsin I promoter. In some embodiments, the construct is a recombinant adeno-associated virus ("AAV" or "rAAV") construct. Also provided are rAAVs comprising a recombinant AAV construct and a shell of serotypes 1 to 10 (e.g., AAV2, AAV6, or AAV9) or a pseudotype derived therefrom (e.g., AAV2 / 9, AAV2 / 6, or AAV2 / 6 / 9).

[0020] In another aspect, the present disclosure provides a host cell comprising one or more fusion proteins and / or one or more nucleic acid constructs as described herein.The host cell can be, for example, a human cell, such as a neuron or a pluripotent stem cell (e.g., an embryonic stem cell or an induced pluripotent stem cell).

[0021] Also provided are pharmaceutical compositions comprising one or more fusion proteins as described herein, one or more nucleic acid constructs (e.g., AAV constructs), recombinant viruses (e.g., rAAV) comprising the nucleic acid constructs, and / or one or more host cells, typically in combination with one or more pharmaceutically acceptable excipients.

[0022] In another aspect, the present disclosure provides a method for inhibiting transcription of a mutant C9orf72 allele in a human cell (e.g., a neuron, a glial cell, an ependymal cell, or a neuroepithelial cell), wherein the mutant allele comprises an expanded G4C2 repeat region in intron 1a, the method comprising introducing into the cell one or more fusion proteins, one or more nucleic acid constructs (e.g., AAV), one or more recombinant viruses, one or more host cells, and / or one or more pharmaceutical compositions as described herein. In some embodiments, the cell is in the brain or spinal cord of a patient with a C9orf72-associated disorder (such as ALS or C9FTD).

[0023] In a related aspect, the present disclosure provides a method of treating a patient having a C9orf72-related disorder, optionally selected from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD), the method comprising introducing into the patient one or more fusion proteins, one or more nucleic acid constructs (e.g., AAV), one or more host cells and / or one or more pharmaceutical compositions as described herein.

[0024] In the treatment methods of the present invention, the fusion protein can be introduced using a recombinant virus expressing the fusion protein (e.g., an AAV vector). In some embodiments, the recombinant virus is administered to the patient via an intraventricular, intrathecal, intracranial, retroorbital (RO), intravenous, intranasal, and / or intracisternal route. In some embodiments, two or more different fusion proteins of the present invention are introduced, wherein the coding sequences of the two or more fusion proteins can be carried on the same or different recombinant viral vectors.

[0025] The present disclosure also provides one or more fusion proteins and / or one or more nucleic acid constructs, one or more recombinant viruses, and one or more pharmaceutical compositions for use in the treatment methods described herein, and uses of the fusion proteins, nucleic acid constructs, and recombinant viruses in the manufacture of medicaments for use in the treatment methods described herein.

[0026] Other features, objectives and advantages of the present invention will be apparent from the following detailed description. However, it should be understood that the detailed description, while indicating embodiments and aspects of the present invention, is provided by way of illustration and not limitation. For those skilled in the art, various changes and modifications within the scope of the present invention will become apparent from the detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figures 1A to 1C Schematic diagram depicting the C9orf72 gene and the transcripts produced.

[0029] Figure 1AThe structures of both the wild-type C9orf72 allele and the expanded mutant C9orf72 allele are shown. The location of the G4C2 expansion on the expanded mutant allele is indicated (in the genomic region between exons 1a and 1b, i.e., intron 1a). Exons are shown as boxes. Adapted from Douglas, supra; see also Rizzu et al. (2016) Acta Neuropathologica Communications 4:37.

[0030] Figure 1B This is a magnified view of the region near the G4C2 amplification of the mutant amplified C9orf72 allele, depicting the promoter and transcripts associated with the amplified allele. The approximate location of the promoter involved in sense strand transcription (solid arrows) and the promoter involved in antisense transcription (open arrows) are shown. Also shown are the five different sense transcripts described previously, along with their approximate locations and antisense orientation. Same as above.

[0031] Figure 1C A model showing repression of the 1a promoter and antisense promoter by a ZFP-TF targeted to the amplified region, where the ZFP-TF binds downstream of both promoters and in an optimal position for promoter regulation. The 1b promoter in this model is not repressed because the ZFP-TF binds upstream of the 1b promoter.

[0032] Figures 2A to 2D Shown is inhibition of C9orf72 expression ("Total C9") in the indicated cell types using the indicated ZFP-TFs. Additionally, the graph shows inhibition of expression of the longer mRNA isoform (expanded) containing intron 1a, which is primarily produced by the expanded mutant allele ("Repeat-containing isoform specific"). The expanded isoform is predominantly expressed in the C9 patient line.

[0033] Figure 2A PCR analysis for total C9 analysis and isoform-specific analysis containing sense and antisense repeats is shown. The top of the figure depicts the genomic structure of the wild-type and amplified alleles, while the bottom of the figure shows the mRNA products produced by each allele. The set of arrows on the mRNA plot depicts the PCR targets used in the total C9 analysis.

[0034] Figures 2B to 2DFigures show the results of C9orf72 expression analysis of various exemplary ZFP-TFs in a wild-type cell line derived from a healthy subject and an ALS patient-derived fibroblast cell line "C9." The C9 cell line is characterized as "5 / 850," which refers to the number of G4C2 repeats on the wild-type allele (5) and the number on the amplified allele (850). Leftmost panel: Total C9orf72 expression ("Total C9") in wild-type cells in round 3 of screening ("Round 3"). Second panel from the left: Total C9 in C9 cells in round 3. Second panel from the right: Total C9 in C9 cells in round 2 of screening ("Round 2"). Rightmost panel: Expression from the amplified C9orf72 allele as determined by isoform-specific C9orf72 analysis. A second round of screening was performed in C9 cells to assess isoform (or disease)-specific C9orf72 transcript levels relative to total C9 transcript levels after ZFP-TF treatment. In round 3, total C9 was measured in C9 cells and wild-type cells to assess the effect of ZFP-TFs on the wild-type (WT) allele of C9 cells. For each ZFP-TF, mRNA concentrations of 1, 3, 10, 30, 100, and 300 ng are shown from left to right. Figure 2B Results for ZFP-TFs 74949, 74951, 74954, 74955, and 74964 are shown in the top graph, and results for 74969, 74971, 74973, 74978, and 74979 are shown in the bottom graph. Figure 2B SEQ ID NOs: 1, 1 and 3 are disclosed in order of appearance, respectively. Figure 2C Results for ZFP-TFs 74983, 74984, 74986, 74987, and 74988 are shown in the top panel, and results for 74997, 74998, 75001, and 75003 are shown in the bottom panel. Figure 2C SEQ ID NOs: 4 and 5 are disclosed in order of appearance, respectively. Figure 2D Results for ZFP-TFs 75023, 75027, 75031, 75032, 75055, and 75078 are shown in the top panel, and results for 75090, 75105, 75109, 75114, and 75115 are shown in the bottom panel. Figure 2DSEQ ID NOs: 8-11 are disclosed in the order of appearance. The sequence at the bottom of the figure represents the DNA binding motif of the ZFP-TF. Each ZFP-TF binds to three hexanucleotide repeats containing the motif. Transcript levels are normalized to the level of green fluorescent protein (GFP) expressed by GFP mRNA transfected with ZFP-TF mRNA. The horizontal dotted lines in the figure show 50% or 70% inhibition, as indicated. For example, for ZFP-TF 75115, there is approximately 50% inhibition of total isoform transcripts in the C9 line and about 70% inhibition of isoform-specific transcripts containing repeat sequences, while there is minimal inhibition of total isoforms in the WT line. The figure indicates that 30% of the transcripts continue to exist, which indicates 70% inhibition.

[0035] Figure 3 Diagram showing the promoter regions of the sense and antisense transcripts in the amplified allele of C9orf72. Primer pairs used to specifically detect sense, total, and antisense transcripts are indicated. AS: antisense. ddPCR: droplet digital PCR. The figure discloses SEQ ID NOs: 1, 1, and 7, respectively, in the order of appearance.

[0036] Figure 4A and Figure 4B Primers targeting intron 1b are shown to specifically detect antisense pre-mRNA. Strand-specific PCR was used to generate sense (S) or antisense (AS) cDNA templates from healthy controls (Con) or C9 cells (C9). For example, C9-AS indicates ddPCR results obtained with antisense cDNA templates generated from RNA isolated from C9 cells. Figure 4A It was shown that only the cDNA template C9-AS generated PCR products, indicating the specificity of the primer pair for detecting the antisense pre-mRNA. Figure 4B Will Figure 4A The experiments in this study were extended to seven different C9orf72 patient-derived cell lines with different G4C2 repeat lengths and six different healthy control lines.

[0037] Figures 5A to 5C Graph showing inhibition of transcripts in C9 cells using isoform-specific analysis containing repeat sequences. Figure 5A Three experiments are shown in which ZFP-TFs 74949, 74978, 75003, 75027, 75109, 75114, 75115, 74960, and 74967 were given at three different doses (30, 100, or 300 ng), and the amount of disease sense transcript was then measured. Figure 5B Three experiments measuring disease antisense transcripts are shown. Figure 5C Three runs measuring total C9orf72 transcripts are shown.

[0038] Figure 6 Shown is inhibition of total C9 transcripts and amplified sense and antisense transcripts (disease isoforms) in three different fibroblast cell lines obtained from different ALS patients, each containing a different number of G4C2 repeats on their amplified alleles (approximately 600, 800, and 850 repeats, respectively). An isoform selectivity assay was used to assess the amount of inhibition after exposing cells to 100 ng of ZFP-TFs 75109, 75114, and 75115. All three ZFP-TFs maintained selective inhibition in all three cell lines.

[0039] Figure 7 Inhibition of total C9 transcripts was demonstrated in two cell lines from healthy subjects with a greater than typical number of G4C2 repeats on their alleles. Healthy subjects typically have 2 to 5 G4C2 repeats on each of their C9orf72 alleles. However, some healthy subjects contain more repeats. To ensure adequate ZFP-TF binding sites, cell lines containing more than the typical number of repeats (5 / 8 and 5 / 20 repeats) were used. In these cell lines, total C9 transcripts were minimally affected.

[0040] Figures 8A to 8C Results from microarray analysis of ALS patient-derived primary fibroblasts (C921, also referred to as C9021), mouse primary neurons, and human primary neurons are shown, demonstrating the specificity of the indicated inhibitors (75027, 75109, 75114, and 75115). ZFP-TF 75027 targets a repetitive GCCCCG (SEQ ID NO: 8) motif, while ZFP-TFs 75109, 75114, and 75115 target a CCGGCC (SEQ ID NO: 11) motif in the antisense strand of the C9orf72 gene.

[0041] Figure 8A Patient-derived primary fibroblasts (C9021) were cultured using Thermo Fisher Clariom TM Results of microarray analysis by S, Thermo Fisher Clariom TM The S analysis contains 21,000 well-annotated genes in its database. The analysis was performed 24 hours after 300 ng of inhibitor in the form of mRNA was applied to C9021 cells. The graph shows genes that are upregulated or downregulated in response to the specified ZFP-TF.

[0042] Figure 8B Mouse primary neurons were expressed using Thermo Fisher Clariom TMResults of microarray analysis by D analysis, Thermo Fisher Clariom TM D analyzes 140,000 annotated and unannotated coding and non-coding transcripts in its database. Analysis was performed 7 days after AAV transduction. All cells were transduced at an MOI of 3,000. The graph shows genes that were upregulated or downregulated in response to the indicated ZFP-TFs.

[0043] Figure 8C Displayed in human primary neurons using Thermo Fisher Clariom TM Results of microarray analysis of D. Analysis was performed 19 days after AAV transduction of cells at an MOI of 3,000. Graphs show genes that were upregulated or downregulated in response to the indicated ZFP-TFs.

[0044] Figure 9 shows in vivo target engagement of ZFPs in C9orf72 BAC transgenic mice. Panel A shows the AAV construct used for injection. The construct contains the synapsin promoter, the ZFP-KRAB coding sequence, and a Venus tag. Panels B and C show the study design, according to which newborn mice were injected intracerebroventricularly (ICV) with AAV containing the ZFP-KRAB expression construct and dissected one month after injection for downstream analysis. Panel D shows the amount of sense, antisense, and total C9 RNA in the hippocampus and cortex of animals injected with ZFP-KRAB (75027). Panel E shows representative images of sense and antisense RNA foci and quantification from the cornu ammonis (CA) and dentate gyrus (DG) regions of animals injected with ZFP-KRAB (75027). Detailed Description of the Invention

[0046] The present disclosure provides zinc finger protein-based transcription factors (ZFP-TFs) that preferentially target human C9orf72 gene alleles with expanded G4C2 repeat regions and inhibit the transcription of these mutant alleles into RNA. Such expanded regions may have more than 30 G4C2 repeat sequences. The ZFP-TFs of the present invention are fusion proteins containing (i) at least one zinc finger protein (ZFP) domain that specifically binds to a DNA motif within the repeat sequence on the sense or antisense strand of the mutant allele, and (ii) at least one transcriptional repressor domain that reduces transcription of the allele in either or both the sense and antisense directions. It is expected that by introducing the ZFP-TF into the nervous system (e.g., the brain and spinal cord), the levels of mutant C9orf72 transcripts in neurons will be reduced, thereby inhibiting (e.g., reducing or stopping) the formation of pathogenic cytotoxic substances in the cells. The ZFP-TFs of the present invention can be used to treat (including prevent and alleviate) C9orf72-related disorders, such as ALS and C9FTD.

[0047] Disclosed herein are methods and compositions for diagnosing, preventing, and / or treating ALS and FTD. Specifically, provided herein are methods and compositions for modifying specific genes (e.g., modulating their expression) to treat these diseases, including the use of engineered transcription factor inhibitors and nucleases. In some embodiments, modulating expression comprises modulating both sense expression and / or antisense expression.

[0048] Therefore, described herein are methods (in vivo, ex vivo, and / or in vitro) for inhibiting sense and / or antisense transcription of a repeat expansion mutant allele of the C9orf72 gene in a cell (e.g., a neuron). The method comprises treating the cell with one or more inhibitors of the mutant C9orf72 gene allele, the one or more inhibitors comprising a transcription inhibitor domain and a DNA binding domain that binds to a target site in the mutant C9orf72 gene allele. The (multiple) inhibitors may comprise one or more zinc finger protein transcription factors (ZFP-TFs comprising a ZFP DNA binding domain), one or more TAL effector domain transcription factors (TALE-TFs comprising a TAL effector domain DNA binding domain), and / or one or more CRISPR / Cas transcription factor systems (comprising a single guide RNA DNA binding domain). In certain embodiments, two or more different inhibitors are used (e.g., one or more pharmaceutical compositions comprising the two or more different inhibitors). In certain embodiments, the C9orf72 gene comprises a mutant allele comprising one or more (G4C2) repeat sequences, optionally wherein the target site bound by the DNA binding domain of the inhibitor is within the one or more (G4C2) repeat sequences. Thus, the present invention provides the use of one or more ZFP-TF, TALE-TF, or CRISPR / CasTF inhibitors that bind to a mutant C9orf72 expansion allele comprising one or more (G4C2) repeat sequences (e.g., formulated into one or more pharmaceutical compositions comprising the one or more inhibitors) for use in a subject in need thereof (e.g., a subject with ALS and / or FTD, wherein the disease is treated and / or symptoms are ameliorated) for inhibiting sense and / or antisense transcription (e.g., by 50%, 70% or more compared to untreated cells / subjects). In certain embodiments, sense and / or antisense transcription is not inhibited to more than 90% of normal (control) levels. In certain embodiments, both antisense and sense transcription are inhibited at the same or different levels (e.g., antisense and sense transcription are similarly inhibited); antisense transcription is more inhibited than sense transcription, or sense transcription is more inhibited than antisense transcription. In certain embodiments, specific sense transcripts are inhibited, while others are not inhibited. In some embodiments, transcription from a promoter in the 1b intron segment is not inhibited, while transcription from a promoter in the 1a intron and antisense transcripts are inhibited. In certain embodiments, transcripts comprising amplified repeat sequences are selectively inhibited (e.g., antisense transcription is inhibited, sense transcription from the 1a promoter is inhibited, and / or sense transcription from the 1b promoter is not inhibited).In certain embodiments, one or more ZFP-TF inhibitors comprising a recognition helical region as shown in Table 1 are used in the methods and uses described herein, optionally in combination with one or more different inhibitors (e.g., additional different ZFP-TFs, e.g., one or more additional ZFP-TFs comprising a ZFP as shown in Table 1). In certain embodiments, one or more inhibitors are administered to cells using one or more non-viral vectors (e.g., in the form of mRNA) and / or viral vectors (e.g., AAV, such as AAV2 / 9). Multiple copies of one or more regulators (e.g., inhibitors) can be administered using the same or different modes (e.g., mRNA and / or AAV). In certain embodiments, the same or different modes can be used to deliver one or more different regulators (e.g., inhibitors). In vivo methods and uses in living subjects (e.g., humans) may involve intravenous administration (e.g., one or more pharmaceutical compositions comprising inhibitors and / or polynucleotides encoding inhibitors) by any suitable means, including but not limited to intracerebroventricular, intrathecal, intracranial, retroorbital (RO), intravenous, intranasal, and / or intracisternal administration. Brain administration may be unilateral or bilateral (e.g., administration to the hippocampus). Any amount (dose) may be administered, for example 1E10 to 1E13 (e.g., 6E11) vg / hemisphere. In any of the methods and uses described herein, the subject is treated for ALS and / or FTD (and / or one or more symptoms of these diseases are treated).

[0049] Provided herein are genetic regulators of the C9orf72 gene, comprising a DNA binding domain (e.g., a zinc finger protein (ZFP), a TAL effector domain protein (TALE), or a single guide RNA) that binds to a target site of at least 12 nucleotides in the C9orf72 gene; and a transcriptional regulator domain (e.g., an inhibitory domain). Also provided are one or more polynucleotides encoding one or more of the genetic regulators described herein (e.g., viral or non-viral gene delivery vehicles, such as AAV vectors). In other aspects, described herein are pharmaceutical compositions comprising one or more polynucleotides and / or one or more gene delivery vehicles as provided herein. In some embodiments, the genetic regulator comprises a regulator domain, and the genetic regulator (and pharmaceutical compositions comprising one or more genetic regulators or polynucleotides encoding one or more genetic regulators) regulates (e.g., inhibits or activates) C9orf72 gene expression. The sense and / or antisense strand of the gene can be bound and / or regulated. Also provided herein are isolated cells (including cell populations) comprising one or more genetic regulators as described herein; one or more polynucleotides; one or more gene delivery vehicles; and / or one or more pharmaceutical compositions. Also provided are methods and uses (in vitro, in vivo, or ex vivo) for regulating expression (e.g., inhibiting) of the C9orf72 gene in a cell, the methods comprising administering to the cell (via any method, including but not limited to intracerebroventricular, intrathecal, intracranial, retroorbital (RO), intravenous, or intracisternal) one or more genetic modulators as described herein; one or more polynucleotides; one or more gene delivery vehicles; and / or one or more pharmaceutical compositions. The methods can be used to treat and / or prevent amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD) in a subject. Also provided are uses of one or more genetic modulators; one or more polynucleotides; one or more gene delivery vehicles; and / or one or more pharmaceutical compositions for treating and / or preventing ALS or FTD in a subject. Also provided are kits comprising one or more genetic modulators as described herein; one or more polynucleotides; one or more gene delivery vehicles; and / or one or more pharmaceutical compositions, and optionally instructions for use.

[0050] Thus, in one aspect, an engineered (non-naturally occurring) genetic regulator (e.g., inhibitor) of one or more genes is provided. These genetic regulators may comprise a system (e.g., zinc finger protein, TAL effector (TALE) protein, or CRISPR / dCas-TF) that regulates (e.g., inhibits) allele expression. The expression of wild-type and / or mutant alleles can be regulated together or separately. In certain embodiments, the mutant allele is regulated at a greater level than the wild-type allele (e.g., compared to an untreated control, the wild-type allele is suppressed by no more than 50% of normal, but the mutant allele is suppressed by at least 70%). In some embodiments, regulating expression may comprise regulating both the sense and antisense transcripts of the C9orf72 gene. In some embodiments, regulating expression may primarily regulate the sense transcript, while in other embodiments, regulating expression may primarily regulate the antisense transcript.

[0051] Amplification mutations in the C9orf72 allele result in the expression of both sense and antisense RNA products associated with ALS and FTD, and therefore, in one embodiment, engineered transcription factors designed to inhibit the expression of these mutant C9orf72 alleles are provided to treat ALS or FTD. Engineered zinc finger proteins or TALEs are non-naturally occurring zinc finger or TALE proteins whose DNA binding domains (e.g., recognition helices or RVDs) have been altered (e.g., by selection and / or rational design) to bind to a pre-selected target site. Any of the zinc finger proteins described herein may include 1, 2, 3, 4, 5, 6 or more zinc fingers, each zinc finger having a recognition helix that binds to a target subsite in a selected sequence(s) (e.g., gene(s)). In certain embodiments, the ZFP-TF comprises a ZFP having a recognition helix region as shown in a single column of Table 1. Similarly, any of the TALE proteins described herein may include any number of TALER RVDs. In some embodiments, at least one RVD has non-specific DNA binding. In some embodiments, at least one recognition helix (or RVD) is non-natural.In certain embodiments, TALE-TF includes a TALE of at least 12 base pairs bound to a target site as shown in Table 1. CRISPR / Cas-TF includes a single guide RNA bound to a target sequence. In certain embodiments, an engineered transcription factor is bound to a target site of at least 9 to 12 base pairs in a disease-associated gene (e.g., via a ZFP, TALE or sgRNA DNA binding domain), for example, a target site comprising at least 9 to 20 base pairs (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more), including continuous or non-continuous sequences in these target sites (e.g., target sites as shown in Table 1). In certain embodiments, a genetic regulator includes a DNA binding molecule (ZFP, TALE, single guide RNA) as described herein, which is operably connected to a transcriptional repressor domain (to form a genetic repressor).

[0052] Therefore, as described herein, zinc finger proteins (ZFP), Cas proteins or TALE proteins of CRISPR / Cas systems can be placed into operational linkages with regulatory domains (or functional domains) as part of a fusion molecule. Functional domains can be, for example, transcriptional activation domains, transcriptional repressor domains and / or nuclease (cleavage) domains. By selecting activation domains or inhibition domains for use with DNA binding molecules, such molecules can be used to activate or inhibit gene expression. In certain embodiments, functional domains or regulatory domains can play a role in histone post-translational modification. In some cases, the domain is a histone acetyltransferase (HAT), a histone deacetylase (HDAC), a histone methylase, or an enzyme that ubiquitinates or biotinylates histones, or allows other enzyme domains (Kousarides, (2007) Cell 128: 693-705) that regulate gene suppression after translation. In some embodiments, molecules are provided comprising ZFPs, dCas or TALEs targeting genes as described herein (e.g., C9orf72) fused to transcriptional repressor domains that can be used to downregulate gene expression. In some embodiments, the methods and compositions of the present invention are suitable for treating eukaryotic organisms. In certain embodiments, the activity of the regulatory domain is regulated by exogenous small molecules or ligands so that in the absence of exogenous ligands, no interaction with the transcriptional machinery of the cell will occur. Such external ligands control the degree of interaction between the ZFP-TF, CRISPR / Cas-TF or TALE-TF and the transcriptional machinery. (Multiple) regulatory domains can be operably linked to any (multiple) parts of one or more of the ZFPs, dCas or TALEs, including between one or more ZFPs, dCas or TALEs, outside one or more ZFPs, dCas or TALEs, and any combination thereof. In preferred embodiments, the regulatory domain causes inhibition of gene expression of the targeted gene (e.g., C9orf72). Any of the fusion proteins described herein can be formulated into a pharmaceutical composition.

[0053] In some embodiments, the artificial regulator binds to the promoter region upstream (e.g., 5' end) of the transcription start site (TSS) of the gene. In some embodiments, the artificial regulator binds to the region downstream of the TSS. In a preferred embodiment, the artificial regulator preferentially binds to the expanded repeat sequence region in the C9orf72 gene. In some embodiments, the artificial regulator binds to the C9orf72 gene to inhibit the expression of the promoter in the 1a intron. In some embodiments, the artificial regulator binds to the C9orf72 gene to inhibit the expression of the promoter in the 1b intron. In some embodiments, the binding of the artificial regulator inhibits expression from the 1a promoter and the antisense promoter, but does not inhibit the 1b promoter. See also Figure 1B and Figure 1C .

[0054] In some embodiments, the methods and compositions of the present invention include the use of two or more fusion molecules as described herein, for example, two or more C9orf72 regulators (artificial transcription factors). The two or more fusion molecules may bind to different target sites and contain the same or different functional domains. Alternatively, two or more fusion molecules as described herein may bind to the same target site but include different functional domains. In some cases, three or more fusion molecules are used; in other cases, four or more fusion molecules are used; and in other cases, five or more fusion molecules are used. In some embodiments, two or more, three or more, four or more, or five or more fusion molecules (or components thereof) are delivered to cells in the form of nucleic acids. In preferred embodiments, the fusion molecules cause inhibition of expression of the targeted gene. In some embodiments, the two fusion molecules are given at a dose in which each molecule is active on its own, but the inhibitory activity is additive in combination. In some embodiments, the two fusion molecules are given at a dose in which neither molecule is active on its own, but the inhibitory activity is synergistic in combination.

[0055] In yet another aspect, polynucleotides encoding any of the DNA binding domains described herein are provided.

[0056] In some embodiments, the polynucleotide encoding the DNA binding protein is an mRNA. In some aspects, the mRNA can be chemically modified (e.g., Kormann et al., (2011) Nature Biotechnology 29(2):154-7). In other aspects, the mRNA can include an ARCA cap (see U.S. Patents 7,074,596 and 8,153,773). In other embodiments, the mRNA can include a mixture of unmodified and modified nucleotides (see U.S. Patent Publication No. 2012 / 0195936).

[0057] In yet another aspect, a gene delivery vector comprising any one of the polynucleotides described herein (e.g., inhibitors) is provided. In certain embodiments, the vector is an adenoviral vector (e.g., Ad5 / F35 vector); a lentiviral vector (LV), including an integration-capable or integration-defective lentiviral vector; or an adenovirus-associated viral vector (AAV). In certain embodiments, the AAV vector is an AAV2, AAV6, AAV8, or AAV9 vector, or a pseudotyped AAV vector, such as AAV2 / 8, AAV2 / 5, AAV2 / 9, and AAV2 / 6. In some embodiments, the AAV vector is an AAV vector (e.g., U.S. Patent Publication No. 2015 / 0079038) capable of passing through the blood-brain barrier. In other embodiments, AAV is a self-complementary AAV (sc-AAV) or single-stranded (ss-AAV) molecule. Also provided herein are adenoviral (Ad) vectors, LV, or adeno-associated viral vectors (AAV) comprising a sequence encoding at least one nuclease (ZFN or TALEN) and / or a donor sequence for targeted integration into a gene of interest. In certain embodiments, the Ad vector is a chimeric Ad vector, such as an Ad5 / F35 vector. In certain embodiments, the lentiviral vector is an integrase-deficient lentiviral vector (IDLV) or an integration-competent lentiviral vector. In certain embodiments, the vector is pseudotyped with a VSV-G envelope or other envelope.

[0058] In addition, pharmaceutical compositions are also provided, which comprise nucleic acids and / or fusions, such as artificial transcription factors (e.g., ZFPs, Cas or TALEs or fusion molecules comprising ZFPs, Cas or TALEs). For example, certain compositions include a combination of a nucleic acid comprising a sequence encoding one of the ZFPs, Cas or TALEs described herein operably linked to a regulatory sequence, wherein the regulatory sequence allows the nucleic acid to be expressed in a cell. In certain embodiments, the encoded ZFP, Cas, CRISPR / Cas or TALE regulates wild-type and / or mutant alleles. In some embodiments, the mutant allele is preferentially regulated, for example, inhibited, than the wild-type allele. In some embodiments, the pharmaceutical composition comprises ZFPs, CRISPR / Cas or TALEs that preferentially regulate mutant alleles, and ZFPs, CRISPR / Cas or TALEs that regulate neurotrophic factors. Protein-based compositions include one or more ZFPs, CRISPR / Cas or TALEs as disclosed herein and a pharmaceutically acceptable carrier or diluent.

[0059] In another aspect, isolated cells comprising any of the proteins, fusion molecules, polynucleotides, and / or compositions described herein are also provided. The isolated cells can be used for non-therapeutic purposes (such as providing cells or animal models for diagnostic and / or screening methods), and / or for therapeutic purposes (such as ex vivo cell therapy).

[0060] In yet another aspect, a pharmaceutical composition comprising one or more genetic regulators, one or more polynucleotides (e.g., gene delivery vehicles) and / or one or more (e.g., a group of) isolated cells as described herein is also provided. In certain embodiments, the pharmaceutical composition comprises two or more genetic regulators. For example, certain compositions include a nucleic acid comprising a sequence encoding one or more genetic regulators of one of the genes associated with a rare disease as described herein (e.g., C9orf72). In certain embodiments, (multiple) genetic regulators (e.g., comprising ZFPs, Cas or TALEs described herein) are operably linked to a regulatory sequence, in combination with a pharmaceutically acceptable carrier or diluent, wherein the regulatory sequence allows the nucleic acid to be expressed in the cell. In certain embodiments, the encoded ZFP, CRISPR / Cas or TALE is specific for a mutant or wild-type allele (e.g., C9orf72). In some embodiments, the pharmaceutical composition comprises a ZFP-TF, CRISPR / Cas-TF, or TALE-TF that modulates mutant and / or wild-type alleles (e.g., C9orf72), including a TF that preferentially modulates (e.g., inhibits at a greater level) the mutant allele compared to the wild-type allele. Protein-based compositions include one or more genetic regulators as disclosed herein and a pharmaceutically acceptable carrier or diluent. In certain embodiments, a composition comprising two or more genetic regulators (carried on the same or different types of vectors, e.g., AAV vectors) is used, optionally wherein one of the genetic regulators comprises a ZFP-TF inhibitor comprising a ZFP designated 74949, 74978, 75027, or 75109.

[0061] The present invention also provides methods and uses for inhibiting gene expression in a subject in need thereof (e.g., a subject suffering from a rare disease as described herein), comprising providing the subject with one or more polynucleotides, one or more gene delivery vehicles, and / or pharmaceutical compositions as described herein. In certain embodiments, the compositions described herein are used to inhibit mutant C9orf72 expression in a subject, including for treating and / or preventing ALS or FTD. The compositions described herein inhibit gene expression in the brain (including but not limited to the frontal cortex, including but not limited to the prefrontal cortex; parietal cortex; occipital cortex; temporal cortex, including but not limited to the entorhinal cortex; hippocampus; brainstem; striatum; thalamus; midbrain; cerebellum) and spinal cord (including but not limited to the lumbar, thoracic, and cervical regions) for a sustained period of time (4 weeks, 3 months, 6 months to a year or longer). The compositions described herein can be provided to the subject by any means of administration, including but not limited to intraventricular, intrathecal, intracranial, intravenous, orbital (retroorbital (RO)), intranasal, and / or intracisternal administration. Also provided are kits comprising one or more of the compositions (eg, genetic modulators, polynucleotides, pharmaceutical compositions, and / or cells) as described herein and instructions for use of these compositions.

[0062] In another aspect, provided herein are methods for treating and / or preventing CNS (e.g., ALS and / or FTD) using the methods and compositions described herein. In some embodiments, the methods relate to compositions to which polynucleotides and / or proteins can be delivered using viral vectors, non-viral vectors (e.g., plasmids), and / or combinations thereof. In some embodiments, the methods relate to compositions comprising a stem cell population comprising an artificial transcription factor (e.g., ZFP-TF, TALE-TF, or dCas-TF). Administration of a composition as described herein (protein, polynucleotide, cell, and / or pharmaceutical composition comprising these proteins, polynucleotides, and / or cells) results in a therapeutic (clinical) effect, including but not limited to improving or eliminating any clinical symptoms associated with ALS and / or FTD, and improving the function and / or increasing the number of CNS cells (e.g., neurons, astrocytes, myelin, etc.). In certain embodiments, the compositions and methods described herein reduce expression of the sense and / or antisense transcripts of a target gene (e.g., C9orf72) by at least 30% or 40%, such as at least 50%, at least 70%, at least 80%, at least 90%, at least 95%, or more than 95%, compared to a control that has not received an artificial inhibitor as described herein. In some embodiments, at least a 50% reduction is achieved. In certain embodiments, the artificial inhibitor preferentially suppresses the mutant allele (e.g., the amplified allele) by, for example, at least 20% (e.g., suppresses the wild-type allele by no more than 50% and suppresses the mutant allele by at least 70%) compared to the wild-type allele. In some embodiments, the inhibitor preferentially inhibits the sense transcript on the mutant allele, while in other embodiments, the inhibitor preferentially inhibits the antisense transcript on the mutant allele. In some embodiments, the inhibitor inhibits both the sense and antisense transcripts on the mutant allele.

[0063] In another aspect, described herein is a method for delivering a gene inhibitor to a subject's brain using a viral or non-viral vector. In certain embodiments, the viral vector is an AAV9 vector. Delivery can be by any suitable means, including reaching any brain region, such as the hippocampus or entorhinal cortex, via the use of an intubation tube. Genetic regulators (e.g., inhibitors) are provided for extensive delivery to the subject's brain, including any AAV vector delivered via anterograde and retrograde axonal transport to brain regions to which the vector is not directly administered (e.g., delivery to the putamen causes delivery to other structures, such as the cortex, substantia nigra, thalamus, etc.). In certain embodiments, the subject is human, and in other embodiments, the subject is a non-human primate. Administration can be in the form of a single dose, or a series of doses given simultaneously, or multiple administrations (at any timing between administrations).

[0064] Thus, in other aspects, described herein are methods for preventing and / or treating a disease (e.g., ALS and / or FTD) in a subject, comprising administering an inhibitor of a gene to the subject using AAV. In certain embodiments, the inhibitor is administered to the CNS (e.g., hippocampus and / or entorhinal cortex) or PNS (e.g., spinal cord / cerebrospinal fluid) of the subject. In other embodiments, the inhibitor is administered intravenously. In certain embodiments, described herein are methods for preventing and / or treating ALS or FTD in a subject, comprising administering an inhibitor of a C9orf72 allele (wild type and / or mutant) to the subject using one or more AAV vectors. In certain embodiments, the AAV encoding the genetic regulator is administered to the CNS (brain and / or CSF) via any delivery method, including but not limited to intraventricular, intrathecal, intracranial, intravenous, intranasal, retroorbital, or intracisternal delivery. In other embodiments, the AAV encoding the inhibitor is administered directly to the brain parenchyma (e.g., hippocampus and / or entorhinal cortex) of the subject. In other embodiments, the AAV encoding the inhibitor is administered intravenously (IV). In any of the methods described herein, administration can be performed once (single administration) or multiple times (with any interval between administrations), with the same or different doses administered each time. When multiple administrations are performed, the same or different doses and / or modes of administration of the delivery vehicle can be used (e.g., different AAV vectors for IV and / or ICV administration). The methods include methods of reducing loss of muscle function, loss of coordination, muscle stiffness, muscle spasms, loss of speech function, difficulty swallowing, cognitive impairment in an ALS subject, methods of reducing loss of motor function, and / or methods of reducing loss of one or more cognitive functions, all compared to a subject not receiving the method, or compared to the subject itself before receiving the method. Thus, the methods described herein result in a reduction in biomarkers and / or symptoms of rare diseases such as ALS or FTD, including one or more of the following: loss of muscle function, loss of physical coordination, muscle stiffness, muscle spasms, loss of speech function, difficulty swallowing, cognitive impairment, changes in blood and / or cerebrospinal fluid chemicals associated with ALS, including changes in the amount of G-CSF, IL-2, IL-15, IL-17, MCP-1, MIP-1α, TNF-α, and VEGF (see Chen et al., Front Immunol. (2018) 9:2122) and / or other biomarkers known in the art. In certain embodiments, the methods may further comprise, for example, administering one or more genetic inhibitors of tau (MAPT) to a subject with FTD. See, for example, U.S. Patent Publication No. 2018 / 0153921.

[0065] In any of the methods described herein, the inhibitor of the targeted allele may be a ZFP-TF, such as a fusion protein comprising a ZFP that specifically binds to the allele and a transcriptional inhibitor domain (e.g., KOX, KRAB, etc.). In other embodiments, the inhibitor of the targeted allele may be a TALE-TF, such as a fusion protein comprising a TALE polypeptide that specifically binds to the gene allele and a transcriptional inhibitor domain (e.g., KOX, KRAB, etc.). In some embodiments, the targeted allele inhibitor is a CRISPR / Cas-TF, in which the nuclease domain in the Cas protein is inactivated so that the protein no longer cleaves DNA. The resulting CasRNA guides the DNA binding domain to fuse to a transcriptional inhibitor (e.g., KOX, KRAB, etc.) to suppress the targeted allele. In some embodiments, the engineered transcription factor is capable of suppressing the expression of mutant alleles rather than wild-type alleles. In other embodiments, the DNA binding molecule preferentially recognizes hexameric GGGGCC (SEQ ID NO: 1) amplification.

[0066] In some embodiments, the sequence encoding a gene inhibitor as described herein (e.g., ZFP-TF, TALE-TF or CRISPR / Cas-TF) is inserted (integrated) into the genome, and in other embodiments, the sequence encoding the inhibitor remains free. In some cases, the nucleic acid encoding the TF fusion is inserted (e.g., via nuclease-mediated integration) at the safe harbor site comprising a promoter so that an endogenous promoter drives expression. In other embodiments, an inhibitor (TF) donor sequence is inserted (via nuclease-mediated integration) into the safe harbor site, and the donor sequence comprises a promoter driving inhibitor expression. In some embodiments, the promoter sequence is widely expressed, and in other embodiments, the promoter is tissue or cell / type specific. In preferred embodiments, the promoter sequence is specific to neuronal cells. In other embodiments, the promoter sequence is specific to muscle cells. In some embodiments, the selected promoter is characterized in that it has low expression. Non-limiting examples of applicable promoters include neural-specific promoters NSE, synaptophysin, CAMKiia and MECP. Non-limiting examples of ubiquitous promoters include CMV, CAG, and Ubc. Other embodiments include the use of self-regulatory promoters as described in U.S. Patent Publication No. 2015 / 0267205. Other embodiments include the use of self-regulatory promoters as described in U.S. Patent Publication No. 2015 / 0267205.

[0067] In any of the methods described herein, the method can produce about 50% or more, 55% or more, 60% or more, 65% or more, about 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more inhibition, 98% or more, or 99% or more inhibition of a target allele (e.g., mutant or wild-type C9orf72) in one or more neurons of a subject (e.g., a subject with ALS). In certain embodiments, expression of the wild-type allele in the subject (compared to an untreated subject) is inhibited by no more than 50%, while expression of the mutant allele in the subject (compared to an untreated subject) is inhibited by at least 70% (70% or any value above). In some embodiments, expression of an antisense promoter is inhibited by at least 70%. In certain embodiments, expression of the antisense activator found in the region of C9orf72 introns 1a, 1b, and / or 1c is inhibited by at least 70%, while expression of the sense promoter in the region of C9orf72 intron 1b is inhibited by no more than 50%.

[0068] In any of the methods described herein, a regulator (e.g., an inhibitor or activator) can be delivered to a subject in the form of any combination of protein, polynucleotide, or protein and polynucleotide. In certain embodiments, one or more inhibitors are delivered using an AAV vector. In other embodiments, at least one component of a regulator (e.g., the sgRNA of the CRISPR / Cas system) is delivered in RNA form. In other embodiments, (multiple) regulators are delivered using a combination of any one of the expression constructs described herein, such as a suppressor (or a portion thereof) on an expression construct (AAV9), and a suppressor (or a portion thereof) on an independent expression construct (AAV or other viral or non-viral construct).

[0069] In addition, in any method described herein, regulatory agent (for example, inhibitor) can provide any concentration (dosage) of desired effect to cell delivery (ex vivo or in vivo). In some embodiments, regulatory agent uses adeno-associated virus (AAV) vector to deliver with 10,000 to 500,000 vector genomes / cell (or any value therebetween). In certain embodiments, regulatory agent uses lentiviral vector to deliver with an MOI between 250 and 1,000 (or any value therebetween). In other embodiments, regulatory agent uses plasmid vector to deliver with 0.01 to 1,000 nanograms / 100,000 cells (or any value therebetween). In other embodiments, inhibitor is delivered with 150 to 1,500 nanograms / 100,000 cells (or any value therebetween) in mRNA form. In addition, for use in vivo, in any method described herein, (multiple) genetic regulators (for example, inhibitor) can provide any concentration (dosage) delivery of desired effect in subject in need. In some embodiments, inhibitors are delivered using adeno-associated virus (AAV) vectors at 10,000 to 500,000 vector genomes / cell (or any value therebetween). In certain embodiments, inhibitors are delivered using lentiviral vectors at an MOI between 250 and 1,000 (or any value therebetween). In other embodiments, inhibitors are delivered using plasmid vectors at 0.01 to 1,000 nanograms / 100,000 cells (or any value therebetween). In other embodiments, inhibitors are delivered in mRNA form at 0.01 to 3000 nanograms / cell number (e.g., 50,000 to 200,000 (e.g., 100,000) cells) (or any value therebetween). In other embodiments, inhibitors are delivered to the brain parenchyma using adeno-associated virus (AAV) vectors at 1E11-1E14Vg / mL with a fixed volume of 1 to 300 μL. In other embodiments, the inhibitor is delivered to the CSF using an adeno-associated viral (AAV) vector at 1E11-1E14 Vg / mL in a fixed volume of 0.5 to 10 mL.

[0070] In any of the methods described herein, the method can result in about 50% or more, 55% or more, 60% or more, 65% or more, about 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more regulation (e.g., inhibition) of the targeted allele(s) in one or more cells of the subject. In some embodiments, the wild-type and mutant alleles are regulated differently, e.g., the mutant allele is preferentially modified compared to the wild-type allele (e.g., the mutant allele is suppressed by at least 70% and the wild-type allele is suppressed by no more than 50%).

[0071] In any of the methods described herein, the method can produce about 50% or more, 55% or more, 60% or more, 65% or more, about 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more modulation (e.g., inhibition) of antisense expression of the targeted allele(s) in one or more cells of the subject. In some embodiments, sense expression and antisense expression in the mutant allele are regulated in different ways, for example, in the mutant allele, expression of the antisense transcript is preferentially regulated compared to expression of the sense transcript (e.g., antisense expression is inhibited by at least 70% and sense expression is inhibited by no more than 50%).

[0072] In other aspects, a transcription factor as described herein, such as a transcription factor comprising one or more of a zinc finger protein (ZFP-TF), a TALE (TALE-TF), and a CRISPR / Cas-TF, e.g., a ZFP-TF, a TALE-TF, or a CRISPR / Cas-TF, is used to inhibit expression of a mutant and / or wild-type allele (e.g., C9orf72) in the brain (e.g., neurons) of a subject. The inhibition can be about 50% or more, 55% or more, 60% or more, 65% or more, 70% or more, about 75% or more, about 85% or more, about 90% or more, about 92% or more, or about 95% or more of the targeted allele in the one or more cells of the subject compared to an untreated (wild-type) cell of the subject. In certain embodiments, the wild-type allele is inhibited by no more than 50% (compared to an untreated cell or subject), and the mutant (lesion or isoform variant) is inhibited by at least 70% (compared to an untreated cell or subject). In certain embodiments, antisense transcription is completely (completely) inhibited. In certain embodiments, the sense transcript is inhibited by no more than 50% (compared to an untreated cell or subject), and the antisense transcript is inhibited by at least 70% (compared to an untreated cell or subject). In certain embodiments, targeted regulatory transcription factors can be used to implement one or more of the methods described herein.

[0073] Therefore, described herein are methods and compositions for regulating gene expression associated with rare diseases disclosed herein, including suppressing when expressing or not expressing exogenous sequences (such as artificial TFs). Compositions and methods can be used in vitro (e.g., to provide cells for studying target genes (regulated therethrough); for drug discovery; and / or preparing genetically modified animals and animal models), in vivo or in vitro, and include administering artificial transcription factors or nucleases comprising DNA binding molecules targeted to rare disease-related genes, optionally in the presence of a donor that is integrated into the gene after nuclease cleavage. In some embodiments, in cells, the donor gene (transgenic gene) is maintained outside the chromosome. In certain embodiments, the cell is in a disease patient. In other embodiments, the cell is modified by any method described herein, and the modified cell is administered to a subject in need (e.g., a subject with a rare disease). Genetically modified cells (e.g., stem cells, precursor cells, T cells, muscle cells, etc.) comprising genetically modified genes (e.g., exogenous sequences) are also provided, including cells obtained by the methods described herein. These cells can be used to provide therapeutic protein(s) to subjects with rare diseases, for example by administering the cell(s) to a subject in need thereof, or alternatively, by isolating the protein produced by the cells and administering the protein to a subject in need thereof (enzyme replacement therapy).

[0074] Also provided are kits comprising one or more of the following: a genetic modulator (e.g., an inhibitor) as described herein and / or a polynucleotide comprising a component of a modulator of interest (or a component thereof) and / or a polynucleotide encoding a modulator of interest (or a component thereof). The kit may further comprise cells (e.g., neurons or muscle cells), reagents (e.g., for detecting and / or quantifying proteins, e.g., in CSF), and / or instructions for use comprising a method as described herein.

[0075] The methods and compositions of the present invention are described in further detail below.

[0076] I. Zinc finger transcription factors

[0077] The ZFP-TF of the present invention is a fusion protein containing a DNA-binding zinc finger protein (ZFP) domain and a transcriptional repressor domain, wherein the two domains can be associated with each other by a direct peptidyl linkage or a peptide linker, or by dimerization (e.g., via a leucine zipper, a STAT protein N-terminal domain, or an FK506 binding protein). As used herein, "fusion protein" refers to a complex of polypeptides having covalently linked domains and polypeptides associated with each other via non-covalent bonds. The transcriptional repressor domain can be associated with the ZFP domain at any suitable position, including at the C-terminus or N-terminus of the ZFP domain.

[0078] In some embodiments, the ZFP-TFs of the present invention inhibit transcription of the human mutant C9orf72 gene by 45% or more (e.g., 50%, 60%, 70%, 80%, 90%, or 95% or more). In some embodiments, two or more ZFP-TFs of the present invention are used simultaneously in a patient, wherein the ZFP-TFs bind to different DNA motifs in the sense and / or antisense strands of the amplified C9orf72 region to achieve optimal inhibition of mutant C9orf72 transcription.

[0079] A. Targeting of ZFP Domains

[0080] The ZFP domain of the fusion protein of the present invention preferentially binds to the amplified region in the mutant human C9orf72 gene allele. The human C9orf72 gene is located at position 21.2 (9p21.2) on the short (p) arm of chromosome 9. It spans base pairs 27,546,546 to 27,573,866 on this chromosome. The genomic structure of human C9orf72 is Figure 1A The DNA-binding ZFP domain of the ZFP-TF guides the fusion protein to the expanded repeat region of the mutant C9orf72 gene and brings the transcriptional repressor domain of the fusion protein to the target region. The repressor domain then inhibits C9orf72 gene transcription by RNA polymerase.

[0081] In some embodiments, the target sequence in the amplification region is at least 8 bp in length. For example, the target sequence can be 8 bp to 40 bp in length, such as 12, 15, 16, 17, 18, 19, 20, 21, 24, 27, 30, 33, or 36 bp in length. In certain embodiments, the target sequence of a ZFP-TF of the present invention is 12 to 20 (e.g., 12 to 18, 15 to 19, 15, 18, or 19) bp in length. In some embodiments, the target sequence comprises a discontinuous subsequence.

[0082] The G4C2 repeats give rise to the following six-nucleotide DNA motif in both the sense and antisense strands of the gene:

[0083] Motif in the positive-sense C9orf72 strand:

[0084] (i) GGGGCC (SEQ ID NO: 1)

[0085] (ii) GGGCCG (SEQ ID NO: 2)

[0086] (iii) GGCCGG (SEQ ID NO: 3)

[0087] (iv) GCCGGG (SEQ ID NO: 4)

[0088] (v) CCGGGG (SEQ ID NO: 5)

[0089] (vi) CGGGGC (SEQ ID NO: 6)

[0090] Motif in the antisense C9orf72 strand:

[0091] (vii) GGCCCC (SEQ ID NO: 7)

[0092] (viii) GCCCCG (SEQ ID NO: 8)

[0093] (ix) CCCCGG (SEQ ID NO: 9)

[0094] (x) CCCGGC (SEQ ID NO: 10)

[0095] (xi) CCGGCC (SEQ ID NO: 11)

[0096] (xii) CGGCCC (SEQ ID NO: 12)

[0097] In some embodiments, the target sequence of a ZFP-TF of the invention comprises one or more (e.g., 2, 3, or 4) tandem repeats of one of these DNA motifs. In some embodiments, the target sequence consists of three tandem repeats of one of the motifs. In some embodiments, the target sequence comprises one or more (e.g., 2 or 3) tandem repeats of a motif plus several (e.g., 1, 2, 3, 4, or 5) nucleotides from upstream and / or downstream adjacent sequences (e.g., CC(G4C2)2GG) (SEQ ID NO: 75).

[0098] The target sequence can be on the sense strand of the gene or the antisense strand of the gene. In certain embodiments, the ZFP-TF used in the patient binds to both the sense strand and the antisense strand of the mutant allele. To ensure targeting accuracy and to reduce off-target binding of the ZFP-TF, the sequence of the selected C9orf72 target region preferably has less than 75% homology (e.g., less than 70%, less than 65%, less than 60%, or less than 50% homology) with sequences in other genes in the genome.

[0099] Other criteria for further evaluation of target segments include the previous availability of ZFPs that bind to such segments or related segments, the ease of designing new ZFPs that bind to a given target segment, and the risk of off-target binding.

[0100] B. Zinc finger protein domain

[0101] "Zinc finger protein" or "ZFP" refers to a protein with a DNA binding domain stabilized by zinc. ZFPs bind to DNA in a sequence-specific manner. Individual DNA binding domains are called "fingers". ZFPs have at least one finger, each of which binds two to four DNA base pairs, typically three or four DNA base pairs. Each zinc finger typically comprises approximately 30 amino acids and chelates zinc. Engineered ZFPs can have novel binding specificity compared to naturally occurring zinc finger proteins. Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, the use of a database comprising triplet (or quadruple) nucleotide sequences and individual zinc finger amino acid sequences, wherein each triplet or quadruple nucleotide sequence is associated with one or more amino acid sequences of a zinc finger that binds to a specific triplet or quadruple sequence. See, for example, the ZFP design methods described in detail in U.S. Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,140,081; 6,200,759; 6,453,242; 6,534,261; 6,979,539; 8,586,526; 8,841,260; 8,956,828; and 9,234,016; and International Patent Publications WO95 / 19431; WO96 / 06166; WO98 / 53057; WO98 / 53058; WO98 / 53059; WO98 / 53060; WO98 / 54311; WO00 / 27878; WO01 / 60970; WO01 / 88197; WO02 / 016536; WO02 / 099084; and WO03 / 016496.

[0102] The ZFP domain of the ZFP-TF of the present invention can include at least three (e.g., four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen or more) zinc fingers. A ZFP domain with three fingers generally recognizes a target site comprising 9 to 12 nucleotides. A ZFP domain with four fingers generally recognizes a target site comprising 12 to 15 nucleotides. A ZFP domain with five fingers generally recognizes a target site comprising 15 to 18 nucleotides. A ZFP domain with six fingers can recognize a target site comprising 18 to 21 nucleotides.

[0103] As described in, for example, U.S. Patent Publication 2018 / 0087072, the target specificity of a ZFP domain can be improved by mutations to the ZFP backbone. Mutations include mutations to residues in the ZFP backbone that may interact non-specifically with phosphates on the DNA backbone but are not involved in nucleotide target specificity. In some embodiments, these mutations comprise mutating cationic amino acid residues to neutral or anionic amino acid residues. In some embodiments, these mutations comprise mutating polar amino acid residues to neutral or non-polar amino acid residues. In other embodiments, the mutations are made at positions (-5), (-9), and / or (-14) relative to the DNA binding helix. In some embodiments, a zinc finger may comprise one or more mutations at positions (-5), (-9), and / or (-14). In other embodiments, one or more zinc fingers in a multi-fingered ZFP domain may comprise mutations at positions (-5), (-9), and / or (-14). In some embodiments, the amino acid at position (-5), (-9) and / or (-14) (e.g., arginine (R) or lysine (K)) is mutated to alanine (A), leucine (L), Ser (S), Asp (N), Glu (E), Tyr (Y) and / or glutamine (Q). In some embodiments, the R residue at position (-5) is mutated to Q.

[0104] Alternatively, the DNA binding domain may be derived from a nuclease. For example, recognition sequences for homing endonucleases and meganucleases such as I-Scel, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-Crel, I-TevI, I-TevII, and I-TevIII are known. See also U.S. Patents 5,420,032 and 6,833,252; Belfort et al., Nucleic Acids Res. (1997) 25:3379-88; Dujon et al., Gene (1989) 82:115-8; Perler et al., Nucleic Acids Res. (1994) 22:1125-7; Jasin, Trends Genet. (1996) 12:224-8; Gimble et al., J Mol Biol. (1996) 263:163-80; Argast et al., J Mol Biol. (1998) 280:345-53; and the New England Biolabs catalog.

[0105] In some embodiments, the ZFP-TF of the present invention comprises one or more zinc finger domains. The domains can be connected together via an extendable flexible linker, such that, for example, one domain comprises one or more (e.g., 4, 5, or 6) zinc fingers, and the other domain comprises another one or more (e.g., 4, 5, or 6) zinc fingers. In some embodiments, the linker is a standard inter-finger linker, such that the index group comprises a DNA binding domain comprising 8, 9, 10, 11, or 12 or more fingers. In other embodiments, the linker is an atypical linker, such as a flexible linker. For example, two ZFP domains can be connected to the transcriptional repressor TF in the following configuration (N-terminus to C-terminus): ZFP-ZFP-TF, TF-ZFP-ZFP, ZFP-TF-ZFP, or ZFP-TF-ZFP-TF (two ZFP-TF fusion proteins are fused together via a linker).

[0106] In some embodiments, the ZFP-TF is "two-handed," that is, it contains two zinc finger clusters (two ZFP domains) separated by an intermediate amino acid, such that the two ZFP domains bind to two non-contiguous target sites. An example of a two-handed zinc finger binding protein is SIP1, in which a cluster of four zinc fingers is located at the amino terminus of the protein and a cluster of three fingers is located at the carboxyl terminus (see Remacle et al., EMBO J. (1999) 18(18):5073-84). Each cluster of zinc fingers in these proteins is capable of binding to a unique target sequence, and the interval between the two target sequences can comprise many nucleotides.

[0107] In alternative embodiments, proteins that are functionally similar to ZFP-TFs can be used instead of ZFP-TFs. For example, transcriptional repressor fusion proteins can include DNA binding domains derived from transcriptional activators, such as effector (TALE) DNA binding domains, rather than ZFP domains. See, for example, U.S. Patents 8,586,526 and 9,458,205; U.S. Patent Publications 2013 / 0196373 and 2013 / 0253040; WO 2010 / 079430; Schornack et al., J Plant Physiol (2006) 163(3):256-72); Kay et al., Science (2007) 318:648-51; Moscou and Bogdanove, Science (2009) 326:1501; and Boch et al., Science (2009) 326:1509-12. In another example, the transcriptional repressor fusion protein can include a DNA binding domain that is a single guide RNA for the CRISPR / Cas system. See, for example, U.S. Patent Publication 2015 / 0056705; Jinek et al., Science (2012) 337:816; Ramalingam et al., Genome Biol. (2013) 14:107; Hwang et al., (2013) Nature Biotechnology 31(3):227.

[0108] C. Transcriptional repressor domain

[0109] The ZFP-TFs of the present invention comprise one or more transcriptional repressor domains that attenuate the transcriptional activity of mutant C9orf72 alleles. Non-limiting examples of transcriptional repressor domains are the KRAB domain of KOX1, KAP-1, MAD, FKHR, EGR-1, ERD, SID, TGFβ-inducible early gene (TIEG), v-ERB-A, MBD2, MBD3, DNMT family members (e.g., DNMT1, DNMT3A, DNMT3B), Rb, and MeCP2. See, for example, Bird et al., Cell (1999) 99:451-54; Tyler et al., Cell (1999) 99:443-46; Knoepfler et al., Cell (1999) 99:447-50; Robertson et al., Nature Genet. (2000) 25:338-42. Additional exemplary repressor domains include, but are not limited to, ROM2 and AtHD2A. See, eg, Chem et al., Plant Cell (1996) 8:305-21; and Wu et al., Plant J. (2000) 22:19-27.

[0110] In some embodiments, the transcriptional repressor domain comprises a sequence from the Kruppel-associated box (KRAB) domain of human zinc finger protein 10 / KOX1 (ZNF10 / KOX1) (e.g., GenBank No. NM_015394.4). An exemplary KRAB domain sequence is:

[0111] DAKSLTAWSR TLVTFKDVFV DFTREEWKLL DTAQQIVYRN VMLENYKNLV SLGYQLTKPDVILRLEKGEE PWLVEREIHQ ETHPDSETAF EIKSSV

[0112] (SEQ ID NO: 13).

[0113] Variants of this KRAB sequence can also be used, as long as they have the same or similar transcriptional repression function.

[0114] D. Peptide Linkers

[0115] The ZFP domains and transcriptional repressor domains and / or zinc fingers within the ZFP domains of the ZFP-TFs of the present invention can be connected via peptide linkers, such as non-cleavable peptide linkers of about 5 to 200 amino acids (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids). Some preferred linkers are flexible amino acid sequences synthesized as recombinant fusion proteins. See, for example, the above description; and U.S. Patents 6,479,626; 6,903,185; 7,153,949; 8,772,453; and 9,163,245; and WO2011 / 139349. The proteins described herein can include any combination of suitable linkers. Non-limiting examples of linkers are DGGGS (SEQ ID NO: 14), TGEKP (SEQ ID NO: 15), LRQKDGERP (SEQ ID NO: 16), GGRR (SEQ ID NO: 17), GGRRGGGS (SEQ ID NO: 18), LRQRDGERP (SEQ ID NO: 19), LRQKDGGGSERP (SEQ ID NO: 20), LRQKD(G3S)2ERP (SEQ ID NO: 21), TGSQKP (SEQ ID NO: 22), LRQKDAARGS (SEQ ID NO: 26), and LRQKDAARGSGG (SEQ ID NO: 76).

[0116] In some embodiments, the peptide linker is 3 to 20 amino acid residues in length and is rich in G and / or S. A non-limiting example of such a linker is a G4S-type linker ("G4S" is disclosed as SEQ ID NO: 23), i.e., a linker containing one or more (e.g., 2, 3, or 4) GGGGS (SEQ ID NO: 23) motifs or variations of the motif (such as those having one, two, or three amino acid insertions, deletions, and substitutions in the motif).

[0117] In some embodiments, the ZFP-TF comprises a nuclear localization signal (eg, the nuclear localization signal from the SV40 medium T antigen) and / or an epitope tag (eg, FLAG and hemagglutinin).

[0118] II. Expression of ZFP-TF

[0119] The ZFP-TF of the present disclosure can be introduced into a patient via a nucleic acid molecule encoding the same. For example, the nucleic acid molecule is an RNA molecule, and the RNA molecule is introduced into the patient's brain via injection of a composition comprising a lipid:nucleic acid complex (e.g., liposome). Alternatively, the ZFP-TF can be introduced into a patient via a nucleic acid expression vector comprising the coding sequence of the ZFP-TF. The expression vector may include expression control sequences (such as promoters, enhancers), transcription signal sequences, and transcription termination sequences that allow the coding sequence of the ZFP-TF to be expressed in cells of the nervous system (e.g., central nervous system). In some embodiments, the expression vector continues to exist in the cell in the form of a stable episome. In other embodiments, the expression vector is integrated into the genome of the cell.

[0120] In some embodiments, the promoter used on the vector to direct the expression of the ZFP-TF in the brain is a constitutively active promoter or an inducible promoter. Suitable promoters include, but are not limited to, Rous sarcoma virus (RSV) long terminal repeat (LTR) promoter (optionally with RSV enhancer), cytomegalovirus (CMV) promoter (optionally with CMV enhancer), CMV immediate early promoter, simian virus 40 (SV40) promoter, dihydrofolate reductase (DHFR) promoter, β-actin promoter, phosphoglycerate kinase (PGK) promoter, EF1α promoter, Moloney murine leukemia virus (MoMLV) LTR, creatine kinase (CK6) based promoter, thyroxine transporter Protein promoter (TTR), thymidine kinase (TK) promoter, tetracycline responsive promoter (TRE), hepatitis B virus (HBV) promoter, human α1-antitrypsin (hAAT) promoter, chimeric liver-specific promoter (LSP), E2 factor (E2F) promoter, human telomerase reverse transcriptase (hTERT) promoter, CMV enhancer / chicken β-actin / rabbit β-hemoglobin promoter (CAG promoter; Niwa et al., Gene (1991) 108 (2): 193-9) and RU-486 responsive promoter. Neuron-specific promoters such as synapsin I promoter, calcium / calmodulin-dependent protein kinase II (CamKII) promoter, methyl CpG binding protein 2 (MeCP2) promoter, choline acetyltransferase (ChAT) promoter and calcium binding protein (Calb) promoter can also be used. Astrocyte-specific promoters, such as the glial fibrillary acidic protein (GFAP) promoter or the aldehyde dehydrogenase 1 family member L1 (Aldh1L1) promoter, can also be used. Oligodendrocyte-specific promoters, such as the Olig2 promoter, can also be used. In addition, the promoter can include one or more self-regulatory elements, whereby the ZFP-TF can bind and suppress its own expression level to a predetermined threshold. See U.S. Patent No. 9,624,498.

[0121] Any method for introducing a nucleotide sequence into a cell may be used, including but not limited to electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, liposomes in combination with a nuclear localization signal, naturally occurring liposomes (e.g., exosomes), or viral transduction.

[0122] For the in vivo delivery of expression vectors, viral transduction can be used. A variety of viral vectors known in the art may be applicable to the present invention, such as vaccinia vectors, adenoviral vectors, lentiviral vectors, poxvirus vectors, herpesvirus vectors, adeno-associated virus (AAV) vectors, retroviral vectors and hybrid virus vectors. In some embodiments, the viral vector used herein is a recombinant AAV (rAAV) vector. AAV vectors are particularly suitable for central nervous system (CNS) gene delivery, because AAV infects both dividing cells and non-dividing cells and has extremely low immunogenicity, and the viral genome exists in the form of a stable episomal structure for long-term expression (Hadaczek et al., Mol Ther. (2010) 18: 1458-61; Zaiss et al., Gene Ther. (2008) 15: 808-16). Any suitable AAV serotype can be used. For example, the AAV can be AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV8.2, AAV9, or AAVrh10, or have a pseudotype (e.g., AAV2 / 8, AAV2 / 5, AAV2 / 6, AAV2 / 9, or AAV2 / 6 / 9). See, e.g., U.S. Patents 7,198,951 and 9,585,971.

[0123] In some embodiments, the expression vector is an AAV vector and is introduced into target human cells by recombinant AAV virions, the genome of which comprises a construct including an AAV inverted terminal repeat (ITR) sequence at both ends, so that AAV virions can be produced in a production system such as an insect cell / baculovirus production system or a mammalian cell production system. AAV can be engineered so that the immunogenicity of its capsid protein in the human body is reduced and the transduction capacity is enhanced. In some embodiments, AAV9 is used. The viral vectors described herein can be produced using methods known in the art. Any suitable permissive or packaging cell type can be used to produce viral particles. For example, mammalian (e.g., 293) insect (e.g., Sf9) cells can be used as packaging cell lines.

[0124] For methods of expressing therapeutic proteins, including ZFPs, in the nervous system of a patient in need thereof, see also U.S. Patents 6,309,634; 6,453,242; 6,503,717; 6,534,261; 6,599,692; 6,607,882; 6,689,558; 6,824,978; 6,933,113; 6,953,575; 6,979,539; 7,013,219; 7,163,824; 7,182,944; 8,309,355; 8,337,458; 8,586,526; 9,050,299; and 9,089,667.

[0125] III. Medical Applications

[0126] The ZFP-TFs of the present invention can be used to treat patients who need to downregulate C9orf72 expression, particularly downregulating expression of mutant C9orf72 alleles. Patients suffer from or are at risk of developing C9orf72-related neurodegenerative diseases (such as ALS and C9FTD). Patients at risk include those who are genetically predisposed to the disease, those who have suffered repeated brain trauma (such as concussions), and those who have been exposed to environmental neurotoxins. The present invention provides methods for treating C9orf72-related neurological diseases (e.g., ALS and C9FTD) in subjects (e.g., human patients in need thereof), comprising introducing a therapeutically effective amount (e.g., an amount that sufficiently inhibits expression of mutant C9orf72 alleles) of a ZFP-TF (e.g., an rAAV vector expressing the same) into the nervous system (e.g., CNS) of the subject. The term "treating" encompasses alleviating symptoms, preventing the onset of symptoms, slowing disease progression, improving quality of life, and increasing survival rates.

[0127] The present invention provides pharmaceutical compositions comprising viral vectors, such as rAAVs whose recombinant genome comprises an expression cassette for a ZFP-TF. The pharmaceutical compositions may further comprise a pharmaceutically acceptable carrier, such as water, saline (e.g., phosphate-buffered saline), dextrose, glycerol, sucrose, lactose, gelatin, dextran, albumin, or pectin. In addition, the compositions may contain auxiliary substances, such as wetting or emulsifying agents, pH buffers, stabilizers, or other agents that enhance the effectiveness of the pharmaceutical composition. The pharmaceutical compositions may contain delivery vehicles, such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, and vesicles.

[0128] The cells targeted by the therapeutic agents of the present invention are cells in the brain and / or spinal cord, including but not limited to neuronal cells (e.g., motor neurons, sensory neurons, dopaminergic neurons, cholinergic neurons, glutamatergic neurons, GABAergic neurons, or serotonergic neurons); glial cells (e.g., oligodendrocytes, astrocytes, pericytes, Schwann cells, or microglial cells); ependymal cells; or neuroepithelial cells. The targeted brain regions may be the cortical region, frontotemporal region, entorhinal cortex, hippocampus, cerebellum, pons, and medulla. These regions can be reached directly via intrahippocampal injection, intracerebral injection, intracisternal (ICM) injection, or more generally via intraparenchymal injection, intracerebroventricular (ICV) injection, intrathecal injection, or intravenous injection. Other routes of administration include, but are not limited to, intracerebral, intraventricular, intranasal, or intraocular administration. In some embodiments, after being directly administered to cerebrospinal fluid (CSF) via intrathecal and / or intracerebral injection or intracisternal injection or intraventricular injection, viral vector propagates in whole CNS tissue. In other embodiments, after intravenous administration, viral vector passes through the blood-brain barrier and realizes extensive distribution in the whole CNS tissue of experimenter. In other embodiments, viral vector is directly delivered to target area via intraparenchymal injection. In some cases, after intraparenchymal delivery, viral vector can experience retrograde or anterograde transport to arrive other brain regions. In some aspects, viral vector has unique CNS tissue targeting ability (for example, CNS tissue tropism), which realizes stable and non-toxic gene transfer with high efficiency.

[0129] For example, the pharmaceutical composition can be provided to a patient via intraventricular administration, for example, administration to the ventricular region of the patient's forebrain, such as the right lateral ventricle, left lateral ventricle, third ventricle, or fourth ventricle. The pharmaceutical composition can be provided to a patient via intracerebral administration, for example, injection of the composition into or near the cerebrum, medulla, pons, cerebellum, intracranial cavity, meninges, dura mater, arachnoid membrane, or pia mater of the brain. In some cases, intracerebral administration can include administering the agent into the cerebrospinal fluid (CSF) in the subarachnoid space surrounding the brain.

[0130] In some cases, intracerebral administration involves the use of stereotactic surgical injection. Stereotactic surgery is well known in the art and generally involves the use of a computer and a three-dimensional scanning device, which are used together to guide injection into a specific brain region, such as a ventricular region. A microinjection pump (e.g., from World Precision Instruments) can also be used. In some cases, a microinjection pump is used to deliver a composition comprising a viral vector. In some cases, the infusion rate of the composition is in the range of 1 microliter / minute to 100 microliters / minute. As will be appreciated by those skilled in the art, the infusion rate will depend on a variety of factors, including, for example, the age of the subject, the weight / size of the subject, the serotype of AAV, the required dose, and the targeted brain region. Therefore, those skilled in the art may consider that other infusion rates are appropriate in certain environments.

[0131] Delivery of rAAV to a subject can be achieved, for example, by intravenous administration. In some cases, it may be desirable to deliver rAAV locally to brain tissue, spinal cord, cerebrospinal fluid (CSF), neuronal cells, glial cells, meninges, astrocytes, oligodendrocytes, interstitial spaces, and the like. In some cases, recombinant AAV (e.g., 10 7 -10 15 AAV can be delivered directly to the CNS using a needle, catheter, or related device using neurosurgical techniques known in the art, such as stereotactic injection. See, for example, Stein et al., J Vir. (1999) 73:3424-9; Davidson et al., PNAS. (2000) 97:3428-32; Davidson et al., Nat Genet. (1993) 3:219-223; and Alisky and Davidson, Hum. Gene Ther. (2000) 11:2315-29; U.S. Patents 7,837,668 and 8,092,429.

[0132] Unless otherwise defined herein, scientific and technical terms used in conjunction with the present invention will have the meanings commonly understood by those skilled in the art. Exemplary methods and materials are described below, but methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. In the event of a conflict, the present specification (including definitions) will prevail. In general, the nomenclature used in conjunction with neurology, medicine, medical and pharmaceutical chemistry, and cell biology described herein and the techniques of the disciplines are well known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to the manufacturer's instructions as commonly practiced in the art or as described herein. In addition, unless the context requires otherwise, singular terms shall include the plural and plural terms shall include the singular. Throughout this specification and embodiments, the words "have" and "comprise" or variations such as "has / having", "comprises / comprising" shall be understood to imply the inclusion of the stated integer or group of integers, but not to exclude any other integer or group of integers. All publications and other references mentioned herein are incorporated by reference in their entirety. Although various documents are cited herein, this citation does not constitute permission for any of these documents to form part of the common general knowledge in this technology. As used herein, the term "substantially" or "about" as applied to one or more values ​​of interest refers to a value similar to the stated reference value. In certain embodiments, unless otherwise stated or otherwise apparent from the context, the term refers to a range of values ​​within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less in either direction of the stated reference value (greater than or less than).

[0133] In order to make the present invention more understandable, the following embodiments and examples are listed. These embodiments and examples are for illustrative purposes only and should not be considered to limit the scope of the present invention in any way.

[0134] IV. Exemplary Implementations

[0135] Non-limiting exemplary embodiments of the invention are described below.

[0136] 1. A method for inhibiting sense and / or antisense transcription of a C9orf72 gene in a cell, the method comprising treating the cell with one or more C9orf72 gene inhibitors, the one or more inhibitors comprising a transcriptional inhibitor domain and a DNA binding domain that binds to a target site in the C9orf72 gene, optionally wherein the one or more inhibitors comprise one or more zinc finger protein transcription factors (ZFP-TFs), one or more TAL effector domain transcription factors (TALE-TFs) and / or one or more CRISPR / Cas transcription factors.

[0137] 2. The method of embodiment 1, wherein the C9orf72 gene comprises a mutant allele comprising one or more expanded (G4C2) repeat sequences, optionally wherein the target site is within the one or more expanded (G4C2) repeat sequences.

[0138] 3. Use of one or more ZFP-TFs, TALE-TFs and / or CRISPR / CasTF inhibitors that bind to a mutant C9orf72 expansion allele comprising one or more (G4C2) repeat sequences for inhibiting sense and / or antisense transcription in a subject in need thereof.

[0139] 4. The method or use according to any one of the preceding embodiments, wherein antisense transcription is inhibited by at least 50% compared to untreated cells.

[0140] 5. The method or use according to any one of the preceding embodiments, wherein antisense transcription is inhibited by at least 70% compared to untreated cells.

[0141] 6. The method or use according to any of the preceding embodiments, wherein transcripts comprising the expanded repeat sequence are selectively inhibited, optionally wherein antisense transcription is inhibited, sense transcription from the 1a promoter is inhibited and / or sense transcription from the 1b promoter is not inhibited.

[0142] 7. The method or use according to any one of the preceding embodiments, wherein the one or more ZFP-TF inhibitors comprise a ZFP having recognition helical regions in the order shown in Table 1.

[0143] 8. The method or use according to any one of the preceding embodiments, wherein the one or more ZFP-TF inhibitors are administered to the cells in the form of mRNA or using a viral vector.

[0144] 9. The method or use according to embodiment 8, wherein the viral vector is an Ad or AAV vector.

[0145] 10. The method or use according to embodiment 9, wherein the AAV vector is an AAV2 / 9 vector.

[0146] 11. The method or use according to any one of the preceding embodiments, wherein the cell is in a living subject and the one or more ZFP-TF inhibitors are administered to the subject.

[0147] 12. The method or use according to embodiment 11, wherein the one or more ZFP-TF inhibitors are administered intracerebroventricularly, intrathecally, intracranially, retro-orbitally (RO), intravenously, intranasally and / or intracisternally to the subject.

[0148] 13. The method or use of embodiment 12, wherein the ZFP-TF inhibitor is administered unilaterally or bilaterally to the hippocampus of the subject, optionally using an AAV vector at a dose of 1E10 to 1E13 (eg, 6E11) vg / hemisphere.

[0149] 14. The method or use according to any one of the preceding embodiments, wherein the cell is a neuron.

[0150] 15. The method or use according to any of the previous embodiments, wherein two or more ZFP-TF inhibitors are administered.

[0151] 16. The method or use according to embodiment 15, wherein the two or more ZFP-TF inhibitors are carried on the same or different non-viral or viral vectors.

[0152] 17. The method or use according to any one of the preceding embodiments, wherein the subject is treated for ALS and / or FTD.

[0153] 18. The method or use according to any one of the preceding embodiments, wherein one or more symptoms of ALS and / or FTD are improved in the subject.

[0154] 19. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 78021.

[0155] 20. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 75114.

[0156] 21. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 75115.

[0157] 22. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 74969.

[0158] 23. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79895.

[0159] 24. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79898.

[0160] 25. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 74986.

[0161] 26. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79899.

[0162] 27. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79901.

[0163] 28. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79902.

[0164] 29. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79904.

[0165] 30. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79916.

[0166] 31. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 75027.

[0167] 32. A ZFP-TF fusion protein that binds to a target sequence and comprises zinc fingers corresponding to the SBS IDs shown in Table 1, said zinc fingers comprising the DNA binding (recognition) helix sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79921.

[0168] 33. The ZFP-TF fusion protein of any one of embodiments 19 to 32, wherein the ZFP-TF fusion protein comprises a transcriptional repressor domain comprising SEQ ID NO: 13.

[0169] 34. The ZFP-TF fusion protein of any one of embodiments 19 to 33, wherein the zinc finger domain and the transcriptional repressor domain are connected by a peptide linker comprising SEQ ID NO: 26. Example

[0170] Example 1: Artificial transcription inhibitors

[0171] A panel of ZFP-TFs was generated to target amplification of the human C9orf72 allele. Exemplary ZFP-TFs are shown in Table 1 below. Each of these ZFP-TFs contains a six-fingered ZFP domain and a KRAB domain as described above (SEQ ID NO: 13). A peptide linker was used to connect the ZFP domain to the KRAB domain. The linker had the following amino acid sequence: LRQKDAARGS (SEQ ID NO: 26).

[0172] Table 1 shows the DNA sequence of the target site in each ZFP-TF and the amino acid sequence of the DNA binding helix of each zinc finger (F1 to F6). The SEQ ID NO is shown in parentheses. The target sequence bound by the ZFP domain in the target site is shown in uppercase letters, while the flanking sequence is shown in lowercase letters. SEQ ID NO: 24 is the target site on the sense strand of the gene allele, while SEQ ID NO: 25 is the target site on the antisense strand of the gene allele.

[0173] The DNA-binding helix is ​​the variable portion of the zinc finger and typically contains six or seven amino acid residues. As described, for example, in U.S. Patent Publication 2018 / 0087072, the target specificity of the ZFP domain can be improved by mutations to the ZFP backbone. The symbol "^" in the table indicates that the arginine (R) residue at position 4 upstream of the first amino acid in a given helix has been changed to a glutamine (Q). In each zinc finger helix sequence, the positions of the seven DNA-binding amino acids are numbered -1, +1, +2, +3, +4, +5, and +6. Therefore, the position number for an R to Q substitution is (-5).

[0174] Table 1 Exemplary C9orf72ZFP-TF

[0175]

[0176]

[0177]

[0178]

[0179]

[0180] ZFP-TFs were evaluated by standard SELEX analysis (see, e.g., Miller et al., Nat Biotech. (2010) doi: 10.1038 / nbt.1755; Wilen et al., PLoS (2011) 7(4): e1002020). All ZFP-TFs were shown to bind to their target sites.

[0181] Five types of human cell lines and one mouse cell line were used in the study. The C9021 fibroblast cell line was obtained from the ALS Research Institute at Columbia University and is derived from an ALS-FTD patient. This cell line contains 5 G4C2 repeats on its normal allele and approximately 850 repeats on its amplified allele. The wild-type fibroblast cell line (NDS00035), 353TRAD, and 204TDP fibroblast cell lines were obtained from the National Institute of Neurological Disorders and Stroke. The wild-type line contains two G4C2 repeats on each allele. The 353TRAD line contains 5 repeats on one allele and 8 repeats on the other allele. The 204TDP line has 2 repeats on one allele and 20 repeats on the other allele. For all fibroblast experiments, human neuron lines were obtained from Cell Dynamics International (iCell GABA Neurons Kit, 01434; Catalog No. R1013; Cell Lot No. 104901). Mouse cortical neurons were obtained from GIBCO (Catalog No. A15586). ZFP74960, which binds to its target region but has no observable inhibitory effect, was used as a negative control.

[0182] For all experiments conducted in patient-derived fibroblasts, transfection of ZFP-TF mRNA into cells was performed using the 96-well ShuttleNucleofector system from Lonza. 1, 3, 10, 30, 100, and 300 ng of ZFP-TF mRNA were transfected per 40,000 cells using the Amaxa P2 Primary CellsNucleofector kit with the CA-137 protocol. After overnight incubation, cDNA was generated from the transfected cells using the Cells-to-Ct kit (Thermo Fisher Scientific), followed by gene expression analysis using qRT-PCR.

[0183] For neuronal transduction, the ZFP was incorporated into an AAV6 plasmid. Neurons were transduced with the AAV6-ZFP. All transductions were performed at an MOI of 3,000. Mouse neurons were harvested 7 days after transduction, while human neurons were harvested 19 days after transduction. After harvest, the cells were processed for microarray analysis.

[0184] Screening assays were performed in multiple rounds. In each round, ZFPs were tested at multiple concentrations to identify ZFP-TFs with suitable on-target (selective inhibition) profiles. Round 2 screening was performed in C9 (C9021) cells to assess amplified positive transcript (disease) C9orf72 levels relative to total C9orf72 ("total C9") mature mRNA following ZFP-TF treatment. RT-PCR analysis used a primer / probe set targeting intron region 1a.

[0185] Amplification of positive-sense C9orf72 transcripts:

[0186] Forward: 5'CCCTCTCTCCCCACTACTTG 3' (SEQ ID NO: 61)

[0187] Reverse: 5'CTACAGGCTGCGGTTGTTTCC 3' (SEQ ID NO: 62)

[0188] Probe: 5'TCTCACAGTACTCGCTGAGGGTGA 3' (SEQ ID NO: 63).

[0189] G4C2 expansion leads to inefficient splicing and accumulation of pre-mRNA containing the expansion ( Figure 2A ). In contrast, the efficiently spliced ​​wild-type (WT) pre-mRNA is present at very low levels. Using this assay in C9021 cells, we show that the ZFP-TFs tested exhibit broad-range inhibition of amplified sense (disease) C9orf72 transcripts. ( Figures 2B to 2D ).

[0190] To assess the inhibition of total C9orf72 mRNA, different primer / probe sets were used, which are denoted as "total C9" ( Figure 2A ):

[0191] Total C9orf72 mRNA:

[0192] Forward: 5'CTATGTGTGTGGTGGGATATGG 3' (SEQ ID NO: 58)

[0193] Reverse: 5'CTCCAGGTTATGTGAAGCAGAA 3' (SEQ ID NO: 59)

[0194] Probe: 5'AGGCCTGCTAAAGGATTCAACTGGAA 3' (SEQ ID NO: 60).

[0195] This primer / probe set detects mRNA that includes a region spanning exons 8 and 9. This region is present in all C9orf72 mRNA isoforms. As shown in Figure 2b, many ZFP-TFs showed modest repression of total C9orf72 transcripts. For example, ZFP-TFs 75114 and 75115 inhibited amplification of the positive sense (disease) transcript by more than 70%, while maintaining total C9orf72 mRNA expression by more than 50% ( Figure 2D , second round data).

[0196] In round 3, total C9orf72 mRNA was assessed and compared between C9021 cells and wild-type (WT) cells to further evaluate the effect of the tested ZFP-TFs on the amount of total C9orf72 mRNA. The data showed that the reduction in total C9orf72 mRNA levels in mutant cells was much more significant than in WT cells ( Figures 2B to 2D ), and the levels were much less affected in wild-type cells treated with the same ZFP-TFs. The overall data suggest that for some ZFPs, such as 75109, 75114, and 75115, the amplification isoform was significantly suppressed (by about 70%), while maintaining about 50% of the total C9 transcripts in the C9 patient fibroblast cell line.

[0197] Isoform-selective inhibition of ZFP-TFs 75109, 75114, and 75115 was evaluated in three different patient-derived fibroblasts containing different G4C2 expanded repeat sequences (600, 800, and 850) on their expanded alleles ( Figure 6 All three ZFPs exhibited similar behaviors independent of the repeat expansion length, indicating that the selective inhibition of ZFP-TFs is independent of the G4C2 repeat length.

[0198] Inhibition of total C9 transcripts was assessed in two cell lines from healthy individuals with a greater than normal number of G4C2 repeats on their alleles ( Figure 7 In healthy cell lines, total C9 transcripts were minimally affected. ZFP-mediated repression of total C9 mRNA transcripts in a patient-derived cell line (C9021) was not truly representative of WT isoform levels because PCR analysis was used to detect total C9 mRNA transcripts targeting exons 8 and 9, which were absent in both amplified and non-amplified (WT) isoforms ( Figure 2A Total C9 mRNA transcript repression in response to isoform-selective ZFP-TFs (75109, 75114, and 75115) was assessed in two different healthy cell lines with different G4C2 repeat lengths on the alleles ( Figure 7). Cell line 353TREAD has 5 repeats on one allele and 8 repeats on the other allele, while cell line 204TDP has 2 repeats on one allele and 20 repeats on the other allele. Although total C9 mRNA transcripts were inhibited in a dose-dependent manner in the C9 cell line C921 (5 repeats on the non-amplified allele and 850 repeats on the amplified allele), they were minimally affected in the other two cell lines that do not have the amplified allele, indicating that the inhibition of total C9 isoforms in the disease line (5 / 850) is a result of inhibition of the amplified isoform and that expression of the non-amplified isoform is not affected by the selective ZFP-TF ( Figure 7 ).

[0199] Without being bound by theory, it is possible that the ZFP-TFs of the present invention can act in a cooperative manner to selectively repress alleles with large repeat sequences. This could be mediated by higher-order complexes, for example, through the recruitment of KAP1 co-repressors associated with the KRAB domains linked to the ZFPs. Under this hypothesis, the KAP1 / KRAB "scaffold" spanning multiple ZFP-TFs enhances the stability of the transcriptional repression machinery and enables preferential repression of amplified C9orf72 alleles compared to the wild-type allele.

[0200] Example 2: Specificity of C9orf72 inhibition

[0201] The global specificity of the ZFP-TFs shown in Table 1 was assessed by microarray analysis in the following three cell lines: C9021 fibroblasts, primary mouse cortical neurons, and human neurons. Briefly, for C9021 cells, 100 ng of ZFP-TF encoding mRNA was transfected into 150,000 C9021 cells in quadruplicate. After 24 hours, total RNA was extracted and processed using the manufacturer's protocol (Affymetrix Genechip MTA1.0). The raw signal from each probe set was normalized using robust multi-array average (RMA). Analysis was performed using Transcriptome Analysis Console 3.0 (Affymetrix) using the "Gene Level Differential Expression Analysis" option. Samples transfected with ZFP-TFs were compared with samples treated with an irrelevant ZFP-TF (a ZFP-TF that does not bind to the C9orf72 target site). Change calls were reported for transcripts (probe sets) with a mean signal >2-fold difference relative to control and a P value <0.05 (one-way ANOVA, unpaired T test for each probe set). A similar procedure was performed on neurons, except that they were transduced with AAV6 at an MOI of 3000 and cultured for 7 days for mouse neurons and 19 days for human neurons before collection.

[0202] Exemplary data are shown in Figures 8A to 8C The data show that ZFP-TF75027 exhibits several off-targets in addition to C9orf72 (shown as a circle), while ZFP-TF75109, 75114, and 75115 inhibit only C9orf72, with very few off-targets in both fibroblasts and neurons in both humans and mice. These results demonstrate that representative ZFP-TFs are highly specific for C9orf72.

[0203] Example 3: Detection of antisense-specific inhibition

[0204] Because sense and antisense transcripts are encoded by overlapping regions of DNA, we developed a detection strategy based on differential processing of transcripts. For sense mRNA from amplified alleles, the intron containing the amplified region (intron 1a) is mis-spliced ​​and retained, while all other introns are removed, including intron 1b. In contrast, the intron 1b region is a predicted exon of the antisense mRNA transcript and should be retained. Therefore, we designed and tested primers located within intron 1b and demonstrated specific detection of antisense transcripts, as described further below.

[0205] To detect C9orf72 transcripts, we used droplet digital PCR (ddPCR). Briefly, to create sense or antisense cDNA templates, RNA was purified from C9orf72 patient and healthy control cells (C9orf72 cell lines: C9-3, C9-6, C9-7, C9-5, C9-10, C9-11, C9-2, C9-4; control cell lines: KinALS6, Con3, Kin1ALS17, Con8, Con10, Con1; see Lagier-Tourenne et al., PNAS (2013) 110(47): E4530-9) and used to synthesize cDNA using the Superscript III (Thermo Fischer Scientific) first-strand synthesis system as follows:

[0206] 1) Combine 0.5 μg RNA, 0.5 μL of 10 mM strand-specific primers, and a dNTP mix, and make up to 10 μL with water. To generate the sense template, use primer 5'CTCTAGCGACTGGTGGAATTG3' (SEQ ID NO: 64). To generate the antisense template, use primer 5'GTGCATGGCAACTGTTTGAATA3' (SEQ ID NO: 65).

[0207] 2) Incubate the reaction at 65°C for 5 minutes to denature and place on ice for at least 1 minute.

[0208] 3) Prepare a cDNA synthesis mixture using these reagents: 10x RT buffer (2 μL); 25 mM MgCl2 (4 μL); 0.1 M DTT (2 μL); RNase OUT (1 μL); Superscript III (1 μL).

[0209] 4) Add 10 μL of this reaction to the RNA mixture and incubate at 50° C. for 50 minutes. The reaction is then inactivated by incubating at 85° C. for 5 minutes.

[0210] The template was then subjected to ddPCR using a labeled probe according to the manufacturer's protocol. Briefly, PCR reactions were performed in ABI PCR 96-well plates using a ddPCR supermix (Bio-Rad) without dUTP for the probe. The PCR master mix was prepared according to the manufacturer's instructions. The antisense primer-probe set located on the intron 1b region is shown below ( Figure 3 ).

[0211] Forward: 5'CAAAGCCTGGTGGTGTTCAA 3' (SEQ ID NO: 66)

[0212] Reverse: 5'GGACATGACCTGGTTGCTTC 3' (SEQ ID NO: 67)

[0213] Probe: 5'CGCGGCCAGATAGACCCAATGAGCA 3' (SEQ ID NO: 68).

[0214] The response is set up as follows:

[0215] 1) Distribute the entire master mix evenly among 8 wells of an ABI PCR plate.

[0216] 2) Add 10 μL of 1:10 diluted RT reaction or water to the sample wells.

[0217] 3) Transfer 15 μL of the master mix to the wells containing RT.

[0218] 4) Seal the plate, vortex and briefly centrifuge.

[0219] To prepare droplets, use the cartridge as follows:

[0220] 1) On the cartridge, place 70 μL of probe oil in the well labeled Oil and 20 μL of ddPCR reaction in the well labeled Sample.

[0221] 2) Place the rubber pad on top of the barrel.

[0222] 3) Transfer 40 μL of the droplet to a fresh Eppendorf 96-well culture plate. Seal the plate with aluminum foil and perform PCR according to the manufacturer's protocol.

[0223] The data show that in the C9orf72 fibroblast cell line, these primers amplify exons in the antisense pre-mRNA (C9-AS), and the complementary region is absent in the sense region (C9-S). Figure 4A Therefore, in this study, ddPCR antisense primers were used to specifically detect antisense precursor mRNA. Compared with 6 different control fibroblasts, antisense precursor mRNA was significantly increased in 7 different C9 patient-derived fibroblasts ( Figure 4B ).

[0224] Example 4: Amplification of allele sense and antisense pre-mRNA suppression

[0225] To test the activity of ZFP-TF inhibitors on the amplified alleles, cells were treated with ZFP-TFs 74949, 74978, 75003, 75027, 75109, 75114, 75115, 74967 (Table 1), or 74960 (negative control) as described above. ZFP-TF-mediated inhibition was assessed using two independent PCR assays performed by researchers blinded to the sample sequence. Each assay used different primers / probes ( Figures 5A to 5C ).

[0226] For Runs 1 and 2, analyses measuring sense amplification, antisense amplification, and total C9 were performed as described above, except that amplification was performed with random hexamers according to standard protocols in the art and with the primers shown below:

[0227] Antisense amplification of C9orf72 precursor mRNA ( Figure 5B ): As shown in Example 3 above.

[0228] Sense amplification of C9orf72 precursor mRNA ( Figure 5A ): This primer / probe set can detect mRNA encompassing a region spanning exon 1a and intron 1a.

[0229] Forward: 5'ACTACTTGCTCTCACAGTACTCG 3' (SEQ ID NO: 69)

[0230] Reverse: 5'TAGCGCGCGACTCCTGAGTTCC 3' (SEQ ID NO: 70)

[0231] Probe: 5'AGGGAAACAACCGCAGCCTGTAGCAAGCTC 3' (SEQ ID NO: 71).

[0232] Total C9orf72 mRNA ( Figure 5C ): This primer / probe set can detect mRNA containing a region within exon 2.

[0233] Forward: 5'TGTGACAGTTGGAATGCAGTGA 3' (SEQ ID NO: 72)

[0234] Reverse: 5'GCCACTTAAAGCAATCTCTGTCTTG 3' (SEQ ID NO: 73)

[0235] Probe: 5'TCGACTCTTTGCCCACCGCCA 3' (SEQ ID NO: 74).

[0236] Operation No. 3 ( Figure 5A and Figure 5C ) using the primers shown in Example 1 above ( Figures 2B to 2D For antisense disease transcripts, the following primers / probes were used to detect intron region 1b ( Figure 5B ).

[0237] Forward: 5'CAGCTTCGGTCAGAGAAATGAG 3' (SEQ ID NO: 78)

[0238] Reverse: 5'AAGAGGCGCGGGTAGAA 3' (SEQ ID NO:79)

[0239] Probe: 5'CTCTCCTCAGAGCTCGACGCATTT 3' (SEQ ID NO: 80).

[0240] Despite the fact that different primer / probe sets and different PCR assays were used (Runs 1 and 2 were performed by similar assays, but different from Run 3), the data were consistent and the inhibition levels were comparable.

[0241] Taken together, all runs consistently demonstrated that some ZFP-TFs were able to robustly repress all three transcripts (sense, antisense, and total) (e.g., ZFP-TFs 74978, 75003, and 75027), whereas some ZFP-TFs (e.g., ZFP-TFs 75109, 75114, and 75115) selectively repressed sense and antisense disease transcripts while preserving total C9 transcripts (selective repression).

[0242] Example 5: Regulation of human C9orf72 in neurons of BACC9orf72 transgenic mice

[0243] All inhibitors targeting BAC mouse C9orf72 were cloned into rAAV6 vectors using a CMV promoter driving expression. Recombinant AAV was produced in HEK293T cells, purified using a CsCl density gradient, and titrated by real-time qPCR according to methods known in the art. Purified virus was used to infect cultured primary mouse cortical neurons at 3E5, 1E5, 3E4, and 1E4 Vg / cell. After 7 days, total RNA was extracted and expression of C9orf72 sense and antisense transcripts, as well as two reference genes (e.g., Atp5b and Eif4a2), was monitored using RT-qPCR.

[0244] All ZFP-TF-encoding AAV vectors efficiently repressed their targets in mouse cells across a wide range of infectious doses, with some ZFPs reducing their targets by more than 95% at multiple doses. In contrast, no gene repression was observed with CMV-GFPrAAV6 virus tested at equivalent doses or in sham-treated neurons.

[0245] Example 6: In vivo gene repression driven by AAV-delivered ZFP-TFs

[0246] The C9orf72 BAC transgenic mice used for the targeted conjugation study contain a 98 kb human transgene that contains a full-length C9orf72 gene allele with approximately 500 G4C2 repeats and substantial flanking sequences (Liu et al., Neuron (2016) 90(3):521-34). Two ZFP-TFs, ZFP-TF75027 and ZFP-TF75114, were selected for this study, with varying potency (ZFP-TF75027 being more efficient; ZFP-TF75114 being more efficient). Figure 2D The expression cassettes for both fusion proteins were cloned into rAAV vectors containing the synapsin promoter to drive expression and the coding sequence for a self-cleavable peptide (e.g., a 2A peptide such as T2A or P2A), followed by a Venus tag for measuring biodistribution ( FIG. 9 , panel A). rAAV was produced in HEK293T cells and titrated by ddPCR using primers on the ITR.

[0247] To evaluate the effect of ZFP-TF expression on the suppression of amplified sense and antisense transcripts in vivo, ZFP-TF rAAV was delivered to POC9-BAC or WT mice by intracerebroventricular (ICV) injection. Briefly, vehicle (PBS) or ZFP-TF75027 rAAV or ZFP-TF 75114 rAAV (total dose 2E10 Vg / ICV) was administered bilaterally (2 μl / ICV) to newborn C9-BAC mice (matched for repeat length) or WT mice ( FIG. 9 , Panel C). Four weeks after injection, animals were sacrificed and one hemisphere was embedded for RNA foci analysis, and the other hemisphere was microdissected into the cortex, hippocampus, and cerebellum for further analysis ( FIG. 9 , Panel B). Quantification of viral genomes and Venus mRNA and protein showed widespread biodistribution, with equivalent transduction and expression of both ZFP-TF 75027 and ZFP-TF 75114.

[0248] Total RNA was extracted from cortical and hippocampal tissues and cDNA was prepared using the iScript cDNA synthesis kit (BioRad). ddPCR was performed to measure the expression of transcripts containing sense and antisense amplifications and the total C9 mRNA amount normalized to the amount of mouse TBP. The primers used for this analysis were:

[0249] Total C9 mRNA:

[0250] Forward: 5'TGTGACAGTTGGAATGCAGTGA3' (SEQ ID NO: 72)

[0251] Reverse: 5'GCCACTTAAAGCAATCTCTGTCTTG 3' (SEQ ID NO: 73)

[0252] Probe: 5'TCGACTCTTTGCCCACCGCCA3' (SEQ ID NO: 74).

[0253] Sense amplification of pre-mRNA:

[0254] Forward: 5'ACTACTTGCTCTCACAGTACTCG 3' (SEQ ID NO: 69)

[0255] Reverse: 5'TAGCGCGCGACTCCTGAGTTCC 3' (SEQ ID NO: 70)

[0256] Probe: 5'AGGGAAACAACCGCAGCCTGTAGCAAGCTC 3' (SEQ ID NO: 71).

[0257] Antisense amplification of pre-mRNA:

[0258] Forward: 5'AGTCGCTAGAGGCGAAAGC3' (SEQ ID NO: 81)

[0259] Reverse: 5'CGAGTGGGTGAGTGAGGAG 3' (SEQ ID NO: 82)

[0260] Probe: 5'AAGAGGCGCGGGTAGAAGCGGGGC3' (SEQ ID NO:83).

[0261] The data showed that ZFP-TF75027 suppressed the levels of total C9 mRNA, sense- and antisense-amplified transcripts in the hippocampus and cortex of C9-BAC animals relative to PBS-injected controls (Figure 9, Panel D). (Selective suppression was not observed in this animal model because transgenic mice do not contain the WT human C9orf72 allele and the mouse C9orf72 gene does not contain the G4C2 repeat sequence.) No suppression was observed with ZFP-TF75114.

[0262] In addition, fluorescence in situ hybridization was used to measure the amount of sense and antisense RNA aggregates (foci) found in the hippocampus after ZFP-TF injection (Figure 9, Panel E). Briefly, 10 μm sections were hybridized with fluorophore-labeled probes: 5'GGCCCCGGCCCCGGCCCC-Cy3 (SEQ ID NO: 84) for sense RNA foci and 5'GGGGCCGGGGCCGGGGCC-Cy3 (SEQ ID NO: 85) for antisense RNA foci. Stacked images were obtained at 40x magnification on a confocal microscope (LSM880). The number of sense and antisense RNA foci, normalized to the total number of cells, was quantified from the Ammon's angle (CA) region of the hippocampus. A lower percentage of antisense RNA foci was observed in animals injected with ZFP-TF75027.

[0263] These results show that ZFP-TFs targeting C9orf72 can effectively suppress the expression of pathogenic C9orf72 alleles in vivo and that differences in ZFP-TF potency can be observed. Sequence Listing <110> Sangamo Biotherapeutics, Inc. <120> Regulators of chromosome 9 open reading frame 72 gene expression and uses thereof <130> 025297.WO017 <140> <141> <150> 62 / 964,844 <151> 2020-01-23 <150> 62 / 837,523 <151> 2019-04-23 <160> 85 <170> PatentIn version 3.5 <210> 1 <211> 6 <212> DNA <213> Homo sapiens <400> 1 ggggcc 6 <210> 2 <211> 6 <212> DNA <213> Homo sapiens <400> 2 gggccg 6 <210> 3 <211> 6 <212> DNA <213> Homo sapiens <400> 3 ggccgg 6 <210> 4 <211> 6 <212> DNA <213> Homo sapiens <400> 4 gccggg 6 <210> 5 <211> 6 <212> DNA <213> Homo sapiens <400> 5 ccgggg 6 <210> 6 <211> 6 <212> DNA <213> Homo sapiens <400> 6 cggggc 6 <210> 7 <211> 6 <212> DNA <213> Homo sapiens <400> 7 ggcccc 6 <210> 8 <211> 6 <212> DNA <213> Homo sapiens <400> 8 gccccg 6 <210> 9 <211> 6 <212> DNA <213> Homo sapiens <400> 9 ccccgg 6 <210> 10 <211> 6 <212> DNA <213> Homo sapiens <400> 10 cccggc 6 <210> 11 <211> 6 <212> DNA <213> Homo sapiens <400> 11 ccggcc 6 <210> 12 <211> 6 <212> DNA <213> Homo sapiens <400> 12 cggccc 6 <210> 13 <211> 96 <212> PRT <213> Homo sapiens <400> 13 Asp Ala Lys Ser Leu Thr Ala Trp Ser Arg Thr Leu Val Thr Phe Lys 1 5 10 15 Asp Val Phe Val Asp Phe Thr Arg Glu Glu Trp Lys Leu Leu Asp Thr 20 25 30 Ala Gln Gln Ile Val Tyr Arg Asn Val Met Leu Glu Asn Tyr Lys Asn 35 40 45 Leu Val Ser Leu Gly Tyr Gln Leu Thr Lys Pro Asp Val Ile Leu Arg 50 55 60 Leu Glu Lys Gly Glu Glu Pro Trp Leu Val Glu Arg Glu Ile His Gln 65 70 75 80 Glu Thr His Pro Asp Ser Glu Thr Ala Phe Glu Ile Lys Ser Ser Val 85 90 95 <210> 14 <211> 5 <212> PRT <213> Artificial Sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 14 Asp Gly Gly Gly Ser 1 5 <210> 15 <211> 5 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 15 Thr Gly Glu Lys Pro 1 5 <210> 16 <211> 9 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 16 Leu Arg Gln Lys Asp Gly Glu Arg Pro 1 5 <210> 17 <211> 4 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 17 Gly Gly Arg Arg 1 <210> 18 <211> 8 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 18 Gly Gly Arg Arg Gly Gly Gly Ser 1 5 <210> 19 <211> 9 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 19 Leu Arg Gln Arg Asp Gly Glu Arg Pro 1 5 <210> 20 <211> 12 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 20 Leu Arg Gln Lys Asp Gly Gly Gly Ser Glu Arg Pro 1 5 10 <210> twenty one <211> 16 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> twenty one Leu Arg Gln Lys Asp Gly Gly Gly Ser Gly Gly Gly Ser Glu Arg Pro 1 5 10 15 <210> twenty two <211> 6 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> twenty two Thr Gly Ser Gln Lys Pro 1 5 <210> twenty three <211> 5 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> twenty three Gly Gly Gly Gly Ser 1 5 <210> twenty four <211> 28 <212> DNA <213> Homo sapiens <400> twenty four taggggccgg ggccggggcc ggggcgtg 28 <210> 25 <211> 28 <212> DNA <213> Homo sapiens <400> 25 cacgccccgg ccccggcccc ggccccta 28 <210> 26 <211> 10 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 26 Leu Arg Gln Lys Asp Ala Ala Arg Gly Ser 1 5 10 <210> 27 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 27 Asp Arg Ser Asp Leu Ser Arg 1 5 <210> 28 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 28 Arg Ser Thr His Leu Val Arg 1 5 <210> 29 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 29 Arg Ser Ala His Leu Ser Arg 1 5 <210> 30 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 30 Glu Arg Gly Asp Leu Lys Arg 1 5 <210> 31 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 31 Glu Arg Gly Thr Leu Ala Arg 1 5 <210> 32 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 32 Arg Ser Ala Asp Leu Ser Glu 1 5 <210> 33 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 33 Arg Ser Asp His Leu Ser Glu 1 5 <210> 34 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 34 Asp Arg Ser His Leu Ala Arg 1 5 <210> 35 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 35 Arg Ser Asp His Leu Ser Gln 1 5 <210> 36 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 36 Asp Asn Ser His Arg Thr Arg 1 5 <210> 37 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 37 Arg Asn Gly His Leu Leu Asp 1 5 <210> 38 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 38 Arg Ser Ala His Leu Ser Glu 1 5 <210> 39 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 39 Arg Ser Asp His Leu Ser Arg 1 5 <210> 40 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 40 Asp Trp Thr Thr Arg Arg Arg 1 5 <210> 41 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 41 His Arg Lys Ser Leu Ser Arg 1 5 <210> 42 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 42 Asp Ser Ser Asp Arg Lys Lys 1 5 <210> 43 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 43 Asp Ser Ser Thr Arg Arg Arg 1 5 <210> 44 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 44 Arg Ser Asp Asp Arg Lys Thr 1 5 <210> 45 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 45 Arg Ser Ala Asp Arg Lys Thr 1 5 <210> 46 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 46 Arg Asn Ala Asp Arg Ile Thr 1 5 <210> 47 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 47 Arg Arg Ala Thr Leu Leu Asp 1 5 <210> 48 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 48 Arg Ser Asp Thr Leu Ser Val 1 5 <210> 49 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 49 Asp Thr Ser Thr Arg Thr Lys 1 5 <210> 50 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 50 Arg Ser Ala Thr Leu Ser Glu 1 5 <210> 51 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 51 His His Arg Ser Leu His Arg 1 5 <210> 52 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 52 Thr Ser Ser Asp Arg Thr Lys 1 5 <210> 53 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 53 Asp Arg Ser His Leu Thr Arg 1 5 <210> 54 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 54 Asp Ser Ser Thr Arg Lys Thr 1 5 <210> 55 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 55 Asp Lys Arg Asp Leu Ala Arg 1 5 <210> 56 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 56 Ser Ser Arg Tyr Arg Thr Lys 1 5 <210> 57 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 57 Arg Glu Gln Asp Leu Lys Gln 1 5 <210> 58 <211> twenty two <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 58 ctatgtgtgt ggtgggatat gg 22 <210> 59 <211> twenty two <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 59 ctccaggtta tgtgaagcag aa 22 <210> 60 <211> 26 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Probe" <400> 60 aggcctgcta aaggattcaa ctggaa 26 <210> 61 <211> 20 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 61 ccctctctcc ccactacttg 20 <210> 62 <211> twenty one <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 62 ctacaggctg cggttgtttc c 21 <210> 63 <211> twenty four <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Probe" <400> 63 tctcacagta ctcgctgagg gtga 24 <210> 64 <211> twenty one <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 64 ctctagcgac tggtggaatt g 21 <210> 65 <211> twenty two <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 65 gtgcatggca actgtttgaa ta 22 <210> 66 <211> 20 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 66 caaagcctgg tggtgttcaa 20 <210> 67 <211> 20 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 67 ggacatgacc tggttgcttc 20 <210> 68 <211> 25 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Probe" <400> 68 cgcggccaga tagacccaat gagca 25 <210> 69 <211> twenty three <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 69 actacttgct ctcacagtac tcg 23 <210> 70 <211> twenty two <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 70 tagcgcgcga ctcctgagtt cc 22 <210> 71 <211> 30 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Probe" <400> 71 agggaaacaa ccgcagcctg tagcaagctc 30 <210> 72 <211> twenty two <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 72 tgtgacagtt ggaatgcagt ga 22 <210> 73 <211> 25 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 73 gccacttaaa gcaatctctg tcttg 25 <210> 74 <211> twenty one <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Probe" <400> 74 tcgactcttt gcccaccgcc a 21 <210> 75 <211> 16 <212> DNA <213> Homo sapiens <400> 75 ccggggccgg ggccgg 16 <210> 76 <211> 12 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 76 Leu Arg Gln Lys Asp Ala Ala Arg Gly Ser Gly Gly 1 5 10 <210> 77 <211> 7 <212> PRT <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Peptide" <400> 77 Glu Arg Arg Asp Leu Arg Arg 1 5 <210> 78 <211> twenty two <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 78 cagcttcggt cagagaaatg ag 22 <210> 79 <211> 17 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 79 aagaggcgcg ggtagaa 17 <210> 80 <211> twenty four <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Probe" <400> 80 ctctcctcag agctcgacgc attt 24 <210> 81 <211> 19 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 81 agtcgctaga ggcgaaagc 19 <210> 82 <211> 19 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Primer" <400> 82 cgagtgggtg agtgaggag 19 <210> 83 <211> 25 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Probe" <400> 83 aagaggcgcg ggtagaagcg ggggc 25 <210> 84 <211> 18 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Probe" <400> 84 ggccccggcc ccggcccc 18 <210> 85 <211> 18 <212> DNA <213> Artificial sequence <220> <221> source <223> / Comment="Description of artificial sequence: Synthetic Probe" <400> 85 ggggccgggg ccggggcc 18

Claims

1. A fusion protein comprising a zinc finger protein (ZFP) domain and a transcriptional repressor domain, wherein the ZFP domain binds to a target region in an intronic segment between exon 1a and exon 1b on a mutant allele of the human C9orf72 gene, wherein the target region comprises more than 30 tandem repeats of SEQ ID NO: 1, and wherein the ZFP domain comprises six recognition helical regions as shown in separate rows in the following table, wherein "^" indicates that arginine at position 4 upstream of the first amino acid in the specified helix is ​​substituted with glutamine, and wherein the SEQ ID NO for each sequence is indicated in parentheses:

2. The fusion protein of claim 1, wherein the fusion protein inhibits transcription of the repeat-containing mRNA from the mutant allele and does not inhibit transcription of the wild-type mRNA from the gene.

3. The fusion protein of claim 1 , wherein the ZFP domain binds to a sense sequence in the target region, wherein the sense sequence comprises one to three tandem repeats of the following hexanucleotide sequence: GGGGCC (SEQ ID NO: 1), GGGCCG (SEQ ID NO: 2), GGCCGG (SEQ ID NO: 3), GCCGGG (SEQ ID NO: 4), CCGGGG (SEQ ID NO: 5), or CGGGGC (SEQ ID NO: 6).

4. The fusion protein of claim 1, wherein the fusion protein inhibits sense transcription from the mutant C9orf72 allele in human cells. The fusion protein of claim 4 , wherein the fusion protein inhibits sense transcription from the C9orf72 1a promoter and does not inhibit sense transcription from the C9orf72 1b promoter.

6. The fusion protein of claim 1 , wherein the ZFP domain binds to an antisense sequence in the target region, wherein the antisense sequence comprises one to three tandem repeats of the following hexanucleotide sequence: GGCCCC (SEQ ID NO: 7), GCCCCG (SEQ ID NO: 8), CCCCGG (SEQ ID NO: 9), CCCGGC (SEQ ID NO: 10), CCGGCC (SEQ ID NO: 11), or CGGCCC (SEQ ID NO: 12).

7. The fusion protein of claim 1, wherein the fusion protein inhibits antisense transcription from the mutant C9orf72 allele in human cells.

8. The fusion protein of claim 1, wherein the fusion protein inhibits both sense and antisense transcription from the mutant C9orf72 allele in human cells.

9. The fusion protein of claim 1, wherein the fusion protein inhibits sense and / or antisense transcription from the mutant C9orf72 allele by at least about 30%.

10. The fusion protein of claim 1, wherein the fusion protein inhibits sense and / or antisense transcription from the mutant C9orf72 allele by at least about 90% and does not inhibit sense transcription from the C9orf72 1b promoter.

11. The fusion protein of claim 1, wherein the transcriptional repressor domain comprises the amino acid sequence of the KRAB domain from human KOX1.

12. The fusion protein of claim 1, wherein the ZFP domain is linked to the transcriptional repressor domain via a peptide linker.

13. A nucleic acid construct comprising a coding sequence for the fusion protein according to any one of claims 1 to 12, wherein the coding sequence is operably linked to a transcriptional regulatory element.

14. The nucleic acid construct of claim 13, wherein the transcriptional regulatory element is the human synapsin I promoter.

15. The nucleic acid construct of claim 13, wherein the construct is a viral construct.

16. A host cell comprising the nucleic acid construct of claim 13.

17. The host cell of claim 16, wherein the host cell is a human cell.

18. The host cell of claim 17, wherein the human cell is a neuron or a pluripotent stem cell.

19. A recombinant virus comprising the nucleic acid construct of claim 15, wherein the recombinant virus is a recombinant adeno-associated virus (rAAV).

20. A pharmaceutical composition comprising the nucleic acid construct of claim 13 and a pharmaceutically acceptable carrier.

21. Use of the fusion protein of any one of claims 1 to 12 in the preparation of a medicament for treating a patient suffering from a C9orf72-related disorder selected from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD).

22. The method of claim 21, wherein the fusion protein is introduced via a recombinant virus expressing the fusion protein.

23. The use according to claim 22, wherein the recombinant virus is an adeno-associated virus (AAV) having serotype 9 or pseudotyped AAV2 / 9 or AAV2 / 6 / 9.

24. The use according to claim 22, wherein the recombinant virus is administered to the patient via the intracerebroventricular, intrathecal, intracranial, retro-orbital (RO), intravenous, intranasal and / or intracisternal routes.

25. The method of claim 21, wherein two or more fusion proteins are introduced, wherein the coding sequences of the two or more fusion proteins are on the same recombinant viral vector.

26. The fusion protein of claim 1 , wherein the ZFP DNA binding domain comprises six fingers comprising SEQ ID NOs: 33, 34, 33, 34, 33, and 34, respectively, and wherein the ZFP DNA binding domain comprises a substitution of glutamine for arginine at the fourth upstream position of each of the second, third, and fifth fingers.

27. The fusion protein of claim 1 , wherein the ZFP DNA binding domain comprises six fingers comprising SEQ ID NOs: 33, 34, 33, 34, 33, and 34, respectively, and wherein the ZFP DNA binding domain comprises a substitution of glutamine for arginine at the fourth upstream position of each of the first, second, third, and fifth finger structures.

28. The fusion protein of claim 1 , wherein the ZFP DNA binding domain comprises six fingers comprising SEQ ID NOs: 33, 34, 33, 34, 33, and 34, respectively, and wherein the ZFP DNA binding domain comprises a substitution of glutamine for arginine at the fourth upstream position of each of the first, third, fourth, and sixth finger structures.

29. The fusion protein of claim 1 , wherein the ZFP DNA binding domain comprises six finger-like structures, the six finger-like structures comprising SEQ ID NOs: 29, 41, 29, 41, 29, and 41, respectively, and wherein the ZFP DNA binding domain comprises a substitution of glutamine for arginine at the fourth upstream position of each of the first and third finger-like structures.

30. The fusion protein of claim 1, wherein the ZFP DNA binding domain comprises six finger-like structures, wherein the six finger-like structures comprise SEQ ID NOs: 29, 41, 29, 41, 29, and 41, respectively, and wherein the ZFP DNA binding domain comprises a substitution of glutamine for arginine at the fourth upstream position of each of the third and fifth finger-like structures.

31. The fusion protein of claim 1 , wherein the ZFP DNA binding domain comprises six finger-like structures, the six finger-like structures comprising SEQ ID NOs: 29, 41, 29, 41, 29, and 41, respectively, and wherein the ZFP DNA binding domain comprises a substitution of glutamine for arginine at the fourth upstream position of each of the third and sixth finger-like structures.

32. The fusion protein of claim 1 , wherein the ZFP DNA binding domain comprises six fingers comprising SEQ ID NOs: 53, 54, 53, 54, 53, and 54, respectively, and wherein the ZFP DNA binding domain comprises a substitution of glutamine for arginine at the fourth position upstream of the first finger.

33. The fusion protein of claim 1 , wherein the ZFP DNA binding domain comprises six fingers comprising SEQ ID NOs: 55, 45, 55, 45, 55, and 45, respectively, and wherein the ZFP DNA binding domain comprises a substitution of glutamine for arginine at the fourth position upstream of the first finger.

34. The fusion protein of claim 1 , wherein the ZFP DNA binding domain comprises six fingers comprising SEQ ID NOs: 77, 45, 77, 45, 77, and 45, respectively, and wherein the ZFP DNA binding domain comprises a substitution of glutamine for arginine at the fourth position upstream of the first finger.

35. The fusion protein of claim 1, wherein the ZFP DNA binding domain comprises six finger-like structures, and the six finger-like structures comprise SEQ ID NOs: 33, 56, 33, 56, 33, and 56, respectively.

36. The fusion protein of claim 1, wherein the ZFP DNA binding domain comprises six finger-like structures, and the six finger-like structures comprise SEQ ID NOs: 57, 41, 57, 41, 57, and 41, respectively.

37. The fusion protein of claim 1 , wherein the ZFP DNA binding domain comprises six finger-like structures, the six finger-like structures comprising SEQ ID NOs: 46, 41, 46, 41, 46, and 41, respectively, and wherein the ZFP DNA binding domain comprises a substitution of glutamine for arginine at the fourth upstream position of each of the first, second, third, and fifth finger-like structures.

Citation Information

Patent Citations

  • RNA with a combination of unmodified and modified nucleotides for protein expression

    US20120195936A1

  • Methods and compositions for treatment of a genetic condition

    US20150056705A1

  • Selective recovery

    US20150079038A1

  • Methods and compositions for regulation of zinc finger protein expression

    US20150267205A1

  • Engineered target specific nucleases

    US20180087072A1