Costimulatory chimeric antigen receptor t cells targeting il13rα2

Abstract

Chimeric transmembrane immunoreceptors (CARs) are described that comprise an extracellular domain comprising a variant of IL-13 or its binding interleukin-13R alpha 2 (IL13R alpha 2), a transmembrane region, a costimulatory domain, and an intracellular signaling domain.

Description

[0001] This application is a divisional application of patent application with application date of September 18, 2015, priority date of September 19, 2014, application number 201580061133.2, and invention title: "Co-stimulatory chimeric antigen receptor T cells targeting IL13Ra2". BACKGROUND

[0002] Immunotherapy based on tumor-specific T cells, including therapies using engineered T cells, have been investigated for anti-tumor treatment. In some cases, the T cells used for the therapy do not maintain activity in vivo for a sufficient period of time. In some cases, the tumor specificity of the T cells is relatively low. Thus, there is a need in the art for tumor-specific cancer therapies that have longer term anti-tumor functional performance.

[0003] Malignant gliomas (MG), including anaplastic astrocytoma (AA- grade III) and glioblastoma (GBM - grade IV), have an incidence of approximately 20,000 new cases diagnosed per year in the United States. According to the American Brain Tumor Association, based on 2010 U.S. Census data, the overall prevalence of individuals afflicted with malignant brain tumors is roughly 140,000 people. Despite being a rare disease, MG is highly aggressive in its malignant behavior and is heterogeneous, and almost uniformly fatal. The current standard of care therapy for high-grade MG produces only short-term benefit, and these brain tumors are in fact incurable. Indeed, even with modern surgical and radiation treatment techniques, which often exacerbate the already severe morbidity imposed by localization in the central nervous system (CNS), 5-year survival rates are very low. Moreover, for most patients with recurrent disease, there are few treatment options. Therefore, there is a clear need for more effective therapies, particularly for those patients who have relapsed / progressed after first line therapy, and to ensure that this patient population is engaged in clinical trials.

[0004] Adoptive T cell therapy (ACT) with chimeric antigen receptor (CAR)-engineered T cells can provide a safe and effective way to reduce the relapse rate of MG, as CAR T cells can be engineered to specifically recognize antigenically distinct tumor populations (Cartellieri et al. 2010 J Biomed Biotechnol 2010:956304; Ahmed et al. 2010 Clin Cancer Res 16:474; Sampson et al. 2014 Clin Cancer Res 20:972; Brown et al. 2013 Clin Cancer Res 2012 18:2199; Chow et al. 2013 Mol Ther 21 :629), and T cells can migrate through the brain parenchyma to target and kill infiltrating malignant cells (Hong et al. 2010 Clin Cancer Res 16:4892; Brown et al. 2007 J Immunol 179:3332; Hong et al. 2010 Clin Cancer Res 16:4892; Yaghoubi 2009 Nat Clin PRact Oncol 6:53). Preclinical studies have demonstrated that CAR+T cells targeting IL13Ra2 show potent IL13Ra2-specific cytolytic activity independent of major histocompatibility complex (MHC) against stem-like and differentiated glioma cells, and induce regression of established glioma xenografts in vivo (Kahlon et al. 2004 Cancer Res 64:9160; Brown et al. 2012 Clin Cancer Res 18:2199). SUMMARY

[0005] Described herein are chimeric transmembrane immune receptors (chimeric antigen receptors or "CARs") comprising an extracellular domain, a transmembrane region, and an intracellular signaling domain. The extracellular domain consists of an IL-13 ligand that binds IL-13Rα2 (IL13Rα2), and optionally, a spacer comprising, e.g., a portion of a human Fc domain. The transmembrane portion comprises a CD4 transmembrane domain, a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3 transmembrane domain, or a 4IBB transmembrane domain. The intracellular signaling domain comprises a signaling domain from the zeta chain of the human CD3 complex (CD3ζ) and one or more costimulatory domains, e.g., a 4-1BB costimulatory domain. When expressed on the surface of a T cell, the extracellular domain enables the CAR to direct T cell activity toward those cells expressing IL13Rα2, a receptor expressed on the surface of tumor cells, including gliomas. Importantly, the IL13Rα2 binding portion of the CAR comprises an amino acid modification, such as the E13Y mutation, which increases binding specificity. The costimulatory domain in the intracellular region, such as the 4-1BB (CD137) costimulatory domain, enables the T cell to receive a costimulatory signal. T cells, e.g., patient-specific autologous T cells, can be engineered to express the CARs described herein and the engineered cells can be expanded and used for ACT. Various T cell subsets can be used. In addition, the CARs can be expressed in other immune cells, such as NK cells. In treating a patient with immune cells expressing the CARs described herein, the cells can be autologous or allogeneic T cells. In some cases, the cells used are CD4+ and CD8+ central memory T cells (T CM ), which are CD45RO+CD62L+, and the use of such cells can improve long-term survival of the cells after adoptive transfer compared to the use of other types of patient-specific T cells.

[0006] Described herein are nucleic acid molecules encoding a chimeric antigen receptor (CAR) r, wherein the chimeric antigen receptor comprises: a human IL-13 or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications; a transmembrane domain selected from the group consisting of: a CD4 transmembrane domain or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications, a CD8 transmembrane domain or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications, a CD28 transmembrane domain or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications, and a CD3ζ transmembrane domain or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications; a costimulatory domain; and a CD3ζ signaling domain or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications.

[0007] In various embodiments, the co-stimulatory domain is selected from the group consisting of: a CD28 co-stimulatory domain or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications, a 4-IBB co-stimulatory domain or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications, and an OX40 co-stimulatory domain or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications. In certain embodiments, the 4IBB co-stimulatory domain or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications is present.

[0008] In additional embodiments, the CAR comprises: a variant of human IL13 having 1-10 amino acid modifications that increase binding specificity for IL13Ra2 over IL13Ra1; human IL-13 or a variant thereof is an IL-13 variant comprising the amino acid sequence of SEQ ID NO: 3 having 1-5 amino acid modifications with the proviso that the amino acid at position 11 of SEQ ID NO: 3 is not E; two different co-stimulatory domains selected from the group consisting of: a CD28 co-stimulatory domain or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications, a 4IBB co-stimulatory domain or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications, and an OX40 co-stimulatory domain or a variant thereof having 1-10 (e.g., 1 or 2) amino acid modifications; two different co-stimulatory domains selected from the group consisting of: a CD28 co-stimulatory domain or a variant thereof having 1-2 amino acid modifications, a 4IBB co-stimulatory domain or a variant thereof having 1-2 amino acid modifications, and an OX40 co-stimulatory domain or a variant thereof having 1-2 amino acid modifications; human IL-13 or a variant thereof having 1-2 amino acid modifications; a transmembrane domain selected from the group consisting of: a CD4 transmembrane domain or a variant thereof having 1-2 amino acid modifications, a CD8 transmembrane domain or a variant thereof having 1-2 amino acid modifications, a CD28 transmembrane domain or a variant thereof having 1-2 amino acid modifications, and a CD3 zeta transmembrane domain or a variant thereof having 1-2 amino acid modifications; a co-stimulatory domain; and a CD3 zeta signaling domain or a variant thereof having 1-2 amino acid modifications; a spacer region positioned between the IL-13 or variant thereof and the transmembrane domain (e.g., the spacer region comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 14-20, 50, and 52); the spacer comprises an IgG hinge region; the spacer region comprises 10-150 amino acids; the 4-1BB signaling domain comprises the amino acid sequence of SEQ ID NO: 6; the CD3 zeta signaling domain comprises the amino acid sequence of SEQ ID NO: 7; and a 3-15 amino acid linker positioned between the co-stimulatory domain and the CD3 zeta signaling domain or variant thereof. In certain embodiments, where two co-stimulatory domains are present, one is a 4-IBB co-stimulatory domain and the other is a co-stimulatory domain selected from the group consisting of CD28 and CD28gg.

[0009] In some embodiments: the nucleic acid molecule expresses a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 31-48, and 52; the chimeric antigen receptor comprises an IL-13 / IgG4 / CD4t / 41-BB region comprising the amino acids of SEQ ID NO: 11 and a CD3 zeta signaling domain comprising the amino acid sequence of SEQ ID NO: 7; and the chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO: 10, 31-48, and 52.

[0010] Also disclosed is a population of human T cells transduced by a vector comprising an expression cassette encoding a chimeric antigen receptor, wherein the chimeric antigen receptor comprises: a human IL-13 or a variant thereof having 1-10 amino acid modifications; a transmembrane domain selected from the group consisting of: a CD4 transmembrane domain or a variant thereof having 1-10 amino acid modifications, a CD8 transmembrane domain or a variant thereof having 1-10 amino acid modifications, a CD28 transmembrane domain or a variant thereof having 1-10 amino acid modifications, and a CD3 zeta transmembrane domain or a variant thereof having 1-10 amino acid modifications; a costimulatory domain; and a CD3 zeta signaling domain or a variant thereof having 1-10 amino acid modifications. In various embodiments: the population of human T cells comprises a vector expressing a chimeric antigen receptor comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 31-48, and 52; the population of human T cells comprises central memory T cells (Tcm cells) (e.g., at least 20%, 30%, 40%, 50%, 60%, 70%, 80% of the cells are Tcm cells; at least 15%, 20%, 25%, 30%, 35% of the Tcm cells are CD4+, and at least 15%, 20%, 25%, 30%, 35% of the Tcm cells are CD8+).

[0011] Also described are methods of treating cancer in a patient comprising administering autologous or allogeneic human T cells (e.g., autologous or allogeneic T cells comprising Tcm cells, e.g., at least 20%, 30%, 40%, 50% 60%, 70%, 80% of the cells are Tcm cells; at least 15%, 20%, 25%, 30%, 35% of the Tcm cells are CD4+ and at least 15%, 20%, 25%, 30%, 35% of the Tcm cells are CD8+ cells) transduced by a vector comprising an expression cassette encoding a chimeric antigen receptor, wherein the chimeric antigen receptor comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 31-48, and 52. In various embodiments: the population of human T cells comprises central memory T cells; the cancer is glioblastoma; and the transduced human T cells are prepared by a method comprising obtaining T cells from the patient, processing the T cells to isolate central memory T cells, and transducing at least a portion of the central memory T cells with a viral vector comprising an expression cassette encoding a chimeric antigen receptor, wherein the chimeric antigen receptor comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 31-48, and 52.

[0012] Also described are: nucleic acid molecules encoding a polypeptide comprising an amino acid sequence that is at least 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 10 and SEQ ID NO: 10, 31-48, and 52; nucleic acid molecules encoding a polypeptide comprising an amino acid sequence that is identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 31-48, and 52, except that there are no more than 5 amino acid substitutions, deletions, or insertions; nucleic acid molecules encoding a polypeptide comprising an amino acid sequence that is identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 10 and SEQ ID NO: 10, 31-48, and 52, except that there are no more than 5 amino acid substitutions; and nucleic acid molecules encoding a polypeptide comprising an amino acid sequence that is identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 10 and SEQ ID NO: 10, 31-48, and 52, except that there are no more than 2 amino acid substitutions.

[0013] Certain CARs described herein, e.g., IL13(EQ)BBζ CARs and IL13(EQ)CD28-BBζ CARs, have certain advantageous features compared to certain other IL13-targeting CARs. For example, they have improved selectivity for IL13Ra, eliciting lower Th2 cytokine production, particularly lower IL13 production.

[0014] T cells expressing CARs targeting IL13Ra2 can be used to treat cancer, such as glioblastoma, and other cancers expressing IL13Ra2, including but not limited to medulloblastoma, breast cancer, head and neck cancer, kidney cancer, ovarian cancer, and Kaposi sarcoma. Accordingly, the disclosure includes methods of treating cancer using T cells expressing the CARs described herein.

[0015] The disclosure also includes nucleic acid molecules encoding any of the CARs described herein (e.g., vectors comprising a nucleic acid sequence encoding one of the CARs) and isolated T lymphocytes expressing any of the CARs described herein.

[0016] The CARs described herein can include a spacer region positioned between the IL13 domain and the transmembrane domain. A variety of different spacers can be used. Some of them include at least part of a human Fc region, e.g., a hinge portion or a CH3 domain of a human Fc region or a variant thereof. Table 1 below provides a number of spacers that can be used in the CARs described herein.

[0017] Table 1: Examples of spacers

[0018]

[0019]

[0020]

[0021] Some spacer regions include all or part of an immunoglobulin (e.g., IgGl, IgG2, IgG3, IgG4) hinge region, i.e., the sequence falling between the CH1 and CH2 domains of an immunoglobulin, e.g., an IgG4 Fc hinge or a CD8 hinge. Some spacer regions include an immunoglobulin CH3 domain or both a CH3 domain and a CH2 domain. The immunoglobulin-derived sequences can include one or more amino acid modifications, e.g., 1, 2, 3, 4, or 5 substitutions, e.g., substitutions that reduce off-target binding.

[0022] An "amino acid modification" refers to an amino acid substitution, insertion, and / or deletion in a protein or peptide sequence. An "amino acid substitution" or "substitution" refers to the replacement of an amino acid at a particular position in a parent peptide or protein sequence with another amino acid. Substitutions can be made to change the amino acid in the resulting protein in a non-conservative manner (i.e., by changing the codon from an amino acid belonging to one group of amino acids having particular size or characteristics to an amino acid belonging to another group) or in a conservative manner (i.e., by changing the codon from an amino acid belonging to one group of amino acids having particular size or characteristics to an amino acid belonging to the same group). Such conservative changes generally result in less change to the structure and function of the resulting protein. The following are examples of groups of amino acids: 1) those with nonpolar R groups: alanine, valine, leucine, isoleucine, proline, phenylalanine, tryptophan, methionine; 2) those with aliphatic hydrophobic R groups: glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine; 3) those with polar R groups that are charged (negative at pH 6.0): aspartic acid, glutamic acid; 4) basic amino acids (positive at pH 6.0): lysine, arginine, histidine (at pH 6.0). Another group can be those with phenyl groups: phenylalanine, tryptophan, and tyrosine.

[0023] In certain embodiments, the spacer is derived from IgGl, IgG2, IgG3, or IgG4, which comprises one or more amino acid residues substituted with an amino acid residue different from the amino acid residue present in the unmodified spacer. The one or more substituted amino acid residues are selected from, but not limited to, one or more amino acid residues at positions 220, 226, 228, 229, 230, 233, 234, 235, 234, 237, 238, 239, 243, 247, 267, 268, 280, 290, 292, 297, 298, 299, 300, 305, 309, 218, 326, 330, 331, 332, 333, 334, 336, 339, or combinations thereof. In this numbering system, described in more detail below, the first amino acid in the IgG4 (L235E, N297Q) spacer in Table 1 is 219, and the first amino acid in the IgG4 (HL-CH3) spacer in Table 1 is 219, which is the first amino acid in the IgG hinge sequence and the IgG4 hinge linker (HL) sequence in Table 1.

[0024] In some embodiments, the modified spacer is derived from an IgGl, IgG2, IgG3, or IgG4, which comprises, but is not limited to, one or more of the following amino acid residue substitutions: C220S, C226S, S228P, C229S, P230S, E233P, V234A, L234V, L234F, L234A, L235A, L235E, G236A, G237A, P238S, S239D, F243L, P247I, S267E, H268Q, S280H, K290S, K290E, K290N, R292P, N297A, N297Q, S298A, S298G, S298D, S298V, T299A, Y300L, V305I, V309L, E318A, K326A, K326W, K326E, L328F, A330L, A330S, A331S, P331S, I332E, E333A, E333S, E333S, K334A, A339D, A339Q, P396L, or combinations thereof.

[0025] In certain embodiments, the modified spacer is derived from an IgG4 region, which comprises one or more amino acid residues substituted with an amino acid residue different from that present in the unmodified region. The one or more substituted amino acid residues are selected from, but not limited to, one or more amino acid residues at positions 220, 226, 228, 229, 230, 233, 234, 235, 234, 237, 238, 239, 243, 247, 267, 268, 280, 290, 292, 297, 298, 299, 300, 305, 309, 218, 326, 330, 331, 332, 333, 334, 336, 339, or combinations thereof.

[0026] In some embodiments, the modified spacer is derived from an IgG4 region comprising, but not limited to, one or more of the following amino acid residue substitutions: 220S, 226S, 228P, 229S, 230S, 233P, 234A, 234V, 234F, 234A, 235A, 235E, 236A, 237A, 238S, 239D, 243L, 247I, 267E, 268Q, 280H, 290S, 290E, 290N, 292P, 297A, 297Q, 298A, 298G, 298D, 298V, 299A, 300L, 305I, 309L, 318A, 326A, 326W, 326E, 328F, 330L, 330S, 331S, 331S, 332E, 333A, 333S, 333S, 334A, 339D, 339Q, 396L, or combinations thereof, wherein the amino acid in the unmodified spacer is substituted with the above-identified amino acid at the indicated position.

[0027] For amino acid positions in the immunoglobulins discussed herein, numbering is according to the EU index or EU numbering system (Kabat et al. 1991 Sequences of Proteins of Immunological Interest, 5th Ed., United States Public Health Service, National Institutes of Health, Bethesda, incorporated by reference in its entirety). The EU index or EU index in the Kabat or EU numbering system refers to the numbering of the EU antibody (Edelman et al. 1969 Proc Natl Acad Sci USA 63:78-85).

[0028] A variety of transmembrane domains can be used for the CAR against IL13Ra2. Table 2 contains examples of suitable transmembrane domains. When a spacer domain is present, the transmembrane domain is positioned at the carboxy-terminal end of the spacer domain.

[0029] Table 2: Examples of transmembrane domains

[0030]

[0031] Many of the CARs described herein comprise one or more (e.g., two) costimulatory domains. The costimulatory domain is positioned between the transmembrane domain and the CD3 zeta signaling domain. Table 3 contains examples of suitable costimulatory domains along with the sequence of the CD3 zeta signaling domain.

[0032] Table 3: Examples of costimulatory domains

[0033]

[0034]

[0035] The present invention comprises the following:

[0036] Embodiment 1. A nucleic acid molecule encoding a chimeric antigen receptor, wherein the chimeric antigen receptor comprises: human IL-13 or a variant thereof having 1-10 amino acid modifications; a transmembrane domain selected from the group consisting of: a CD4 transmembrane domain or a variant thereof having 1-10 amino acid modifications, a CD8 transmembrane domain or a variant thereof having 1-10 amino acid modifications, a CD28 transmembrane domain or a variant thereof having 1-10 amino acid modifications, and a CD3 zeta transmembrane domain or a variant thereof having 1-10 amino acid modifications; a costimulatory domain; and a CD3 zeta signaling domain or a variant thereof having 1-10 amino acid modifications.

[0037] Embodiment 2. The nucleic acid molecule of embodiment 1, wherein the costimulatory domain is selected from the group consisting of: a CD28 costimulatory domain or a variant thereof having 1-10 amino acid modifications, a 4 IBB costimulatory domain or a variant thereof having 1-10 amino acid modifications, and an OX40 costimulatory domain or a variant thereof having 1-10 amino acid modifications.

[0038] Embodiment 3. The nucleic acid molecule of embodiment 1, comprising a variant of human IL13 having 1-10 amino acid modifications that increase binding specificity for IL13Rα2 relative to IL13Rα1.

[0039] Embodiment 4. The nucleic acid molecule of embodiment 1, wherein the human IL-13 or variant thereof is an IL-13 variant comprising the amino acid sequence of SEQ ID NO: 3 having 1-5 amino acid modifications, provided that the amino acid at position 11 of SEQ ID NO: 3 is not E.

[0040] Embodiment 5. The nucleic acid molecule of embodiment 2, wherein the chimeric antigen receptor comprises two different costimulatory domains selected from the group consisting of: a CD28 costimulatory domain or a variant thereof having 1-10 amino acid modifications, a 4 IBB costimulatory domain or a variant thereof having 1-10 amino acid modifications, and an OX40 costimulatory domain or a variant thereof having 1-10 amino acid modifications.

[0041] Embodiment 6. The nucleic acid molecule of embodiment 5, wherein the chimeric antigen receptor comprises two different costimulatory domains selected from the group consisting of: a CD28 costimulatory domain or a variant thereof having 1-2 amino acid modifications, a 4 IBB costimulatory domain or a variant thereof having 1-2 amino acid modifications, and an OX40 costimulatory domain or a variant thereof having 1-2 amino acid modifications.

[0042] Embodiment 7. The nucleic acid molecule of embodiment 1, wherein the chimeric antigen receptor comprises: human IL-13 or a variant thereof having 1-2 amino acid modifications; a transmembrane domain selected from the group consisting of: a CD4 transmembrane domain or a variant thereof having 1-2 amino acid modifications, a CD8 transmembrane domain or a variant thereof having 1-2 amino acid modifications, a CD28 transmembrane domain or a variant thereof having 1-2 amino acid modifications, and a CD3 zeta transmembrane domain or a variant thereof having 1-2 amino acid modifications; a costimulatory domain; and a CD3 zeta signaling domain or a variant thereof having 1-2 amino acid modifications.

[0043] Embodiment 8. The nucleic acid molecule of embodiment 1, comprising a spacer region positioned between the IL-13 or variant thereof and the transmembrane domain.

[0044] Embodiment 9. The nucleic acid molecule of embodiment 6, wherein the spacer region comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 4, 14-20, 50, and 521.

[0045] Embodiment 10. The nucleic acid molecule of embodiment 6, wherein the spacer comprises an IgG hinge region.

[0046] Embodiment 11. The nucleic acid molecule of embodiment 6, wherein the spacer comprises 10-150 amino acids.

[0047] Embodiment 12. The nucleic acid molecule of embodiment 2, wherein the 4-1BB signaling domain comprises the amino acid sequence of SEQ ID NO: 6.

[0048] Embodiment 13. The nucleic acid molecule of embodiment 1, wherein the CD3 zeta signaling domain comprises the amino acid sequence of SEQ ID NO: 7.

[0049] Embodiment 14. The nucleic acid molecule of embodiment 1, wherein a linker of 3-15 amino acids is positioned between the costimulatory domain and the CD3 zeta signaling domain or variant thereof.

[0050] Embodiment 15. The nucleic acid molecule of embodiment 1, wherein the nucleic acid molecule expresses a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 10, 31-48, and 52.

[0051] Embodiment 16. The nucleic acid molecule of embodiment 1, wherein the chimeric antigen receptor contains an IL-13 / IgG4 / CD4t / 41-BB region comprising the amino acids of SEQ ID NO: 11 and a CD3 zeta signaling domain comprising the amino acid sequence of SEQ ID NO: 7.

[0052] Embodiment 17. The nucleic acid molecule of embodiment 14, wherein the chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO: 10, 31-48, and 52.

[0053] Embodiment 18. A population of human T cells transduced by a vector comprising an expression cassette encoding a chimeric antigen receptor, wherein the chimeric antigen receptor comprises: human IL-13 or a variant thereof having 1-10 amino acid modifications; a transmembrane domain selected from the group consisting of: a CD4 transmembrane domain or a variant thereof having 1-10 amino acid modifications, a CD8 transmembrane domain or a variant thereof having 1-10 amino acid modifications, a CD28 transmembrane domain or a variant thereof having 1-10 amino acid modifications, and a CD3 zeta transmembrane domain or a variant thereof having 1-10 amino acid modifications; a costimulatory domain; and a CD3 zeta signaling domain or a variant thereof having 1-10 amino acid modifications.

[0054] Embodiment 19. A population of human T cells comprising a vector expressing a chimeric antigen receptor comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 31-48, and 52.

[0055] Embodiment 20. The population of human T cells of embodiment 16, wherein the T cells comprise a population of central memory T cells.

[0056] Embodiment 21. A method of treating cancer in a patient comprising administering a population of autologous or allogeneic human T cells transduced by a vector comprising an expression cassette encoding a chimeric antigen receptor, wherein the chimeric antigen receptor comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 31-48, and 52.

[0057] Embodiment 22. The method of embodiment 19, wherein the population of human T cells comprises central memory T cells.

[0058] Embodiment 23. The method of embodiment 19, wherein the cancer is a glioblastoma.

[0059] Embodiment 24. The method of embodiment 20, wherein the transduced human T cells are prepared by a method comprising obtaining T cells from the patient, processing the T cells to isolate central memory T cells, and transducing at least a portion of the central memory T cells with a viral vector comprising an expression cassette encoding a chimeric antigen receptor, wherein the chimeric antigen receptor comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 31-48, and 52.

[0060] Embodiment 25. A nucleic acid molecule encoding a polypeptide comprising an amino acid sequence that is at least 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 10 and SEQ ID NO: 10, 31-48, and 52.

[0061] Embodiment 26. A nucleic acid molecule encoding a polypeptide comprising an amino acid sequence identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 10, 31-48, and 52, except for the presence of no more than 5 amino acid substitutions, deletions, or insertions.

[0062] Embodiment 27. A nucleic acid molecule encoding a polypeptide comprising an amino acid sequence identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 10 and SEQ ID NO: 10, 31-48, and 52, except for the presence of no more than 5 amino acid substitutions.

[0063] Embodiment 28. A nucleic acid molecule encoding a polypeptide comprising an amino acid sequence identical to an amino acid sequence selected from the group consisting of SEQ ID NO: 10 and SEQ ID NO: 10, 31-48, and 52, except for the presence of no more than 2 amino acid substitutions. SUMMARY

[0064] Figure 1 is a schematic depiction of an IL13(E13Y)-zetakine CAR (left) composed of the indicated IL13Ra2-specific human IL-13 variant (huIL-13(E13Y)), human IgG4 Fc spacer (huY4 F c ), human CD4 transmembrane (huCD4 tm), and human CD3 zeta chain cytoplasmic (huCD3 zeta cyt) moieties. Also depicted is an IL13(EQ)BBz CAR, which is identical to the IL13(E13Y)-zetakine except for the two point mutations L235E and N297Q indicated in red in the CH2 domain of the IgG4 spacer, and the addition of the costimulatory 4-1BB cytoplasmic domain (4-1BB cyt).

[0065] Figure 2 A-C depict certain vector reading frames. A is a diagram of the cDNA reading frame of the 2670 nucleotide IL13(EQ)BBZ-T2A-CD19t construct, with the indicated IL13Ra2-specific ligand IL13(E13Y), IgG4(EQ)Fc hinge, CD4 transmembrane, 4-1BB cytoplasmic signaling, tri-glycine linker, and CD3 zeta cytoplasmic signaling domains of the IL13(EQ)BBZ CAR, as well as the T2A ribosomal skip and truncated CD19 sequence. Also indicated are the human GM-CSF receptor alpha and CD19 signal sequence driving IL13(EQ)BBz CAR and CD19t surface expression. B is a diagram of the sequences flanking the long terminal repeat (indicated by 'R') that will integrate into the host genome. C is an IL13(EQ)BBZ-T2A-CD19t_epHIV7 plasmid map.

[0066] Figure 3 Construction of pHIV7 is described.

[0067] Figure 4 Elements of pHIV7 are described.

[0068] Figure 5 Generation scheme of IL13(EQ)BBZ / CD19t+TCM is described.

[0069] Figure 6 A-C describe the results of flow cytometric analysis of surface transgene and T cell marker expression. IL13(EQ)BBZ / CD19t+T CM HD006.5 and HD187.1 were co-stained with anti-IL13-PE and anti-CD8-FITC to detect CD8+CAR+and CD4+(i.e., CD8 negative) CAR+cells (A), or with anti-CD19-PE and anti-CD4-FITC to detect CD4+CD19t+and CD8+(i.e., CD4 negative) CAR+cells (B). IL13(EQ)BBZ / CD19t+T CM HD006.5 and HD187.1 were stained with fluorescently conjugated anti-CD3, TCR, CD4, CD8, CD62L, and CD28 (gray histograms) or isotype control (black histograms) (C). In all cases, percentages are based on viable lymphocytes (DAPI negative) above isotype staining.

[0070] Figure 7 A-B describe the in vitro functional characterization of IL13(EQ)BBZ+T CM IL13Ra2-specific effector function. IL13(EQ)BBZ / CD19t+T CM HD006.5 and HD187.1 were used as effectors in a 6-hour 51 Cr release assay using a 10:1 E:T ratio based on CD19t expression. IL13Ra2-positive tumor targets were K562 engineered to express IL13Ra2 (K562-IL13Ra2) and primary glioma line PBT030-2, and IL13Ra2-negative tumor target control was K562 parental line (A). IL13(EQ)BBZ / CD19t+T CM Antigen-dependent cytokine production by HD006.5 and HD187.1. Cytokine levels were determined using the Bio-Plex Pro Human Cytokine TH1 / TH2 Assay Kit and INF-γ is reported (B).

[0071] Figure 8 A-C depict results of a study demonstrating that IL13(EQ)BBζ / CD19t+T CM Regression of established glioma tumor xenografts following adoptive transfer. EGFP-ffLuc+PBT030-2 tumor cells (1 x 10 5 ) were stereotactically implanted into the right frontal lobe of NSG mice. On day 5, mice received 2 x 10 6 IL13(EQ)BBζ / CD19t+T CM (1.1 x 10 6 CAR+; n = 6), 2 x 10 6 mock TCM (no CAR; n = 6), or PBS (n = 6). Representative mice from each group showing relative tumor burden using Xenogen Living Image (A). Quantification of ffLuc flux (photons / sec) showed that IL13(EQ)BBζ / CD19t+T CM induced tumor regression compared to mock transduced TCM and PBS (#p < 0.02, *p < 0.001, repeated measures ANOVA) (B). Kaplan Meier survival curves (n = 6 / group) demonstrating that mice treated with IL13(EQ)BBζ / CD19t+T CM survival was significantly improved (p = 0.0008; log-rank test) (C).

[0072] Figure 9 A-C depict results of a study comparing the anti-tumor effects of IL13(EQ)BBZ T CM and IL13-zetakine CTL clones. EGFP-ffLuc+PBT030-2 TSs (1 x 105) were stereotactically implanted into the right frontal lobe of NSG mice. On day 8, mice received 1.6 x 10 6 mock T CM (no CAR), 1.0 x 10 6 CAR+IL13(EQ)BBζ T CM (1.6 x 10 6 total T cells; 63% CAR), 1.0 x 10 6IL13-zetakine CD8+CTL cl.2D7 (clonal CAR+), or no treatment (n=6 / group). Xenogen Living Image shows relative tumor burden from representative mice from each group (A). Linear regression lines of the natural log of ffLuc flux (photons / sec) over time, P-values are for group by time interaction comparisons (B). Kaplan Meier survival analysis (n=6 / group) demonstrates significantly improved survival with IL13(EQ)BBζT CM treated mice (p=0.02; log-rank test) (C).

[0073] Figure 10 A-C depict results of a study comparing the anti-tumor effects of IL13(EQ)BBζT CM and IL13-zetakine CTL clones. EGFP-ffLuc+PBT030-2 TSs (1 x 10 5 ) were stereotactically implanted into the right frontal lobe of NSG mice. On day 8, mice received 1.3 x 10 6 mock T CM cells (no CAR; n=6), 1.0, 0.3, or 0.1 x 10 6 CAR+IL13(EQ)BBζT CM (78% CAR+; n=6-7), 1.0, 0.3, or 0.1 x 10 6 IL13-zetakine CD8+CTL cl.2D7 (clonal CAR+; n=6-7), or no treatment (n=5). Xenogen imaging of representative mice from each group shows relative tumor burden (A). Linear regression lines of the natural log of ffLuc flux (photons / sec) over time show that IL13(EQ)BBζT CM achieved superior tumor regression compared to first generation IL13-zetakine CTL cl.2D7, mock T CM and tumor only. Mean flux per group on day 27 post-tumor injection demonstrates that 0.1 x 10 6 IL13(EQ)BBζT CM doses outperformed a 10-fold higher dose of 1.0 x 10 6 IL13-zetakine CD8+CTL cl.2D7 (p=0.043; Welch two-sample t-test) (C).

[0074] Figure 11 The results are described, demonstrating that IL13(EQ)BBζTcm exhibits enhanced persistence compared to the IL13-zetakine CTL clone. CD3 immunohistochemistry assessed T cell persistence at the tumor site 7 days after T cell infusion. A significant number of T cells were detected with IL13(EQ)BBζTcm (top panel). Conversely, very few viable CD3+IL13-zetakine T cells were detected (bottom panel).

[0075] Figure 12 AD describes experimental results comparing CAR+ T cell delivery pathways (ic vs. iv) for large tumor establishment. EGFP-ffLuc+PBT030-2 TSs (1×10⁻⁶) were delivered. 5 The 5x10⁻¹⁰ ions were implanted into the right forebrain of NSG mice. On days 19 and 26, the ions were administered via 5x10⁻¹⁰ ions. 6 CAR+IL13(EQ)BBζ+Tcm(11.8x10) 6 Total cells; n=4), or simulated Tcm (11.8x10⁻¹²). 6 Cells; n=4) were administered to mice via tail vein IV. Alternatively, on days 19, 22, 26, and 29, 1x10⁻⁶ cells were administered. 6 CAR+IL13(EQ)BBζ+Tcm(2.4x10) 6 Total cells; n=4), or simulated Tcm (2.4x10⁻¹²). 6 (n=5) ic-injected mice. Mean ffLuc flux (photons / sec) over time showed that ic-delivered IL13(EQ)BBZTcm mediated tumor regression on day 19. By comparison, iv-delivered T cells did not show a reduction in tumor burden compared to untreated or Tcm-mimicking controls (A). Kaplan-Meier survival curves demonstrated improved survival in mice treated with IL13(EQ)BBZTcm ic compared to mice treated with iv-administered CAR+Tcm (p=0.0003 time test) (B). Representative H&E and CD3 IHC in mice treated with IL13(EQ)BBZ+Tcm v. (C) versus ic (D). CD3+ T cells were detected only in the ic-treated group; no CD3+ cells were detected in the tumor or surrounding brain parenchyma in iv-treated mice.

[0076] Figure 13A-B depict results of studies showing that CAR+ T cells injected intracranially, intratumorally (i.c.t.) or intraventricularly (i.c.v.) can traffic to tumors on the contralateral hemisphere. EGFP-ffLuc+PBT030-2TSs (1 x 105) were stereotactically implanted into the right and left frontal lobe of NSG mice. On day 6, mice were injected i.c. with 1.0 x 106 IL13(EQ)BBζ+ Tcm (1.6 x 106 total cells; 63% CAR; n = 4) at the right tumor site. Schematic of multi-lesional glioma experimental model (A). CD3 IHC showing T cell infiltration of both right and left tumor sites (B).

[0077] Figure 14 A-C depict results of a series of studies evaluating the co-stimulatory domains of IL13Ra2-specific CARs. Schematic of IL13Ra2-specific CAR constructs comparing multiple endo / signaling domains, including a first generation CD3z CAR lacking co-stimulation, versus second generation CARs incorporating 4-1BB or CD28, versus third generation CARs containing CD28 and 41BB (A). All CAR cassettes also contained a T2A ribosome skip and a truncated CD19 (CD19t) sequence as a marker for transduced cells. CD4 and CD8 TCM were transduced by lentivirus and CAR-expressing T cells were enriched by anti-CD19 immunomagnetic selection. CD19 and IL13 (i.e., CAR) expression levels as determined by flow cytometry (B). Stability of each CAR construct was determined by dividing the mean fluorescence intensity (MFI) of the CAR (IL13) by the mean fluorescence intensity of the transduction marker (CD19t) (C). CARs containing 4-1BB demonstrated the lowest expression levels compared to the CD19t transduction marker.

[0078] Figure 15A-B depict results of studies demonstrating that IL13Ra2-specific CARs containing the 4-1BB costimulatory domain produce less Thl and Th2 cytokines. The ability of mock-transduced or CAR-expressing T cells to kill IL13Ra2-expressing PBT030-2 tumor cell targets was determined in a 4 hour51Cr release assay at the indicated effector:target ratios. Mean % chromium release + S.D. of triplicate wells is depicted (A). As expected, mock-transduced T cells were not effective at lysing targets. In contrast, all CAR-expressing T cells lysed tumor cells in a similar manner. Mock-transduced or CAR-expressing T cells were co-cultured with IL13Ra2-expressing PBT030-2 tumor cells at a 10: 1 ratio overnight and supernatants were analyzed for IL-13 and IFN-g levels by Cytometric Bead Array (B). Mean + S.D. of triplicate wells is depicted. Interestingly, T cells expressing the zeta, 41BB-zeta or CD28-41BB-zeta CARs exhibited lower antigen-stimulated cytokine production than T cells expressing the CD28-zeta CAR.

[0079] Figure 16 A-C depict results of a series of studies of the in vivo effects of IL13Ra2-specific CARs. NSG mice received an intracranial injection of ffLuc+PBT030-2 tumor cells on day 0 and were randomized into 6 groups (n=9-10 mice / group) on day 8 for i.c. treatment with PBS (tumor only), mock-transduced T cells or T cells expressing the indicated IL13Ra2-specific CARs. Quantitative bioluminescence imaging was then performed to monitor tumor growth over time. Bioluminescence images of representative mice in each group (A). Mean + S.E. of overall flux levels of luciferase activity over time in each group (B). Flux levels in each mouse on day 27. All groups treated with IL13Ra2-specific CAR T cells showed statistically significant reductions in tumor volume compared to mice treated with mock-transduced T cells, except for those treated with T cells expressing the CD28-CAR (C).

[0080] Figure 17 The amino acid sequence of IL13(EQ)BBζ / CD19t+ is depicted (SEQ ID NO: 1).

[0081] Figure 18 A sequence comparison of IL13(EQ)41BBζ [IL13{EQ}41BBζ T2A-CD19t_epHIV7; pF02630] (SEQ ID NO: 12) and CD19Rop_epHIV7 (pJ01683) (SEQ ID NO: 13) is depicted.

[0082] Figure 19 The amino acid sequence of IL13(EmY)-CD8h3-CD8tm2-41BBζ is described (SEQ ID NO: 31 with GMSCFRa signal peptide; SEQ ID NO: 39 without GMSCFRa signal peptide).

[0083] Figure 20 The amino acid sequence of IL13(EmY)-CD8h3-CD28tm-CD28gg-41BB-ζ is described (SEQ ID NO: 32 with GMSCFRa signal peptide; SEQ ID NO: 40 without GMSCFRa signal peptide).

[0084] Figure 21 The amino acid sequence of IL13(EmY)-IgG4(HL-CH3)-CD4tm-41BB-ζ is described (SEQ ID NO: 33 with GMSCFRa signal peptide; SEQ ID NO: 41 without GMSCFRa signal peptide).

[0085] Figure 22 The amino acid sequence of IL13(EmY)-IgG4(L235E,N297Q)-CD8tm-41BB-ζ is described (SEQ ID NO: 34 with GMSCFRa signal peptide; SEQ ID NO: 42 without GMSCFRa signal peptide).

[0086] Figure 23 The amino acid sequence of IL13(EmY)-Linker-CD28tm-CD28gg-41BB-ζ is described (SEQ ID NO: 35 with GMSCFRa signal peptide; SEQ ID NO: 43 without GMSCFRa signal peptide).

[0087] Figure 24 The amino acid sequence of IL13(EmY)-HL-CD28m-CD28gg-41BB-ζ is described (SEQ ID NO: 36 with GMSCFRa signal peptide; SEQ ID NO: 44 without GMSCFRa signal peptide).

[0088] Figure 25 The amino acid sequence of IL13(EmY)-IgG4(HL-CH3)-CD28tm-CD28gg-41BB-ζ is described (SEQ ID NO: 37 with GMSCFRa signal peptide; SEQ ID NO: 45 without GMSCFRa signal peptide).

[0089] Figure 26The amino acid sequence of IL13(EmY)IgG4(L235E, N297Q)-CD28tm-CD28gg-41BB-ζ is described (SEQ ID NO: 38 with GMSCFRa signal peptide; SEQ ID NO: 46 without GMSCFRa signal peptide).

[0090] Figure 27 The amino acid sequence of IL13(EmY)-CD8h3-CD8tm-41BBζ is described (SEQ ID NO: 47 with GMSCFRa signal peptide; SEQ ID NO: 48 without GMSCFRa signal peptide). DETAILED DESCRIPTION

[0091] Described below are the structure, construction, and characterization of a number of IL13Ra2-specific chimeric antigen receptors. A chimeric antigen receptor (CAR) is a recombinant biomolecule that contains at a minimum an extracellular recognition domain, a transmembrane region, and an intracellular signaling domain. Thus, the term "antigen" is not limited to molecules that bind antibodies, but also refers to any molecule that can specifically bind a target. For example, a CAR can comprise a ligand that specifically binds a cell surface receptor. The extracellular recognition domain (also referred to as the extracellular domain or simply the recognition element contained therein) comprises a recognition element that specifically binds a molecule present on the surface of a target cell. The transmembrane region anchors the CAR in the membrane. The intracellular signaling domain comprises the signaling domain from the zeta chain of the human CD3 complex and optionally one or more costimulatory signaling domains. CARs can both bind an antigen and transduce T cell activation, independent of MHC restriction. Thus, CARs are "universal" immune receptors that can treat a patient population with antigen-positive tumors, regardless of their HLA genotype. Adoptive immunotherapy using T lymphocytes expressing tumor-specific CARs can be a powerful therapeutic strategy for treating cancer.

[0092] One IL13Ra2-specific CAR described herein is called IL13(EQ)BBζ. This CAR comprises a number of important features, including: an IL13Ra2 ligand with amino acid changes that improve specificity of binding to IL13Ra2; a domain of CD137 (4-1BB) in tandem with CD3ζ to provide beneficial costimulation; and an IgG4 Fc region that is mutated at two sites within the CH2 region (L235E; N297Q) in a manner that reduces binding by Fc receptors (FcR). Other CARs described herein contain a second costimulatory domain.

[0093] In some cases, the CARs described herein, including the IL13(EQ)BBζ CAR, can be produced using a vector in which the CAR open reading frame is followed by a T2A ribosomal skip sequence and a truncated CD19 (CD19t) that lacks a cytoplasmic signaling tail (truncated at amino acid position 323). In this arrangement, co-expression of CD19t provides an inert, non-immunogenic surface marker that allows for precise determination of genetically modified cells and enables positive selection of genetically modified cells, as well as efficient cell trafficking and / or therapeutic T cell imaging in vivo after adoptive transfer. Co-expression of CD19t provides a marker for in vivo immunotargeting of transduced cells for selective elimination of therapeutic cells using clinically available antibodies and / or immunotoxin reagents, and thus functions as a suicide switch.

[0094] Gliomas express IL13 receptors, particularly the high affinity IL13 receptor. However, unlike the IL13 receptor, glioma cells overexpress a unique IL13Rα2 chain that is capable of binding IL13 independent of the need for IL4Rβ or γc44. Similar to its homolog IL4, IL13 has pleotropic immunomodulatory activities outside the CNS. Both IL13 and IL4 stimulate B lymphocyte production of IgE and inhibit macrophage production of proinflammatory cytokines.

[0095] Detailed studies using autoradiography with radiolabeled IL13 have demonstrated abundant IL13 binding on virtually all malignant glioma tissues studied. This binding is highly homogenous in both tumor sections and single cell analysis. However, molecular probe analysis specific for IL13Rα2 mRNA does not detect expression of the glioma-specific receptor by normal brain elements, and autoradiography with radiolabeled IL13 also does not detect specific IL13 binding in the normal CNS. These studies suggest that the shared IL13Rα1 / IL4β / γc receptor is not detectably expressed in the normal CNS. Thus, IL13Rα2 is a very specific cell surface target for gliomas and is a suitable target for CARs designed to treat gliomas.

[0096] However, IL13-based therapeutic molecules bind to the widely expressed IL13Ra1 / IL4p / gc receptor complex have the potential to mediate unwanted toxicity to normal tissues outside the CNS, and thus limit systemic administration of these agents. Amino acid substitution of the tyrosine at amino acid position 13 of IL13 helix A alpha selectively reduces the affinity of IL13 for the IL13Ra1 / IL4p / gc receptor. However, this mutant, termed IL13(E13Y), has increased binding to IL13Ra2 relative to wild-type IL13. Thus, this minimally altered IL13 analog both increases the specificity and affinity of IL13 for glioma cells. Accordingly, the CAR described herein comprises IL13 containing a mutation at amino acid position 13 (numbering according to Debinski et al. 1999 Clin Cancer Res 5:3143s) (E to Y or E to some other amino acid such as K or R or L or V). However, IL13 with the native sequence can also be used and can be particularly useful in situations where the modified T cells are to be administered locally, such as by direct injection into a tumor mass.

[0097] A CAR described herein can be produced by any means known in the art, although it is preferred that it be produced using recombinant DNA technology. Nucleic acids encoding the several regions of the chimeric receptor can be prepared and assembled into the complete coding sequence by standard techniques of molecular cloning known in the art (genomic library screening, PCR, primer-assisted ligation, site-directed mutagenesis, etc.). The resulting coding region is preferably inserted into an expression vector and used to transform a suitable expression host cell line, preferably a T lymphocyte cell line, and most preferably a self T lymphocyte cell line.

[0098] A plurality of T cell subpopulations isolated from a patient can be transduced with a vector for CAR expression, including unselected PBMC or enriched CD3 T cells or enriched CD3 or memory T cell subpopulations. Central memory T cells are a useful T cell subpopulation. Central memory T cells can be selected by selecting CD45RO+ / CD62L+ cells using, for example Peripheral blood mononuclear cells (PBMC) are isolated from a device to isolate central memory T cells for immunomagnetic selection of cells expressing the desired receptor. Cells enriched for central memory T cells can be activated with anti-CD3 / CD28 and transduced with a SIN lentivirus vector directing expression of an IL13Ra2-specific CAR (e.g., IL13(EQ)BBz) and a truncated human CD19 (CD19t) that is a non-immunogenic surface marker for both in vivo detection and possible ex vivo selection. Activated / genetically modified central memory T cells can be expanded in vitro with IL-2 / IL-15 and cryopreserved. Examples

[0099] Example 1: Construction and Structure of IL13Ra2-Specific CAR

[0100] The structure of a useful IL13Ra2-specific CAR is described below. The codon-optimized CAR sequence contains a membrane-tethered IL-13 ligand mutated at a single site (E13Y) to reduce possible binding to IL13Ra1, an IgG4 Fc spacer containing two mutations (L235E; N297Q) that greatly reduce the model of Fc receptor-mediated recognition, a CD4 transmembrane domain, a costimulatory 4-1BB cytoplasmic signaling domain, and a CD3 zeta cytoplasmic signaling domain. A T2A ribosome skip sequence separates this IL13(EQ)BBz CAR sequence from a CD19t, which is an inert, non-immunogenic cell surface detection / selectable marker. This T2A linkage results in the co-expression of IL13(EQ)BBz and CD19t from a single transcript. Figure 2 A is a schematic of the 2670 nucleotide open reading frame encoding the IL13(EQ)BBz-T2ACD19t construct. In this figure, the IL13Ra2-specific ligand IL13(E13Y), IgG4(EQ)Fc, CD4 transmembrane, 4-1BB cytoplasmic signaling, a glycine-serine-glycine linker, and CD3 zeta cytoplasmic signaling domains of the IL13(EQ)BBz CAR, as well as the T2A ribosome skip and truncated CD19 sequence are indicated. The human GM-CSF receptor alpha and CD19 signal sequences driving IL13(EQ)BBz CAR and CD19t surface expression are also indicated. Thus, the IL13(EQ)BBz-T2ACD19t construct comprises an IL13Ra2-specific, hinge-optimized, costimulatory chimeric immunoreceptor sequence (designated IL13(EQ)BBz), a ribosome skip T2A sequence, and a CD19t sequence.

[0101] The IL13(EQ)BBz sequence was generated by fusing a human GM-CSF receptor alpha leader peptide to an IL13(E13Y) ligand 5L235E / N297Q-modified IgG4 Fc hinge (where the double mutations interfere with FcR recognition), a CD4 transmembrane, a 4-1BB cytoplasmic signaling domain, and a CD3 zeta cytoplasmic signaling domain sequence. This sequence was synthesized de novo after codon optimization. The T2A sequence was obtained from a T2A-containing plasmid digest. The CD19t sequence was obtained from the leader peptide sequence across the CD19-containing plasmid and the transmembrane component (i.e., base pairs 1-972). All three fragments, 1) IL13(EQ)BBz, 2) T2A, and 3) CD19t, were cloned into the multiple cloning site of an epHIV7 lentiviral vector. When transfected into appropriate cells, the vector integrates Figure 2The sequence schematically depicted in B is inserted into the host cell genome. Figure 2 C provides a schematic of the IL13(EQ)BBZ-T2A-CD19t_epHIV7 plasmid itself.

[0102] As Figure 1 As schematically depicted in B, the IL13(EQ)BBZ CAR differs from a previously described IL13Ra2-specific CAR, termed IL13(E13Y)-zetakine, in several important ways (Brown et al. 2012 Clinical Cancer Research 18:2199). The IL13(E13Y)-zetakine consists of the indicated IL13Ra2-specific human IL-13 mutein (huIL-13(E13Y)), a human IgG4 Fc spacer (huY4 Fc), a human CD4 transmembrane (huCD4 tm), and a human CD3 zeta chain cytoplasmic (huCD3 zeta cyt) portion. In contrast, the IL13(EQ)BBZ) has two point mutations, L235E and N297Q, which are located in the CH2 domain of the IgG4 spacer, and a costimulatory 4-1BB cytoplasmic domain (4-1BB cyt).

[0103] Example 2: Construction and structure of epHIV7 for expression of IL13Ra2-specific CAR

[0104] The pHIV7 plasmid is the parental plasmid from which the clinical vector IL13(EQ)BBZ-T2A-CD19t_epHIV7 was derived in the T cell Therapeutics Research Laboratory (TCTRL) at the City of Hope (COH). The epHIV7 vector for expression of CAR was generated from the pHIV7 vector. Importantly, this vector uses the human EFl promoter to drive expression of the CAR. Both the 5' and 3' sequences of the vector are derived from pv653RSN as previously derived from the HXBc2 provirus. The polypurine tract DNA flap sequence (cPPT) is derived from HIV-1 strain pNL4-3 from the NIH AIDS Reagent Repository. The woodchuck post-transcriptional regulatory element (WPRE) sequence was previously described.

[0105] In Figure 3Construction of pHIV7 is schematically depicted in FIG. 1. Briefly, pv653RSN, which contains 653 bp from gag-pol plus 5' and 3' long terminal repeats (LTRs) with an intervening SL3-neomycin phosphotransferase gene (Neo), was subcloned into pBluescript as follows: In step 1, the sequence from the 5' LTR to the rev-response element (RRE) constituted p5'HIV-1 51, then the 5' LTR was modified by removing the sequence upstream of the TATA box and first ligated to the CMV enhancer, then to the SV40 replication origin (p5'HIV-2). In step 2, the 3' LTR was cloned into pBluescript to make p3'HIV-1, a 400-bp deletion was made in the 3' LTR enhancer / promoter to remove the cis-regulatory elements in HIV U3 and form p3'HIV-2. In step 3, fragments isolated from p5'HIV-3 and p3'HIV-2 were ligated to make pHIV-3. In step 4, p3'HIV-2 was further modified by removing extra upstream HIV sequences to yield p3'HIV-3, and a 600-bp BamHI-Sall fragment containing WPRE was added to p3'HIV-3 to make p3'HIV-4. In step 5, the RRE in pHIV-3 was reduced in size by PCR and ligated into p3'HIV-4 from the 5' fragment (not shown) and pHIV-3 to make pHIV-6. In step 6, a 190-bp Bglll-BamHI fragment containing the cPPT DNA flap sequence from HIV-1 pNL4-3(55) was amplified from pNL4-3 and placed between the RRE and WPRE sequences in pHIV6 to make pHIV-7. This parental plasmid, pHIV7-GFP (GFP, green fluorescent protein), was used to package the parental vector using a four-plasmid system.

[0106] Efficient packaging of the viral genome into the vector requires the packaging signal, psi (ψ). The RRE and WPRE enhance RNA transcript transport and transgene expression. The flap sequence in combination with the WPRE has been shown to enhance the transduction efficiency of lentiviral vectors in mammalian cells.

[0107] The helper functions required to produce the viral vector were divided into three separate plasmids to reduce the possibility of producing replication-competent lentivirus through recombination: 1) pCgp encodes the gag / pol proteins required for viral vector assembly; 2) pCMV-Rev2 encodes the Rev protein, which acts on the RRE sequence to assist viral genome transport for efficient packaging; and 3) pCMV-G encodes the glycoprotein of vesiculo-stomatitis virus (VSV), which is required for infectivity of the viral vector.

[0108] There is minimal DNA sequence homology between the pHIV7 encoded vector genome and the helper plasmids. The homologous regions include a packaging signal region of approximately 600 nucleotides located in the gag / pol sequence of the pCgp helper plasmid; the CMV promoter sequence in all three helper plasmids; and the RRE sequence in the pCgp helper plasmid. It is very likely that recombination events could occur that would result in replication-competent recombinant virus because it would require multiple recombination events. In addition, any resulting recombinants would likely lose the functional LTR and tat sequences, which are required for lentiviral replication.

[0109] The CMV promoter was replaced with the EF1 alpha-HTLV promoter (EF1p) and the new plasmid was named epHIV7 Figure 4 ). The EF1p is 563 bp and was introduced into epHIV7 using NruI and NheI after the CMV promoter was cut out.

[0110] The lentiviral genome has been removed from this system and does not contain gag / pol and rev, which are required for the pathogenicity of wild-type virus and for efficient infection of target cells. In addition, the IL13(EQ)BBZ-T2ACD19t_epHIV7 vector construct does not contain a complete 3' LTR promoter, so the resulting expressed and reverse transcribed DNA proviral genome in the targeted cells will have an inactive LTR. Because of this design, no HIV-I derived sequences are transcribed from the provirus and only the therapeutic sequences will be expressed from their respective promoters. The removal of LTR promoter activity in the SIN vector is expected to significantly reduce the possibility of inadvertent activation of host genes (56). Table 4 outlines the regulatory elements present in the IL13(EQ)BBZ-T2ACD19t_epHIV7.

[0111]

[0112]

[0113]

[0114] Example 3: Production of vector for transduction of patient T cells

[0115] For each plasmid (IL13(EQ)BBZ-T2A-CD19t_epHIV7; pCgp; pCMV-G; and pCMV-Rev2), a seed bank was generated that was used to inoculate a fermenter to produce sufficient quantities of plasmid DNA. The plasmid DNA was tested for identity, sterility, and endotoxin before it was used in the generation of lentiviral vector.

[0116] Briefly, cells are expanded from 293T working cell bank (WCB) that have been tested to verify sterility and lack of viral contamination. Vials of 293T cells from the 293T WCB are thawed. Cells are cultured and expanded until there are sufficient numbers of cells to plate an appropriate number of 10 layer cell factories (CF) for vector production and cell train maintenance. A single train of cells can be used for production.

[0117] Lentiviral vectors are produced in up to 10 CFs in batch. Two batches can be produced in the same week, resulting in approximately 20 L of lentiviral supernatant / week. The material produced from all batches is pooled during downstream processing to produce a batch of product. 293T cells are plated in CFs in 293T media (DMEM with 10% FBS). The factories are placed in a 37°C incubator and laid flat horizontally to achieve an even cell distribution across all layers of the CF. Two days later, the cells are transfected using the CaP04method with the four lentiviral plasmids described above, which include Tris:EDTA, 2M CaCl2, 2X HBS, and a mixture of the four DNA plasmids. On day 3 post-transfection, the supernatant containing the secreted lentiviral vector is collected, purified, and concentrated. After the supernatant is removed from the CFs, the production end-of-life cells are collected from each CF. The cells are trypsinized from each factory and collected by centrifugation. The cells are resuspended in frozen media and stored cold. These cells are later used for replication competent lentivirus (RCL) testing.

[0118] To purify and formulate the vector, the crude supernatant is clarified by membrane filtration to remove cell debris. Endonuclease digestion degrades host cell DNA and residual plasmid DNA. The viral supernatant is clarified of cell debris using a 0.45 μm filter. The clarified supernatant is collected into pre-weighed containers to which Endonuclease digestion of residual plasmid DNA and host genomic DNA was performed at 37°C for 6 hours. Initial tangential flow filtration (TFF) concentration of the endonuclease treated supernatant was used to remove residual low molecular weight components from the crude supernatant while concentrating the virus approximately 20-fold. The clarified endonuclease treated viral supernatant was circulated through a hollow fiber cartridge with a NMWCO of 500 kD at a flow rate designed to maintain a shear rate of approximately 4,000 / sec or less while maximizing the flow rate. Diafiltration of the endonuclease treated supernatant was initiated during the concentration process to maintain cartridge performance. An 80% permeate replacement rate was established using 4% lactose in PBS as the diafiltration buffer. The viral supernatant was brought to the target volume, representing a 20-fold concentration of the crude supernatant, and diafiltration was continued at a 100% permeate replacement rate for 4 additional exchange volumes.

[0119] Further concentration of the viral product was accomplished by using high speed centrifugation techniques. A Sorvall RC-26 plus centrifuge was used to pellet the lentivirus at 6000 RPM (6,088 RCF) for 16-20 hours per batch at 6°C. The viral pellets from each batch were then reconstituted in 50 mL volumes of 4% lactose in PBS. The pellets reconstituted in this buffer represented the final formulation for the viral preparation. The complete vector concentration process resulted in an approximate 200-fold volume reduction. After all batches were completed, the material was then placed in -80°C while samples from each batch were tested for sterility. After the samples were verified for sterility, the batches were thawed rapidly with frequent agitation at 37°C. The material was then collected and manually divided into Class II A / B3 bio-safety cabinets in the viral vector suite. A 1 mL fill configuration of the concentrated lentivirus was used in sterile USP grade, externally threaded, O-ring cryogenic vials. The Center for Applied Technology Development (CATD) Quality Systems (QS) released all material in accordance with Policies and Standard Operating Procedures for the CBG and in compliance with current Good Manufacturing Practices (cGMPs).

[0120] To ensure the purity of the lentiviral vector preparation, it was tested for residual host DNA contamination, as well as for the transfer of residual host and plasmid DNA. In addition, vector identity was assessed by RT-PCR to ensure the presence of the correct vector. For the vectors intended for use in this study, all release criteria were met.

[0121] Example 4: Manufacture of T cells suitable for use in ACT

[0122] T lymphocytes are obtained from patients by leukapheresis and appropriate allogeneic or autologous T cell subsets, such as central memory T cells (TCM), are genetically altered to express CAR and then administered back to the patient by any clinically acceptable means to achieve anti-cancer therapy.

[0123] A summary of the manufacturing strategy for T Figure 5 cells (for IL13(EQ)BBZ / CD19t+T CM cells) is described in CM Particular, plasma apheresis products are ficollized, washed and incubated overnight. GMP grade anti-CD14, anti-CD25 and anti-CD45RA reagents (Miltenyi Biotec) and CliniMACS® Prodigy® separation device are then used to deplete monocytes, regulatory T cells and naive T cell populations. After depletion, DREG56-biotin (COH clinical grade) and anti-biotin microbeads (Miltenyi Biotec) are used on the CliniMACS® Prodigy® separation device to enrich CD62L+T TM cells from the negative fraction. CM Cells are enriched for CD62L+T

[0124] After enrichment, T CM cells are formulated in complete X-Vivo 15 plus 50 IU / mL IL-2 and 0.5 ng / mL IL-15 and transferred to Teflon cell culture bags where they are stimulated with Dynal ClinEx TM Vivo CD3 / CD28 beads. After stimulation for up to 5 days, cells are transduced with IL13(EQ)BBZ-T2A-CD19t_epHIV7 lentiviral vector at a multiplicity of infection (MOI) of 1.0-0.3. Cultures are maintained with the addition of complete X-Vivo 15 and IL-2 and IL-15 cytokines as required for cell expansion for up to 42 days (maintaining cell density between 3x10 5 -2x10 6 cells / mL) and cytokine replenishment every week on Monday, Wednesday and Friday of the culture. Cells are typically expanded to approximately 10 9 cells under these conditions within 21 days. At the end of the culture period, cells are harvested, washed twice and formulated in clinical grade cryopreservation medium (Cryostore CS5, BioLife Solutions).

[0125] On the day of T-cell infusion, the refrigerated and released products were thawed, washed, and prepared for re-infusion. The refrigerated tubes containing the released cell products were removed from liquid nitrogen storage, thawed, cooled, and washed with PBS / 2% human serum albumin (HSA) wash buffer. After centrifugation, the supernatant was removed, and the cells were resuspended in preservative-free physiological saline (PFNS) / 2% HSA infusion dilution. Samples were then used for quality control testing.

[0126] Two quantification runs were performed on cells obtained from healthy donors using the aforementioned manufacturing platform. Human donor (HD) numbers—HD006.5 and HD187.1—were assigned to the products of each preclinical quantification run. Importantly, as shown in Table 5, these quantification runs expanded >80-fold within 28 days, and the expanded cells expressed the IL13(EQ)BBζ / CD19t transgene.

[0127] Table 5: Summary of expression data from preclinical quantitative run products

[0128]

[0129] Example 5: IL13(EQ)BBζ / CD19t+T CM Flow cytometry analysis of surface transgene and T cell marker expression

[0130] The two preclinical quantitative run products described in Example 4 were used in the preclinical studies described below. Figure 6 AC describes the results of flow cytometry analysis of surface transgene and T cell marker expression. IL13(EQ)BBζ / CD19t+T CM HD006.5 and HD187.1 were co-stained with anti-IL13-PE and anti-CD8-FITC to detect CD8+CAR+ and CD4+ (i.e., CD8-negative) CAR+ cells. Figure 6 A), or co-staining with anti-CD19-PE and anti-CD4-FITC to detect CD4+CD19t+ and CD8+ (i.e., CD4-negative) CAR+ cells ( Figure 6 B). Using fluorescently conjugated anti-CD3, TCR, CD4, CD8, CD62L, and CD28 (gray bar chart) or allotype controls (black bar chart), IL13(EQ)BBζ / CD19t+T was stained. CM HD006.5 and HD187.1. Figure 6 C). In Figure 6 In the various AC figures, the percentages indicated are based on the above isotypes stained with live lymphocytes (DAPI negative).

[0131] Example 6: IL13(EQ)BBζ / CD19t+TCM Effector activity

[0132] Assess the effector activity of IL13(EQ)BBζ / CD19t+TCM and in Figure 7 The results of this analysis are described in section AB. In short, IL13(EQ)BBζ / CD19t+T CM HD006.5 and HD187.1 were used as effectors in a 6-hour 51Cr-release assay based on CD19t expression using a 10E:1T ratio. The IL13Rα2-positive tumor target was engineered from K562 to express IL13Rα2 (K562-IL13Rα2) and the primary glioma line PBT030-2, while the IL13Rα2-negative tumor target control was the parental K562 line (…). Figure 7 A). As described above, antigen-dependent cytokine production of IL13(EQ)BBζ / CD19t+HD006.5 and HD187.1 was assessed after overnight co-culture with the same IL13Rα2-positive and negative targets at a 10E:1T ratio. Cytokine levels were measured and INF-γ levels were described using the Bio-Plex Pro Human Cytokine TH1 / TH2 assay kit. Figure 7 B).

[0133] Example 7: IL13(EQ)BBζ / CD19t+T CM in vivo antitumor activity

[0134] The following study demonstrates that IL13(EQ)BBζ / CD19t+T in an in vivo mouse model CM Demonstrating anti-tumor effects. In particular, we have evaluated IL13(EQ)BBζ / CD19t+T CM To target the antitumor potential of the IL13Rα2+ primary low-passage glioblastoma tumor spheroid line PBT030-2, the primary low-passage glioblastoma tumor spheroid line PBT030-2 was modified to express both EGFP and the firefly luciferase (ffLuc) reporter gene (PBT030-2 EGFP:ffLuc) (6). A group of primary lines (PBT) from patient glioblastoma samples were grown into tumor spheroids (TS) in serum-free medium. These expanded TS lines exhibited stem cell-like characteristics, including expression of stem cell markers, multilineage differentiation, and the ability to initiate orthotopic tumors with low cell numbers in immunocompromised mice (NSG). PBT030-2 EGFP:ffLuc TS-initiated xenograft model (0.1 x 10⁻⁶) 6Cells; 5 day graft implantation) have previously been used to assess the in vivo anti-tumor activity of IL13Rα2-specific CAR-expressing T cells in NSG mice, whereby three injections of 2x10 6 Cytolytic T lymphocytes (CTLs) reduce tumor growth. However, in those experiments, most PBT030-2 tumors eventually recurred. By comparison, a single injection of IL13(EQ)BBζ / CD19t+T CM (1.1x10 6 CAR+T CM ; 2x10 6 Total TCM) demonstrated strong anti-tumor activity against PBT030-2 EGFP:ffLuc TS-initiated tumors (0.1x10 6 Cells; 5 day graft implantation) as shown in Figure 8 A-C. In comparison to NSG mice treated with PBS or mock-transduced T CM IL13(EQ)BBζ / CD19t+T CM significantly reduced ffLuc flux (>18 days, p<0.001) and significantly improved survival (p=0.0008).

[0135] Briefly, EGFP-ffLuc+PBT030-2 tumor cells (1x10 5 ) were stereotactically implanted into the right frontal brain of NSG mice. On day 5, mice received 2x10 6 IL13(EQ)BBζ / CD19t+T CM (1.1x106 CAR+; n=6), 2x10 6 mock T CM (nocar; n=6) or PBS (n=6). Figure 8 A depicts representative mice from each group, shown using Xenogen Living Image for relative tumor burden. Quantification of ffLuc flux (photons / sec) shows that IL13(EQ)BBζ / CD19t+T CM induced tumor regression (#p<0.02, *p<0.001, repeated measures ANOVA) CM ( Figure 8 B). As Figure 8 C shows, Kaplan Meier survival curves (n=6 / group) demonstrate that mice treated with IL13(EQ)BBζ / CD19t+T CM survival was significantly improved (p=0.0008; log-rank test).

[0136] ​Example 8: Comparison of IL13(EQ)BBζ+Tcm and non-Tcm IL13-zetakine CD8+ CTL clones in anti-tumor efficacy and T cell persistence

[0137] The following study compares IL13(EQ)BBζ+Tcm to previously generated IL13Rα2- specific human CD8+CTLs (IL13-zetakine CD8+CTLs (described in Brown et al. 2012 Clin Cancer Res 18:2199 and Kahlon et al. 2004 Cancer Res 64:9160). The IL13-zetakine uses the CD3ζ stimulatory domain, lacks a costimulatory domain and uses the same IL13 variant as IL13(EQ)BBζ+.

[0138] A panel of primary brain tumor (PBT) lines were generated from patient glioblastoma samples that were grown as tumor spheres (TS) in serum-free media (Brown et al. 2012 Clin Cancer Res 18:2199; Brown et al. 2009 Cancer Res 69:8886). These expanded TS lines exhibit stem cell-like characteristics, including expression of stem cell markers, multilineage differentiation, and the ability to initiate orthotopic tumors in immunocompromised mice (NSG) at low cell numbers. The IL13Rα2+primary low-passage glioblastoma TS line PBT030-2 was used for the experiments summarized below, which has been engineered to express both the EGFP and firefly luciferase (ffLuc) reporter genes (PBT030-2 EGFP:ffLuc) (Brown et al. 2012 Clin Cancer Res 18:2199).

[0139] First, a single dose (1 x 10 6 CAR T cells) of IL13(EQ)BBζ+Tcm product was compared to IL13-zetakine CD8+CTL clones evaluated against PBT030-2 EGFP:ffuc TS-initiated xenografts (0.1 x 10 6 Although both IL13Rα2-specific CAR T cells (IL13-zetakine CTL and IL13(EQ)BBζTcm) demonstrated anti-tumor activity against established PBT030-2 tumors compared to untreated and mock Tcm (CAR-negative) controls Figure 9A and 9B), IL13(EQ)BBζ+Tcm mediated significantly improved survival and long-lasting tumor regression compared to our first generation IL13-zetakine CD8+CTL clone, with mice surviving greater than 150 days Figure 9 C).

[0140] To further compare the therapeutic efficacy of these two IL13Ra2-CAR T cell products, 1.0, 0.3 and 0.1 x 10 6 Dose titration of CAR T cells Figure 10 A-C). The highest dose (1 x 10 6 ) of IL13-zetakine CD8+CTL cl.2D7 mediated an anti-tumor response as determined by Xenogen flux in 3 of 6 animals Figure 10 C), but no significant anti-tumor response was observed at lower CAR T cell doses. By comparison, the IL13(EQ)BBζ+Tcm product mediated complete tumor regression at all dose levels in the majority of mice with treatment involving as few as 0.1 x 10 6 CAR T cells. These data demonstrate that IL13(EQ)BBζ+Tcm are at least 10-fold more effective than IL13-zetakine CD8+CTL clones in anti-tumor efficacy. The improved anti-tumor efficacy is due to improved T cell persistence in the tumor microenvironment. Evaluation of CD3+T cells 7 days after i.c. injection revealed a significant number of IL13(EQ)BBζ+Tcm in the tumor microenvironment, whereas very few first generation IL13-ζ CTLs Figure 11 ) were present.

[0141] Example 9: Comparison of CAR T cell delivery routes for treatment of large TS- initiated PBT tumors

[0142] Described below are studies that compare the route of delivery intravenously (i.v.) or intracranially (i.c.) on anti-tumor activity against an aggressive primary PBT line. In a preliminary study (data not shown), it was unexpectedly observed that i.v. administered IL13(EQ)BBζ+Tcm did not provide a therapeutic benefit compared to PBS for treating small (day 5) PBT030-2 EGFP:ffLuc tumors. This is in contrast to the strong therapeutic effect observed with i.c. administered CAR+T cells. It was reasoned that day 5 PBT030-2 tumors can have been too small to recruit therapeutic T cells from the periphery, so comparisons were made for i.v. versus i.c. delivery against larger day 19 PBT030-2 EGFP:ffLuc tumors. For these studies, PBT030-2 engrafted mice were treated with two i.v. infusions (5 x 10 6 CAR+Tcm; day 19 and day 26) or four i.c. infusions (1 x 10 6 CAR+Tcm; day 19, 22, 26 and 29) IL13(EQ)BBZ+Tcm, or mock Tcm (no CAR). There was no therapeutic benefit as monitored by Xenogen imaging of i.v. administered CAR+T cells or Kaplan-Meier survival analysis Figure 12 A and 12B). In contrast, potent anti-tumor activity was observed with i.c. administered IL13(EQ)BBζ+Tcm Figure 12 A-B). Then, brains from a group of mice 7 days after T cell injection were collected and assessed for CD3+human T cells by IHC. Surprisingly, for mice treated i.v. with mock Tcm or IL13(EQ)BBζ Tcm, there were no detectable CD3+human T cells in the tumor or other mouse brain regions where human T cells are normally found (i.e., pia mater) Figure 12 C), suggesting a lack of tumor tropism. This is in contrast to the detection of significant numbers of T cells in i.c. treated mice Figure 12 D).

[0143] Tumor-derived cytokines, particularly MCP-1 / CCL2, are important in recruiting T cells into tumors. Therefore, PBT030-2 tumor cells were evaluated and found to produce high levels of MCP-1 / CCL2 comparable to U251 T cells, a glioma line previously shown to attract effector CD8+T cells intravenously administered to intracranially engrafted tumors. Malignant gliomas are highly invasive tumors and are often multifocal in presentation. The above studies established that IL13BBZ T CMInfiltrated tumors such as PBT030-2 can be eliminated and mediate long-term durable anti-tumor activity. The ability of intracranially delivered CAR T cells to traffic to multifocal disease was also examined. For this study, PBT030-2 EGFP:ffLuc TS were implanted in the left and right hemispheres of the brain of NSG mice and CAR+T cells were injected only over the right tumor site. Figure 13 A) and T cells were detected by CD3 IHC at 7 days post T cell infusion in the tumor of the left hemisphere (i.e., the right tumor) for all mice evaluated (n=3). Figure 13 B). These findings provide evidence that CAR+T cells are able to traffic to and infiltrate tumor foci at distant sites. Similar findings were also observed in a second tumor model using U251 T glioma cell line (data not shown).

[0144] Example 10: Comparison of costimulatory domains

[0145] A series of studies were performed to evaluate multiple costimulatory domains. The multiple CARs evaluated are schematically depicted in Figure 14 A and include a first generation CD3 zeta CAR lacking a costimulatory domain, second generation CARs incorporating either a 4-1 BB costimulatory domain or a CD28 costimulatory domain, and third generation CARs containing both a CD28 costimulatory domain and a 41 BB costimulatory domain. All CAR constructs also contain a T2A ribosome skip sequence and a truncated CD19 (CD19t) sequence as a marker for transduced cells.

[0146] CD4 and CD8 T cells were lentivirally transduced CM and CAR-expressing T cells were immunomagnetically enriched by anti-CD19. CD19 and IL13 (i.e., CAR) expression levels were determined by flow cytometry. Results are shown in Figure 14 B. The stability of each CAR construct was determined by dividing the mean fluorescence intensity (MFI) of the CAR (IL13) by the mean fluorescence intensity of the transduction marker (CD19t). Figure 14 C). The two CARs containing a 4-1 BB costimulatory domain exhibited the lowest expression levels compared to the CD19t transduction marker.

[0147] The ability of the indicated mock transduced or CAR-expressing T cells to kill PBT030-2 tumor cell targets expressing IL13Rα2 was determined in a 4 hour 51 Cr-release assay. Results of this study are shown in Figure 15 A (mean % chromium release ± S.D. for triplicate wells is depicted). As expected, mock transduced T cells did not effectively lyse targets. In contrast, all CAR-expressing T cells lysed tumor cells in a similar manner.Figure 15 B describes the results of studies in which mock transduced or CAR-expressing T cells were co-cultured overnight at a 10: 1 ratio with PBT030-2 tumor cells expressing IL13Ra2 and supernatants were analyzed for IL-13 and IFN-g levels by Cytometric Bead Array. Interestingly, T cells expressing zeta, 41BB-zeta or CD28-41BB-zeta CARs exhibited lower antigen-stimulated cytokine production than T cells expressing CD28-zeta CAR.

[0148] The in vivo efficacy of various CARs was examined as follows. Briefly, NSG mice received an intracranial injection of ffLuc+PBT030-2 tumor cells on day 0 and were randomized into 6 groups (n=9-10 mice / group) for intracranial treatment on day 8 with PBS (tumor only), mock transduced T cells or T cells expressing the indicated IL13Ra2-specific CARs. Quantitative bioluminescence imaging was then performed to monitor tumor growth over time. Bioluminescence images of representative mice in each group are shown in Figure 16 A). Flow levels for each mouse on day 27 Figure 16 B). All groups treated with IL13Ra2-specific CAR T cells showed statistically significant reductions in tumor volume compared to mice treated with mock transduced T cells except for those treated with CD28-CAR-expressing T cells Figure 16 C).

[0149] Example 11: Amino acid sequence of IL13(EQ)BBz / CD19t

[0150] The complete amino acid sequence of IL13(EQ)BBz / CD19t is described in Figure 17 The entire sequence (SEQ ID NO: 1) includes: a 22 amino acid GMCSF signal peptide (SEQ ID NO: 2), a 112 amino acid IL-13 sequence (SEQ ID NO: 3; amino acid substitution E13Y shown in bold); a 229 amino acid IgG4 sequence (SEQ ID NO: 4; with amino acid substitutions L235E and N297Q shown in bold); a 22 amino acid CD4 transmembrane sequence (SEQ ID NO: 5); a 42 amino acid 4-1BB sequence (SEQ ID NO: 6); a 3 amino acid Gly linker; a 112 amino acid CD3 zeta sequence (SEQ ID NO: 7); a 24 amino acid T2A sequence (SEQ ID NO: 8); and a 323 amino acid CD19t sequence (SEQ ID NO: 9).

[0151] The mature chimeric antigen receptor sequence (SEQ ID NO: 10) comprises: a 112 amino acid IL-13 sequence (SEQ ID NO: 3; amino acid substitution E13Y shown in bold); a 229 amino acid IgG4 sequence (SEQ ID NO: 4; with amino acid substitutions L235E and N297Q shown in bold); a 22 amino acid CD4 sequence (SEQ ID NO: 5); a 42 amino acid 4-1BB sequence (SEQ ID NO: 6); a 3 amino acid Gly linker; and a 112 amino acid CD3 zeta sequence (SEQ ID NO: 7). Within the CAR sequence (SEQ ID NO: 10) is an IL-13 / IgG4 / CD4t / 41-BB sequence (SEQ ID NO: 11) comprising a 112 amino acid IL-13 sequence (SEQ ID NO: 3; amino acid substitution E13Y shown in bold); a 229 amino acid IgG4 sequence (SEQ ID NO: 4; with amino acid substitutions L235E and N297Q shown in bold); a 22 amino acid CD4 sequence (SEQ ID NO: 5); and a 42 amino acid 4-1BB sequence (SEQ ID NO: 6). The IL13 / IgG4 / CD4t / 4-1BB sequence (SEQ ID NO: 11) can be connected to a 112 amino acid CD3 zeta sequence (SEQ ID NO: 7) by a linker such as a Gly Gly Gly linker. The CAR sequence (SEQ ID NO: 10) can be preceded by a 22 amino acid GMCSF signal peptide (SEQ ID NO: 2).

[0152] Figure 18 A sequence comparison of IL13(EQ)41BBζ [IL13{EQ}41BBζ T2A-CD19t_epHIV7; pF02630] (SEQ ID NO: 12) and CD19Rop_epHIV7 (pJ01683) (SEQ ID NO: 13) is depicted.

[0153] Example 12: Amino acid sequence of IL13(EQ)BBζ / CD19t

[0154] Figures 19-26Amino acid sequences of additional CARs against IL13Rα2 are described in various cases in which multiple domains are tagged except for a GlyGlyGly spacer positioned between certain intracellular domains. Each includes a Glu to Tyr substitution in human IL13 (SEQ ID NO: 3; amino acid substitution E13Y highlighted). In the expression vectors used to express these CARs, the expressed amino acid sequence can include a 24 amino acid T2A sequence (SEQ ID NO: 8); and a 323 amino acid CD19t sequence (SEQ ID NO: 9) to allow for the co-expression of a truncated CD19 sequence on the surface of the cell expressing the CAR.

[0155] A panel of CARs containing a human IL13 (E13Y) domain, a CD28tm domain, a CD28gg costimulatory domain, a 4-1BB costimulatory domain, and a CD3ζ domain CAR backbone and containing a HL (22 amino acid) spacer, a CD8 hinge (48 amino acid) spacer, an IgG4-HL-CH3 (129 amino acid) spacer, or an IgG4(EQ) (229 amino acid) spacer were tested for their ability to mediate IL13Ra2-specific killing as assessed in a 72 hour co-culture assay. All were active except for HL (22 amino acid) which appeared to have weak CAR expression in this system. SEQUENCE LISTING <110> City of Hope <120> Costimulatory chimeric antigen receptor T cell targeting IL13R-ALPHA-2 <130> 40056-0002WO1 <140> PCT / US2015 / 051089 <141> 2015-09-18 <150> 62 / 053,068 <151> 2014-09-19 <160> 54 <170> PatentIn version 3.5 <210> 1 <211> 889 <212> PRT <213> Artificial Sequence <220> <221> ORIGIN <223> / note=“description of artificial sequence: synthetic polypeptide” <400> 1 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg 20 25 30 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gin Asn Gin Lys Ala Pro 35 40 45 Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met 50 55 60 Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala 65 70 75 80 Ile Glu Lys Thr Gin Arg Met Leu Ser Gly Phe Cys Pro His Lys Val 85 90 95 Ser Ala Gly Gin Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu 100 105 110 Val Ala Gin Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125 Arg Glu Gly Arg Phe Asn Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro 130 135 140 Cys Pro Ala Pro Glu Phe Glu Gly Gly Pro Ser Val Phe Leu Phe Pro 145 150 155 160 Pro Lys Pro Lys Asp Thr Leu Met lie Ser Arg Thr Pro Glu Val Thr 165 170 175 Cys Val Val Val Asp Val Ser Gin Glu Asp Pro Glu Val Gin Phe Asn 180 185 190 Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg 195 200 205 Glu Glu Gin Phe Gin Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val 210 215 220 Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser 225 230 235 240 Asn Lys Gly Leu Pro Ser Ser lie Gin Lys Thr lie Ser Lys Ala Lys 245 250 255 Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Gin Glu 260 265 270 Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe 275 280 285 Tyr Pro Ser Asp lie Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu 290 295 300 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe 305 310 315 320 Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gin Glu Gly 325 330 335 Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 340 345 350 Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly Lys Met Ala Leu lie Val 355 360 365 Leu Gly Gly Val Ala Gly Leu Leu Leu Phe lie Gly Leu Gly lie Phe 370 375 380 Phe Lys Arg Gly Arg Lys Lys Leu Leu Tyr lie Phe Lys Gin Pro Phe 385 390 395 400 Met Arg Pro Val Gin Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg 405 410 415 Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Gly Gly Gly Arg Val 420 425 430 Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gin Gin Gly Gin Asn 435 440 445 Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val 450 455 460 Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg 465 470 475 480 Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin Lys Asp Lys 485 490 495 Met Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly Glu Arg Arg Arg 500 505 510 Gly Lys Gly His Asp Gly Leu Tyr Gin Gly Leu Ser Thr Ala Thr Lys 515 520 525 Asp Thr Tyr Asp Ala Leu His Met Gin Ala Leu Pro Pro Arg Leu Glu 530 535 540 Gly Gly Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val Glu 545 550 555 560 Glu Asn Pro Gly Pro Arg Met Pro Pro Pro Arg Leu Leu Phe Phe Leu 565 570 575 Leu Phe Leu Thr Pro Met Glu Val Arg Pro Glu Glu Pro Leu Val Val 580 585 590 Lys Val Glu Glu Gly Asp Asn Ala Val Leu Gin Cys Leu Lys Gly Thr 595 600 605 Ser Asp Gly Pro Thr Gin Gin Leu Thr Trp Ser Arg Glu Ser Pro Leu 610 615 620 Lys Pro Phe Leu Lys Leu Ser Leu Gly Leu Pro Gly Leu Gly lie His 625 630 635 640 Met Arg Pro Leu Ala Ile Trp Leu Phe Ile Phe Asn Val Ser Gln Gln 645 650 655 Met Gly Gly Phe Tyr Leu Cys Gln Pro Gly Pro Pro Ser Glu Lys Ala 660 665 670 Trp Gln Pro Gly Trp Thr Val Asn Val Glu Gly Ser Gly Glu Leu Phe 675 680 685 Arg Trp Asn Val Ser Asp Leu Gly Gly Leu Gly Cys Gly Leu Lys Asn 690 695 700 Arg Ser Ser Glu Gly Pro Ser Ser Pro Ser Gly Lys Leu Met Ser Pro 705 710 715 720 Lys Leu Tyr Val Trp Ala Lys Asp Arg Pro Glu Ile Trp Glu Gly Glu 725 730 735 Pro Pro Cys Val Pro Pro Arg Asp Ser Leu Asn Gln Ser Leu Ser Gln 740 745 750 Asp Leu Thr Met Ala Pro Gly Ser Thr Leu Trp Leu Ser Cys Gly Val 755 760 765 Pro Pro Asp Ser Val Ser Arg Gly Pro Leu Ser Trp Thr His Val His 770 775 780 Pro Lys Gly Pro Lys Ser Leu Leu Ser Leu Glu Leu Lys Asp Asp Arg 785 790 795 800 Pro Ala Arg Asp Met Trp Val Met Glu Thr Gly Leu Leu Leu Pro Arg 805 810 815 Ala Thr Ala Gln Asp Ala Gly Lys Tyr Tyr Cys His Arg Gly Asn Leu 820 825 830 Thr Met Ser Phe His Leu Glu Ile Thr Ala Arg Pro Val Leu Trp His 835 840 845 Trp Leu Leu Arg Thr Gly Gly Trp Lys Val Ser Ala Val Thr Leu Ala 850 855 860 Tyr Leu Ile Phe Cys Leu Cys Ser Leu Val Gly Ile Leu His Leu Gln 865 870 875 880 Arg Ala Leu Val Leu Arg Arg Lys Arg 885 <210> 2 <211> twenty two <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Description of artificial sequence: Synthesis" peptide <400> 2 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro 20 <210> 3 <211> 112 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 3 Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr Leu Ile Glu Glu Leu 1 5 10 15 Val Asn Ile Thr Gin Asn Gin Lys Ala Pro Leu Cys Asn Gly Ser Met 20 25 30 Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala Leu Glu 35 40 45 Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gin Arg 50 55 60 Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gin Phe Ser 65 70 75 80 Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gin Phe Val Lys 85 90 95 Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn 100 105 110 <210> 4 <211> 229 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / Description of Artificial Sequence: synthetic Polypeptide <400> 4 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe 1 5 10 15 Glu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 20 25 30 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 35 40 45 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 50 55 60 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Gln Ser 65 70 75 80 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 85 90 95 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 100 105 110 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 115 120 125 Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln 130 135 140 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp He Ala 145 150 155 160 Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr 165 170 175 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 180 185 190 Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser 195 200 205 Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser 210 215 220 Leu Ser Leu Gly Lys 225 <210> 5 <211> 22 <212> PRT <213> Homo sapiens <400> 5 Met Ala Leu He Val Leu Gly Gly Val Ala Gly Leu Leu Leu Phe He 1 5 10 15 Gly Leu Gly He Phe Phe 20 <210> 6 <211> 42 <212> PRT <213> Artificial Sequence <220> <221> SOURCE <223> NOTE="Artificial sequence description: synthetic polypeptide" <400> 6 Lys Arg Gly Arg Lys Lys Leu Leu Tyr lie Phe Lys Gin Pro Phe Met 1 5 10 15 Arg Pro Val Gin Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe 20 25 30 Pro Gin Glu Glu Glu Gly Gly Cys Glu Leu 35 40 <210> 7 <211> 112 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: Synthetic polypeptide" <400> 7 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gin Gin Gly 1 5 10 15 Gln Asn Gin Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30 Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 35 40 45 Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin Lys 50 55 60 Asp Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly Glu Arg 65 70 75 80 Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gin Gly Leu Ser Thr Ala 85 90 95 Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gin Ala Leu Pro Pro Arg 100 105 110 <210> 8 <211> 24 <212> PRT <213> Artificial Sequence <220> <221> SOURCE <223> NOTE = "Artificial sequence description: synthetic peptide" <400> 8 Leu Glu Gly Gly Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp 1 5 10 15 Val Glu Glu Asn Pro Gly Pro Arg 20 <210> 9 <211> 323 <212> PRT <213> Artificial Sequence <220> <221> SOURCE <223> NOTE = "Artificial sequence description: synthetic polypeptide" <400> 9 Met Pro Pro Pro Arg Leu Leu Phe Phe Leu Leu Phe Leu Thr Pro Met 1 5 10 15 Glu Val Arg Pro Glu Glu Pro Leu Val Val Lys Val Glu Glu Gly Asp 20 25 30 Asn Ala Val Leu Gin Cys Leu Lys Gly Thr Ser Asp Gly Pro Thr Gin 35 40 45 Gln Leu Thr Trp Ser Arg Glu Ser Pro Leu Lys Pro Phe Leu Lys Leu 50 55 60 Ser Leu Gly Leu Pro Gly Leu Gly lie His Met Arg Pro Leu Ala lie 65 70 75 80 Trp Leu Phe lie Phe Asn Val Ser Gin Gin Met Gly Gly Phe Tyr Leu 85 90 95 Cys Gin Pro Gly Pro Pro Ser Glu Lys Ala Trp Gin Pro Gly Trp Thr 100 105 110 Val Asn Val Glu Gly Ser Gly Glu Leu Phe Arg Trp Asn Val Ser Asp 115 120 125 Leu Gly Gly Leu Gly Cys Gly Leu Lys Asn Arg Ser Ser Glu Gly Pro 130 135 140 Ser Ser Pro Ser Gly Lys Leu Met Ser Pro Lys Leu Tyr Val Trp Ala 145 150 155 160 Lys Asp Arg Pro Glu lie Trp Glu Gly Glu Pro Pro Cys Val Pro Pro 165 170 175 Arg Asp Ser Leu Asn Gin Ser Leu Ser Gin Asp Leu Thr Met Ala Pro 180 185 190 Gly Ser Thr Leu Trp Leu Ser Cys Gly Val Pro Pro Asp Ser Val Ser 195 200 205 Arg Gly Pro Leu Ser Trp Thr His Val His Pro Lys Gly Pro Lys Ser 210 215 220 Leu Leu Ser Leu Glu Leu Lys Asp Asp Arg Pro Ala Arg Asp Met Trp 225 230 235 240 Val Met Glu Thr Gly Leu Leu Leu Pro Arg Ala Thr Ala Gln Asp Ala 245 250 255 Gly Lys Tyr Tyr Cys His Arg Gly Asn Leu Thr Met Ser Phe His Leu 260 265 270 Glu Ile Thr Ala Arg Pro Val Leu Trp His Trp Leu Leu Arg Thr Gly 275 280 285 Gly Trp Lys Val Ser Ala Val Thr Leu Ala Tyr Leu Ile Phe Cys Leu 290 295 300 Cys Ser Leu Val Gly Ile Leu His Leu Gln Arg Ala Leu Val Leu Arg 305 310 315 320 Arg Lys Arg <210> 10 <211> 520 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Synthetic polypeptide" ​ <400> 10 Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr Leu Ile Glu Glu Leu 1 5 10 15 Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly Ser Met 20 25 30 Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala Leu Glu 35 40 45 Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gln Arg 50 55 60 Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln Phe Ser 65 70 75 80 Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe Val Lys 85 90 95 Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn 100 105 110 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe 115 120 125 Glu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 130 135 140 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 145 150 155 160 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 165 170 175 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Gln Ser 180 185 190 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 195 200 205 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 210 215 220 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 225 230 235 240 Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln 245 250 255 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 260 265 270 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 275 280 285 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 290 295 300 Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser 305 310 315 320 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 325 330 335 Leu Ser Leu Gly Lys Met Ala Leu Ile Val Leu Gly Gly Val Ala Gly 340 345 350 Leu Leu Leu Phe Ile Gly Leu Gly Ile Phe Phe Lys Arg Gly Arg Lys 355 360 365 Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr 370 375 380 Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu 385 390 395 400 Gly Gly Cys Glu Leu Gly Gly Gly Arg Val Lys Phe Ser Arg Ser Ala 405 410 415 Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu 420 425 430 Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly 435 440 445 Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu 450 455 460 Gly Leu Tyr Asn Glu Leu Gin Lys Asp Lys Met Ala Glu Ala Tyr Ser 465 470 475 480 Glu He Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly 485 490 495 Leu Tyr Gin Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu 500 505 510 His Met Gin Ala Leu Pro Pro Arg 515 520 <210> 11 <211> 405 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Description of Artificial Sequence: Synthetic Polypeptide" <400> 11 Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr Leu He Glu Glu Leu 1 5 10 15 Val Asn He Thr Gin Asn Gin Lys Ala Pro Leu Cys Asn Gly Ser Met 20 25 30 Val Trp Ser He Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala Leu Glu 35 40 45 Ser Leu He Asn Val Ser Gly Cys Ser Ala He Glu Lys Thr Gin Arg 50 55 60 Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gin Phe Ser 65 70 75 80 Ser Leu His Val Arg Asp Thr Lys He Glu Val Ala Gin Phe Val Lys 85 90 95 Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn 100 105 110 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe 115 120 125 Glu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 130 135 140 Leu Met He Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 145 150 155 160 Ser Gin Glu Asp Pro Glu Val Gin Phe Asn Trp Tyr Val Asp Gly Val 165 170 175 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Gin Ser 180 185 190 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu 195 200 205 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 210 215 220 Ser lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro 225 230 235 240 Gln Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin 245 250 255 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala 260 265 270 Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr 275 280 285 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 290 295 300 Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser 305 310 315 320 Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser 325 330 335 Leu Ser Leu Gly Lys Met Ala Leu lie Val Leu Gly Gly Val Ala Gly 340 345 350 Leu Leu Leu Phe lie Gly Leu Gly lie Phe Phe Lys Arg Gly Arg Lys 355 360 365 Lys Leu Leu Tyr lie Phe Lys Gin Pro Phe Met Arg Pro Val Gin Thr 370 375 380 Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu 385 390 395 400 Gly Gly Cys Glu Leu 405 <210> 12 <211> 7754 <212> DNA <213> Artificial Sequence <220> <221> Source <223> / note= "Synthetic sequence polynucleotide" <400> 12 gttagaccag atctgagcct gggagctctc tggctaacta gggaacccac tgcttaagcc 60 tcaataaagc ttgccttgag tgcttcaagt agtgtgtgcc cgtctgttgt gtgactctgg 120 taactagaga tccctcagac ccttttagtc agtgtggaaa atctctagca gtggcgcccg 180 aacagggact tgaaagcgaa agggaaacca gaggagctct ctcgacgcag gactcggctt 240 gctgaagcgc gcacggcaag aggcgagggg cggcgactgg tgagtacgcc aaaaattttg 300 actagcggag gctagaagga gagagatggg tgcgagagcg tcagtattaa gcgggggaga 360 attagatcga tgggaaaaaa ttcggttaag gccaggggga aagaaaaaat ataaattaaa 420 ACATATAGTA TGGGCAAGCA GGGAGCTAGA ACgATTcGCA GTTAATCCTG GCCTGTTAGA 480 AACATCAGAA GGCTGTA AAC AAAT ACTGGG ACAgCTACAA CCA TCCCTTC AGACAGGATC 540 AGAAGAAGTT AGATCATTAT ATAATACAGT AGCAACCC TCTATTGTGT GCATCAAAGGAT 600 AGAGATAAAA GACACC AAGGA AGCTTTAGA CAAGATAGAG GAAGAGCAA AACA AAAGTA A 660 GAAAAAAGCA CAGCAAGCAG CAGCTGACAC AGGACACAGC AA T C AGGTCA GC C AAA TTA 720 CCCTATAGTG CAGAACATCC AGGGGCAAAT GGTACATCAG GCCATATCAC CTA GAAC TTT 780 AAATGCATGG GTA AAAGTAGTA GAAGAGAAGGCTTTCAGC CCAGAAGTGA TACCCATGTT 840 TTCAGCATTATCAGAAGGAGCCACCCCACAAGATT TAAACACATGCTAAACACAGTGGG 900 GGGACATCAAGCAGCCATGCAAATGT TAAAAGAGACCATCAATGAGGAAGCTGCAGGCAA 960 AGAGAAGAGTG GTGCAGAGA GAAAAAAGAG CAGTGGGAA T AGGAGCTTTG TTCCTTGGGT 1020 TCTTGGGAGC AGCAGGAAGC ACTATGGGCG CAGC GTCAAT GACGCTGACG GTACAGGCCA 1080 GACAATTATTGTCTG GTATAGTGCAGCAGCAGAAC AATT T GCTGAGGGCT ATTGAGGC GC 1140 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 1200 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 1260 tcatttgcac cactgctgtg ccttggatct acaaatggca gtattcatcc acaattttaa 1320 aagaaaaggg gggattgggg ggtacagtgc aggggaaaga atagtagaca taatagcaac 1380 agacatacaa actaaagaat tacaaaaaca aattacaaaa attcaaaatt ttcgggttta 1440 ttacagggac agcagagatc cagtttgggg atcaattgca tgaagaatct gcttagggtt 1500 aggcgttttg cgctgcttcg cgaggatctg cgatcgctcc ggtgcccgtc agtgggcaga 1560 gcgcacatcg cccacagtcc ccgagaagtt ggggggaggg gtcggcaatt gaaccggtgc 1620 ctagagaagg tggcgcgggg taaactggga aagtgatgtc gtgtactggc tccgcctttt 1680 tcccgagggt gggggagaac cgtatataag tgcagtagtc gccgtgaacg ttctttttcg 1740 caacgggttt gccgccagaa cacagctgaa gcttcgaggg gctcgcatct ctccttcacg 1800 cgcccgccgc cctacctgag gccgccatcc acgccggttg agtcgcgttc tgccgcctcc 1860 cgcctgtggt gcctcctgaa ctgcgtccgc cgtctaggta agtttaaagc tcaggtcgag 1920 accgggcctt tgtccggcgc tcccttggag cctacctaga ctcagccggc tctccacgct 1980 ttgcctgacc ctgcttgctc aactctacgt ctttgtttcg ttttctgttc tgcgccgtta 2040 cagatccaag ctgtgaccgg cgcctacggc tagcgccgcc accatgctgc tgctggtgac 2100 cagcctgctg ctgtgcgagc tgccccaccc cgcctttctg ctgatccctg gccccgtgcc 2160 ccctagcacc gccctgcgct acctgatcga ggaactggtg aacatcaccc agaaccagaa 2220 agcccccctg tgcaacggca gcatggtgtg gagcatcaac ctgaccgccg gcatgtactg 2280 tgccgccctg gaaagcctga tcaacgtgag cggctgcagc gccatcgaga aaacccagcg 2340 gatgctgtcc ggcttctgcc cccacaaggt gtccgccgga cagttcagca gcctgcacgt 2400 gcgggacacc aagatcgagg tggcccagtt cgtgaaggac ctgctgctgc acctgaagaa 2460 gctgttccgg gagggccggt tcaactacaa gaccaccccc cctgtgctgg acagcgacgg 2520 cagcttcttc ctgtacagca ggctgaccgt ggacaagagc cggtggcagg aaggcaacgt 2580 CTTGGAGCTG GAGAAGAGGC CTGGCTGACC ATGAGCGGCT GGGAGTGCAC ATGAGCGGCT 60 CCTGAGCCTG GGCAAGCGGG TGAAGTTCAG CCGGTCCGCC GACGCCCCTG CCTACCAGCA 2700 GGGCCAGAAC CAGCTGTACA ACGAGCTGAA CCTGGGCAGG GGAGGAATAC GACGTGCT 2760 GGACAAGCGG AGAGGCCGGG ACCCTGAGAT GGGCGGCAAG CCTCGGCAGA AGAACCCCCA 2820 GGAAGGCCTG TATAACGAAC TGCAGAAAGA CAAGATGGCC GAGGCCTACA GC GAGATCGG 2880 CATGAAGGGC GAGCGGAGGC GGGGCAAGGG CCACGACGGC CTGTATCAGG GCCTGTCCAC 2940 CGCCACC AAG GATA CCTAC GACGCCCTGCA CATGCAGGCC CTGCCCCCAA GGTCTAGACC 3000 C GGGCTGCAG GAATT CGATAT CAAGCTTATC GATAATCAA CCTCTGGATT ACAAAATTTG 3060 TGAAAGATTG ACTG GTATTCTTA ACTATGTTGC TCCTTTTACG CTATGTGGAT ACGCTGC 3120 TTTAATGCCT TTGTATCATG CTATTGCTTC CCGTATGGCT TTCATTTTCT CCTCCTTGTA 3180 TAATCCTGGT TGCTGTCTCT TTATGAGGAG TTGTGGCCCG TTGTCAGGCA AC GTGGCGT 3240 G GTGTGC ACTGTGTTTGCT GACGCAACCC CACTG GTTGGG GCATTGCCACCACCTGTCA 3300 GCTCCTTTCC GGGACTTTCG CTTTCCCCCT CCCTATTGCC ACGGCGGAAC TCATCGCCGC 3360 CTGCCTTGCC CGCTGCTGGA CAGGGGCTCG GCTGTTGGGC ACTGACAATT CCGTGGTGTT 3420 GTCGGGGAAA TCATCGTCCT TTCCTTGGCT GCTCGCCTGT GTTGCCACCT GGATTCTGCG 3480 CGGGACGTCC TTCTGCTACG TCCCTTCGGC CCTCAATCCA GCGGACCTTC TTCCCgcGG 3540 CCTGCTGCCG GCTCTGCGGC CTCTTCCGCG TCTTCGCCTT CGCCCTCAGA CGAGTCGGAT 3600 CTCCCTTTGG GCCGCCTCCC CGCATCGATA CCgtcGACTA GCCGTACCTT TAAGACCAAT 3660 GACTTACAAG GCAGCTGTAG ATCTTAGCCA CTTTTTAAAA GAAAAGGGGG GACTGGAAGG 3720 GCTAATTCAC TCCCAAAGAA GACAAGATCT GCTTTTTGCC TGTACTGGGT CTCTCTGGTT 3780 AGACCAGATC TGAGCCTGGG AGCTCTCTGG CTAaCTAGGG AACCCACTGC TTAAGCCTCA 3840 ATAAAGCTTG CCTTGAGTGC TTCAAGTAGT GTGTGCCCgt CTGTTGTGTG ACTCTGGTAA 3900 CTAGAGATCC CTCAGACCCt TTTAGTCAGT GTGGAAAATC TCTAGCAGAA TTCGATATCA 3960 AGCTTATCGA TACCgtcGAC CTCGAGGGGG GGCCCGGTAC CCAATTCGCC CTATAGTGAG 4020 tcgtattaca attcactggc cgtcgtttta caacgtcgtg actgggaaaa cctggcgtt 4080 accaactta atcgccttgc agcacatccc ccttcgcca gctggcgtaa tagcgaagg 4140 gcccgcaccg atcgccctc ccaacagttg cgcagcctga atggcgaatg gaaattgtaa 4200 gcgttaatat ttgttaaaa ttcgcgttaa atttttgtta aatcagctca tttttaacc 4260 ataggccga atcggcaa atcccttata atcaaaga atagaccgag ataggttga 4320 gtgttgttcc agtttggac aagagtccac tattaaagaa cgtggactcc aacgtcaaag 4380 ggcgaaaaac cgtctatcag ggcgatggcc cactacgtga accatcaccc taatcaagtt 4440 ttttggggtc gaggtgccgt aaagcactaa atcggaaccc taaagggagc cccgattta 4500 gagcttgacg gggaaagccg gcgaacgtgg cgagaaagga agggaaaa gcgaaaggag 4560 cgggcgctag ggcgctggca agtgtagcgg tcacgctgcg cgtaccacc acacccgccg 4620 cgcttaatgc gccgctacag gggcgcgtcag gtggcactt tcgggaat gtgcgcggaa 4680 cccctatttg tttattttc taaatacatt caatatgta tccgctcatg agacaataac 4740 cctgataaat gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg 4800 tcgcccttat tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc 4860 tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg 4920 atctcaacag cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga 4980 gcacttttaa agttctgcta tgtggcgcgg tattatcccg tattgacgcc gggcaagagc 5040 aactcggtcg ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag 5100 aaaagcatct tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga 5160 gtgataacac tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg 5220 cttttttgca caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga 5280 atgaagccat accaaacgac gagcgtgaca ccacgatgcc tgtagcaatg gcaacaacgt 5340 tgcgcaaact attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact 5400 ggatggaggc ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt 5460 ttattgctga taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg 5520 ggccagatgg taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta 5580 tggatgaacg aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac 5640 tgtcagacca agtttactca tatatacttt agattgattt aaaacttcat ttttaattta 5700 aaaggatcta ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt 5760 tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt 5820 tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt 5880 gtttgccgga tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc 5940 agataccaaa tactgttctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg 6000 tagcaccgcc tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg 6060 ataagtcgtg tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt 6120 cgggctgaac ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac 6180 TGAGATACCT ACAGCGTGAG CTATGAGAAA GCGCCACGCT TCCC GAAGGG AGAAAGGC GG 6240 ACAGGTATCC GGTAAGCGGC AGGTCGG AACAGGAGAGCG CACGAGGGAG CTTCCAGGGG 6300 GAAACGCCTG GTATCTTTAT AGTCCTGTCG GGT TTCGCCACCTCTGACTTGAGCGTCGAT 6360 TTTTGTGATG CTCGTCAGGG GGGCGGAGCC TATGGAAAAA CGCCAGCAAC GC GGCCTTTT 6420 TACGGTT CCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTT CCTGCGTTATCCCCTG 6480 ATTCTGTGGAT AACC GTATT ACCGCCTTTG AGTGAGCTGAT ACCGCTCGC C GCAGCCGAA 6540 CGACC GAGCGC AGCGAGTCA GTGAGCGAGGA AGCGGAAGA GCGCCCAATAC GCAAACC GC 6600 CTCTCCCCGC GC GTTGGCCG ATTCATTAAT GCAGCTGGCAC GACAGGTTTC CCGACTGGA 6660 AAGCGGGCAG TGAGCGCAAC GCAATTAATG TGAGT TAGCTC ACTCATTAG GCACCCCAGG 6720 CTTTACACTT TATGCTTCCG GCTC GTATGTTGTGTGGAATTGTGAGCGGATAACAATTTC 6780 ACACAGGAAAC AGCTATGACC ATGATTACGC CAAGCTCGAA ATTAACCCTC ACTAAAGGG 6840 AACAAAAGCT GGAGCTCCACC GC GGTGGCGGCCTCGAGGTCGAGATCCGGTCGACCAGCA 6900 accatagtccc gccccctaac tccgcccatc ccgcccctaa ctccgcccag ttccgcccat 6960 tctccgcccc atggctgact aatttttttt atttatgcag aggccgaggc cgcctcggcc 7020 tctgagctat tccagaagta gtgaggaggc ttttttggag gcctaggctt ttgcaaaaag 7080 cttcgacggt atcgattggc tcatgtccaa cattaccgcc atgttgacat tgattattga 7140 ctagttatta atagtaatca attacggggt cattagttca tagcccatat atggagttcc 7200 gcgttacata acttacggta aatggcccgc ctggctgacc gcccaacgac ccccgcccat 7260 tgacgtcaat aatgacgtat gttcccatag taacgccaat agggactttc cattgacgtc 7320 aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 7380 caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tatgcccagt 7440 acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 7500 ccatggtgat gcggttttgg cagtacatca atgggcgtgg atagcggttt gactcacggg 7560 gatttccaag tctccacccc attgacgtca atgggagttt gttttggcac caaaatcaac 7620 gggactttcc aaaatgtcgt aacaactccg ccccattgac gcaaatgggc ggtaggcgtg 7680 tacggaattc ggagtggcga gccctcagat cctgcatata agcagctgct ttttgcctgt 7740 actgggtctc tctg 7754 <210> 13 <211> 8732 <212> DNA <213> Artificial Sequence <220> <221> Source <223> / Note="Description of artificial sequence: Synthetic Polynucleotide" <400>​​​​​​​​​​​​​​​acatatagta tgggcaagca gggagctaga acgattcgca gttaatcctg gcctgttaga 480 aacatcagaa ggctgtagac aaatactggg acagctacaa ccatcccttc agacaggatc 540 agaagaactt agatcattat ataatacagt agcaaccctc tattgtgtgc atcaaaggat 600 agagataaaa gacaccaagg aagctttaga caagatagag gaagagcaaa acaaaagtaa 660 gaaaaaagca cagcaagcag cagctgacac aggacacagc aatcaggtca gccaaaatta 720 ccctatagtg cagaacatcc aggggcaaat ggtacatcag gccatatcac ctagaacttt 780 aaatgcatgg gtaaaagtag tagaagagaa ggctttcagc ccagaagtga tacccatgtt 840 ttcagcatta tcagaaggag ccaccccaca agatttaaac accatgctaa acacagtggg 900 gggacatcaa gcagccatgc aaatgttaaa agagaccatc aatgaggaag ctgcaggcaa 960 agagaagagt ggtgcagaga gaaaaaagag cagtgggaat aggagctttg ttccttgggt 1020 tcttgggagc agcaggaagc actatgggcg cagcgtcaat gacgctgacg gtacaggcca 1080 gacaattatt gtctggtata gtgcagcagc agaacaattt gctgagggct attgaggcgc 1140 aacagcatct gttgcaactc acagtctggg gcatcaagca gctccaggca agaatcctgg 1200 ctgtggaaag atacctaaag gatcaacagc tcctggggat ttggggttgc tctggaaaac 1260 tcatttgcac cactgctgtg ccttggatct acaaatggca gtattcatcc acaattttaa 1320 aagaaaaggg gggattgggg ggtacagtgc aggggaaaga atagtagaca taatagcaac 1380 agacatacaa actaaagaat tacaaaaaca aattacaaaa attcaaaatt ttcgggttta 1440 ttacagggac agcagagatc cagtttgggg atcaattgca tgaagaatct gcttagggtt 1500 aggcgttttg cgctgcttcg cgaggatctg cgatcgctcc ggtgcccgtc agtgggcaga 1560 gcgcacatcg cccacagtcc ccgagaagtt ggggggaggg gtcggcaatt gaaccggtgc 1620 ctagagaagg tggcgcgggg taaactggga aagtgatgtc gtgtactggc tccgcctttt 1680 tcccgagggt gggggagaac cgtatataag tgcagtagtc gccgtgaacg ttctttttcg 1740 caacgggttt gccgccagaa cacagctgaa gcttcgaggg gctcgcatct ctccttcacg 1800 cgcccgccgc cctacctgag gccgccatcc acgccggttg agtcgcgttc tgccgcctcc 1860 cgcctgtggt gcctcctgaa ctgcgtccgc cgtctaggta agtttaaagc tcaggtcgag 1920 accgggcctt tgtccggcgc tcccttggag cctacctaga ctcagccggc tctccacgct 1980 ttgcctgacc ctgcttgctc aactctacgt ctttgtttcg ttttctgttc tgcgccgtta 2040 cagatccaag ctgtgaccgg cgcctacggc tagcgccgcc accatgctgc tgctggtgac 2100 cagcctgctg ctgtgcgagc tgccccaccc cgcctttctg ctgatccccg acatccagat 2160 gacccagacc acctccagcc tgagcgccag cctgggcgac cgggtgacca tcagctgccg 2220 ggccagccag gacatcagca agtacctgaa ctggtatcag cagaagcccg acggcaccgt 2280 caagctgctg atctaccaca ccagccggct gcacagcggc gtgcccagcc ggtttagcgg 2340 cagcggctcc ggcaccgact acagcctgac catctccaac ctggaacagg aagatatcgc 2400 cacctacttt tgccagcagg gcaacacact gccctacacc tttggcggcg gaacaaagct 2460 ggaaatcacc ggcagcacct ccggcagcgg caagcctggc agcggcgagg gcagcaccaa 2520 gggcgaggtg aagctgcagg aaagcggccc tggcctggtg gcccccagcc agagcctgag 2580 cgtgacctgc accgtgagcg gcgtgagcct gcccgactac ggcgtgagct ggatccggca 2640 gccccccagg aagggcctgg aatggctggg cgtgatctgg ggcagcgaga ccacctacta 2700 caacagcgcc ctgaagagcc ggctgaccat catcaaggac aacagcaaga gccaggtgtt 2760 cctgaagatg aacagcctgc agaccgacga caccgccatc tactactgcg ccaagcacta 2820 ctactacggc ggcagctacg ccatggacta ctggggccag ggcaccagcg tgaccgtgag 2880 cagcgagagc aagtacggcc ctccctgccc cccttgccct gcccccgagt tcctgggcgg 2940 acccagcgtg ttcctgttcc cccccaagcc caaggacacc ctgatgatca gccggacccc 3000 cgaggtgacc tgcgtggtgg tggacgtgag ccaggaagat cccgaggtcc agttcaattg 3060 gtacgtggac ggcgtggagg tgcacaacgc caagaccaag cccagggaag agcagttcaa 3120 cagcacctac cgggtggtgt ccgtgctgac cgtgctgcac caggactggc tgaacggcaa 3180 agaatacaag tgcaaggtgt ccaacaaggg cctgcccagc agcatcgaga aaaccatcag 3240 caaggccaag ggccagcctc gggagcccca ggtgtacacc ctgccccctt cccaggaaga 3300 GATGACCAAG AATCAGGTGT CCCTGACCTG CCTGGTGAAG GGCTTCTACC CCAGCGACAT 3360 CGCCGTGGAG TGGGAGAGCA ACGGCCAGCC CGAGAACAAC TACAAGACCA CCCCCCCTGT 3420 GCTGGACAGC GACGGCAGCT TCTTCCTGTA CAGCAGGCTG ACCGTGGACA AGAGCCGGTG 3480 GCAGGAAGGC AACGTCTTTA GCTGCAGCGT GATGCACGAG GCCCTGCACA ACCACTACAC 3540 CCAGAAGAGC CTGTCCCTGA GCCTGGGCAA GATGGCCCTG ATCGTGCTGG GCGGCgtggc 3600 Cgggctgctg ctgttcatcg gcctgggcat ctttttccgg gtgaagttca gccggtccgc 3660 CGACGCCCCT GCCTACCAGC AGGGCCAGAA CCAGCTGTAC AACGAGCTGA ACCTGGGCAG 3720 GCgggaggaa tacgacgtgc tggacaagcg gagaggccgg gaccctgaga tgggcggcaa 3780 GCCCAGGCGG AAGAACCCTC AGGAAGGCCT GTATAACGAA CTGCAGAAAG ACAAGATGGC 3840 CGAGGCCTAC AGCGAGATCG Gcatgaaggg cgagcggcgg aggggcaagg gccacgacgg 3900 CCTGTACCAG GGCCTGAGCA CCgccaccaa ggatacctac gacgccctgc acatgcaggc 3960 CCTGCCCCCC AGGTGACCCG GGCTGCAGGA ATTCGatatc AAGCTTATCG ATaatcaacc 4020 tctggattac aaaatttgtg aaagattgac tggtattctt aactatgttg ctcctttac 4080 gctatgtgga tacgctgctt taatgccttt gtatcatgct attgcttccc gtatggcttt 4140 cattttctcc tccttgtata aatcctggtt gctgtctctt tatgaggagt tgtggcccgt 4200 tgtcaggcaa cgtggcgtgg tgtgcactgt gtttgctgac gcaaccccca ctggttgggg 4260 cattgccacc acctgtcagc tcctttccgg gactttcgct ttccccctcc ctattgccac 4320 ggcggaactc atcgccgcct gccttgcccg ctgctggaca ggggctcggc tgttgggcac 4380 tgacaattcc gtggtgttgt cggggaaatc atcgtccttt ccttggctgc tcgcctgtgt 4440 tgccacctgg attctgcgcg ggacgtcctt ctgctacgtc ccttcggccc tcaatccagc 4500 ggaccttcct tcccgcggcc tgctgccggc tctgcggcct cttccgcgtc ttcgccttcg 4560 ccctcagacg agtcggatct ccctttgggc cgcctccccg catcgatacc gtcgactagc 4620 cgtaccttta agaccaatga cttacaaggc agctgtagat cttagccact ttttaaaaga 4680 aaagggggga ctggaagggc taattcactc ccaaagaaga caagatctgc tttttgcctg 4740 tactgggtct ctctggttag accagatctg agcctgggag ctctctggct aactagggaa 4800 cccactgctt aagcctcaat aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct 4860 gttgtgtgac tctggtaact agagatccct cagacccttt tagtcagtgt ggaaaatctc 4920 tagcagaatt cgatatcaag cttatcgata ccgtcgacct cgaggggggg cccggtaccc 4980 aattcgccct atagtgagtc gtattacaat tcactggccg tcgttttaca acgtcgtgac 5040 tgggaaaacc ctggcgttac ccaacttaat cgccttgcag cacatccccc tttcgccagc 5100 tggcgtaata gcgaagaggc ccgcaccgat cgcccttccc aacagttgcg cagcctgaat 5160 ggcgaatgga aattgtaagc gttaatattt tgttaaaatt cgcgttaaat ttttgttaaa 5220 tcagctcatt ttttaaccaa taggccgaaa tcggcaaaat cccttataaa tcaaaagaat 5280 agaccgagat agggttgagt gttgttccag tttggaacaa gagtccacta ttaaagaacg 5340 tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg cgatggccca ctacgtgaac 5400 catcacccta atcaagtttt ttggggtcga ggtgccgtaa agcactaaat cggaacccta 5460 aagggagcccc cgatttaga gcttgacggg gaaagccggc gaacgtggcg agaaaggaag 5520 ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag tgtagcggtc acgctgcgcg 5580 taaccaccac acccgccgcg cttaatgcgc cgctacaggg cgcgtcaggt ggcacttttc 5640 ggggaaatgt gcgcggaacc cctatttgtt tatttttcta aatacattca aatatgtatc 5700 cgctcatgag acaataaccc tgataaatgc ttcaataata ttgaaaaagg aagagtatga 5760 gtattcaaca tttccgtgtc gcccttattc ccttttttgc ggcattttgc cttcctgttt 5820 ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga agatcagttg ggtgcacgag 5880 tgggttacat cgaactggat ctcaacagcg gtaagatcct tgagagtttt cgccccgaag 5940 aacgttttcc aatgatgagc acttttaaag ttctgctatg tggcgcggta ttatcccgta 6000 ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta ttctcagaat gacttggttg 6060 agtactcacc agtcacagaa aagcatctta cggatggcat gacagtaaga gaattatgca 6120 gtgctgccat aaccatgagt gataacactg cggccaactt acttctgaca acgatcggag 6180 GAGAAGCCAATTCACATTTCCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 60 GTTGGGAACC GGAGCTG AAT GAAGCC ATAC CAAACGACG A GC GT GAC ACC AC GAT GC CTG 6300 TAGCAATGGC AACAACGTTG CGCAAAC TAT TAAC TGGCGA CTACTTACT CTAGCTTCCC 6360 GGCAACAATT AATAGACTGG ATGGAGGCGG ATAAAGTTGC AGGACCAC TTCTGCGCTCGG 6420 CCCTTCCGGC TGGCTGGTTT ATTGCTGATA AATCTGGAGC CGGTGAGCGT GGGTCTCGCG 6480 GTATCATTGC AGC ACTGGGGCC AGATGGTAAG CCCTCCCGTA TCGTAGTTAT CTACAGA 6540 C GGGGA GT C AGGCA ACTAT GGA TGAAC GAA ATAGAC AGAT CGCTGAGAT AGGTGCCTCAC 6600 TGATTAAGCA TTGGTAAC TGT CAGACCAAG TTTACTCATA TATACTTTAG ATTGATTTAA 6660 A ACTTC ATTT TTAATT TAAA AGGATCTAGGT GAAGATCCTTTTTTGATAAT CT CATGACCA 6720 AAATCCCTTA AC GTGAGTTTT CGTTCCACT GAGC GTCAGACCCCGTAGAA AAGATCAAAG 6780 GATCTTCTTG AGATCCTTTTTTCTGC GCGTAATCTGCTGCTTGCAAAC AAA AAAACAC 6840 CGCTACCAGC GGTG GTTT GTTT GCCGGATC AAGAGCTACCA ACTCTTTTTT CGAAGGTAA 6900 ctggcttcag cagagcgcag ataccaaata ctgttcttct agtgtagccg tagttaggcc 6960 accacttcaa gaactctgta gcaccgccta catacctcgc tctgctaatc ctgttaccag 7020 tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt ggactcaaga cgatagttac 7080 cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg cacacagccc agcttggagc 7140 gaacgaccta caccgaactg agatacctac agcgtgagct atgagaaagc gccacgcttc 7200 ccgaagggag aaaggcggac aggtatccgg taagcggcag ggtcggaaca ggagagcgca 7260 cgagggagct tccaggggga aacgcctggt atctttatag tcctgtcggg tttcgccacc 7320 tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg gcggagccta tggaaaaacg 7380 ccagcaacgc ggccttttta cggttcctgg ccttttgctg gccttttgct cacatgttct 7440 ttcctgcgtt atcccctgat tctgtggata accgtattac cgcctttgag tgagctgata 7500 ccgctcgccg cagccgaacg accgagcgca gcgagtcagt gagcgaggaa gcggaagagc 7560 gcccaatacg caaaccgcct ctccccgcgc gttggccgat tcattaatgc agctggcacg 7620 acaggtttcc cgactggaaa gcgggcagtg agcgcaacgc aattaatgtg agttagctca 7680 ctcattaggc accccaggct ttacacttta tgcttccggc tcgtatgttg tgtggaattg 7740 tgagcggata acaatttcac acaggaaaca gctatgacca tgattacgcc aagctcgaaa 7800 ttaaccctca ctaaagggaa caaaagctgg agctccaccg cggtggcggc ctcgaggtcg 7860 agatccggtc gaccagcaac catagtcccg cccctaactc cgcccatccc gcccctaact 7920 ccgcccagtt ccgcccattc tccgccccat ggctgactaa ttttttttat ttatgcagag 7980 gccgaggccg cctcggcctc tgagctattc cagaagtagt gaggaggctt ttttggaggc 8040 ctaggctttt gcaaaaagct tcgacggtat cgattggctc atgtccaaca ttaccgccat 8100 gttgacattg attattgact agttattaat agtaatcaat tacggggtca ttagttcata 8160 gcccatatat ggagttccgc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 8220 ccaacgaccc ccgcccattg acgtcaataa tgacgtatgt tcccatagta acgccaatag 8280 ggactttcca ttgacgtcaa tgggtggagt atttacggta aactgcccac ttggcagtac 8340 atcaagtgta tcatatgcca agtacgcccc ctattgacgt caatgacggt aaatggcccg 8400 cctggcatta tgcccagtac atgaccttat gggactttcc tacttggcag tacatctacg 8460 tattagtcat cgctattacc atggtgatgc ggttttggca gtacatcaat gggcgtggat 8520 agcggtttga ctcacgggga tttccaagtc tccaccccat tgacgtcaat gggagtttgt 8580 tttggcacca aaatcaacgg gactttccaa aatgtcgtaa caactccgcc ccattgacgc 8640 aaatgggcgg taggcgtgta cggaattcgg agtggcgagc cctcagatcc tgcatataag 8700 cagctgctttttgcctgtac tgggtctctc tg 8732 <210> 14 <211> 10 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Description of artificial sequence: Synthesis" peptide <400> 14 Gly Gly Gly Ser Ser Gly Gly Gly Ser Gly 1 5 10 <210> 15 <211> 12 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Description of artificial sequence: Synthesis" peptide <400> 15 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro 1 5 10 <210> 16 <211> 22 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: synthetic peptide" <400> 16 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Gly Gly Gly Ser 1 5 10 15 Ser Gly Gly Gly Ser Gly 20 <210> 17 <211> 39 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 17 Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser Asn 1 5 10 15 Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro Leu 20 25 30 Phe Pro Gly Pro Ser Lys Pro 35 <210> 18 <211> 48 <212> PRT <213> Artificial Sequence <220> <221> source <223> / Note="Description of artificial sequence: Synthesis" polypeptide <400> 18 Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro 1 5 10 15 Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro 20 25 30 Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp 35 40 45 <210> 19 <211> 45 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Description of artificial sequence: Synthesis" polypeptide <400> 19 Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala 1 5 10 15 Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly 20 25 30 Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp 35 40 45 <210> 20 <211> 129 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Description of artificial sequence: Synthetic Polypeptide" <400> 20 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Gly Gly Gly Ser 1 5 10 15 Ser Gly Gly Gly Ser Gly Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 20 25 30 Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr 35 40 45 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 50 55 60 Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 65 70 75 80 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys 85 90 95 Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu 100 105 110 Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 115 120 125 Lys <210> 21 <211> 21 <212> PRT <213> Homo sapiens <400> 21 Leu Cys Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu 1 5 10 15 Thr Ala Leu Phe Leu 20 <210> 22 <211> 27 <212> PRT <213> Homo sapiens <400> 22 Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu 1 5 10 15 Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val 20 25 <210> 23 <211> 21 <212> PRT <213> Homo sapiens <400> 23 Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu 1 5 10 15 Ser Leu Val Ile Thr 20 <210> 24 <211> 23 <212> PRT <213> Homo sapiens <400> 24 Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu 1 5 10 15 Ser Leu Val Ile Thr Leu Tyr 20 <210> 25 <211> 24 <212> PRT <213> Homo sapiens <400> 25 Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu 1 5 10 15 Ser Leu Val Ile Thr Leu Tyr Cys 20 <210> 26 <211> 27 <212> PRT <213> Homo sapiens <400> 26 Ile Ile Ser Phe Phe Leu Ala Leu Thr Ser Thr Ala Leu Leu Phe Leu 1 5 10 15 Leu Phe Phe Leu Thr Leu Arg Phe Ser Val Val 20 25 <210> 27 <211> 41 <212> PRT <213> Homo sapiens <400> 27 Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr 1 5 10 15 Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro 20 25 30 Pro Arg Asp Phe Ala Ala Tyr Arg Ser 35 40 <210> 28 <211> 41 <212> PRT <213> Homo sapiens <400> 28 Arg Ser Lys Arg Ser Arg Gly Gly His Ser Asp Tyr Met Asn Met Thr 1 5 10 15 Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro 20 25 30 Pro Arg Asp Phe Ala Ala Tyr Arg Ser 35 40 <210> 29 <211> 42 <212> PRT <213> Homo sapiens <400> 29 Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met 1 5 10 15 Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe 20 25 30 Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu 35 40 <210> 30 <211> 42 <212> PRT <213> Homo sapiens <400> 30 Ala Leu Tyr Leu Leu Arg Arg Asp Gln Arg Leu Pro Pro Asp Ala His 1 5 10 15 Lys Pro Pro Gly Gly Gly Ser Phe Arg Thr Pro Ile Gln Glu Glu Gln 20 25 30 Ala Asp Ala His Ser Thr Leu Ala Lys Ile 35 40 <210> 31 <211> 362 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 31 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg 20 25 30 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro 35 40 45 Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met 50 55 60 Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala 65 70 75 80 Ile Glu Lys Thr Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys Val 85 90 95 Ser Ala Gly Gln Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu 100 105 110 Val Ala Gln Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala ProArg Glu Gly Arg Phe Asn Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg 130 135 140 Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg 145 150 155 160 Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly 165 170 175 Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr 180 185 190 Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Lys Arg Gly 195 200 205 Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val 210 215 220 Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu 225 230 235 240 Glu Glu Gly Gly Cys Glu Leu Gly Gly Gly Arg Val Lys Phe Ser Arg 245 250 255 Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn 260 265 270 Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg 275 280 285 Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro 290 295 300 Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala 305 310 315 320 Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His 325 330 335 Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp 340 345 350 Ala Leu His Met Gln Ala Leu Pro Pro Arg 355 360 <210> 32 <211> 410 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Description of artificial sequence: Synthesis" polypeptide <400> 32 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg 20 25 30 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro 35 40 45 Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met 50 55 60 Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala 65 70 75 80 Ile Glu Lys Thr Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys Val 85 90 95 Ser Ala Gly Gln Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu 100 105 110 Val Ala Gln Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125 Arg Glu Gly Arg Phe Asn Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg 130 135 140 Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg 145 150 155 160 Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly 165 170 175 Leu Asp Phe Ala Cys Asp Phe Trp Val Leu Val Val Val Gly Gly Val 180 185 190 Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp 195 200 205 Val Arg Ser Lys Arg Ser Arg Gly Gly His Ser Asp Tyr Met Asn Met 210 215 220 Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala 225 230 235 240 Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Gly Gly Gly Lys Arg Gly 245 250 255 Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val 260 265 270 Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu 275 280 285 Glu Glu Gly Gly Cys Glu Leu Gly Gly Gly Arg Val Lys Phe Ser Arg 290 295 300 Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn 305 310 315 320 Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg 325 330 335 Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro 340 345 350 Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala 355 360 365 Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His 370 375 380 Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp 385 390 395 400 Ala Leu His Met Gln Ala Leu Pro Pro Arg 405 410 <210> 33 <211> 442 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: Synthetic polypeptide" <400> 33 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg 20 25 30 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro 35 40 45 Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met 50 55 60 Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala 65 70 75 80 Ile Glu Lys Thr Gin Arg Met Leu Ser Gly Phe Cys Pro His Lys Val 85 90 95 Ser Ala Gly Gin Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu 100 105 110 Val Ala Gin Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125 Arg Glu Gly Arg Phe Asn Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro 130 135 140 Cys Pro Gly Gly Gly Ser Ser Gly Gly Gly Ser Gly Gly Gin Pro Arg 145 150 155 160 Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys 165 170 175 Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 180 185 190 Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys 195 200 205 Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 210 215 220 Arg Leu Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser 225 230 235 240 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser 245 250 255 Leu Ser Leu Ser Leu Gly Lys Met Ala Leu Ile Val Leu Gly Gly Val 260 265 270 Ala Gly Leu Leu Leu Phe Ile Gly Leu Gly Ile Phe Phe Lys Arg Gly 275 280 285 Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gin Pro Phe Met Arg Pro Val 290 295 300 Gln Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu 305 310 315 320 Glu Glu Gly Gly Cys Glu Leu Gly Gly Gly Arg Val Lys Phe Ser Arg 325 330 335 Ser Ala Asp Ala Pro Ala Tyr Gin Gin Gly Gin Asn Gin Leu Tyr Asn 340 345 350 Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg 355 360 365 Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro 370 375 380 Gln Glu Gly Leu Tyr Asn Glu Leu Gin Lys Asp Lys Met Ala Glu Ala 385 390 395 400 Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His 405 410 415 Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp 420 425 430 Ala Leu His Met Gln Ala Leu Pro Pro Arg 435 440 <210> 34 <211> 541 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: Synthetic polypeptide" <400> 34 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg 20 25 30 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro 35 40 45 Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met 50 55 60 Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala 65 70 75 80 Ile Glu Lys Thr Gin Arg Met Leu Ser Gly Phe Cys Pro His Lys Val 85 90 95 Ser Ala Gly Gin Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu 100 105 110 Val Ala Gin Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125 Arg Glu Gly Arg Phe Asn Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro 130 135 140 Cys Pro Ala Pro Glu Phe Glu Gly Gly Pro Ser Val Phe Leu Phe Pro 145 150 155 160 Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr 165 170 175 Cys Val Val Val Asp Val Ser Gin Glu Asp Pro Glu Val Gin Phe Asn 180 185 190 Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg 195 200 205 Glu Glu Gin Phe Gin Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val 210 215 220 Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser 225 230 235 240 Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys 245 250 255 Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu 260 265 270 Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe 275 280 285 Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu 290 295 300 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe 305 310 315 320 Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly 325 330 335 Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 340 345 350 Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys Ile Tyr Ile Trp Ala 355 360 365 Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr 370 375 380 Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met 385 390 395 400 Arg Pro Val Gin Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe 405 410 415 Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Gly Gly Gly Arg Val Lys 420 425 430 Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gin Gin Gly Gin Asn Gin 435 440 445 Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu 450 455 460 Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg 465 470 475 480 Lys Asn Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin Lys Asp Lys Met 485 490 495 Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly Glu Arg Arg Arg Gly 500 505 510 Lys Gly His Asp Gly Leu Tyr Gin Gly Leu Ser Thr Ala Thr Lys Asp 515 520 525 Thr Tyr Asp Ala Leu His Met Gin Ala Leu Pro Pro Arg 530 535 540 <210> 35 <211> 373 <212> PRT <213> Artificial Sequence <220> <221> SOURCE <223> COMMENT="Artificial sequence: synthetic polypeptide" <400> 35 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg 20 25 30 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro 35 40 45 Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met 50 55 60 Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala 65 70 75 80 Ile Glu Lys Thr Gln Arg Met Leu Ser Gly Phe Cys Pro His Lys Val 85 90 95 Ser Ala Gly Gln Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu 100 105 110 Val Ala Gln Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125 Arg Glu Gly Arg Phe Asn Gly Gly Gly Ser Ser Gly Gly Gly Ser Gly 130 135 140 Met Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser 145 150 155 160 Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser Lys Arg 165 170 175 Ser Arg Gly Gly His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro 180 185 190 Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe 195 200 205 Ala Ala Tyr Arg Ser Gly Gly Gly Lys Arg Gly Arg Lys Lys Leu Leu 210 215 220 Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu 225 230 235 240 Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys 245 250 255 Glu Leu Gly Gly Gly Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro 260 265 270 Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly 275 280 285 Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro 290 295 300 Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr 305 310 315 320 Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly 325 330 335 Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln 340 345 350 Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln 355 360 365 Ala Leu Pro Pro Arg 370 <210> 36 <211> 385 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Description of artificial sequence: Synthesis" polypeptide <400> 36 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg 20 25 30 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro 35 40 45 Leu Cys Asn Gly Ser Met Val Trp Ser lie Asn Leu Thr Ala Gly Met 50 55 60 Tyr Cys Ala Ala Leu Glu Ser Leu lie Asn Val Ser Gly Cys Ser Ala 65 70 75 80 lie Glu Lys Thr Gin Arg Met Leu Ser Gly Phe Cys Pro His Lys Val 85 90 95 Ser Ala Gly Gin Phe Ser Ser Leu His Val Arg Asp Thr Lys lie Glu 100 105 110 Val Ala Gin Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125 Arg Glu Gly Arg Phe Asn Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro 130 135 140 Cys Pro Gly Gly Gly Ser Ser Gly Gly Gly Ser Gly Met Phe Trp Val 145 150 155 160 Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr 165 170 175 Val Ala Phe lie lie Phe Trp Val Arg Ser Lys Arg Ser Arg Gly Gly 180 185 190 His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg 195 200 205 Lys His Tyr Gin Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg 210 215 220 Ser Gly Gly Gly Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys 225 230 235 240 Gln Pro Phe Met Arg Pro Val Gin Thr Thr Gin Glu Glu Asp Gly Cys 245 250 255 Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Gly Gly 260 265 270 Gly Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gin Gin 275 280 285 Gly Gin Asn Gin Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu 290 295 300 Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly 305 310 315 320 Lys Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin 325 330 335 Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu 340 345 350 Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gin Gly Leu Ser Thr 355 360 365 Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gin Ala Leu Pro Pro 370 375 380 Arg 385 <210> 37 <211> 492 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: Synthetic polypeptide" <400> 37 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg 20 25 30 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gin Asn Gin Lys Ala Pro 35 40 45 Leu Cys Asn Gin Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met 50 55 60 Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala 65 70 75 80 Ile Glu Lys Thr Gin Arg Met Leu Ser Gly Phe Cys Pro His Lys Val 85 90 95 Ser Ala Gly Gin Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu 100 105 110 Val Ala Gin Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125 Arg Glu Gly Arg Phe Asn Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro 130 135 140 Cys Pro Gly Gly Gly Ser Ser Gly Gly Gly Ser Gly Gly Gin Pro Arg 145 150 155 160 Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys 165 170 175 Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 180 185 190 Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys 195 200 205 Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 210 215 220 Arg Leu Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser 225 230 235 240 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser 245 250 255 Leu Ser Leu Ser Leu Gly Lys Met Phe Trp Val Leu Val Val Val Gly 260 265 270 Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile 275 280 285 Phe Trp Val Arg Ser Lys Arg Ser Arg Gly Gly His Ser Asp Tyr Met 290 295 300 Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro 305 310 315 320 Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Gly Gly Gly Lys 325 330 335 Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg 340 345 350 Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro 355 360 365 Glu Glu Glu Glu Gly Gly Cys Glu Leu Gly Gly Gly Arg Val Lys Phe 370 375 380 Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu 385 390 395 400 Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp 405 410 415 Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys 420 425 430 Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala 435 440 445 Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys 450 455 460 Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr 465 470 475 480 Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 485 490 <210> 38 <211> 592 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: Synthetic polypeptide" <400> 38 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg 20 25 30 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gln Asn Gln Lys Ala Pro 35 40 45 Leu Cys Asn Gly Ser Met Val Trp Ser lie Asn Leu Thr Ala Gly Met 50 55 60 Tyr Cys Ala Ala Leu Glu Ser Leu lie Asn Val Ser Gly Cys Ser Ala 65 70 75 80 lie Glu Lys Thr Gin Arg Met Leu Ser Gly Phe Cys Pro His Lys Val 85 90 95 Ser Ala Gly Gin Phe Ser Ser Leu His Val Arg Asp Thr Lys lie Glu 100 105 110 Val Ala Gin Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125 Arg Glu Gly Arg Phe Asn Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro 130 135 140 Cys Pro Ala Pro Glu Phe Glu Gly Gly Pro Ser Val Phe Leu Phe Pro 145 150 155 160 Pro Lys Pro Lys Asp Thr Leu Met lie Ser Arg Thr Pro Glu Val Thr 165 170 175 Cys Val Val Val Asp Val Ser Gin Glu Asp Pro Glu Val Gin Phe Asn 180 185 190 Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg 195 200 205 Glu Glu Gln Phe Gln Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val 210 215 220 Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser 225 230 235 240 Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys 245 250 255 Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu 260 265 270 Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe 275 280 285 Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu 290 295 300 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe 305 310 315 320 Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly 325 330 335 Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 340 345 350 Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys Met Phe Trp Val Leu 355 360 365 Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val 370 375 380 Ala Phe Ile Ile Phe Trp Val Arg Ser Lys Arg Ser Arg Gly Gly His 385 390 395 400 Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys 405 410 415 His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser 420 425 430 Gly Gly Gly Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln 435 440 445 Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser 450 455 460 Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Gly Gly Gly 465 470 475 480 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly 485 490 495 Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 500 505 510 Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 515 520 525 Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin Lys 530 535 540 Asp Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly Glu Arg 545 550 555 560 Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gin Gly Leu Ser Thr Ala 565 570 575 Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gin Ala Leu Pro Pro Arg 580 585 590 <210> 39 <211> 340 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: Synthetic polypeptide" <400> 39 Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr Leu lie Glu Glu Leu 1 5 10 15 Val Asn lie Thr Gin Asn Gin Lys Ala Pro Leu Cys Asn Gly Ser Met 20 25 30 Val Trp Ser lie Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala Leu Glu 35 40 45 Ser Leu lie Asn Val Ser Gly Cys Ser Ala lie Glu Lys Thr Gin Arg 50 55 60 Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln Phe Ser 65 70 75 80 Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe Val Lys 85 90 95 Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn 100 105 110 Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro 115 120 125 Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro 130 135 140 Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp 145 150 155 160 Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu 165 170 175 Ser Leu Val Ile Thr Leu Tyr Lys Arg Gly Arg Lys Lys Leu Leu Tyr 180 185 190 Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu 195 200 205 Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu 210 215 220 Leu Gly Gly Gly Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala 225 230 235 240 Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg 245 250 255 Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu 260 265 270 Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn 275 280 285 Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met 290 295 300 Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly 305 310 315 320 Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala 325 330 335 Leu Pro Pro Arg 340 <210> 40 <211> 388 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Description of Artificial Sequence: Synthetic Polypeptide" <400> 40 Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr Leu Ile Glu Glu Leu 1 5 10 15 Val Asn Ile Thr Gin Asn Gin Lys Ala Pro Leu Cys Asn Gly Ser Met 20 25 30 Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala Leu Glu 35 40 45 Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gin Arg 50 55 60 Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gin Phe Ser 65 70 75 80 Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gin Phe Val Lys 85 90 95 Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn 100 105 110 Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro 115 120 125 Thr Ile Ala Ser Gin Pro Leu Ser Leu Arg Pro Gin Ala Cys Arg Pro 130 135 140 Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp 145 150 155 160 Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu 165 170 175 Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser Lys Arg Ser 180 185 190 Arg Gly Gly His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly 195 200 205 Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala 210 215 220 Ala Tyr Arg Ser Gly Gly Gly Lys Arg Gly Arg Lys Lys Leu Leu Tyr 225 230 235 240 Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu 245 250 255 Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu 260 265 270 Leu Gly Gly Gly Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala 275 280 285 Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg 290 295 300 Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu 305 310 315 320 Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn 325 330 335 Glu Leu Gin Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met 340 345 350 Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gin Gly 355 360 365 Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gin Ala 370 375 380 Leu Pro Pro Arg 385 <210> 41 <211> 420 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: Synthetic polypeptide" <400> 41 Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr Leu lie Glu Glu Leu 1 5 10 15 Val Asn lie Thr Gin Asn Gin Lys Ala Pro Leu Cys Asn Gly Ser Met 20 25 30 Val Trp Ser lie Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala Leu Glu 35 40 45 Ser Leu lie Asn Val Ser Gly Cys Ser Ala lie Glu Lys Thr Gin Arg 50 55 60 Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gin Phe Ser 65 70 75 80 Ser Leu His Val Arg Asp Thr Lys lie Glu Val Ala Gin Phe Val Lys 85 90 95 Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn 100 105 110 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Gly Gly Gly Ser 115 120 125 Ser Gly Gly Gly Ser Gly Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr 130 135 140 Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr 145 150 155 160 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val Glu Trp Glu 165 170 175 Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 180 185 190 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys 195 200 205 Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu 210 215 220 Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 225 230 235 240 Lys Met Ala Leu lie Val Leu Gly Gly Val Ala Gly Leu Leu Leu Phe 245 250 255 lie Gly Leu Gly lie Phe Phe Lys Arg Gly Arg Lys Lys Leu Leu Tyr 260 265 270 lie Phe Lys Gin Pro Phe Met Arg Pro Val Gin Thr Thr Gin Glu Glu 275 280 285 Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu 290 295 300 Leu Gly Gly Gly Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala 305 310 315 320 Tyr Gin Gin Gly Gin Asn Gin Leu Tyr Asn Glu Leu Asn Leu Gly Arg 325 330 335 Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu 340 345 350 Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn 355 360 365 Glu Leu Gin Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met 370 375 380 Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gin Gly 385 390 395 400 Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gin Ala 405 410 415 Leu Pro Pro Arg 420 <210> 42 <211> 519 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Description of Artificial Sequence: Synthetic Polypeptide" <400> 42 Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr Leu lie Glu Glu Leu 1 5 10 15 Val Asn lie Thr Gin Asn Gin Lys Ala Pro Leu Cys Asn Gly Ser Met 20 25 30 Val Trp Ser lie Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala Leu Glu 35 40 45 Ser Leu lie Asn Val Ser Gly Cys Ser Ala lie Glu Lys Thr Gin Arg 50 55 60 Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gin Phe Ser 65 70 75 80 Ser Leu His Val Arg Asp Thr Lys He Glu Val Ala Gin Phe Val Lys 85 90 95 Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn 100 105 110 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe 115 120 125 Glu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 130 135 140 Leu Met He Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 145 150 155 160 Ser Gin Glu Asp Pro Glu Val Gin Phe Asn Trp Tyr Val Asp Gly Val 165 170 175 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Gin Ser 180 185 190 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu 195 200 205 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 210 215 220 Ser lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro 225 230 235 240 Gln Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin 245 250 255 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala 260 265 270 Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr 275 280 285 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 290 295 300 Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser 305 310 315 320 Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser 325 330 335 Leu Ser Leu Gly Lys lie Tyr lie Trp Ala Pro Leu Ala Gly Thr Cys 340 345 350 Gly Val Leu Leu Leu Ser Leu Val lie Thr Lys Arg Gly Arg Lys Lys 355 360 365 Leu Leu Tyr lie Phe Lys Gin Pro Phe Met Arg Pro Val Gin Thr Thr 370 375 380 Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly 385 390 395 400 Gly Cys Glu Leu Gly Gly Gly Arg Val Lys Phe Ser Arg Ser Ala Asp 405 410 415 Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn 420 425 430 Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg 435 440 445 Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly 450 455 460 Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu 465 470 475 480 Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu 485 490 495 Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His 500 505 510 Met Gln Ala Leu Pro Pro Arg 515 <210> 43 <211> 351 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / Note="Description of artificial sequence: Synthetic polypeptide" <400> 43 Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr Leu Ile Glu Glu Leu 1 5 10 15 Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly Ser Met 20 25 30 Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala Leu Glu 35 40 45 Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gln Arg 50 55 60 Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln Phe Ser 65 70 75 80 Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe Val Lys 85 90 95 Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn 100 105 110 Gly Gly Gly Ser Ser Gly Gly Gly Ser Gly Met Phe Trp Val Leu Val 115 120 125 Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala 130 135 140 Phe lie lie Phe Trp Val Arg Ser Lys Arg Ser Arg Gly Gly His Ser 145 150 155 160 Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His 165 170 175 Tyr Gin Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Gly 180 185 190 Gly Gly Lys Arg Gly Arg Lys Lys Leu Leu Tyr lie Phe Lys Gin Pro 195 200 205 Phe Met Arg Pro Val Gin Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys 210 215 220 Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Gly Gly Gly Arg 225 230 235 240 Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gin Gin Gly Gin 245 250 255 Asn Gin Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp 260 265 270 Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro 275 280 285 Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin Lys Asp 290 295 300 Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly Glu Arg Arg 305 310 315 320 Arg Gly Lys Gly His Asp Gly Leu Tyr Gin Gly Leu Ser Thr Ala Thr 325 330 335 Lys Asp Thr Tyr Asp Ala Leu His Met Gin Ala Leu Pro Pro Arg 340 345 350 <210> 44 <211> 363 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Description of Artificial Sequence: Synthetic Polypeptide" <400> 44 Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr Leu lie Glu Glu Leu 1 5 10 15 Val Asn lie Thr Gin Asn Gin Lys Ala Pro Leu Cys Asn Gly Ser Met 20 25 30 Val Trp Ser lie Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala Leu Glu 35 40 45 Ser Leu lie Asn Val Ser Gly Cys Ser Ala lie Glu Lys Thr Gin Arg 50 55 60 Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gin Phe Ser 65 70 75 80 Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe Val Lys 85 90 95 Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn 100 105 110 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Gly Gly Gly Ser 115 120 125 Ser Gly Gly Gly Ser Gly Met Phe Trp Val Leu Val Val Val Gly Gly 130 135 140 Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe 145 150 155 160 Trp Val Arg Ser Lys Arg Ser Arg Gly Gly His Ser Asp Tyr Met Asn 165 170 175 Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr 180 185 190 Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Gly Gly Gly Lys Arg 195 200 205 Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro 210 215 220 Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu 225 230 235 240 Glu Glu Glu Gly Gly Cys Glu Leu Gly Gly Gly Arg Val Lys Phe Ser 245 250 255 Arg Ser Ala Asp Ala Pro Ala Tyr Gin Gin Gly Gin Asn Gin Leu Tyr 260 265 270 Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys 275 280 285 Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn 290 295 300 Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin Lys Asp Lys Met Ala Glu 305 310 315 320 Ala Tyr Ser Glu He Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly 325 330 335 His Asp Gly Leu Tyr Gin Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr 340 345 350 Asp Ala Leu His Met Gin Ala Leu Pro Pro Arg 355 360 <210> 45 <211> 470 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Description of Artificial Sequence: Synthetic Polypeptide" <400> 45 Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr Leu Ile Glu Glu Leu 1 5 10 15 Val Asn Ile Thr Gin Asn Gin Lys Ala Pro Leu Cys Asn Gly Ser Met 20 25 30 Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala Leu Glu 35 40 45 Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gin Arg 50 55 60 Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gin Phe Ser 65 70 75 80 Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gin Phe Val Lys 85 90 95 Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn 100 105 110 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Gly Gly Gly Ser 115 120 125 Ser Gly Gly Gly Ser Gly Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr 130 135 140 Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin Val Ser Leu Thr 145 150 155 160 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala Val Glu Trp Glu 165 170 175 Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 180 185 190 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys 195 200 205 Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu 210 215 220 Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Leu Gly 225 230 235 240 Lys Met Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr 245 250 255 Ser Leu Leu Val Thr Val Ala Phe lie lie Phe Trp Val Arg Ser Lys 260 265 270 Arg Ser Arg Gly Gly His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg 275 280 285 Pro Gly Pro Thr Arg Lys His Tyr Gin Pro Tyr Ala Pro Pro Arg Asp 290 295 300 Phe Ala Ala Tyr Arg Ser Gly Gly Gly Lys Arg Gly Arg Lys Lys Leu 305 310 315 320 Leu Tyr lie Phe Lys Gin Pro Phe Met Arg Pro Val Gin Thr Thr Gin 325 330 335 Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly 340 345 350 Cys Glu Leu Gly Gly Gly Arg Val Lys Phe Ser Arg Ser Ala Asp Ala 355 360 365 Pro Ala Tyr Gin Gin Gly Gin Asn Gin Leu Tyr Asn Glu Leu Asn Leu 370 375 380 Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp 385 390 395 400 Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu 405 410 415 Tyr Asn Glu Leu Gin Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu lie 420 425 430 Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr 435 440 445 Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met 450 455 460 Gln Ala Leu Pro Pro Arg 465 470 <210> 46 <211> 570 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 46 Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr Leu Ile Glu Glu Leu 1 5 10 15 Val Asn Ile Thr Gin Asn Gin Lys Ala Pro Leu Cys Asn Gly Ser Met 20 25 30 Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala Leu Glu 35 40 45 Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gin Arg 50 55 60 Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gin Phe Ser 65 70 75 80 Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gin Phe Val Lys 85 90 95 Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn 100 105 110 Glu Ser Lys Tyr Gin Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe 115 120 125 Glu Ser Lys Tyr Gin Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu PheGlu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 130 135 140 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 145 150 155 160 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 165 170 175 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Gln Ser 180 185 190 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 195 200 205 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 210 215 220 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 225 230 235 240 Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln 245 250 255 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 260 265 270 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 275 280 285 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 290 295 300 Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser 305 310 315 320 Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser 325 330 335 Leu Ser Leu Gly Lys Met Phe Trp Val Leu Val Val Val Gly Gly Val 340 345 350 Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe He He Phe Trp 355 360 365 Val Arg Ser Lys Arg Ser Arg Gly Gly His Ser Asp Tyr Met Asn Met 370 375 380 Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gin Pro Tyr Ala 385 390 395 400 Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Gly Gly Gly Lys Arg Gly 405 410 415 Arg Lys Lys Leu Leu Tyr He Phe Lys Gin Pro Phe Met Arg Pro Val 420 425 430 Gln Thr Thr Gin Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu 435 440 445 Glu Glu Gly Gly Cys Glu Leu Gly Gly Gly Arg Val Lys Phe Ser Arg 450 455 460 Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn 465 470 475 480 Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg 485 490 495 Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro 500 505 510 Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala 515 520 525 Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His 530 535 540 Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp 545 550 555 560 Ala Leu His Met Gln Ala Leu Pro Pro Arg 565 570 <210> 47 <211> 363 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: Synthetic polypeptide" <400> 47 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Gly Pro Val Pro Pro Ser Thr Ala Leu Arg 20 25 30 Tyr Leu Ile Glu Glu Leu Val Asn Ile Thr Gin Asn Gin Lys Ala Pro 35 40 45 Leu Cys Asn Gly Ser Met Val Trp Ser Ile Asn Leu Thr Ala Gly Met 50 55 60 Tyr Cys Ala Ala Leu Glu Ser Leu Ile Asn Val Ser Gly Cys Ser Ala 65 70 75 80 Ile Glu Lys Thr Gin Arg Met Leu Ser Gly Phe Cys Pro His Lys Val 85 90 95 Ser Ala Gly Gin Phe Ser Ser Leu His Val Arg Asp Thr Lys Ile Glu 100 105 110 Val Ala Gin Phe Val Lys Asp Leu Leu Leu His Leu Lys Lys Leu Phe 115 120 125 Arg Glu Gly Arg Phe Asn Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg 130 135 140 Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gin Pro Leu Ser Leu Arg 145 150 155 160 Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly 165 170 175 Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr 180 185 190 Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Gly Gly Gly Lys Arg 195 200 205 Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro 210 215 220 Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu 225 230 235 240 Glu Glu Glu Gly Gly Cys Glu Leu Gly Gly Gly Arg Val Lys Phe Ser 245 250 255 Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr 260 265 270 Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys 275 280 285 Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn 290 295 300 Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu 305 310 315 320 Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly 325 330 335 His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr 340 345 350 Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 355 360 <210> 48 <211> 341 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Description of artificial sequence: Synthesis" polypeptide <400> 48 Gly Pro Val Pro Pro Ser Thr Ala Leu Arg Tyr Leu Ile Glu Glu Leu 1 5 10 15 Val Asn Ile Thr Gln Asn Gln Lys Ala Pro Leu Cys Asn Gly Ser Met 20 25 30 Val Trp Ser Ile Asn Leu Thr Ala Gly Met Tyr Cys Ala Ala Leu Glu 35 40 45 Ser Leu Ile Asn Val Ser Gly Cys Ser Ala Ile Glu Lys Thr Gln Arg 50 55 60 Met Leu Ser Gly Phe Cys Pro His Lys Val Ser Ala Gly Gln Phe Ser 65 70 75 80 Ser Leu His Val Arg Asp Thr Lys Ile Glu Val Ala Gln Phe Val Lys 85 90 95 Asp Leu Leu Leu His Leu Lys Lys Leu Phe Arg Glu Gly Arg Phe Asn 100 105 110 Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro 115 120 125 Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro 130 135 140 Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp 145 150 155 160 Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu 165 170 175 Ser Leu Val Ile Thr Gly Gly Gly Lys Arg Gly Arg Lys Lys Leu Leu 180 185 190 Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu 195 200 205 Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys 210 215 220 Glu Leu Gly Gly Gly Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro 225 230 235 240 Ala Tyr Gin Gin Gly Gin Asn Gin Leu Tyr Asn Glu Leu Asn Leu Gly 245 250 255 Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro 260 265 270 Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr 275 280 285 Asn Glu Leu Gin Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly 290 295 300 Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gin 305 310 315 320 Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gin 325 330 335 Ala Leu Pro Pro Arg 340 <210> 49 <211> 112 <212> PRT <213> Homo sapiens <400> 49 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gin Gin Gly 1 5 10 15 Gln Asn Gin Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30 Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 35 40 45 Pro Arg Arg Lys Asn Pro Gin Glu Gly Leu Tyr Asn Glu Leu Gin Lys 50 55 60 Asp Lys Met Ala Glu Ala Tyr Ser Glu lie Gly Met Lys Gly Glu Arg 65 70 75 80 Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gin Gly Leu Ser Thr Ala 85 90 95 Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gin Ala Leu Pro Pro Arg 100 105 110 <210> 50 <211> 107 <212> PRT <213> Artificial Sequence <220> <221> Source <223> / note= "Artificial sequence description: Synthetic polypeptide" <400> 50 Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Gin Glu 1 5 10 15 Glu Met Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe 20 25 30 Tyr Pro Ser Asp lie Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu 35 40 45 Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe 50 55 60 Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly 65 70 75 80 Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr 85 90 95 Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys 100 105 <210> 51 <211> 229 <212> PRT <213> Artificial sequence <220> <221> source <223> / Note="Description of artificial sequence: Synthesis" polypeptide <400> 51 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe 1 5 10 15 Glu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 20 25 30 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 35 40 45 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 50 55 60 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gin Phe Gin Ser 65 70 75 80 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu 85 90 95 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 100 105 110 Ser lie Glu Lys Thr lie Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro 115 120 125 Gln Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin 130 135 140 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp lie Ala 145 150 155 160 Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr 165 170 175 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 180 185 190 Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser 195 200 205 Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser 210 215 220 Leu Ser Leu Gly Lys 225 <210> 52 <211> 12 <212> PRT <213> Artificial Sequence <220> <221> SOURCE <223> / note= "Artificial sequence description: synthetic peptide" <400> 52 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Ser Cys Pro 1 5 10 <210> 53 <211> 229 <212> PRT <213> Artificial Sequence <220> <221> SOURCE <223> / note= "Artificial sequence description: synthetic polypeptide" <400> 53 Glu Ser Lys Tyr Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro Glu Phe 1 5 10 15 Glu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 20 25 30 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 35 40 45 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 50 55 60 Glu Val His Gln Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser 65 70 75 80 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu 85 90 95 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 100 105 110 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro 115 120 125 Gln Val Tyr Thr Leu Pro Pro Ser Gin Glu Glu Met Thr Lys Asn Gin 130 135 140 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 145 150 155 160 Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr 165 170 175 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 180 185 190 Thr Val Asp Lys Ser Arg Trp Gin Glu Gly Asn Val Phe Ser Cys Ser 195 200 205 Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser 210 215 220 Leu Ser Leu Gly Lys 225 <210> 54 <211> 28 <212> PRT <213> Homo sapiens <400> 54 Met Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser 1 5 10 15 Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val 20 25

Claims

1. Chimeric antigen receptors, including (i) The binding domain consisting of SEQ ID NO:3; (ii) A spacer domain derived from IgG4 consisting of SEQ ID NO:51; (iii) The CD4 transmembrane domain consisting of SEQ ID NO:5; (iv) A single 4-1BB costimulatory domain consisting of SEQ ID NO:29; and (v) The CD3ζ signal conduction domain consisting of SEQ ID NO:

7.

2. The chimeric antigen receptor of claim 1, wherein the chimeric antigen receptor comprises SEQ ID NO:

10.

3. The chimeric antigen receptor according to any one of claims 1-2, further comprising a GMSCFRa signal sequence.

4. The chimeric antigen receptor of claim 3, wherein the GMSCFRa signal sequence comprises SEQ ID NO:

2.

5. A population of human T cells expressing chimeric antigen receptors, said chimeric antigen receptors including (i) The binding domain consisting of SEQ ID NO:3; (ii) A spacer domain derived from IgG4 consisting of SEQ ID NO:51; (iii) The CD4 transmembrane domain consisting of SEQ ID NO:5; (iv) A single 4-1BB costimulatory domain consisting of SEQ ID NO:29; and (v) The CD3ζ signal conduction domain consisting of SEQ ID NO:

7.

6. A composition for treating glioblastoma in a patient, said composition comprising a population of autologous or allogeneic human T cells expressing a chimeric antigen receptor, said chimeric antigen receptor comprising (i) The binding domain consisting of SEQ ID NO:3; (ii) A spacer domain derived from IgG4 consisting of SEQ ID NO:51; (iii) The CD4 transmembrane domain consisting of SEQ ID NO:5; (iv) A single 4-1BB costimulatory domain consisting of SEQ ID NO:29; and (v) The CD3ζ signal conduction domain consisting of SEQ ID NO:

7.

7. The composition according to claim 6, wherein the chimeric antigen receptor is composed of SEQ ID NO:

10.

8. The composition according to claim 6 or 7, wherein the human T cell population comprises central memory T cells.

9. Nucleic acid molecules that encode chimeric antigen receptors, including: (i) The binding domain consisting of SEQ ID NO:3; (ii) A spacer domain derived from IgG4 consisting of SEQ ID NO:51; (iii) The CD4 transmembrane domain consisting of SEQ ID NO:5; (iv) A single 4-1BB costimulatory domain consisting of SEQ ID NO:29; and (v) The CD3ζ signal conduction domain consisting of SEQ ID NO:

7.

10. Human T cell populations containing nucleic acid molecules encoding chimeric antigen receptors, wherein the chimeric antigen receptors include: (i) The binding domain consisting of SEQ ID NO:3; (ii) A spacer domain derived from IgG4 consisting of SEQ ID NO:51; (iii) The CD4 transmembrane domain consisting of SEQ ID NO:5; (iv) A single 4-1BB costimulatory domain consisting of SEQ ID NO:29; and (v) The CD3ζ signal conduction domain consisting of SEQ ID NO:

7.

11. The human T cell population of claim 10, wherein the chimeric antigen receptor comprises SEQ ID NO:

10.

12. The human T cell population of claim 10 or 11, wherein the T cells comprise a population of central memory T cells.

13. Use of the composition in the preparation of a medicament for treating glioblastoma in patients, said composition comprising an autologous or allogeneic human T cell population, said autologous or allogeneic human T cell population comprising a nucleic acid molecule encoding a chimeric antigen receptor, wherein the chimeric antigen receptor comprises: (i) The binding domain consisting of SEQ ID NO:3; (ii) A spacer domain derived from IgG4 consisting of SEQ ID NO:51; (iii) The CD4 transmembrane domain consisting of SEQ ID NO:5; (iv) A single 4-1BB costimulatory domain consisting of SEQ ID NO:29; and (v) The CD3ζ signal conduction domain consisting of SEQ ID NO:

7.

14. The use according to claim 13, wherein the chimeric antigen receptor comprises SEQ ID NO:

10.

15. The use according to claim 13 or 14, wherein the human T cell population comprises central memory T cells.

16. A population of human T cells containing a vector expressing a chimeric antigen receptor consisting of the amino acid sequence of SEQ ID NO:

10.

17. The human T cell population of claim 16, wherein the T cells comprise a population of central memory T cells.

18. A composition for treating cancer in a patient, the composition comprising an autologous or allogeneic human T cell population transduced by a vector, the vector comprising an expression cassette encoding a chimeric antigen receptor, wherein the chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO: 10; wherein the cancer expresses an IL13Ra2 receptor.

19. The composition of claim 18, wherein the human T cell population comprises central memory T cells.

20. The composition of claim 18, wherein the cancer is glioblastoma.

21. The composition of claim 19, wherein the human T cell population is prepared by a method comprising: treating T cells obtained from a patient to isolate central memory T cells, and transducing at least a portion of the central memory T cells using a viral vector comprising an expression cassette encoding a chimeric antigen receptor, wherein the chimeric antigen receptor comprises the amino acid sequence of SEQ ID NO: 10.

Images