T cell receptors and methods of use thereof
By developing a recombinant T-cell receptor that specifically binds to human NY-ESO-1, the problem of targeting non-mutated antigens in existing technologies has been solved, achieving specific recognition of NY-ESO-1 and broad-spectrum cancer treatment effects.
Patent Information
- Application Number
- CN202080024940.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2019-03-04
- Filing Date
- 2020-03-03
- Publication Date
- 2026-03-27
- Estimated Expiration
- 2040-03-03
AI Technical Summary
Existing technologies have difficulty effectively targeting the non-mutated antigen NY-ESO-1, and the high polymorphism of the HLA gene hinders the specificity of anti-tumor T cell responses, limiting the widespread application of adoptive T cell therapy.
A recombinant T-cell receptor (TCR) that specifically binds to human NY-ESO-1 was developed. By binding to specific HLA alleles, it achieves specific recognition and targeting of NY-ESO-1 through nucleic acid molecules encoding specific TCRs and nucleotide sequences that inhibit the expression of endogenous TCRs.
This expands the applicability of anti-NY-ESO-1 TCR therapy and improves the treatment effect for cancer patients, especially in the field of immuno-oncology.
Smart Images

Figure BDA0003281469740000171 
Figure BDA0003281469740000181 
Figure BDA0003281469740000271
Abstract
Description
[0001] Cross-references to related applications
[0002] This PCT application claims priority to U.S. Provisional Application No. 62 / 813,644, filed March 4, 2019, which is incorporated herein by reference in its entirety.
[0003] References to sequence lists submitted electronically via EFS-WEB
[0004] The contents of the sequence list submitted electronically (name: 4285_003PC01_Seqlisting_ST25.txt, size: 28,117 bytes; and creation date: March 3, 2020) are incorporated herein by reference in their entirety. Technical Field
[0005] This disclosure provides a recombinant T-cell receptor (“TCR”) that specifically binds to human NY-ESO-1 and its uses. Background of the Invention
[0007] Immunotherapy has emerged as a key tool in the fight against a variety of diseases, including cancer. T-cell therapy is at the forefront of immunotherapy development, and adoptive transfer of anti-tumor T cells has been shown to induce clinical responses in cancer patients. Although many T-cell therapies target mutated tumor antigens, the vast majority of neoantigens are not common to each patient but are unique.
[0008] The number of potential non-mutated antigens exceeds that of mutated antigens by several orders of magnitude. Elucidating T-cell epitopes derived from shared antigens could facilitate the robust development of effective and safe adoptive T-cell therapies readily available to a large population of cancer patients. However, the absolute number of non-mutated antigens and the high polymorphism of HLA genes may have hindered a comprehensive analysis of the specificity of anti-tumor T-cell responses to non-mutated antigens.
[0009] This disclosure provides novel epitopes of the nonmutated antigen NY-ESO-1 and TCRs capable of specifically binding to said epitopes. These novel epitopes are associated with specific HLA alleles. The use of these tumor-responsive HLA-restricted NY-ESO-1 TCRs supports the applicability of broadened anti-NY-ESO-1 TCR gene therapy, particularly in immuno-oncology. Summary of the Invention
[0010] Certain aspects of the present disclosure relate to a nucleic acid molecule comprising (i) a first nucleotide sequence encoding a recombinant T cell receptor (TCR) or an antigen binding portion thereof that specifically binds to human NY-ESO-1 ("anti-NY-ESO-1 TCR"); and (ii) a second nucleotide sequence, wherein the second nucleotide sequence or a polypeptide encoded by the second nucleotide sequence inhibits expression of an endogenous TCR, wherein the anti-NY-ESO-1 TCR cross-competes for binding to human NY-ESO-1 with a reference TCR, which reference TCR comprises an alpha chain and a beta chain, and wherein the alpha chain comprises an amino acid sequence as set forth in SEQ ID NO: 1 and the beta chain comprises an amino acid sequence as set forth in SEQ ID NO: 2.
[0011] Certain aspects of the present disclosure relate to a nucleic acid molecule comprising (i) a first nucleotide sequence encoding a recombinant T cell receptor (TCR) or an antigen binding portion thereof that specifically binds to human NY-ESO-1 ("anti-NY-ESO-1 TCR"); and (ii) a second nucleotide sequence, wherein the second nucleotide sequence or a polypeptide encoded by the second nucleotide sequence inhibits expression of an endogenous TCR, wherein the anti-NY-ESO-1 TCR binds to the same epitope or an overlapping epitope of human NY-ESO-1 as a reference TCR, which reference TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises an amino acid sequence as set forth in SEQ ID NO: 1 and the beta chain comprises an amino acid sequence as set forth in SEQ ID NO: 2.
[0012] In some embodiments, the anti-NY-ESO-1 TCR binds to an epitope of NY-ESO-1 consisting of an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, the epitope is complexed with an HLA Class I molecule. In some embodiments, the HLA Class I molecule is an HLA-B*07 allele. In some embodiments, the HLA Class I molecule is selected from the group consisting of an HLA-B*07:02 allele, an HLA-B*07:03 allele, an HLA-B*07:04 allele, an HLA-B*07:05 allele, and an HLA-B*07:06 allele. In some embodiments, the HLA Class I molecule is an HLA-B*07:02 allele.
[0013] In some embodiments, the anti-NY-ESO-l TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a variable region comprising an alpha chain CDR1, an alpha chain CDR2, and an alpha chain CDR3; and wherein the beta chain comprises a variable domain comprising a beta chain CDR1, a beta chain CDR2, and a beta chain CDR3; wherein the beta chain CDR3 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 10. In some embodiments, the alpha chain CDR3 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 7.
[0014] In some embodiments, the anti-NY-ESO-l TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a variable region comprising an alpha chain CDR1, an alpha chain CDR2, and an alpha chain CDR3; and wherein the beta chain comprises a variable domain comprising a beta chain CDR1, a beta chain CDR2, and a beta chain CDR3; wherein the beta chain CDR3 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 10. In some embodiments, the alpha chain CDR3 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 7.
[0015] In some embodiments, the alpha chain CDR1 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 5. In some embodiments, the beta chain CDR1 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 8. In some embodiments, the alpha chain CDR2 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 6. In some embodiments, the beta chain CDR2 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 9.
[0016] In some embodiments, the alpha chain variable domain of the anti-NY-ESO-l TCR comprises an amino acid sequence of a variable domain present in the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the beta chain variable domain of the anti-NY-ESO-l TCR comprises an amino acid sequence of a variable domain present in the amino acid sequence set forth in SEQ ID NO: 2.
[0017] In some embodiments, the alpha chain of the anti-NY-ESO-l TCR further comprises a constant region, wherein the constant region is different from the endogenous constant region of the alpha chain. In some embodiments, the alpha chain of the anti-NY-ESO-l TCR further comprises a constant region, wherein the alpha chain constant region comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a constant region present in the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the alpha chain constant region comprises an amino acid sequence comprising at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to a constant region present in the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the beta chain of the anti-NY-ESO-l TCR further comprises a constant region, wherein the constant region is different from the endogenous constant region of the beta chain.
[0018] In some embodiments, the beta chain of the anti-NY-ESO-l TCR further comprises a constant region, wherein the beta chain constant region comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to a constant region present in the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the beta chain constant region comprises an amino acid sequence comprising at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to a constant region present in the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the alpha chain of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 1.
[0019] In some embodiments, the beta chain of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 2. In some embodiments, the second nucleotide sequence is one or more siRNAs that reduce expression of an endogenous TCR.
[0020] In some embodiments, the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of an endogenous TCR. In some embodiments, the one or more siRNAs comprise one or more nucleotide sequences selected from the group consisting of SEQ ID NOs: 53-56.
[0021] In some embodiments, the second nucleotide sequence encodes a Cas9.
[0022] In some embodiments, the anti-NY-ESO-l TCR comprises an alpha chain constant region, a beta chain constant region, or both; and wherein the alpha chain constant region, the beta chain constant region, or both comprise an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 substitutions within a target sequence relative to a corresponding amino acid sequence of an endogenous TCR.
[0023] Certain aspects of the present disclosure relate to a vector comprising a nucleic acid molecule disclosed herein. In some embodiments, the vector is a viral vector, a mammalian vector, or a bacterial vector. In some embodiments, the vector is a retroviral vector. In some embodiments, the vector is selected from the group consisting of an adenoviral vector, a lentivirus, a Sendai virus vector, a baculovirus vector, an Epstein Barr viral vector, a papovaviral vector, a vaccinia virus vector, a herpes simplex virus vector, a hybrid vector, and an adeno-associated virus (AAV) vector. In some embodiments, the vector is a lentivirus.
[0024] Certain aspects of the present disclosure relate to a T cell receptor (TCR) or antigen binding portion thereof comprising an alpha chain variable domain of an anti-NY-ESO-l TCR disclosed herein and a beta chain variable domain of an anti-NY-ESO-l TCR disclosed herein. In some embodiments, the recombinant T cell receptor (TCR) or antigen binding portion thereof that specifically binds human NY-ESO-l (“anti-NY-ESO-l TCR”) cross-competes for binding to human NY-ESO-l with a reference TCR; wherein the reference TCR comprises an alpha chain and a beta chain, and wherein the alpha chain comprises an amino acid sequence as set forth in SEQ ID NO: 1 and the beta chain comprises an amino acid sequence as set forth in SEQ ID NO: 2; and wherein the anti-NY-ESO-l TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a constant region, and wherein the beta chain comprises a constant region; wherein (i) the alpha chain constant region comprises an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to a constant region present in the amino acid sequence set forth in SEQ ID NO: 1, or (ii) the beta chain constant region comprises an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to a constant region present in the amino acid sequence of SEQ ID NO: 2.
[0025] Certain aspects of the present disclosure relate to a recombinant T cell receptor (TCR) or antigen binding portion thereof that specifically binds to human NY-ESO-1 ("anti-NY-ESO-1 TCR") that binds to the same epitope or an overlapping epitope of human NY-ESO-1 as a reference TCR; wherein the reference TCR comprises an alpha chain and a beta chain, and wherein the alpha chain comprises an amino acid sequence as set forth in SEQ ID NO: 1 and the beta chain comprises an amino acid sequence as set forth in SEQ ID NO: 2; and wherein the anti-NY-ESO-1 TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a constant region, and wherein the beta chain comprises a constant region; wherein (i) the alpha chain constant region comprises an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the constant region present in the amino acid sequence set forth in SEQ ID NO: 1, or (ii) the beta chain constant region comprises an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the constant region present in the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the anti-NY-ESO-1 TCR binds to an epitope of NY-ESO-1 consisting of an amino acid sequence as set forth in SEQ ID NO: 13.
[0026] In some embodiments, the epitope is complexed with an HLA class I molecule. In some embodiments, the HLA class I molecule is an HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, or HLA-G allele. In some embodiments, the HLA class I molecule is an HLA-B*07 allele. In some embodiments, the HLA class I molecule is selected from the group consisting of an HLA-B*07:02 allele, an HLA-B*07:03 allele, an HLA-B*07:04 allele, an HLA-B*07:05 allele, and an HLA-B*07:06 allele. In some embodiments, the HLA class I molecule is an HLA-B*07:02 allele.
[0027] In some embodiments, the alpha chain of the anti-NY-ESO-1 TCR comprises a variable domain comprising an alpha chain CDR1, an alpha chain CDR2, and an alpha chain CDR3; and wherein the beta chain of the anti-NY-ESO-1 TCR comprises a variable domain comprising a beta chain CDR1, a beta chain CDR2, and a beta chain CDR3; wherein the alpha chain CDR3 of the anti-NY-ESO-1 comprises an amino acid sequence as set forth in SEQ ID NO: 7. In some embodiments, the beta chain CDR3 of the anti-NY-ESO-1 TCR comprises an amino acid sequence as set forth in SEQ ID NO: 10.
[0028] In some embodiments, the alpha chain of the anti-NY-ESO-l TCR comprises a variable domain comprising an alpha chain CDR1, an alpha chain CDR2, and an alpha chain CDR3; and wherein the beta chain of the anti-NY-ESO-l TCR comprises a variable domain comprising a beta chain CDR1, a beta chain CDR2, and a beta chain CDR3; wherein the beta chain CDR3 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 10. In some embodiments, the alpha chain CDR3 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 7.
[0029] In some embodiments, the alpha chain CDR1 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 5. In some embodiments, the beta chain CDR1 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 8. In some embodiments, the alpha chain CDR2 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 6. In some embodiments, the beta chain CDR2 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 9.
[0030] In some embodiments, the alpha chain variable domain of the anti-NY-ESO-l TCR comprises an amino acid sequence of a variable domain present in the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the beta chain variable domain of the anti-NY-ESO-l TCR comprises an amino acid sequence of a variable domain present in the amino acid sequence set forth in SEQ ID NO: 2.
[0031] In some embodiments, the alpha chain constant region comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to an amino acid sequence of a constant region present in the amino acid sequence set forth in SEQ ID NO: 1.
[0032] In some embodiments, the beta chain constant region comprises an amino acid sequence having at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to an amino acid sequence of a constant region present in the amino acid sequence set forth in SEQ ID NO: 2.
[0033] In some embodiments, the alpha chain of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 1. In some embodiments, the beta chain of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 2.
[0034] Certain aspects of the present disclosure relate to a bispecific TCR comprising a first antigen binding domain and a second antigen binding domain, wherein the first antigen binding domain comprises a TCR or antigen binding portion thereof disclosed herein or a TCR or antigen binding portion thereof disclosed herein. In some embodiments, the first antigen binding domain comprises a single chain variable fragment ("scFv"). In some embodiments, the second antigen binding domain specifically binds to a protein expressed on the surface of a T cell. In some embodiments, the second antigen binding domain specifically binds to CD3. In some embodiments, the second antigen binding domain comprises a scFv. In some embodiments, the first antigen binding domain and second antigen binding domain are linked or associated by a covalent bond. In some embodiments, the first antigen binding domain and second antigen binding domain are linked by a peptide bond.
[0035] Certain aspects of the present disclosure relate to a cell comprising a nucleic acid molecule disclosed herein, a vector disclosed herein, a TCR disclosed herein, a recombinant TCR disclosed herein, or a bispecific TCR disclosed herein. In some embodiments, the cell further expresses CD3. In some embodiments, the cell is selected from the group consisting of a T cell, a natural killer (NK) cell, a natural killer T (NKT) cell, or an ILC cell.
[0036] Certain aspects of the present disclosure relate to a method of treating a cancer in a subject in need thereof, comprising administering to the subject a cell disclosed herein. In some embodiments, the cancer is selected from the group consisting of melanoma, bone cancer, pancreatic cancer, skin cancer, head and neck cancer, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's Disease, NHL, primary mediastinal large B-cell lymphoma (PMBC), diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), esophageal cancer, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, chronic or acute leukemia, acute myeloid leukemia, chronic myeloid leukemia, acute lymphoblastic leukemia (ALL) (including non T-cell ALL), chronic lymphocytic leukemia (CLL), solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the CNS, primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, T-cell lymphoma, environmentally induced cancers including those induced by asbestos, other B-cell malignancies, and combinations of said cancers.
[0037] In some embodiments, the cancer is relapsed or refractory. In some embodiments, the cancer is locally advanced. In some embodiments, the cancer is advanced. In some embodiments, the cancer is metastatic.
[0038] In some embodiments, the cells are obtained from a subject. In some embodiments, the cells are obtained from a donor other than the subject. In some embodiments, the subject is pretreated prior to administration of the cells. In some embodiments, the pretreatment comprises administration of chemotherapy, cytokine, protein, small molecule, or any combination thereof to the subject. In some embodiments, the pretreatment comprises administration of interleukin. In some embodiments, the pretreatment comprises administration of IL-2, IL-4, IL-7, IL-9, IL-15, IL-21, or any combination thereof. In some embodiments, the pretreatment comprises administration of a pretreatment agent selected from the group consisting of cyclophosphamide, fludarabine, vitamin C, AKT inhibitor, ATRA, Rapamycin, or any combination thereof. In some embodiments, the pretreatment comprises administration of cyclophosphamide, fludarabine, or both.
[0039] Certain aspects of the present disclosure relate to a method of engineering a cell targeting an antigen, the method comprising transducing a cell collected from a subject in need of a T cell therapy with a nucleic acid disclosed herein or a vector disclosed herein. In some embodiments, the cell targeting an antigen further expresses CD3. In some embodiments, the cell is a T cell or a natural killer (NK) cell.
[0040] Certain aspects of the present disclosure relate to an HLA class I molecule complexed with a peptide, wherein the HLA class I molecule comprises an al domain, an a2 domain, an a3 domain, and a b2m, and wherein the peptide consists of an amino acid sequence as set forth in SEQ ID NO: 14.
[0041] In some embodiments, the HLA class I molecule is HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, or HLA-G. In some embodiments, the HLA class I molecule is HLA-B. In some embodiments, the HLA class I molecule is an HLA-B*07 allele. In some embodiments, the HLA class I molecule is selected from the group consisting of an HLA-B*07:02 allele, an HLA-B*07:03 allele, an HLA-B*07:04 allele, an HLA-B*07:05 allele, and an HLA-B*07:06 allele. In some embodiments, the HLA class I molecule is an HLA-B*07:02 allele. In some embodiments, the HLA class I molecule is an HLA-B*07:03 allele.
[0042] In some embodiments, the HLA Class I molecule is monomeric. In some embodiments, the HLA Class I molecule is dimeric. In some embodiments, the HLA Class I molecule is trimeric. In some embodiments, the HLA Class I molecule is tetrameric. In some embodiments, the HLA Class I molecule is pentameric.
[0043] Certain aspects of the present disclosure relate to an antigen presenting cell (APC) comprising an HLA Class I molecule disclosed herein. In some embodiments, the HLA Class I molecule is expressed on the surface of the APC.
[0044] Certain aspects of the present disclosure relate to a method of enriching a target T cell population obtained from a human subject, the method comprising contacting the T cells with an HLA Class I molecule disclosed herein or an APC disclosed herein, wherein following the contacting, the enriched T cell population comprises a higher number of T cells capable of binding to the HLA Class I molecule relative to the number of T cells capable of binding to the HLA Class I molecule prior to the contacting.
[0045] Certain aspects of the present disclosure relate to a method of enriching a target T cell population obtained from a human subject, the method comprising contacting the T cells in vitro with a peptide, wherein the peptide consists of the amino acid sequence as set forth in SEQ ID NO: 13, wherein following the contacting, the enriched T cell population comprises a higher number of T cells capable of targeting tumor cells relative to the number of T cells capable of targeting tumor cells prior to the contacting.
[0046] In some embodiments, the T cells obtained from a human subject are tumor infiltrating lymphocytes (TILs).
[0047] Certain aspects of the present disclosure relate to a method of treating a tumor in a subject in need thereof, the method comprising administering to the subject an enriched T cell population disclosed herein.
[0048] Certain aspects of the present disclosure relate to a method of enhancing cytotoxic T cell-mediated targeting of cancer cells in a subject afflicted with a cancer, the method comprising administering to the subject a peptide having the amino acid sequence as set forth in SEQ ID NO: 13.
[0049] Certain aspects of the present disclosure relate to a cancer vaccine comprising a peptide having the amino acid sequence as set forth in SEQ ID NO: 13.
[0050] Certain aspects of the present disclosure relate to a method of selecting a T cell capable of targeting a tumor cell, the method comprising contacting a population of isolated T cells in vitro with a peptide, wherein the peptide consists of an amino acid sequence as set forth in SEQ ID NO: 11. In some embodiments, the T cell is a tumor infiltrating lymphocyte (TIL). BRIEF DESCRIPTION OF DRAWINGS
[0051] Figures 1A-1B B*07:02 / NY-ESO-1 for melanoma TIL 60-72 Graphical representation of multimer staining. Figure 1A B*07:02 / NY-ESO-1 60-72 Multimer staining of TIL. B*07:02 / HIV nef 128-137 ( Figure 1B ) Multimer used as negative control. CD8 + Multimer in T cells + Percentage of cells.
[0052] Figure 2 B*07:02 / NY-ESO-1 60-72 Bar graph of functional assessment of B*07:02 / NY-ESO-1 60-72 specific manner. In IFN-γ ELISPOT analysis, TIL were used as responder cells. B*07:02- artificial APC pulsed with the indicated peptides were used as stimulator cells. HIV nef 128-137 peptide was used as control. Experiments were performed in triplicate and error bars show standard deviation (SD). *P < 0.05.
[0053] Figures 3A-3I B*07:02 / NY-ESO-1 60-72 Graphical representation of positive staining of Jurkat 76 / CD8 cells transduced with TCR genes. Jurkat 76 / CD8 cells transduced with B*07:02 / NY-ESO-1 60-72 TCR Figure 3B , 3E and 3H) were stained with B*07:02 / NY-ESO-1 60-72 multimer Figure 3B ) B*07:02 / MAGE-A1 289-297 multimer Figure 3D , 3E and 3F), B*07:02 / non- exchanged multimer Figure 3G , 3H and 3I) and B*07:02 / MAGE-A1 289-297 TCR Figure 3C , 3F and 3I) and Jurkat 76 / CD8 cells not transduced with a TCR Figure 3A , 3D and 3G) as a control. The multimers + CD8 + cells are shown.
[0054] Figures 4A-4D Graphical representation of positive staining of human primary T cells transduced with B*07:02 / NY-ESO-1 60-72 TCR gene Figure 4B and 4D transduced with B*07:02 / NY-ESO-1 60-72 TCR were stained with B*07:02 / NY-ESO-1 60-72 ( Figure 4B ) or B*07:02 / HIV nef 128-137 control multimers Figure 4D ). Untransduced primary T cells were used as negative controls Figure 4A and 4C ). The multimers + CD8 + T cells are shown.
[0055] Figure 5 Bar graph illustrating the strong reaction of human primary T cells transduced with B*07:02 / NY-ESO-1 60-72 TCR gene with the cognate peptide presented by the target class I molecule. In an IFN-γ ELISPOT assay, primary T cells transduced with B*07:02 / NY-ESO-1 60-72 TCR gene or untransduced primary T cells (x-axis) were used as responder cells. HLA-B*07:02 transduced T2 cells (T2-B*07:02) were generated. T2 or T2-B*07:02 cells pulsed with NY-ESO-1 60-72 or HIV nef 128-137 peptides (control) were used as stimulator cells. Experiments were performed in triplicate and error bars display SD. **P < 0.01.
[0056] Figure 6A and 6B Graphical representation of primary T cells transduced with B*07:02 / NY-ESO-1 60-72 TCR gene recognizing tumor cells Figure 6A ) and its legendFigure 6B ). In IFN-γ ELISPOT analysis, A375, SK-MEL-37 and SK-MEL-21 cells transduced with B*07:02 / NY-ESO-1 60-72 TCR gene-transduced primary T cells or untransduced primary T cells as responder cells. As indicated in the legend of Figure Figure 6B Figure 6A A375, SK-MEL-37 and SK-MEL-21 cells untransduced or transduced with HLA-B*07:02 or NY-ESO-1 were used as stimulator cells. Experiments were performed in triplicate and error bars show SD. **P < 0.01, ***P < 0.001.
[0057] Figures 7A-7D Graphical representation of NY-ESO-1 expression from endogenous or transduced full-length gene. Expression of NY-ESO-1 in target cells from endogenous or transduced full-length gene was analyzed by intracellular flow cytometry after staining with anti-NY-ESO-1 mAb (open curve) and isotype control (solid curve).
[0058] Figures 8A-8D Graphical representation of ΔNGFR expression in target cells transduced with full-length HLA-B*07:02 gene labeled with ΔNGFR Figure 8B and 8D Graphical representation of ΔNGFR expression in target cells transduced with full-length HLA-B*07:02 gene labeled with ΔNGFR Figure 8A and 8C Graphical representation of ΔNGFR expression in target cells transduced with full-length HLA-B*07:02 gene labeled with ΔNGFR DETAILED DESCRIPTION
[0059] The present disclosure relates to a TCR or an antigen-binding portion thereof that specifically binds to an epitope on NY-ESO-1, nucleic acid molecules encoding the TCR, and cells comprising the TCR or the nucleic acid molecules. Some aspects of the present disclosure relate to methods of treating cancer in a subject in need thereof, the methods comprising administering the cells to the subject. Other aspects of the present disclosure relate to HLA class I molecules complexed with a peptide comprising an epitope of NY-ESO-1.
[0060] I. Terminology
[0061] To enable a clearer understanding of the present disclosure, certain terms will first be defined. As used in this application, and unless specifically identified otherwise herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout this application.
[0062] It must be noted that as used herein the terms "a" and "an" refer to one or more (i.e. at least one) of that entity. For example, "a nucleotide sequence" refers to one or more nucleotide sequences.
[0063] Also, the term "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components. For example, the phrase "A and / or B" is to be taken as specific disclosure of each of the following alternatives: A; B; or A and B. Likewise, the phrase "A, B, and / or C" is to be taken as specific disclosure of each of the following alternatives: A; B; C; A and B; A and C; B and C; or A and B and C. Also, the term "and / or" when used in the context of "at least one of A and / or B" or "at least one of A and B" should be taken as specific disclosure of each of the following alternatives: at least one A; at least one B; or at least one A and at least one B.
[0064] The term "about" is used herein to refer to approximately, roughly, around, or in the vicinity of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the stated numerical values by a margin of tolerance. Generally, the term "about" is used herein to modify a numerical value above and below the stated value by a margin of 10%.
[0065] It should be appreciated that wherever the word "comprising" is used in this document, it is to be taken as a specific disclosure of an otherwise similar aspect described using the terms "consisting of and / or "consisting essentially of.
[0066] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as those commonly understood by one of ordinary skill in the art to which this disclosure belongs. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure.
[0067] Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Unless otherwise indicated, nucleotide sequences are written left to right in 5' to 3' orientation. Amino acid sequences are written left to right in amino to carboxy orientation. The headings provided herein are not limitations of the various aspects of the disclosure, which can be had by reference to the specification as a whole. Accordingly, the terms defined herein are to be accorded their broadest interpretation as is reasonably permitted, consistent with the statements made concurrently herein. As used herein, the indefinite articles "a" and "an" mean "one or more" unless the context clearly dictates otherwise.
[0068] "Administering" refers to the physical introduction of an agent to a subject using any of a variety of methods and delivery systems known to those of skill in the art. Exemplary routes of administration for the formulations disclosed herein include intravenous, intramuscular, subcutaneous, intraperitoneal, trans-spinal or other parenteral routes of administration, e.g., by injection or infusion. The phrase "parenteral administration" as used herein means modes of administration other than enteral and topical administration, usually by injection and includes, without limitation, intravenous, intramuscular, intraarterial, intrathecal, intralymphatic, intralesional, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcutaneous, subcutaneous, intraarticular, subcapsular, subarachnoid, intraspinal, epidural, and sternal injection and infusion, and in vivo electroporation. In some embodiments, the formulation is administered via a non-parenteral route, e.g., orally. Other non-parenteral routes include topical, transdermal, or transmucosal routes of administration, e.g., intranasally, vaginally, rectally, sublingually, or topically. Administration can also be performed, e.g., once, multiple times, and / or over one or more extended periods of time.
[0069] As used herein, the term "T cell receptor" (TCR) refers to a heterogeneous cell surface receptor capable of specifically interacting with a target antigen. As used herein, "TCR" includes, but is not limited to, naturally occurring and non-naturally occurring TCRs; full-length TCRs and antigen-binding portions thereof; chimeric TCRs; TCR fusion constructs; and synthetic TCRs. In humans, TCRs are expressed on the surface of T cells and are responsible for T cell recognition and targeting of antigen-presenting cells. Antigen-presenting cells (APCs) display fragments of foreign proteins (antigens) complexed with major histocompatibility complexes (MHCs; also referred to herein as with HLA molecules, e.g., HLA class 1 molecules). TCRs recognize and bind to the antigen:HLA complex and recruit CD3 (expressed by T cells), thereby activating the TCR. The activated TCR initiates downstream signaling and an immune response, including destruction of the EPC.
[0070] Generally, a TCR can comprise two chains, an alpha chain and a beta chain (or, less commonly, a gamma chain and a delta chain), which are interconnected by disulfide bonds. Each chain comprises a variable domain (an alpha chain variable domain and a beta chain variable domain) and a constant region (an alpha chain constant region and a beta chain constant region). The variable domain is located distal to the cell membrane, and the variable domain interacts with an antigen. The constant region is located proximal to the cell membrane. A TCR can also comprise a transmembrane region and a short cytoplasmic tail. As used herein, the term “constant region” encompasses the transmembrane region and cytoplasmic tail (when present) as well as the traditional “constant region.”
[0071] A variable domain can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). Each alpha chain variable domain and beta chain variable domain comprises three CDRs and four FRs: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. Each variable domain contains a binding domain that interacts with an antigen. While all three CDRs on each chain are involved in antigen binding, it is believed that CDR3 is the primary antigen binding region. CDR1 also interacts with the antigen, while CD2 is believed to primarily recognize the HLA complex.
[0072] Unless explicitly stated otherwise, and unless the context indicates otherwise, the term “TCR” also includes an antigen binding fragment or antigen binding portion of any of the TCRs disclosed herein, and includes monovalent and bivalent fragments or portions, and single chain TCRs. The term “TCR” is not limited to naturally occurring TCRs that bind to the surface of a T cell. As used herein, the term “TCR” further refers to a TCR as described herein expressed on the surface of a cell other than a T cell (e.g., a cell naturally expressing or modified to express CD3 as described herein), or a TCR as described herein that is free of a cell membrane (e.g., an isolated TCR or a soluble TCR).
[0073] “Antigen binding molecule,” “portion of a TCR,” or “TCR fragment” refers to any portion of a TCR that is less than the whole. An antigen binding molecule can include an antigen complementarity determining region (CDR).
[0074] An "antigen" refers to any molecule, such as a peptide, that elicits an immune response or is capable of being bound by a TCR. As used herein, an "epitope" refers to the portion of a polypeptide that elicits an immune response or is capable of being bound by a TCR. The immune response can involve antibody production or activation of specific immune-competent cells or both. Those skilled in the art will readily understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Antigens and / or epitopes can be expressed endogenously, i.e., from genomic DNA, or can be recombinantly expressed. Antigens and / or epitopes can be specific for a certain tissue, such as a cancer cell, or they can be widely expressed. Furthermore, fragments of larger molecules can serve as antigens. In one embodiment, the antigen is a tumor antigen. Epitopes can exist within longer polypeptides (e.g., proteins), or epitopes can exist as fragments of longer polypeptides. In some embodiments, epitopes are complexed with major histocompatibility complex (MHC; also referred to herein as with HLA molecules, e.g., HLA class I molecules).
[0075] As used herein, "NY-ESO-1," "New York esophageal squamous cell carcinoma 1," "cancer-testis antigen 1B," or "CTAG1B" refers to a tumor antigen that has expression in a variety of cancer types. NY-ESO-1 is a member of the cancer-testis antigen family, which is characterized by expression that is largely restricted to testicular germ cells and placental trophoblasts, with little or no expression in healthy adult somatic cells. NY-ESO-1 expression can be detected during embryonic development, and NY-ESO-1 expression is maintained in spermatogonia and primary spermatocytes. In females, NY-ESO-1 expression rapidly decreases in female oogonia. Low levels of NY-ESO-1 RNA have been detected in ovarian and endometrial tissues; however, NY-ESO-1 protein has not been found in these tissues. The NY-ESO-1 protein (SEQ ID NO: 52; Table 1) is an 18-kDa protein with 180 amino acids. See, e.g., Thoma et al., Front. Immunol. 9:947 (2018).
[0076] Table 1. NY-ESO-1 amino acid sequence
[0077]
[0078] As used herein, the term "HLA" refers to human leukocyte antigen. HLA genes encode major histocompatibility complex (MHC) proteins in humans. MHC proteins are expressed on the surface of cells and are involved in activation of immune responses. HLA class I genes encode MHC class I molecules, which are expressed on the surface of cells in complex with peptide fragments (antigens) of self or non-self proteins. T cells that express TCRs and CD3 recognize the antigen:MHC class I complex and initiate an immune response to target and destroy antigen-presenting cells that display non-self proteins.
[0079] As used herein, "HLA class I molecule" or "HLA class I molecule" refers to the protein product of a wild-type or variant HLA class I gene that encodes an MHC class I molecule. Thus, "HLA class I molecule" and "MHC class I molecule" are used interchangeably herein.
[0080] MHC class I molecules comprise two protein chains: an alpha chain and a beta2-microglobulin (β2m) chain. Human β2m is encoded by the B2M gene. The amino acid sequence of β2m is set forth in SEQ ID NO: 16 (Table 2). The alpha chain of MHC class I molecules is encoded by the HLA gene complex. The HLA complex is located within the 6p21.3 region on the short arm of human chromosome 6 and contains over 220 genes with diverse functions. HLA genes are highly variable, with over 20,000 HLA alleles and related alleles, including over 15,000 HLA class I alleles known in the art, which encode thousands of HLA proteins, including over 10,000 HLA class I proteins (see, e.g., hla.alleles.org, last accessed February 27, 2019). There are at least three genes in the HLA complex that encode MHC class I alpha chain proteins: HLA-A, HLA-B, and HLA-C. In addition, HLA-E, HLA-F, and HLA-G encode proteins that associate with MHC class I molecules.
[0081] Table 2. Amino acid sequence of human β2m
[0082]
[0083] The term "autologous" refers to any material derived from the same individual to which the any material is subsequently reintroduced. For example, an autologous T cell therapy includes administration of T cells isolated from the same subject to the subject. The term "allogeneic" refers to any material derived from one individual and then introduced into another individual of the same species. For example, an allogeneic T cell transplant includes administration of T cells obtained from a donor other than the subject to the subject.
[0084] "Cancer" refers to a large set of various diseases characterized by the uncontrolled growth of abnormal cells in the body. Unregulated cell division and growth results in the formation of malignant tumors, which invade neighboring tissues and can also metastasize to distant parts of the body through the lymphatic system or bloodstream. "Cancer" or "cancerous tissue" can include a tumor. Examples of cancers that can be treated by the methods of the present application include, but are not limited to, cancers of the immune system, including lymphomas, leukemias, and other white blood cell malignancies. In some embodiments, the methods of the present application can be used to reduce the tumor size of a tumor derived from, for example, bone cancer, kidney cancer, prostate cancer, breast cancer, colon cancer, lung cancer, malignant melanoma of the skin or eye, pancreatic cancer, skin cancer, head and neck cancer, malignant melanoma of the skin or eye, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's Disease, non-Hodgkin's lymphoma (NHL), primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), esophageal cancer, small bowel cancer, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia, acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, T-cell lymphoma, environmentally induced cancers (including those induced by asbestos), other B-cell malignancies, and combinations of said cancers. A particular cancer can be responsive to chemotherapy or radiation therapy or the cancer can be refractory. Refractory cancer refers to a cancer that is not suitable for surgical intervention and which either initially does not respond to chemotherapy or radiation therapy or which becomes unresponsive over time.
[0085] As used herein, "anti-tumor effect" refers to a biological effect that can exist in the form of a reduction in tumor volume, a reduction in the number of tumor cells, a reduction in tumor cell proliferation, a reduction in the number of metastases, an increase in overall survival or progression-free survival, an increase in life expectancy, or an improvement in various physiological symptoms associated with a tumor. Anti-tumor effect can also refer to the prevention of tumor occurrence, e.g., a vaccine.
[0086] The term "progression-free survival" can be abbreviated as PFS and, as used herein, refers to the length of time during treatment after which disease progression or death from any cause occurs according to the revised IWG Response Criteria for Malignant Lymphoma.
[0087] "Progressive disease" or "disease progression" can be abbreviated as PD and, as used herein, refers to the worsening of one or more symptoms associated with a particular disease. For example, disease progression in a subject afflicted with cancer can include an increase in the number or size of one or more malignant lesions, tumor metastasis, and death.
[0088] "Duration of response" can be abbreviated as DOR and, as used herein, refers to the length of time a subject is in objective response until the date of disease progression or death according to the revised IWG Response Criteria for Malignant Lymphoma.
[0089] The term "overall survival" can be abbreviated as OS and is defined as the length of time from the treatment date until the date of death.
[0090] As used herein, “cytokine” refers to a non-antibody protein released by a cell in response to contact with a specific antigen, where the cytokine interacts with a second cell to mediate a response in the second cell. Cytokines can be expressed endogenously by a cell or administered to a subject. Cytokines can be released by immune cells including macrophages, B cells, T cells, and mast cells to propagate an immune response. Cytokines can induce various responses in recipient cells. Cytokines can include homeostatic cytokines, chemokines, proinflammatory cytokines, effectors, and acute phase proteins. For example, homeostatic cytokines including interleukin (IL) 7 and IL-15 promote immune cell survival and proliferation, and proinflammatory cytokines can promote an inflammatory response. Examples of homeostatic cytokines include, but are not limited to, IL-2, IL-4, IL-5, IL-7, IL-10, IL-12p40, IL-12p70, IL-15, and interferon (IFN) gamma. Examples of proinflammatory cytokines include, but are not limited to, IL-la, IL-lb, IL-6, IL-13, IL-17a, tumor necrosis factor (TNF)-alpha, TNF-beta, fibroblast growth factor (FGF) 2, granulocyte macrophage colony-stimulating factor (GM-CSF), soluble intercellular adhesion molecule 1 (sICAM-1), soluble vascular adhesion molecule 1 (sVCAM-1), vascular endothelial growth factor (VEGF), VEGF-C, VEGF-D, and placental growth factor (PLGF). Examples of effectors include, but are not limited to, granzyme A, granzyme B, soluble Fas ligand (sFasL), and perforin. Examples of acute phase proteins include, but are not limited to, C-reactive protein (CRP) and serum amyloid A (SAA).
[0091] “Chemokine” is a class of cytokines that mediate chemotaxis or directed movement of cells. Examples of chemokines include, but are not limited to, IL-8, IL-16, eotaxin, eotaxin-3, macrophage-derived chemokine (MDC or CCL22), monocyte chemotactic protein 1 (MCP-1 or CCL2), MCP-4, macrophage inflammatory protein 1 alpha (MIP-1 alpha, MIP-1a), MIP-1 beta (MIP-1b), gamma-inducible protein 10 (IP-10), and thymus and activation-regulated chemokine (TARC or CCL17).
[0092] Other examples of analytes and cytokines of the present invention include, but are not limited to, chemokine (C-C motif) ligand (CCL) 1, CCL5, monocyte-specific chemokine 3 (MCP3 or CCL7), Monocyte Chemotactic Protein 2 (MCP-2 or CCL8), CCL13, IL-1, IL-3, IL-9, IL-11, IL-12, IL-14, IL-17, IL-20, IL-21, granulocyte colony-stimulating factor (G-CSF), leukemia inhibitory factor (LIF), oncostatin M (OSM), CD154, lymphotoxin (LT) beta, 4-1BB ligand (4-1BBL), a proliferation-inducing ligand (APRIL), CD70, CD153, CD178, glucocorticoid-induced TNFR-related ligand (GITRL), tumor necrosis factor superfamily member 14 (TNFSF14), OX40L, TNF-related and ApoL-related leukocyte-expressed ligand 1 (TALL-1), or TNF-related apoptosis-inducing ligand (TRAIL).
[0093] A "therapeutically effective amount," "effective dose," "effective amount," or "therapeutically effective dose" of a drug or therapeutic agent is any amount of the drug that, when used alone or in combination with another therapeutic agent, prevents the onset of a disease or promotes the regression of a disease as evidenced by a decrease in the severity of symptoms of the disease, an increase in the frequency and duration of disease symptom-free periods, or the prevention of impairment or disability due to the disease. The ability of a therapeutic agent to promote the regression of a disease can be assessed using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by determining the activity of the agent in in vitro assays.
[0094] The term "lymphocyte" as used herein includes a natural killer (NK) cell, a T cell, or a B cell. NK cells are a type of cytotoxic / cell toxic lymphocyte that represents a major component of the innate immune system. NK cells reject tumors and cells infected by viruses. They work through a process of apoptosis or programmed cell death. They are called "natural killers" because they do not require activation to kill cells. T cells play a major role in cell-mediated immunity (not involving antibodies). The T cell receptor (TCR) distinguishes T cells from other lymphocyte types. The thymus, a specialized organ of the immune system, is primarily responsible for the maturation of T cells. There are six types of T cells, namely: helper T cells (e.g., CD4+ cells), cytotoxic T cells (also known as TC, cytotoxic T lymphocyte, CTL, T-killer cell, cytolytic T cell, CD8+ T cell, or killer T cell), memory T cells ((i) stem cell memory T cells (TSCM), (ii) central memory T cells (TCM), (iii) effector memory T cells (TEM), (iv) terminally differentiated effector memory T cells (TEMRA), and (v) peripheral SCMCells (such as naive cells) are CD45RO-, CCR7+, CD45RA+, CD62L+ (L-selectin), CD27+, CD28+, and IL-7Ra+, but they also express large amounts of CD95, IL-2Rβ, CXCR3, and LFA-1, and show many of the functional characteristics unique to memory cells); (ii) central memory T CM Cells express L-selectin and CCR7, secrete IL-2, but not IFNy or IL-4, and (iii) effector memory T EM Cells do not express L-selectin or CCR7, but produce effector cytokines such as IFNy and IL-4), regulatory T cells (Tregs, suppressor T cells, or CD4+CD25+ regulatory T cells), natural killer T cells (NKT), and gd T cells. B cells, on the other hand, play a major role in humoral immunity (involving antibodies). B cells produce antibodies and antigens and function as antigen presenting cells (APCs) and become memory B cells upon activation by antigen interaction. In mammals, immature B cells are formed in the bone marrow from which the B cell designation is derived.
[0095] The term "genetically engineered" or "engineered" refers to a method of modifying the genome of a cell, including but not limited to deletion of a coding or non-coding region or a portion thereof or insertion of a coding region or a portion thereof. In some embodiments, the modified cell is a lymphocyte, e.g., a T cell or a modified cell expressing CD3, which can be obtained from a patient or a donor. The cell can be modified to express an exogenous construct, such as a T cell receptor (TCR) as disclosed herein, incorporated into the genome of the cell. In some embodiments, the cell is modified to express CD3.
[0096] An "immune response" refers to the actions of cells of the immune system (e.g., T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells, and neutrophils) and soluble macromolecules (including Abs, cytokines, and complement) produced by any of these cells or the liver that result in the selective targeting, binding, damaging, destruction, and / or elimination of an invading pathogen, a pathogen-infected cell or tissue, a cancer cell or other abnormal cell, or a normal human cell or tissue in an autoimmune or pathologic inflammatory situation within a vertebrate animal.
[0097] The term "immunotherapy" refers to the treatment of a subject afflicted with, or at risk for acquiring or experiencing a recurrence of, a disease by a method involving the induction, enhancement, suppression or otherwise modulation of an immune response. Examples of immunotherapy include, but are not limited to, T cell therapy. T cell therapy can include adoptive T cell therapy, tumor infiltrating lymphocyte (TIL) immunotherapy, autologous cell therapy, engineered autologous cell therapy (eACT), and allogeneic T cell transplantation.
[0098] The cells used in the immunotherapy described herein can be from any source known in the art. For example, the T cells can be distinguished from a population of hematopoietic stem cells in vitro, or the T cells can be obtained from a subject. The T cells can be obtained from, for example, peripheral blood mononuclear cells, bone marrow, lymph node tissue, umbilical cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. In addition, the T cells can be derived from one or more T cell lines available in the art. The T cells can also be obtained from a subject using methods known to the skilled artisan, such as FICOLL TM Any number of techniques for separation and / or apheresis of a unit of blood collected from a subject. Other methods for isolating T cells for T cell therapy are disclosed in U.S. Patent Publication No. 2013 / 0287748, which is incorporated by reference herein in its entirety. Immunotherapy can also include administering to a subject a modified cell, wherein the modified cell expresses CD3 and a TCR disclosed herein. In some embodiments, the modified cell is not a T cell.
[0099] A "patient" as used herein includes any human afflicted with a cancer, such as a lymphoma or leukemia. The terms "subject" and "patient" are used interchangeably herein.
[0100] The terms "peptide," "polypeptide," and "protein" are used interchangeably and refer to a compound comprising amino acid residues linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no maximum number of amino acids to which the sequence of a protein or peptide can be limited. A polypeptide includes any peptide or protein comprising two or more amino acids linked to one another by peptide bonds. As used herein, the terms refer to short chains, which are also referred to in the art as, for example, peptides, oligopeptides, and oligomers; as well as to longer chains, which are also referred to in the art as proteins. "Polypeptide" includes, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, polypeptide variants, modified polypeptides, derivatives, analogs, fusion proteins, and the like. A polypeptide includes a natural, recombinant, synthetic, or a combination thereof.
[0101] As used herein, "stimulation" refers to a primary response induced by the binding of a stimulatory molecule to its cognate ligand, wherein the binding mediates a signal transduction event. A "stimulatory molecule" is a molecule on a T cell that specifically binds to a cognate stimulatory ligand present on an antigen presenting cell, such as the T cell receptor (TCR) / CD3 complex. A "stimulatory ligand" is a ligand that, when present on an antigen presenting cell (e.g., aAPC, dendritic cell, B cell, and the like), can specifically bind to a stimulatory molecule on a T cell, thereby mediating a primary response by the T cell, including but not limited to activation, initiation of an immune response, proliferation, and the like. Stimulatory ligands include, but are not limited to, MHC class I molecules loaded with peptides, anti-CD3 antibodies, superagonist anti-CD28 antibodies, and superagonist anti-CD2 antibodies.
[0102] The terms "treatment" and "pretreatment" are used interchangeably herein and indicate preparing a patient in need of a T cell therapy for suitability. Treatment as used herein includes, but is not limited to, reducing the number of endogenous lymphocytes, removing a cytokine sink, increasing the serum content of one or more homeostatic cytokines or proinflammatory factors, enhancing the effector function of T cells administered post-treatment, enhancing antigen presenting cell activation and / or availability, or any combination thereof prior to a T cell therapy. In one embodiment, "treatment" includes increasing the serum content of one or more cytokines, such as interleukin 7 (IL-7), interleukin 15 (IL-15), interleukin 10 (IL-10), interleukin 5 (IL-5), gamma-induced protein 10 (IP-10), interleukin 8 (IL-8), monocyte chemotactic protein 1 (MCP-1), placental growth factor (PLGF), C-reactive protein (CRP), soluble intercellular adhesion molecule 1 (sICAM-1), soluble vascular adhesion molecule 1 (sVCAM-1), or any combination thereof. In another embodiment, "treatment" includes increasing the serum content of IL-7, IL-15, IP-10, MCP-1, PLGF, CRP, or any combination thereof.
[0103] "Treatment" or "treating" of a subject refers to any type of intervention or process performed on a subject or administration of an active agent to a subject with the objective to reverse, alleviate, ameliorate, inhibit, slow down or prevent the onset, progression, development, severity or recurrence of a symptom, complication or condition associated with a disease or a biochemical marker. In one embodiment, "treatment" or "treating" includes partial alleviation. In another embodiment, "treatment" or "treating" includes complete alleviation.
[0104] The use of the alternative (e.g.,“or”) should be understood to mean either one, but not both, of the alternatives. As used herein, the indefinite article“a” or“an” should be understood to mean“one or more” of any stated or
[0105] The term“about” or“substantially” refers to a value or composition that is within an acceptable error range for the value or composition as determined by one of ordinary skill in the art, which will depend on how the value or composition is measured or determined, i.e., the limitations of the measurement system. For example,“about” or“substantially” can mean within 1 or more than 1 standard deviation, per the practice in the art. Alternatively,“about” or“substantially” can mean ranges approximately 10% of the indicated value (i.e., ±10%). For example, about 3 mg can include any number between 2.7 mg and 3.3 mg (for 10%). Also, particularly with respect to biological systems or processes, the terms can mean within one or more orders of magnitude. When a particular value or composition is provided in the application and claims, unless otherwise stated the meaning of“about” or“substantially” should be assumed to be within an acceptable error range of the particular value or composition.
[0106] Unless otherwise indicated, any concentration range, percentage range, ratio range, or integer range described herein is to be understood to include any and all sub-ranges of the same, e.g., every combination of variable endpoints of the ranges listed. For example, a range of“1 to 10” is to be understood to include, individually and / or in combination with one another, the following ranges: 1 to 10; 3 to 7; 5 to 6; 4 to 8; 3 to 9; etc.
[0107] Various aspects of the application are described in more detail in the following subsections.
[0108] II. Compositions of the Disclosure
[0109] The present disclosure relates to T cell receptors (TCRs) or antigen binding portions thereof that specifically bind to an epitope on NY-ESO-1, nucleic acid molecules encoding the TCRs, and cells comprising the TCRs or the nucleic acid molecules. Some aspects of the present application relate to methods of treating cancer in a subject in need thereof, the methods comprising administering to the subject a cell comprising a TCR described herein. Other aspects of the present disclosure relate to an epitope of NY-ESO-1 bound by a TCR, and an HLA class I molecule complexed with a peptide comprising the epitope of NY-ESO-1.
[0110] A T cell receptor or TCR is a molecule present on the surface of a T cell or T lymphocyte that is responsible for recognizing a fragment of an antigen as a peptide bound to a major histocompatibility complex (MHC) molecule. The binding between a TCR and an antigen peptide is of relatively low affinity and is degenerate: in other words, many TCRs recognize the same antigen peptide and many antigen peptides are recognized by the same TCR.
[0111] The TCR is composed of two different protein chains (in other words, it is a heterodimer). In humans, in 95% of T cells, the TCR is composed of an alpha (a) chain and a beta (b) chain (encoded by TRA and TRB, respectively), but in 5% of T cells, the TCR is composed of gamma and delta (g / d) chains (encoded by TRG and TRD, respectively). This ratio changes during ontogeny and in diseased states, such as leukemia. It also differs among species. Orthologs of four loci have been mapped in various species. Each locus can give rise to multiple polypeptides with constant and variable regions.
[0112] When the TCR engages with an antigenic peptide and MHC (peptide / MHC), the T lymphocyte is activated through signal transduction, a series of biochemical events mediated by associated enzymes, co-receptors, specialized adaptor molecules, and activated or released transcription factors.
[0113] II.A. NUCLEIC ACID MOLECULES
[0114] Certain aspects of the present disclosure relate to nucleic acid molecules comprising (i) a first nucleotide sequence encoding a recombinant TCR or antigen binding portion thereof that specifically binds to human NY-ESO-1 ("anti-NY-ESO-1 TCR"); and (ii) a second nucleotide sequence, wherein the second nucleotide sequence or polypeptide encoded by the second nucleotide sequence inhibits expression of an endogenous TCR. In some embodiments, the second nucleotide sequence is a non-naturally occurring sequence. In other embodiments, the second nucleotide sequence is synthetic. In other embodiments, the second nucleotide sequence comprises a sequence that targets a nucleotide sequence encoding an endogenous TCR. In some embodiments, the anti-NY-ESO-1 TCR cross-competes for binding to human NY-ESO-1 with a reference TCR. In some embodiments, the anti-NY-ESO-1 TCR binds to the same epitope or an overlapping epitope of human NY-ESO-1 as a reference TCR.
[0115] In some embodiments, the reference TCR comprises an alpha chain and a beta chain; wherein the alpha chain comprises a complementarity determining region 1 (CDR1), a CDR2, and a CDR3; wherein the beta chain comprises a CDR1, a CDR2, and a CDR3; and wherein the reference TCR comprises an alpha chain CDR3 as set forth in SEQ ID NO: 7 and a beta chain CDR3 as set forth in SEQ ID NO: 10. In some embodiments, the alpha chain CDR1, CDR2, and CDR3 sequences are present in the amino acid sequence set forth in SEQ ID NO: 1, and the reference TCR comprises the beta chain CDR1, CDR2, and CDR3 sequences present in the amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the reference TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises an amino acid sequence as set forth in SEQ ID NO: 1 and the beta chain comprises an amino acid sequence as set forth in SEQ ID NO: 2.
[0116] Table 3. Alpha and Beta Chain TCR Sequences
[0117]
[0118]
[0119] II.A.1. TCR Encoded by a First Nucleotide Sequence
[0120] The present disclosure relates to a TCR encoded by a first nucleotide sequence described herein. In some embodiments, the anti-NY-ESO-1 TCR encoded by the first nucleotide sequence comprises an alpha chain and a beta chain, wherein the alpha chain comprises a variable domain comprising an alpha chain CDR1, an alpha chain CDR2, and an alpha chain CDR3; and wherein the beta chain comprises a variable domain comprising a beta chain CDR1, a beta chain CDR2, and a beta chain CDR3. In some embodiments, the anti-NY-ESO-1 TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7 (CVVSFSGNTPLVF). In some embodiments, the anti-NY-ESO-1 TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10 (CASSSSYSNQPQHF). In some embodiments, non-CDR regions in the alpha chain and / or the beta chain are further modified, for example, a substitution or mutation of one amino acid, two amino acids, three amino acids, four amino acids, five amino acids, or six amino acids, whereby the alpha chain and / or the beta chain are not naturally occurring. In some embodiments, the substitution or mutation can improve the TCR described herein in various ways, for example, binding affinity, binding specificity, stability, viscosity, or any combination thereof.
[0121] In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises an alpha chain CDR1, wherein the alpha chain CDR1 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 5 (SSYSPS). In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises a beta chain CDR1, wherein the beta chain CDR1 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 8 (SEHNR).
[0122] In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises an alpha chain CDR2, wherein the alpha chain CDR2 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 6 (YTSAATLV). In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises a beta chain CDR2, wherein the beta chain CDR2 of the anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 9 (FQNEAQ).
[0123] In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises an alpha chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the variable domain of the alpha chain amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises an alpha chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the variable domain of the alpha chain amino acid sequence set forth in SEQ ID NO: 1, wherein the anti-NY-ESO-l TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises an alpha chain variable domain present in the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
[0124] In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises a beta chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the variable domain of the beta chain amino acid sequence set forth in SEQ ID NO:2. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises a beta chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the variable domain of the beta chain amino acid sequence set forth in SEQ ID NO:2, wherein the anti-NY-ESO-l TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises a beta chain variable domain present in the amino acid sequence set forth in SEQ ID NO:2.
[0125] In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence further comprises an alpha chain constant region, a beta chain constant region, or both an alpha chain constant region and a beta chain constant region. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises an alpha chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the constant region of the alpha chain amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises an alpha chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the constant region of the alpha chain amino acid sequence set forth in SEQ ID NO: 1, wherein the anti-NY-ESO-l TCR comprises an alpha chain CDR3 comprising the amino acid sequence as set forth in SEQ ID NO: 7. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises the alpha chain constant region present in the alpha chain amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide further comprises an alpha constant region that is different from the endogenous (e.g., naturally occurring) constant region of the alpha chain. In some embodiments, the alpha chain constant region comprises an amino acid sequence comprising at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the amino acid sequence of the constant region of the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
[0126] In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises a beta chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the constant region of the beta chain amino acid sequence set forth in SEQ ID NO:2. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises a beta chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the constant region of the beta chain amino acid sequence set forth in SEQ ID NO:2, wherein the anti-NY-ESO-l TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises a beta chain constant region present in the amino acid sequence set forth in SEQ ID NO:2. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence further comprises a beta constant region that is different from an endogenous (e.g., naturally occurring) constant region of a beta chain. In some embodiments, the beta chain constant region comprises an amino acid sequence comprising at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the amino acid sequence of the constant region of the beta chain amino acid sequence set forth in SEQ ID NO:2.
[0127] In certain embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises an alpha chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the alpha chain amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises an alpha chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the alpha chain amino acid sequence set forth in SEQ ID NO: 1, wherein the anti-NY-ESO-l TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises an alpha chain comprising the amino acid sequence set forth in SEQ ID NO: 1.
[0128] In certain embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises a beta chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the beta chain amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises a beta chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the beta chain amino acid sequence set forth in SEQ ID NO: 2, wherein the anti-NY-ESO-l TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises a beta chain comprising an amino acid sequence set forth in SEQ ID NO: 2.
[0129] In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence comprises an alpha chain constant region, a beta chain constant region, or both; and wherein the alpha chain constant region, the beta chain constant region, or both comprise an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 substitutions within a target sequence relative to the corresponding amino acid sequence of an endogenous TCR.
[0130] II.A.2. Epitope
[0131] In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide sequence binds to the same epitope as the reference TCR. In some embodiments, the anti-NY-ESO-l TCR binds to an epitope of NY-ESO-l comprising the amino acid sequence set forth in SEQ ID NO: 13 (APRGPHGGAASGL). In some embodiments, the anti-NY-ESO-l TCR binds to an epitope of NY-ESO-l consisting of the amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, the epitope consists of amino acid residues 60-72 of NY-ESO-l (SEQ ID NO: 52), e.g.,“NY-ESO-l 60-72 ”.
[0132] In certain embodiments, the epitope is complexed with an HLA class I molecule. The human leukocyte antigen (HLA) system (major histocompatibility complex [MHC] in humans) is an important part of the immune system and is controlled by genes located on chromosome 6. It encodes cell surface molecules that are specialized to present antigenic peptides to the T cell receptor (TCR) on T cells. (See also Overview of the Immune System.) MHC molecules that present antigens (Ag) are divided into two major classes: class I MHC molecules and class II MHC molecules.
[0133] Class I MHC molecules exist as transmembrane glycoproteins on the surface of all nucleated cells. The complete class I molecule consists of an alpha heavy chain that is bound to a beta-2 microglobulin molecule. The heavy chain consists of two peptide-binding domains, Ig-like domains, and a transmembrane region with a cytoplasmic tail. The heavy chain of class I molecules is encoded by genes at the HLA-A, HLA-B, and HLA-C loci. T cells that express CD8 molecules react with class I MHC molecules. These lymphocytes often have cytotoxic function, which requires that they be able to recognize any infected cell. Because every nucleated cell expresses class I MHC molecules, all infected cells can serve as antigen-presenting cells for CD8 T cells (CD8 binds to the nonpolymorphic portion of the class I heavy chain). Some class I MHC genes encode nonclassical MHC molecules, such as HLA-G (which can play a role in protecting the fetus from the maternal immune response) and HLA-E (which presents peptides to certain receptors on natural killer [NK] cells).
[0134] In some embodiments, the HLA class 1 molecule is selected from HLA-A, HLA-B, and HLA-C alleles. In some embodiments, the HLA class 1 molecule is selected from HLA-E, HLA-F, and HLA-G alleles. In certain embodiments, the HLA class 1 molecule is an HLA-A allele. In certain embodiments, the HLA class 1 molecule is an HLA-B allele. In certain embodiments, the HLA class 1 molecule is an HLA-C allele.
[0135] Many HLA-A, HLA-B, and HLA-C alleles are known in the art, and any of the known alleles can be used in the present disclosure. An updated list of HLA alleles is available at hla.alleles.org / (last accessed February 27, 2019). In some embodiments, the HLA class 1 molecule is an HLA-B allele selected from the group consisting of HLA-B*07, HLA-B*08, HLA-B*13, HLA-B*14, HLA-B*15, HLA-B*18, HLA-B*27, HLA-B*35, HLA-B*37, HLA-B*38, HLA-B*39, HLA-B*40, HLA-B*41, HLA-B*42, HLA-B*44, HLA-B*45, HLA-B*46, HLA-B*47, HLA-B*48, HLA-B*49, HLA-B*50, HLA-B*51, HLA-B*52, HLA-B*53, HLA-B*54, HLA-B*55, HLA-B*56, HLA-B*57, HLA-B*58, HLA-B*59, HLA-B*67, HLA-B*73, HLA-B*78, HLA-B*79, HLA-B*81, HLA-B*82, and HLA-B*83. In certain embodiments, the HLA-B allele is an HLA-B*07:02 allele. In certain embodiments, the HLA-B allele is an HLA-B*07:03 allele. In certain embodiments, the HLA-B allele is an HLA-B*07:04 allele. In certain embodiments, the HLA-B allele is an HLA-B*07:05 allele. In certain embodiments, the HLA-B allele is an HLA-B*07:06 allele. In certain embodiments, the HLA class 1 molecule is an HLA-B allele selected from the group consisting of HLA-B*07:02:01:01, HLA-B*07:02:01:02, HLA-B*07:02:01:03, HLA-B*07:02:01:04, HLA-B*07:02:01:05, HLA-B*07:02:01:06, HLA-B*07:02:01:07, HLA-B*07:02:01:08, HLA-B*07:02:01:09, HLA-B*07:02:01:10, HLA-B*07:02:01:11, HLA-B*07:02:01:12, HLA-B*07:02:01:13, HLA-B*07:02:01:14, HLA-B*07:02:02, HLA-B*07:02:03, HLA-B*07:02:04, HLA-B*07:02:05,HLA-B*07:02:06, HLA-B*07:02:07, HLA-B*07:02:08, HLA-B*07:02:09, HLA-B*07:02:10, HLA-B*07:02:11, HLA-B*07:02:12, HLA-B*07:02:13, HLA-B*07:02:14, HLA-B*07:02:15, HLA-B*07:02:16, HLA-B*07:02:17, HLA-B*07:02:18, HLA-B*07:02:19, HLA-B*07:02:20, HLA-B*07:02:21, HLA-B*07:02:22, HLA-B*07:02:23, HLA-B*07:02:24, HLA-B*07:02:25, HLA-B*07:02:26, HLA-B*07:02:27, HLA-B*07:02:28, HLA-B*07:02:29, HLA-B*07:02:30, HLA-B*07:02:31, HLA-B*07:02:32, HLA-B*07:02:33, HLA-B*07:02:34, HLA-B*07:02:35, HLA-B*07:02:36, HLA-B*07:02:37, HLA-B*07:02:38, HLA-B*07:02:39, HLA-B*07:02:40, HLA-B*07:02:41, HLA-B*07:02:42, HLA-B*07:02:43, HLA-B*07:02:44, HLA-B*07:02:45, HLA-B*07:02:46, HLA-B*07:02:47, HLA-B*07:02:48, HLA-B*07:02:49, HLA-B*07:02:50, HLA-B*07:02:51, HLA-B*07:02:52, HLA-B*07:02:53, HLA-B*07:02:54, HLA-B*07:02:55, HLA-B*07:02:56, HLA-B*07:02:57, HLA-B*07:02:58, HLA-B*07:02:59, HLA-B*07:02:60, HLA-B*07:02:61, HLA-B*07:02:62, HLA-B*07:02:63, HLA-B*07:02:64, HLA-B*07:02:65, HLA-B*07:02:66, HLA-B*07:02:67, HLA-B*07:02:68, HLA-B*07:02:69, HLA-B*07:02:70, HLA-B*07:02:71,HLA-B*07:02:72, HLA-B*07:02:73, HLA-B*07:03, HLA-B*07:04:01, HLA-B*07:04:02, HLA-B*07:05:01:01, HLA-B*07:05:01:02, HLA-B*07:05:01:03, HLA-B*07:05:01:04, HLA-B*07:05:02, HLA-B*07:05:03, HLA-B*07:05:04, HLA-B*07:05:05, HLA-B*07:05:06, HLA-B*07:05:07, HLA-B*07:05:08, HLA-B*07:05:09, HLA-B*07:06:01, HLA-B*07:06:02, HLA-B*07:06:03, HLA-B*07:07:01, HLA-B*07:07:02, HLA-B*07:08:01, HLA-B*07:08:02, HLA-B*07:09:01, HLA-B*07:09:02, HLA-B*07:10, HLA-B*07:100, HLA-B*07:101, HLA-B*07:102, HLA-B*07:103, HLA-B*07:104, HLA-B*07:105, HLA-B*07:106, HLA-B*07:107, HLA-B*07:108, HLA-B*07:109, HLA-B*07:11, HLA-B*07:110, HLA-B*07:111, HLA-B*07:112, HLA-B*07:113, HLA-B*07:114, HLA-B*07:115, HLA-B*07:116, HLA-B*07:117, HLA-B*07:118, HLA-B*07:119, HLA-B*07:12, HLA-B*07:120, HLA-B*07:121, HLA-B*07:122, HLA-B*07:123, HLA-B*07:124, HLA-B*07:125, HLA-B*07:126, HLA-B*07:127, HLA-B*07:128, HLA-B*07:129, HLA-B*07:13, HLA-B*07:130, HLA-B*07:131, HLA-B*07:132, HLA-B*07:133, HLA-B*07:134, HLA-B*07:135, HLA-B*07:136:01, HLA-B*07:136:02, HLA-B*07:137, HLA-B*07:138, HLA-B*07:139:01,HLA-B*07:139:02, HLA-B*07:14, HLA-B*07:140, HLA-B*07:141, HLA-B*07:142, HLA-B*07:143, HLA-B*07:144, HLA-B*07:145, HLA-B*07:146, HLA-B*07:147, HLA-B*07:148, HLA-B*07:149, HLA-B*07:15, HLA-B*07:150, HLA-B*07:151:01, HLA-B*07:151:02, HLA-B*07:152, HLA-B*07:153, HLA-B*07:154, HLA-B*07:155, HLA-B*07:156, HLA-B*07:157, HLA-B*07:158, HLA-B*07:159, HLA-B*07:16, HLA-B*07:160, HLA-B*07:161, HLA-B*07:162, HLA-B*07:163, HLA-B*07:164, HLA-B*07:165, HLA-B*07:166, HLA-B*07:167, HLA-B*07:168, HLA-B*07:169, HLA-B*07:17, HLA-B*07:170, HLA-B*07:171, HLA-B*07:172, HLA-B*07:173, HLA-B*07:174, HLA-B*07:175, HLA-B*07:176, HLA-B*07:177, HLA-B*07:178, HLA-B*07:179, HLA-B*07:180, HLA-B*07:181, HLA-B*07:182, HLA-B*07:183, HLA-B*07:184, HLA-B*07:185, HLA-B*07:186, HLA-B*07:187, HLA-B*07:188, HLA-B*07:189, HLA-B*07:18:01, HLA-B*07:18:02, HLA-B*07:19, HLA-B*07:190, HLA-B*07:191, HLA-B*07:192, HLA-B*07:193, HLA-B*07:194, HLA-B*07:195, HLA-B*07:196, HLA-B*07:197, HLA-B*07:198, HLA-B*07:199, HLA-B*07:20, HLA-B*07:200, HLA-B*07:201, HLA-B*07:202, HLA-B*07:203, HLA-B*07:204, HLA-B*07:205,HLA-B*07:206, HLA-B*07:207, HLA-B*07:208, HLA-B*07:209, HLA-B*07:21, HLA-B*07:210, HLA-B*07:211, HLA-B*07:212, HLA-B*07:213, HLA-B*07:214, HLA-B*07:215, HLA-B*07:216, HLA-B*07:217, HLA-B*07:218, HLA-B*07:219, HLA-B*07:220, HLA-B*07:221, HLA-B*07:222, HLA-B*07:223, HLA-B*07:224, HLA-B*07:225, HLA-B*07:226, HLA-B*07:227, HLA-B*07:228:01, HLA-B*07:228:02, HLA-B*07:229, HLA-B*07:22:01, HLA-B*07:22:02, HLA-B*07:23, HLA-B*07:230, HLA-B*07:231, HLA-B*07:232, HLA-B*07:233, HLA-B*07:234, HLA-B*07:235, HLA-B*07:236, HLA-B*07:237, HLA-B*07:238, HLA-B*07:239, HLA-B*07:24, HLA-B*07:240, HLA-B*07:241, HLA-B*07:242, HLA-B*07:243, HLA-B*07:244, HLA-B*07:245, HLA-B*07:246, HLA-B*07:247, HLA-B*07:248, HLA-B*07:249, HLA-B*07:25, HLA-B*07:250, HLA-B*07:251, HLA-B*07:252, HLA-B*07:253, HLA-B*07:254, HLA-B*07:255, HLA-B*07:256, HLA-B*07:257, HLA-B*07:258, HLA-B*07:259, HLA-B*07:26, HLA-B*07:260, HLA-B*07:261, HLA-B*07:262, HLA-B*07:263, HLA-B*07:264, HLA-B*07:265, HLA-B*07:266, HLA-B*07:267, HLA-B*07:268, HLA-B*07:269, HLA-B*07:27, HLA-B*07:270, HLA-B*07:271, HLA-B*07:272,HLA-B*07:273, HLA-B*07:274, HLA-B*07:275, HLA-B*07:276:01, HLA-B*07:276:02, HLA-B*07:277, HLA-B*07:278, HLA-B*07:279, HLA-B*07:28, HLA-B*07:280, HLA-B*07:281, HLA-B*07:282, HLA-B*07:283, HLA-B*07:284, HLA-B*07:285, HLA-B*07:286, HLA-B*07:287, HLA-B*07:288, HLA-B*07:289, HLA-B*07:29, HLA-B*07:290, HLA-B*07:291, HLA-B*07:292, HLA-B*07:293, HLA-B*07:294, HLA-B*07:295, HLA-B*07:296, HLA-B*07:297, HLA-B*07:298, HLA-B*07:299, HLA-B*07:30, HLA-B*07:300, HLA-B*07:301, HLA-B*07:302, HLA-B*07:303:01, HLA-B*07:303:02, HLA-B*07:304, HLA-B*07:305, HLA-B*07:306, HLA-B*07:307, HLA-B*07:308, HLA-B*07:309, HLA-B*07:31, HLA-B*07:310, HLA-B*07:311, HLA-B*07:312, HLA-B*07:313, HLA-B*07:314, HLA-B*07:315, HLA-B*07:316, HLA-B*07:317, HLA-B*07:318, HLA-B*07:319, HLA-B*07:32, HLA-B*07:320, HLA-B*07:321, HLA-B*07:322, HLA-B*07:323, HLA-B*07:324, HLA-B*07:325, HLA-B*07:326, HLA-B*07:327, HLA-B*07:328, HLA-B*07:329, HLA-B*07:330, HLA-B*07:331, HLA-B*07:332, HLA-B*07:333, HLA-B*07:334, HLA-B*07:335, HLA-B*07:336, HLA-B*07:337, HLA-B*07:338, HLA-B*07:339, HLA-B*07:33:01, HLA-B*07:33:02,HLA-B*07:33:03, HLA-B*07:34, HLA-B*07:340, HLA-B*07:341, HLA-B*07:342, HLA-B*07:343, HLA-B*07:344, HLA-B*07:345, HLA-B*07:346, HLA-B*07:347, HLA-B*07:348, HLA-B*07:349, HLA-B*07:35, HLA-B*07:350, HLA-B*07:351, HLA-B*07:352, HLA-B*07:353, HLA-B*07:354, HLA-B*07:355, HLA-B*07:356, HLA-B*07:357, HLA-B*07:358, HLA-B*07:36, HLA-B*07:37:01, HLA-B*07:37:02, HLA-B*07:38, HLA-B*07:39, HLA-B*07:40, HLA-B*07:41, HLA-B*07:42, HLA-B*07:43, HLA-B*07:44, HLA-B*07:45, HLA-B*07:46, HLA-B*07:47, HLA-B*07:48, HLA-B*07:49, HLA-B*07:50, HLA-B*07:51, HLA-B*07:52, HLA-B*07:53, HLA-B*07:54, HLA-B*07:55, HLA-B*07:56:01, HLA-B*07:56:02, HLA-B*07:57, HLA-B*07:58, HLA-B*07:59, HLA-B*07:60, HLA-B*07:61, HLA-B*07:62, HLA-B*07:63, HLA-B*07:64, HLA-B*07:65, HLA-B*07:66, HLA-B*07:67, HLA-B*07:68:01, HLA-B*07:68:02, HLA-B*07:68:03, HLA-B*07:69, HLA-B*07:70, HLA-B*07:71, HLA-B*07:72, HLA-B*07:73, HLA-B*07:74, HLA-B*07:75:01:01, HLA-B*07:75:01:02, HLA-B*07:76, HLA-B*07:77, HLA-B*07:78, HLA-B*07:79, HLA-B*07:80, HLA-B*07:81, HLA-B*07:82, HLA-B*07:83, HLA-B*07:84, HLA-B*07:85:01, HLA-B*07:85:02,HLA-B*07:86, HLA-B*07:87, HLA-B*07:88, HLA-B*07:89, HLA-B*07:90, HLA-B*07:91, HLA-B*07:92, HLA-B*07:93, HLA-B*07:94, HLA-B*07:95, HLA-B*07:96:01, HLA-B*07:96:02, HLA-B*07:97, HLA-B*07:98, and HLA-B*07:99.
[0136] II.A.3 Second Nucleotide Sequence
[0137] The second nucleotide sequence of the nucleic acid molecule disclosed herein can be any sequence that is capable of inhibiting the expression of an endogenous TCR or can encode any polypeptide that is capable of inhibiting the expression of an endogenous TCR. In some embodiments, the second nucleotide sequence is one or more siRNAs. In some embodiments, the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of an endogenous TCR. In certain embodiments, the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of a wild-type human TCR. In some embodiments, the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of an alpha chain of a wild-type TCR. In some embodiments, the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of a beta chain of a wild-type TCR. In some embodiments, the one or more siRNAs comprise (i) one or more siRNAs that are complementary to a target sequence within a nucleotide sequence encoding a constant region of an alpha chain of a wild-type TCR and (ii) one or more siRNAs that are complementary to a target sequence within a nucleotide sequence encoding a constant region of a beta chain of a wild-type TCR.
[0138] In some embodiments, the one or more siRNAs comprise a nucleotide sequence selected from the group consisting of SEQ ID NOs: 53-56 (Table 4). In some embodiments, the second nucleotide sequence of the nucleic acid molecule encodes one or more siRNAs, wherein the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of an alpha chain of a wild-type TCR, and wherein the one or more siRNAs comprise the nucleic acid sequences listed in SEQ ID NOs: 53 and 54.
[0139] Table 4. siRNA Sequences
[0140]
[0141] In some embodiments, the second nucleotide sequence of the nucleic acid molecule encodes one or more siRNAs, wherein the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of a beta chain of a wild-type TCR, and wherein the one or more siRNAs comprise the nucleic acid sequences set forth in SEQ ID NOs: 55 and 56. In some embodiments, the second nucleotide sequence of the nucleic acid molecule encodes one or more siRNAs, wherein the one or more siRNAs comprise (i) one or more siRNAs complementary to a target sequence within a nucleotide sequence encoding a constant region of an alpha chain of a wild-type TCR, wherein the one or more siRNAs comprise the nucleic acid sequences set forth in SEQ ID NOs: 53 and 54; and (ii) one or more siRNAs complementary to a target sequence within a nucleotide sequence encoding a constant region of a beta chain of a wild-type TCR, wherein the one or more siRNAs comprise the nucleic acid sequences set forth in SEQ ID NOs: 55 and 56.
[0142] In some embodiments, the second nucleotide sequence of the nucleic acid molecule comprises SEQ ID NOs: 53-56. In some embodiments, the second nucleotide sequence comprises SEQ ID NOs: 53-56, wherein one or more of SEQ ID NOs: 53-56 is separated by one or more nucleic acids that do not encode an siRNA. In certain embodiments, the one or more siRNAs are selected from the siRNAs disclosed in U.S. Pub. No. 2010 / 0273213 Al, which is incorporated by reference herein in its entirety.
[0143] In some embodiments, the second nucleotide sequence of the nucleic acid molecule encodes a protein, wherein the protein is capable of inhibiting expression of an endogenous (e.g., wild-type) TCR. In some embodiments, the second nucleotide sequence encodes Cas9.
[0144] II.A.3 Vectors
[0145] Certain aspects of the application relate to vectors comprising the nucleic acid molecules disclosed herein. In some embodiments, the vector is a viral vector. In some embodiments, the vector is a virion or virus. In some embodiments, the vector is a mammalian vector. In some embodiments, the vector is a bacterial vector.
[0146] In certain embodiments, the vector is a retroviral vector. In some embodiments, the vector is selected from the group consisting of an adenoviral vector, a lentivirus, a Sendai virus, a baculoviral vector, an Epstein Barr virus vector, a papovaviral vector, a vaccinia virus vector, a herpes simplex virus vector, and an adeno-associated virus (AAV) vector. In particular embodiments, the vector is an AAV vector. In some embodiments, the vector is a lentivirus. In particular embodiments, the vector is an AAV vector. In some embodiments, the vector is a Sendai virus. In some embodiments, the vector is a hybrid vector. Examples of hybrid vectors that can be used in the present application can be found in Huang and Kamihira, Biotechnol. Adv. 31(2):208-23 (2103), which is incorporated by reference herein in its entirety.
[0147] II.B. Recombinant T Cell Receptors (TCRs)
[0148] Certain aspects of the present application relate to recombinant T cell receptors (TCRs) or antigen binding portions thereof that specifically bind to human NY-ESO-1 ("anti-NY-ESO-1 TCRs"). In some embodiments, the anti-NY-ESO-1 TCR is encoded by a nucleic acid molecule disclosed herein.
[0149] In some embodiments, the anti-NY-ESO-1 TCR cross-competes for binding to human NY-ESO-1 with a reference TCR. In some embodiments, the anti-NY-ESO-1 TCR binds to the same epitope or an overlapping epitope of human NY-ESO-1 as a reference TCR. In some embodiments, the reference TCR comprises an alpha chain and a beta chain, and the alpha chain of the reference TCR comprises an amino acid sequence as set forth in SEQ ID NO: 1. In some embodiments, the beta chain of the reference TCR comprises an amino acid sequence as set forth in SEQ ID NO: 2.
[0150] In some embodiments, the anti-NY-ESO-1 TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a constant region, and wherein the beta chain comprises a constant region; wherein the alpha chain constant region comprises an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the constant region of an alpha chain comprising the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the anti-NY-ESO-1 TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a constant region, and wherein the beta chain comprises a constant region; wherein the beta chain constant region comprises an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the constant region of a beta chain comprising the amino acid sequence set forth in SEQ ID NO: 2.
[0151] In some embodiments, an anti-NY-ESO-l TCR comprises an alpha chain and a beta chain, wherein the alpha chain comprises a constant region, and wherein the beta chain comprises a constant region; wherein (i) the alpha chain constant region comprises an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the constant region of an alpha chain comprising the amino acid sequence set forth in SEQ ID NO: 1; and (ii) the beta chain constant region comprises an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the constant region of a beta chain comprising the amino acid sequence set forth in SEQ ID NO: 2.
[0152] In some embodiments, an alpha chain of an anti-NY-ESO-l TCR comprises a variable domain comprising an alpha chain CDR1, an alpha chain CDR2, and an alpha chain CDR3; and a beta chain of an anti-NY-ESO-l TCR comprises a variable domain comprising a beta chain CDR1, a beta chain CDR2, and a beta chain CDR3. In some embodiments, an anti-NY-ESO-l TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7. In some embodiments, an anti-NY-ESO-l TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10.
[0153] In some embodiments, an alpha chain CDR1 of an anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 5. In some embodiments, a beta chain CDR1 of an anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 8.
[0154] In some embodiments, an alpha chain CDR2 of an anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 6. In some embodiments, a beta chain CDR2 of an anti-NY-ESO-l TCR comprises an amino acid sequence as set forth in SEQ ID NO: 9.
[0155] In some embodiments, the anti-NY-ESO-l TCR comprises an alpha chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the variable domain of the alpha chain amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the anti-NY-ESO-l TCR comprises an alpha chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the variable domain of the alpha chain amino acid sequence set forth in SEQ ID NO: 1, wherein the anti-NY-ESO-l TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7. In some embodiments, the anti-NY-ESO-l TCR comprises an alpha chain variable domain present in the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
[0156] In some embodiments, the anti-NY-ESO-l TCR comprises a beta chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the variable domain of the beta chain amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the anti-NY-ESO-l TCR comprises a beta chain variable domain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the variable domain of the beta chain amino acid sequence set forth in SEQ ID NO: 2, wherein the anti-NY-ESO-l TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10. In some embodiments, the anti-NY-ESO-l TCR comprises a beta chain variable domain present in the beta chain amino acid sequence set forth in SEQ ID NO: 2.
[0157] In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide further comprises an alpha chain constant region, a beta chain constant region, or both an alpha chain constant region and a beta chain constant region. In some embodiments, the anti-NY-ESO-l TCR comprises an alpha chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the constant region of the alpha chain amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the anti-NY-ESO-l TCR comprises an alpha chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the constant region of the alpha chain amino acid sequence set forth in SEQ ID NO: 1, wherein the anti-NY-ESO-l TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7. In some embodiments, the anti-NY-ESO-l TCR comprises an alpha chain constant region present in the alpha chain amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide further comprises an alpha constant region that is different from an endogenous (e.g., naturally occurring) constant region of an alpha chain. In some embodiments, the alpha chain constant region comprises an amino acid sequence comprising at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the amino acid sequence of the constant region of the alpha chain amino acid sequence set forth in SEQ ID NO: 1.
[0158] In some embodiments, the anti-NY-ESO-l TCR comprises a beta chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the constant region of the beta chain amino acid sequence set forth in SEQ ID NO:2. In some embodiments, the anti-NY-ESO-l TCR comprises a beta chain constant region having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity to the constant region of the beta chain amino acid sequence set forth in SEQ ID NO:2, wherein the anti-NY-ESO-l TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10. In some embodiments, the anti-NY-ESO-l TCR comprises a beta chain constant region present in the beta chain amino acid sequence set forth in SEQ ID NO:2. In some embodiments, the anti-NY-ESO-l TCR encoded by the first nucleotide further comprises a beta constant region that is different from an endogenous (e.g., naturally occurring) constant region of the beta chain. In some embodiments, the beta chain constant region comprises an amino acid sequence comprising at least 1, at least 2, at least 3, at least 4, or at least 5 amino acid substitutions relative to the amino acid sequence of the constant region of the beta chain amino acid sequence set forth in SEQ ID NO:2.
[0159] In certain embodiments, the anti-NY-ESO-l TCR comprises an alpha chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the alpha chain amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the anti-NY-ESO-l TCR comprises an alpha chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the alpha chain amino acid sequence set forth in SEQ ID NO: 1, wherein the anti-NY-ESO-l TCR comprises an alpha chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 7. In some embodiments, the anti-NY-ESO-l TCR comprises an alpha chain comprising the amino acid sequence set forth in SEQ ID NO: 1.
[0160] In certain embodiments, the anti-NY-ESO-l TCR comprises a beta chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the beta chain amino acid sequence set forth in SEQ ID NO: 2. In some embodiments, the anti-NY-ESO-l TCR comprises a beta chain having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the beta chain amino acid sequence set forth in SEQ ID NO: 2, wherein the anti-NY-ESO-l TCR comprises a beta chain CDR3 comprising an amino acid sequence as set forth in SEQ ID NO: 10. In some embodiments, the anti-NY-ESO-l TCR comprises a beta chain comprising an amino acid sequence as set forth in SEQ ID NO: 2.
[0161] In some embodiments, the anti-NY-ESO-l TCR comprises an alpha chain constant region, a beta chain constant region, or both; and wherein the alpha chain constant region, the beta chain constant region, or both comprise an amino acid sequence having at least 1, at least 2, at least 3, at least 4, or at least 5 substitutions within a target sequence relative to the corresponding amino acid sequence of an endogenous TCR.
[0162] II.B.2. Epitope
[0163] In some embodiments, the anti-NY-ESO-l TCR binds to the same epitope as the reference TCR. In some embodiments, the anti-NY-ESO-l TCR binds to an epitope of NY-ESO-l comprising the amino acid sequence set forth in SEQ ID NO: 13. In some embodiments, the anti-NY-ESO-l TCR binds to an epitope of NY-ESO-l consisting of the amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, the epitope consists of amino acid residues 60-72 of NY-ESO-l (SEQ ID NO: 52), e.g.,“NY-ESO-l 60-72 ”.
[0164] In certain embodiments, the epitope is complexed with an HLA class I molecule. In some embodiments, the HLA class 1 molecule is selected from the group consisting of HLA-A, HLA-B, and HLA-C alleles. In some embodiments, the HLA class 1 molecule is selected from the group consisting of HLA-E, HLA-F, and HLA-G alleles. In certain embodiments, the HLA class 1 molecule is an HLA-A allele. In certain embodiments, the HLA class 1 molecule is an HLA-B allele. In certain embodiments, the HLA class 1 molecule is an HLA-C allele.
[0165] Many HLA-A, HLA-B, and HLA-C alleles are known in the art, and any of the known alleles can be used in the present application. An updated list of HLA alleles is available at hla.alleles.org / (last accessed February 27, 2019). In some embodiments, the HLA class 1 molecule is an HLA-B allele selected from the group consisting of HLA-B*07, HLA-B*08, HLA-B*13, HLA-B*14, HLA-B*15, HLA-B*18, HLA-B*27, HLA-B*35, HLA-B*37, HLA-B*38, HLA-B*39, HLA-B*40, HLA-B*41, HLA-B*42, HLA-B*44, HLA-B*45, HLA-B*46, HLA-B*47, HLA-B*48, HLA-B*49, HLA-B*50, HLA-B*51, HLA-B*52, HLA-B*53, HLA-B*54, HLA-B*55, HLA-B*56, HLA-B*57, HLA-B*58, HLA-B*59, HLA-B*67, HLA-B*73, HLA-B*78, HLA-B*79, HLA-B*81, HLA-B*82, and HLA-B*83. In certain embodiments, the HLA-B allele is an HLA-B*07:02 allele. In certain embodiments, the HLA-B allele is an HLA-B*07:03 allele. In certain embodiments, the HLA-B allele is an HLA-B*07:04 allele. In certain embodiments, the HLA-B allele is an HLA-B*07:05 allele. In certain embodiments, the HLA-B allele is an HLA-B*07:06 allele.
[0166] In certain embodiments, the HLA Class 1 molecule is an HLA-B allele selected from the group consisting of HLA-B*07:02:01:01, HLA-B*07:02:01:02, HLA-B*07:02:01:03, HLA-B*07:02:01:04, HLA-B*07:02:01:05, HLA-B*07:02:01:06, HLA-B*07:02:01:07, HLA-B*07:02:01:08, HLA-B*07:02:01:09, HLA-B*07:02:01:10, HLA-B*07:02:01:11, HLA-B*07:02:01:12, HLA-B*07:02:01:13, HLA-B*07:02:01:14, HLA-B*07:02:02, HLA-B*07:02:03, HLA-B*07:02:04, HLA-B*07:02:05, HLA-B*07:02:06, HLA-B*07:02:07, HLA-B*07:02:08, HLA-B*07:02:09, HLA-B*07:02:10, HLA-B*07:02:11, HLA-B*07:02:12, HLA-B*07:02:13, HLA-B*07:02:14, HLA-B*07:02:15, HLA-B*07:02:16, HLA-B*07:02:17, HLA-B*07:02:18, HLA-B*07:02:19, HLA-B*07:02:20, HLA-B*07:02:21, HLA-B*07:02:22, HLA-B*07:02:23, HLA-B*07:02:24, HLA-B*07:02:25, HLA-B*07:02:26, HLA-B*07:02:27, HLA-B*07:02:28, HLA-B*07:02:29, HLA-B*07:02:30, HLA-B*07:02:31, HLA-B*07:02:32, HLA-B*07:02:33, HLA-B*07:02:34, HLA-B*07:02:35, HLA-B*07:02:36, HLA-B*07:02:37, HLA-B*07:02:38, HLA-B*07:02:39, HLA-B*07:02:40, HLA-B*07:02:41, HLA-B*07:02:42, HLA-B*07:02:43, HLA-B*07:02:44, HLA-B*07:02:45, HLA-B*07:02:46, HLA-B*07:02:47, HLA-B*07:02:48,HLA-B*07:02:49, HLA-B*07:02:50, HLA-B*07:02:51, HLA-B*07:02:52, HLA-B*07:02:53, HLA-B*07:02:54, HLA-B*07:02:55, HLA-B*07:02:56, HLA-B*07:02:57, HLA-B*07:02:58, HLA-B*07:02:59, HLA-B*07:02:60, HLA-B*07:02:61, HLA-B*07:02:62, HLA-B*07:02:63, HLA-B*07:02:64, HLA-B*07:02:65, HLA-B*07:02:66, HLA-B*07:02:67, HLA-B*07:02:68, HLA-B*07:02:69, HLA-B*07:02:70, HLA-B*07:02:71, HLA-B*07:02:72, HLA-B*07:02:73, HLA-B*07:03, HLA-B*07:04:01, HLA-B*07:04:02, HLA-B*07:05:01:01, HLA-B*07:05:01:02, HLA-B*07:05:01:03, HLA-B*07:05:01:04, HLA-B*07:05:02, HLA-B*07:05:03, HLA-B*07:05:04, HLA-B*07:05:05, HLA-B*07:05:06, HLA-B*07:05:07, HLA-B*07:05:08, HLA-B*07:05:09, HLA-B*07:06:01, HLA-B*07:06:02, HLA-B*07:06:03, HLA-B*07:07:01, HLA-B*07:07:02, HLA-B*07:08:01, HLA-B*07:08:02, HLA-B*07:09:01, HLA-B*07:09:02, HLA-B*07:10, HLA-B*07:100, HLA-B*07:101, HLA-B*07:102, HLA-B*07:103, HLA-B*07:104, HLA-B*07:105, HLA-B*07:106, HLA-B*07:107, HLA-B*07:108, HLA-B*07:109, HLA-B*07:11, HLA-B*07:110, HLA-B*07:111, HLA-B*07:112, HLA-B*07:113, HLA-B*07:114, HLA-B*07:115, HLA-B*07:116,HLA-B*07:117, HLA-B*07:118, HLA-B*07:119, HLA-B*07:12, HLA-B*07:120, HLA-B*07:121, HLA-B*07:122, HLA-B*07:123, HLA-B*07:124, HLA-B*07:125, HLA-B*07:126, HLA-B*07:127, HLA-B*07:128, HLA-B*07:129, HLA-B*07:13, HLA-B*07:130, HLA-B*07:131, HLA-B*07:132, HLA-B*07:133, HLA-B*07:134, HLA-B*07:135, HLA-B*07:136:01, HLA-B*07:136:02, HLA-B*07:137, HLA-B*07:138, HLA-B*07:139:01, HLA-B*07:139:02, HLA-B*07:14, HLA-B*07:140, HLA-B*07:141, HLA-B*07:142, HLA-B*07:143, HLA-B*07:144, HLA-B*07:145, HLA-B*07:146, HLA-B*07:147, HLA-B*07:148, HLA-B*07:149, HLA-B*07:15, HLA-B*07:150, HLA-B*07:151:01, HLA-B*07:151:02, HLA-B*07:152, HLA-B*07:153, HLA-B*07:154, HLA-B*07:155, HLA-B*07:156, HLA-B*07:157, HLA-B*07:158, HLA-B*07:159, HLA-B*07:16, HLA-B*07:160, HLA-B*07:161, HLA-B*07:162, HLA-B*07:163, HLA-B*07:164, HLA-B*07:165, HLA-B*07:166, HLA-B*07:167, HLA-B*07:168, HLA-B*07:169, HLA-B*07:17, HLA-B*07:170, HLA-B*07:171, HLA-B*07:172, HLA-B*07:173, HLA-B*07:174, HLA-B*07:175, HLA-B*07:176, HLA-B*07:177, HLA-B*07:178, HLA-B*07:179, HLA-B*07:180, HLA-B*07:181, HLA-B*07:182, HLA-B*07:183,HLA-B*07:184, HLA-B*07:185, HLA-B*07:186, HLA-B*07:187, HLA-B*07:188, HLA-B*07:189, HLA-B*07:18:01, HLA-B*07:18:02, HLA-B*07:19, HLA-B*07:190, HLA-B*07:191, HLA-B*07:192, HLA-B*07:193, HLA-B*07:194, HLA-B*07:195, HLA-B*07:196, HLA-B*07:197, HLA-B*07:198, HLA-B*07:199, HLA-B*07:20, HLA-B*07:200, HLA-B*07:201, HLA-B*07:202, HLA-B*07:203, HLA-B*07:204, HLA-B*07:205, HLA-B*07:206, HLA-B*07:207, HLA-B*07:208, HLA-B*07:209, HLA-B*07:21, HLA-B*07:210, HLA-B*07:211, HLA-B*07:212, HLA-B*07:213, HLA-B*07:214, HLA-B*07:215, HLA-B*07:216, HLA-B*07:217, HLA-B*07:218, HLA-B*07:219, HLA-B*07:220, HLA-B*07:221, HLA-B*07:222, HLA-B*07:223, HLA-B*07:224, HLA-B*07:225, HLA-B*07:226, HLA-B*07:227, HLA-B*07:228:01, HLA-B*07:228:02, HLA-B*07:229, HLA-B*07:22:01, HLA-B*07:22:02, HLA-B*07:23, HLA-B*07:230, HLA-B*07:231, HLA-B*07:232, HLA-B*07:233, HLA-B*07:234, HLA-B*07:235, HLA-B*07:236, HLA-B*07:237, HLA-B*07:238, HLA-B*07:239, HLA-B*07:24, HLA-B*07:240, HLA-B*07:241, HLA-B*07:242, HLA-B*07:243, HLA-B*07:244, HLA-B*07:245, HLA-B*07:246, HLA-B*07:247, HLA-B*07:248, HLA-B*07:249,HLA-B*07:25, HLA-B*07:250, HLA-B*07:251, HLA-B*07:252, HLA-B*07:253, HLA-B*07:254, HLA-B*07:255, HLA-B*07:256, HLA-B*07:257, HLA-B*07:258, HLA-B*07:259, HLA-B*07:26, HLA-B*07:260, HLA-B*07:261, HLA-B*07:262, HLA-B*07:263, HLA-B*07:264, HLA-B*07:265, HLA-B*07:266, HLA-B*07:267, HLA-B*07:268, HLA-B*07:269, HLA-B*07:27, HLA-B*07:270, HLA-B*07:271, HLA-B*07:272, HLA-B*07:273, HLA-B*07:274, HLA-B*07:275, HLA-B*07:276:01, HLA-B*07:276:02, HLA-B*07:277, HLA-B*07:278, HLA-B*07:279, HLA-B*07:28, HLA-B*07:280, HLA-B*07:281, HLA-B*07:282, HLA-B*07:283, HLA-B*07:284, HLA-B*07:285, HLA-B*07:286, HLA-B*07:287, HLA-B*07:288, HLA-B*07:289, HLA-B*07:29, HLA-B*07:290, HLA-B*07:291, HLA-B*07:292, HLA-B*07:293, HLA-B*07:294, HLA-B*07:295, HLA-B*07:296, HLA-B*07:297, HLA-B*07:298, HLA-B*07:299, HLA-B*07:30, HLA-B*07:300, HLA-B*07:301, HLA-B*07:302, HLA-B*07:303:01, HLA-B*07:303:02, HLA-B*07:304, HLA-B*07:305, HLA-B*07:306, HLA-B*07:307, HLA-B*07:308, HLA-B*07:309, HLA-B*07:31, HLA-B*07:310, HLA-B*07:311, HLA-B*07:312, HLA-B*07:313, HLA-B*07:314, HLA-B*07:315, HLA-B*07:316,HLA-B*07:317, HLA-B*07:318, HLA-B*07:319, HLA-B*07:32, HLA-B*07:320, HLA-B*07:321, HLA-B*07:322, HLA-B*07:323, HLA-B*07:324, HLA-B*07:325, HLA-B*07:326, HLA-B*07:327, HLA-B*07:328, HLA-B*07:329, HLA-B*07:330, HLA-B*07:331, HLA-B*07:332, HLA-B*07:333, HLA-B*07:334, HLA-B*07:335, HLA-B*07:336, HLA-B*07:337, HLA-B*07:338, HLA-B*07:339, HLA-B*07:33:01, HLA-B*07:33:02, HLA-B*07:33:03, HLA-B*07:34, HLA-B*07:340, HLA-B*07:341, HLA-B*07:342, HLA-B*07:343, HLA-B*07:344, HLA-B*07:345, HLA-B*07:346, HLA-B*07:347, HLA-B*07:348, HLA-B*07:349, HLA-B*07:35, HLA-B*07:350, HLA-B*07:351, HLA-B*07:352, HLA-B*07:353, HLA-B*07:354, HLA-B*07:355, HLA-B*07:356, HLA-B*07:357, HLA-B*07:358, HLA-B*07:36, HLA-B*07:37:01, HLA-B*07:37:02, HLA-B*07:38, HLA-B*07:39, HLA-B*07:40, HLA-B*07:41, HLA-B*07:42, HLA-B*07:43, HLA-B*07:44, HLA-B*07:45, HLA-B*07:46, HLA-B*07:47, HLA-B*07:48, HLA-B*07:49, HLA-B*07:50, HLA-B*07:51, HLA-B*07:52, HLA-B*07:53, HLA-B*07:54, HLA-B*07:55, HLA-B*07:56:01, HLA-B*07:56:02, HLA-B*07:57, HLA-B*07:58, HLA-B*07:59, HLA-B*07:60, HLA-B*07:61, HLA-B*07:62, HLA-B*07:63,HL A-B* 07 : 64, HLA-B*07:65, HLA-B*07:66, HLA-B*07:67, HLA-B*07:68:01, HLA-B*07:68:02, HLA-B*07:68:03, HLA-B*07:69, HLA-B*07:70, HLA-B*07:71, HLA-B*07:72, HLA-B*07:73, HLA-B*07:74, HLA-B*07:75:01:01, HLA-B*07:75:01:02, HLA-B*07:76, HLA-B*07:77, HLA-B*07:78, HLA-B*07:79, HLA-B*07:80, HLA-B*07:81, HLA-B*07:82, HLA-B*07:83, HLA-B*07:84, HLA-B*07:85:01, HLA-B*07:85:02, HLA-B*07:86, HLA-B*07:87, HLA-B*07:88, HLA-B*07:89, HLA-B*07:90, HLA-B*07:91, HLA-B*07:92, HLA-B*07:93, HLA-B*07:94, HLA-B*07:95, HLA-B*07:96:01, HLA-B*07:96:02, HLA-B*07:97, HLA-B*07:98, and HLA-B*07:99.
[0167] II.B.3. Bispecific T cell receptors (TCRs)
[0168] Certain aspects of the present disclosure relate to a bispecific TCR comprising a first antigen binding domain and a second antigen binding domain, wherein the first antigen binding domain comprises a TCR or antigen binding portion thereof disclosed herein. In some embodiments, the first antigen binding domain comprises a single chain variable fragment (“scFv”).
[0169] In some embodiments, the second antigen binding domain specifically binds to a protein expressed on the surface of a T cell. Any protein expressed on the surface of a T cell can be targeted by the bispecific antibodies disclosed herein. In certain embodiments, the protein expressed on the surface of a T cell is not expressed by other cells. In some embodiments, the protein expressed on the surface of a T cell is expressed on the surface of one or more other human immune cells. In some embodiments, the protein expressed on the surface of a T cell is expressed on the surface of one or more other human immune cells, but it is not expressed on the surface of a human non-immune cell. In some embodiments, the second antigen binding domain specifically binds to a protein expressed on the surface of a T cell selected from the group consisting of CD3, CD2, CD5, CD6, CD8, CD11a (LFA-1 alpha), CD43, CD45, and CD53. In certain embodiments, the second antigen binding domain specifically binds to CD3. In some embodiments, the second antigen binding domain comprises a scFv.
[0170] In some embodiments, the first antigen binding domain and the second antigen binding domain are linked or associated by a covalent bond. In some embodiments, the first antigen binding domain and the second antigen binding domain are linked by a peptide bond.
[0171] II.C. TCR-expressing cells
[0172] Certain aspects of the present disclosure relate to a cell comprising a nucleic acid molecule disclosed herein, a vector disclosed herein, a recombinant TCR disclosed herein, a bispecific TCR disclosed herein, or any combination thereof. Any cell can be used in the present disclosure.
[0173] In certain embodiments, the cell expresses CD3. The CD3 expression can be naturally occurring, e.g., the CD3 is expressed from a nucleic acid sequence endogenously expressed by the cell. For example, T cells and natural killer (NK) cells naturally express CD3. Thus, in some embodiments, the cell is a T cell or a natural killer cell. In certain embodiments, the cell is a T cell selected from the group consisting of natural killer T (NKT) cells and innate lymphoid cells (ILCs).
[0174] In some embodiments, the T cell is isolated from a human subject. In some embodiments, the human subject is the same subject who will ultimately receive the T cell therapy. In other embodiments, the subject is a donor subject, wherein the donor subject is not the same subject who will receive the T cell therapy.
[0175] In some embodiments, the cell is a cell that does not naturally express CD3, wherein the cell has been modified to express CD3. In some embodiments, the cell comprises a transgene encoding CD3, wherein the transgene is expressed by the cell. In some embodiments, the cell comprises a transgene encoding a protein that activates endogenous CD3 expression by the cell. In some embodiments, the cell comprises a transgene encoding a protein or siRNA that inhibits CD3 expression in the cell. In some embodiments, the transgene is incorporated into the genome of the cell. In some embodiments, the transgene is not incorporated into the genome of the cell.
[0176] In some embodiments, the cell modified to express CD3 is isolated from a human subject. In some embodiments, the human subject is the same subject who will ultimately receive the cell therapy. In other embodiments, the human subject is a donor subject, wherein the donor subject is not the same subject who will receive the cell therapy.
[0177] II.D. HLA Class I Molecules
[0178] Certain aspects of the present disclosure relate to an HLA Class I molecule complexed with a peptide, wherein the peptide comprises the amino acid sequence set forth in SEQ ID NO: 13. In some embodiments, the peptide consists of the amino acid sequence set forth in SEQ ID NO: 13.
[0179] In some embodiments, the HLA Class I molecule is HLA-A, HLA-B, or HLA-C. In some embodiments, the HLA Class I molecule is HLA-E, HLA-F, or HLA-G. In some embodiments, the HLA Class 1 molecule is an HLA-B allele selected from the group consisting of HLA-B*07, HLA-B*08, HLA-B*13, HLA-B*14, HLA-B*15, HLA-B*18, HLA-B*27, HLA-B*35, HLA-B*37, HLA-B*38, HLA-B*39, HLA-B*40, HLA-B*41, HLA-B*42, HLA-B*44, HLA-B*45, HLA-B*46, HLA-B*47, HLA-B*48, HLA-B*49, HLA-B*50, HLA-B*51, HLA-B*52, HLA-B*53, HLA-B*54, HLA-B*55, HLA-B*56, HLA-B*57, HLA-B*58, HLA-B*59, HLA-B*67, HLA-B*73, HLA-B*78, HLA-B*79, HLA-B*81, HLA-B*82, and HLA-B*83. In certain embodiments, the HLA-B allele is an HLA-B*07:02 allele. In certain embodiments, the HLA-B allele is an HLA-B*07:03 allele. In certain embodiments, the HLA-B allele is an HLA-B*07:04 allele. In certain embodiments, the HLA-B allele is an HLA-B*07:05 allele. In certain embodiments, the HLA-B allele is an HLA-B*07:06 allele. In some embodiments, the HLA allele is any HLA allele disclosed herein, e.g., supra.
[0180] In some embodiments, the HLA Class I molecule comprises an alpha chain and a beta2m. In some embodiments, the alpha chain comprises an alpha 1 domain, an alpha 2 domain, an alpha 3 domain. In some embodiments, the beta2m comprises an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 16. In some embodiments, the sequence of the alpha chain is selected from any one of the HLA protein sequences available at hla.alleles.org (last accessed February 27, 2019).
[0181] In some embodiments, the HLA Class I molecule is monomeric. In some embodiments, the HLA Class I molecule is dimeric. In some embodiments, the HLA Class I molecule is multimeric. In some embodiments, the HLA Class I molecule is trimeric. In some embodiments, the HLA Class I molecule is tetrameric. In some embodiments, the HLA Class I molecule is pentameric.
[0182] Certain aspects of the present disclosure relate to an antigen presenting cell (APC) comprising any of the HLA Class I molecules disclosed herein. In certain embodiments, the APC expresses an HLA Class I molecule on the surface of the APC. In certain embodiments, the APC comprises more than one HLA Class I molecule disclosed herein.
[0183] II. D. Vaccines
[0184] Certain aspects of the present disclosure relate to a cancer vaccine comprising a peptide comprising an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, the cancer vaccine comprises a peptide consisting of the amino acid sequence set forth in SEQ ID NO: 13. In some embodiments, the vaccine further comprises one or more excipients. In some embodiments, the vaccine further comprises one or more other peptides. In some embodiments, the one or more other peptides comprise one or more other epitopes.
[0185] III. Methods of the Disclosure
[0186] Certain aspects of the present disclosure relate to methods of treating cancer in a subject in need thereof. Other aspects of the present disclosure relate to methods of engineering cells that target an antigen. Other aspects of the present disclosure relate to methods of enriching a population of target T cells obtained from a human subject.
[0187] III. A. Methods of Treating Cancer
[0188] Certain aspects of the present disclosure relate to methods of treating cancer in a subject in need thereof, comprising administering to the subject a nucleic acid molecule disclosed herein, a recombinant TCR disclosed herein, a bispecific TCR disclosed herein, an epitope disclosed herein, or an HLA Class I molecule disclosed herein, or a vector or cell comprising any of the foregoing.
[0189] In some embodiments, the cancer is selected from melanoma, bone cancer, kidney cancer, prostate cancer, breast cancer, colon cancer, lung cancer, cutaneous or intraocular malignant melanoma, pancreatic cancer, skin cancer, cancer of the head or neck, uterine cancer, ovarian cancer, rectal cancer, cancer of the anal region, stomach cancer, testicular cancer, uterine cancer, carcinoma of the fallopian tubes, carcinoma of the endometrium, carcinoma of the cervix, carcinoma of the vagina, carcinoma of the vulva, Hodgkin's Disease, non-Hodgkin's lymphoma (NHL), primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), esophageal cancer, cancer of the small intestine, cancer of the endocrine system, cancer of the thyroid gland, cancer of the parathyroid gland, cancer of the adrenal gland, sarcoma of soft tissue, cancer of the urethra, cancer of the penis, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia, acute lymphoblastic leukemia (ALL) (including non T-cell ALL), chronic lymphocytic leukemia (CLL), solid tumors of childhood, lymphocytic lymphoma, cancer of the bladder, cancer of the kidney or ureter, carcinoma of the renal pelvis, neoplasm of the central nervous system (CNS), primary CNS lymphoma, tumor angiogenesis, spinal axis tumors, brain stem glioma, pituitary adenoma, Kaposi's sarcoma, epidermoid cancer, squamous cell cancer, T-cell lymphoma, environmentally induced cancers including those induced by asbestos, other B-cell malignancies, and combinations of said cancers. In some embodiments, the cancer is melanoma.
[0190] In some embodiments, the cancer is recurrent. In some embodiments, the cancer is refractory. In some embodiments, the cancer is advanced. In some embodiments, the cancer is metastatic.
[0191] In some embodiments, the methods disclosed herein treat a cancer in a subject. In some embodiments, the methods disclosed herein reduce the severity of one or more symptoms of a cancer. In some embodiments, the methods disclosed herein reduce the size or number of tumors derived from a cancer. In some embodiments, the methods disclosed herein increase overall survival of a subject relative to a subject not provided the methods disclosed herein. In some embodiments, the methods disclosed herein increase progression-free survival of a subject relative to a subject not provided the methods disclosed herein. In some embodiments, the methods disclosed herein induce a partial response in a subject. In some embodiments, the methods disclosed herein induce a complete response in a subject.
[0192] In some embodiments, the methods disclosed herein comprise treating a cancer in a subject in need thereof, comprising administering to the subject a cell described herein, wherein the cell comprises a nucleic acid molecule disclosed herein, a vector disclosed herein, a recombinant TCR disclosed herein, and / or a bispecific antibody disclosed herein. In some embodiments, the cell is a T cell. In some embodiments, the cell is a cell modified to express CD3.
[0193] In some embodiments, the cell (e.g., T cell) is obtained from a subject. In some embodiments, the cell (e.g., T cell) is obtained from a donor other than the subject.
[0194] In some embodiments, the subject is pre-treated prior to administration of the cell. The pre-treatment can comprise any substance that aids in T cell function and / or survival. In some embodiments, the pre-treatment comprises administering to the subject a chemotherapy, a cytokine, a protein, a small molecule, or any combination thereof. In some embodiments, the pre-treatment comprises administering an interleukin. In some embodiments, the pre-treatment comprises administering IL-2, IL-4, IL-7, IL-9, IL-15, IL-21, or any combination thereof. In some embodiments, the pre-treatment comprises administering cyclophosphamide, fludarabine, or both. In some embodiments, the pre-treatment comprises administering vitamin C, an AKT inhibitor, ATRA (vesanoid, retinoic acid), rapamycin, or any combination thereof.
[0195] III.B. Methods of engineering cells to target an antigen
[0196] Certain aspects of the disclosure relate to methods of engineering cells to target an antigen. In some embodiments, the antigen is a NY-ESO-1 antigen. In some embodiments, the method comprises transducing a cell with a nucleic acid molecule disclosed herein or a vector disclosed herein. The cell can be any cell described herein. In some embodiments, the cell is a T cell described herein. In some embodiments, the cell is a cell modified to express CD3 as described herein. In some embodiments, the cell (e.g., T cell) is obtained from a subject in need of a T cell therapy. In some embodiments, the cell is obtained from a donor other than the subject in need of a T cell therapy. In some embodiments, the cell is a T cell or a natural killer cell.
[0197] III.C. Methods of enriching a target T cell population
[0198] Certain aspects of the present disclosure relate to methods of enriching a population of target T cells obtained from a human subject. In some embodiments, the method comprises contacting the T cells with an HLA class I molecule disclosed herein. In some embodiments, the method comprises contacting the T cells with an APC disclosed herein. In some embodiments, following the contacting, the enriched population of T cells comprises a higher number of T cells capable of binding to the HLA class I molecule relative to the number of T cells capable of binding to the HLA class I molecule prior to the contacting.
[0199] In some embodiments, the method comprises contacting the T cells in vitro with a peptide, wherein the peptide comprises the amino acid sequence set forth in SEQ ID NO: 13. In some embodiments, the method comprises contacting the T cells in vitro with a peptide, wherein the peptide consists of the amino acid sequence set forth in SEQ ID NO: 13. In some embodiments, following the contacting, the enriched population of T cells comprises a higher number of T cells capable of binding to the HLA class I molecule relative to the number of T cells capable of binding to the HLA class I molecule prior to the contacting.
[0200] Some aspects of the present disclosure relate to a method of selecting a T cell capable of targeting a tumor cell. In some embodiments, the method comprises contacting a population of isolated T cells in vitro with a peptide, wherein the peptide consists of an amino acid sequence as set forth in SEQ ID NO: 13. In some embodiments, the T cells are obtained from a human subject.
[0201] The T cells obtained from a human subject can be any T cell disclosed herein. In some embodiments, the T cells obtained from a human subject are tumor infiltrating lymphocytes (TILs).
[0202] In some embodiments, the method further comprises administering the enriched T cells to a human subject. In some embodiments, the subject is pretreated prior to receiving the T cells as described herein.
[0203] The various aspects, embodiments, and options described herein can all be combined in any and all variations.
[0204] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the extent allowable under the patent laws. The incorporation should not be understood as an express or implied admission that any of the
[0205] Having generally described this application, a further understanding can be obtained by reference to the examples provided herein. These examples are for purposes of illustration only and are not intended to be limiting.
[0206] Examples
[0207] Example 1
[0208] TILs were isolated from patients with metastatic melanoma, followed by polyclonal expansion in vitro, and their NY-ESO-1 antigen specificity was examined against the HLA-B*07:02 allele. A combination of structure-based and functional analyses using peptide / HLA (pHLA) multimers was used to measure antigen-specific T cell responses. pHLA multimers were used in conjunction with previously known NY-ESO-1 antigens. 60-72 Peptides were used to stain T cells (Figure 1). TILs showed staining against B*07:02 / NY-ESO-1. 60-72 The multimer was positive. According to ELISPOT analysis, multimer-positive T cells secrete detectable IFN-γ in an HLA-restricted peptide-specific manner. Figure 2 ).
[0209] Multimer-positive anti-tumor T cells were collected and their TCR genes were molecularly cloned (Figure 3). The antigen specificity and functional reactivity of the cloned TCRs were verified by multimer staining and ELISPOT assay of TCR-reconstructed T cells. When reconstructing on primary T cells, B*07:02 / NY-ESO-1 was used. 60-72 TCR-transduced T cells were successfully stained with homologous multimers (Figure 4) and presented with NY-ESO-1 molecules via surface B*07:02 molecules. 60-72 Peptide strong reaction ( Figure 5 Importantly, these cells were able to recognize tumor cells that naturally express the NY-ESO-1 gene and whose peptides were not pulsed (Fig. 6). Although both the A375 and SK-MEL-37 melanoma cell lines were negative for B*07:02, they endogenously expressed the NY-ESO-1 gene. When the B*07:02 molecule was ectopically expressed, the B*07:02 / NY-ESO-1 ratio was significantly increased. 60-72 TCR-transduced T cells successfully recognized both melanoma cell lines. Furthermore, SK-MEL-21 melanoma cells lacking endogenous NY-ESO-1 expression became resistant to B*07:02 / NY-ESO-1 upon transduction of the full-length NY-ESO-1 gene. 60-72 TCR-transduced T cells are reactive (Figures 6-8). These results clearly demonstrate that B*07:02 / NY-ESO-1 60-72 TCR-transduced T cells showed a strong affinity for recognizing tumor cells, and the cloned B*07:02 / NY-ESO-1 60-72 TCRs are tumor-responsive.
[0210] The use of newly cloned tumor-reactive B*07:02-restricted NY-ESO-1 TCR genes can widen the applicability of anti-NY-ESO-1 TCR gene therapy to HLA-A*02:01 -positive cancer patients below.
[0211] Methods
[0212] Cell samples
[0213] Peripheral blood samples were obtained from healthy donors after approval by the institutional review board. Mononuclear cells were obtained via density gradient centrifugation (Ficoll-Paque PLUS; GE Healthcare). K562 is a red-white blood leukemia cell line with defective HLA expression. T2 is an HLA-A*02:01 + T cell leukemia / B-LCL hybrid cell lines. Jurkat 76 is a T cell leukemia cell line lacking TCR and CD8 expression. A375, SK-MEL-37, and SK-MEL-21 are melanoma cell lines. The melanoma cell lines were grown in DMEM supplemented with 10% FBS and 50 pg / ml gentamicin (Invitrogen). K562, T2, and Jurkat 76 cell lines were cultured in RPMI 1640 supplemented with 10% FBS and 50 pg / ml gentamicin. TILs isolated from metastatic melanoma patients were grown in vitro.
[0214] Peptides
[0215] Synthetic peptides were dissolved in DMSO to 50 pg / ml. The peptides used were B*07:02-restricted NY-ESO-1 60-72 (APRGPHGGAASGL; SEQ ID NO: 13), MAGE-A1 289-297 (RVRFFFPSL; SEQ ID NO: 62), and HIV nef 128-137 (TPGPGVRYPL; SEQ ID NO: 63) peptides. MAGE-A1 289-297 and HIV nef 128-137 peptides were used as negative controls.
[0216] Genes
[0217] The HLA-B*07:02 gene was fused to a truncated version of human nerve growth factor receptor (ΔNGFR) via an internal ribosome entry site. ΔNGFR transduced cells were isolated using an anti-NGFR monoclonal antibody (mAb). The full-length NY-ESO-1 gene was cloned from Me275 cells via RT-PCR according to published sequences. The TCR genes were cloned by 5' rapid amplification of cDNA ends (RACE) PCR using the SMARTer RACE cDNA Amplification Kit (Takara Bio). To clone the TCR a gene, for the first round of PCR, cDNA was amplified using the supplied 5'-RACE primer and a 3'-TCRa untranslated region primer (5'-GGAGAGTTCCCTCTGTTTGGAGAG-3'; SEQ ID NO: 57). The second round of PCR was performed using a modified 5'-RACE primer (5'- GTGTGGTGGTACGGGAATTCAAGCAGTGGTATCAACGCAGAGT-3'; SEQ ID NO: 58) and a 3'-TCRa primer (5'-ACCACTGTGCTGGCGGCCGCTCAGCTGGACCACAGCCGCAGCG-3'; SEQ ID NO: 59). To clone the TCR β gene, for the first round of PCR, cDNA was amplified using the supplied 5'-RACE primer and β C region specific reverse primers 3'-Cβ-1 (5'- ATCGTCGACCACTGTGCTGGCGGCCGCTCGAGTTCCAGGGCTGCCTTCAGAAATCC-3'; SEQ ID NO: 60) and 3'-Cβ-2 (5'-GACCACTGTGCTGGCGGCCGCTCGAGCTAGCCTCTGGAATCCTTTCTCTTGACCATTGC-3'; SEQ ID NO: 61). The second round of PCR was performed using a modified 5'-RACE primer and β C region specific reverse primers. TCR a and β gene allele designations are according to the International ImMunoGeneTics information system unique gene terminology (http: / / www.imgt.org). All genes were cloned into pMX retroviral vectors and transduced using a 293GPG cell-based retroviral system 36 .
[0218] Transfectants
[0219] Jurkat 76 / CD8 cells were transduced with individual TCRa and TCRP genes. Jurkat 76 / CD8-derived TCR transfectants were purified (>95% purity) using CD3 microbeads (Miltenyi Biotec). K562-based artificial APCs have been previously reported to express various HLA class I genes as single HLA alleles in combination with CD80 and CD83 individually (Butler and Hirano, Immunol. Rev. 257: 191-209 (2014); Hirano et al., Clin. Cancer Res. 12: 2967-75 (2006)). TCR genes were transduced into human primary T cells using PG13-derived retroviral supernatant. TCR genes were transfected into 293GPG cell line using TransIT293 (Mirus Bio). NY-ESO-1 - SK-MEL-21 cells to generate SK-MEL-21 / NY-ESO-1. Expression of transduced NY-ESO-1 was assessed by flow cytometry after staining with anti-NY-ESO-1 mAb (clone D1Q2U; Cell Signaling Technology). HLA-B*07:02 - A375 and SK-MEL-37 cells to generate A375 / B*07:02 and SK-MEL-37 / B*07:02 cells. HLA-B*07:02 genes were tagged with the ΔNGFR gene as described above, and ΔNGFR + Cells were purified (>95% purity) and used in subsequent experiments. Retroviral transduction of the ΔNGFR gene alone was used as a control.
[0220] Flow cytometry and cell sorting
[0221] Cell surface molecules were stained with PC5-conjugated anti-CD8 mAb (clone B9.11; Beckman Coulter), FITC-conjugated anti-NGFR (clone ME20.4; Biolegend), and APC / Cy7-conjugated anti-CD3 (clone UCHT1; Biolegend). Dead cells were discriminated with LIVE / DEAD Fixable Aqua Dead Cell Stain kit (Life Technologies). For intracellular staining, cells were fixed and permeabilized by using Cytofix / Cytoperm kit (BD Biosciences). Stained cells were analyzed by flow cytometry (BD Biosciences), and data analysis was performed using FlowJo (Tree Star). Cell sorting was performed using FACS Aria II (BD Bioscience).
[0222] Cytokine ELISPOT analysis
[0223] IFN-γ ELISPOT assay was performed as previously described (see, e.g., Kagoya et al., Nat. Commun. 9:1915 (2018); Anczurowski et al., Sci. Rep. 8:4804 (2018); and Yamashita et al., Nat Commun. 8:15244 (2017)). PVDF plates (Millipore, Bedford, MA) were coated with a capture mAb (1-D1K; MABTECH, Mariemont, OH), and T cells were incubated with 2x10 4 target cells per well in the presence or absence of peptides at 37°C for 20-24 hours. Plates were then washed and incubated with a biotin-conjugated detection mAb (7-B6-1; MABTECH). HRP-conjugated SA (Jackson ImmunoResearch) was then added, and IFN-γ spots were developed. The reaction was stopped by washing thoroughly with cold tap water. ELISPOT plates were scanned and counted using ImmunoSpot Reader and ImmunoSpot version 5.0 software (Cellular Technology Limited, Shaker Heights, OH).
[0224] Primary CD8 + Expansion of T cells
[0225] CD3 + T cell purification. Purified T cells were stimulated with 200 Gy irradiated artificial APCs / mOKT3 at an E:T ratio of 20:1. From the next day, activated T cells were retrovirally transduced with cloned TCR genes via spinoculation at 32°C for 1 hour at 1,000g for 3 consecutive days. On the second day, 100 IU / ml IL-2 and 10 ng / ml IL-15 were added to the TCR transduced T cells. Medium was replenished every 2-3 days.
[0226] Generation of pHLA multimers based on mammalian cells
[0227] Engineered HLA class I affinity matured to carry a Glu (E) residue instead of a Gln (Q) residue at position 115 of the a2 domain and a mouse K b Gene-derived a3 domain. Soluble HLA class I Q115E -K b genes were generated by sequentially fusing the extracellular domain of the affinity matured HLA class I Q115E -K b genes with a Gly-Ser (GS) flexible linker and a 6x His tag. HEK293T cells were individually transduced with various soluble HLA class I Q115E -K b genes using a retroviral system based on 293GPG cells. Stable HEK293T cells ectopically expressing soluble affinity matured class I Q115E -K b were grown until confluence and then the medium was changed. Forty-eight hours later, the conditioned medium was harvested and immediately used or frozen until use. Supernatants containing soluble HLA class I Q115E -K b were generated by HEK293T transfectants were incubated with 100-1000 pg / ml of the target class I restricted peptide overnight at 37°C for in vitro peptide exchange. Soluble monomeric class I Q115E -K b dimerized using an anti-His mAb (clone AD1.1.10; Abeam) conjugated to a fluorescent dye such as phycoerythrin (PE) at a 2:1 molar ratio for 2 hours at room temperature or overnight at 4°C. Functional soluble HLA class IConcentration of molecules.
[0228] pHLA multimer staining
[0229] T cells (1 x 10 5 ) were incubated with 50 nM dasatinib (LC laboratories) for 30 min at 37°C. Cells were then washed and incubated with 5-10 μg / ml of multimers for 30 min at room temperature and R-phycoerythrin-conjugated AffiniPure Fab fragment goat anti-mouse IgGl (Jackson ImmunoResearch Laboratories) was added for 15 min at 4°C. Cells were then washed three times and co-stained with anti-CD8 mAb for 15 min at 4°C. Finally, dead cells were discriminated using the Live / Dead Fixable Dead Cell Stain Kit.
[0230] Statistical analysis
[0231] Statistical analysis was performed using GraphPad Prism 5.0e. To determine if a given variable was significantly different between two groups, analysis was performed using Welch’s t test (two-sided). P values < 0.05 were considered significant. SEQUENCE LISTING <110> University Health Network <120> T cell receptors and methods of use thereof <130> 4285.003PC01 / C-K / BMD <150> US 62 / 813,644 <151> 2019-03-04 <160> 63 <170> PatentIn version 3.5 <210> 1 <211> 274 <212> PRT <213> Artificial sequence <220> <223> Alpha chain amino acid sequence <400> 1 Met Leu Leu Leu Leu Val Pro Val Leu Glu Val Ile Phe Thr Leu Gly 1 5 10 15 Gly Thr Arg Ala Gin Ser Val Thr Gin Leu Asp Ser His Val Ser Val 20 25 30 Ser Glu Gly Thr Pro Val Leu Leu Arg Cys Asn Tyr Ser Ser Ser Tyr 35 40 45 Ser Pro Ser Leu Phe Trp Tyr Val Gin His Pro Asn Lys Gly Leu Gin 50 55 60 Leu Leu Leu Lys Tyr Thr Ser Ala Ala Thr Leu Val Lys Gly Ile Asn 65 70 75 80 Gly Phe Glu Ala Glu Phe Lys Lys Ser Glu Thr Ser Phe His Leu Thr 85 90 95 Lys Pro Ser Ala His Met Ser Asp Ala Ala Glu Tyr Phe Cys Val Val 100 105 110 Ser Phe Ser Gly Asn Thr Pro Leu Val Phe Gly Lys Gly Thr Arg Leu 115 120 125 Ser Val Ile Ala Asn Ile Gin Asn Pro Asp Pro Ala Val Tyr Gin Leu 130 135 140 Arg Asp Ser Lys Ser Ser Asp Lys Ser Val Cys Leu Phe Thr Asp Phe 145 150 155 160 Asp Ser Gin Thr Asn Val Ser Gin Ser Lys Asp Ser Asp Val Tyr Ile 165 170 175 Thr Asp Lys Thr Val Leu Asp Met Arg Ser Met Asp Phe Lys Ser Asn 180 185 190 Ser Ala Val Ala Trp Ser Asn Lys Ser Asp Phe Ala Cys Ala Asn Ala 195 200 205 Phe Asn Asn Ser Ile Ile Pro Glu Asp Thr Phe Phe Pro Ser Pro Glu 210 215 220 Ser Ser Cys Asp Val Lys Leu Val Glu Lys Ser Phe Glu Thr Asp Thr 225 230 235 240 Asn Leu Asn Phe Gln Asn Leu Ser Val Ile Gly Phe Arg Ile Leu Leu 245 250 255 Leu Lys Val Ala Gly Phe Asn Leu Leu Met Thr Leu Arg Leu Trp Ser 260 265 270 Ser Glx <210> 2 <211> 311 <212> PRT <213> Artificial sequence <220> <223> Beta chain amino acid sequence <400> 2 Met Gly Thr Ser Leu Leu Cys Trp Met Ala Leu Cys Leu Leu Gly Ala 1 5 10 15 Asp His Ala Asp Thr Gly Val Ser Gln Asp Pro Arg His Lys Ile Thr 20 25 30 Lys Arg Gly Gin Asn Val Thr Phe Arg Cys Asp Pro lie Ser Glu His 35 40 45 Asn Arg Leu Tyr Trp Tyr Arg Gin Thr Leu Gly Gin Gly Pro Glu Phe 50 55 60 Leu Thr Tyr Phe Gin Asn Glu Ala Gin Leu Glu Lys Ser Arg Leu Leu 65 70 75 80 Ser Asp Arg Phe Ser Ala Glu Arg Pro Lys Gly Ser Phe Ser Thr Leu 85 90 95 Glu lie Gin Arg Thr Glu Gin Gly Asp Ser Ala Met Tyr Leu Cys Ala 100 105 110 Ser Ser Ser Ser Tyr Ser Asn Gin Pro Gin His Phe Gly Asp Gly Thr 115 120 125 Arg Leu Ser lie Leu Glu Asp Leu Asn Lys Val Phe Pro Pro Glu Val 130 135 140 Ala Val Phe Glu Pro Ser Glu Ala Glu lie Ser His Thr Gin Lys Ala 145 150 155 160 Thr Leu Val Cys Leu Ala Thr Gly Phe Phe Pro Asp His Val Glu Leu 165 170 175 Ser Trp Trp Val Asn Gly Lys Glu Val His Ser Gly Val Ser Thr Asp 180 185 190 Pro Gin Pro Leu Lys Glu Gin Pro Ala Leu Asn Asp Ser Arg Tyr Cys 195 200 205 Leu Ser Ser Arg Leu Arg Val Ser Ala Thr Phe Trp Gin Asn Pro Arg 210 215 220 Asn His Phe Arg Cys Gin Val Gin Phe Tyr Gly Leu Ser Glu Asn Asp 225 230 235 240 Glu Trp Thr Gin Asp Arg Ala Lys Pro Val Thr Gin He Val Ser Ala 245 250 255 Glu Ala Trp Gly Arg Ala Asp Cys Gly Phe Thr Ser Val Ser Tyr Gin 260 265 270 Gln Gly Val Leu Ser Ala Thr He Leu Tyr Glu He Leu Leu Gly Lys 275 280 285 Ala Thr Leu Tyr Ala Val Leu Val Ser Ala Leu Val Leu Met Ala Met 290 295 300 Val Lys Arg Lys Asp Phe Glx 305 310 <210> 3 <400> 3 000 <210> 4 <400> 4 000 <210> 5 <211> 6 <212> PRT <213> Artificial sequence <220> <223> a CDR1 <400> 5 Ser Ser Tyr Ser Pro Ser 1 5 <210> 6 <211> 8 <212> PRT <213> Artificial sequence <220> <223> a CDR2 <400> 6 Tyr Thr Ser Ala Ala Thr Leu Val 1 5 <210> 7 <211> 13 <212> PRT <213> Artificial sequence <220> <223> a CDR3 <400> 7 Cys Val Val Ser Phe Ser Gly Asn Thr Pro Leu Val Phe 1 5 10 <210> 8 <211> 5 <212> PRT <213> Artificial sequence <220> <223> β CDR1 <400> 8 Ser Glu His Asn Arg 1 5 <210> 9 <211> 6 <212> PRT <213> Artificial sequence <220> <223> β CDR2 <400> 9 Phe Gin Asn Glu Ala Gin 1 5 <210> 10 <211> 14 <212> PRT <213> Artificial sequence <220> <223> CDR3 <400> 10 Cys Ala Ser Ser Ser Ser Tyr Ser Asn Gin Pro Gin His Phe 1 5 10 <210> 11 <400> 11 000 <210> 12 <400> 12 000 <210> 13 <211> 13 <212> PRT <213> Artificial sequence <220> <223> Epitope <400> 13 Ala Pro Arg Gly Pro His Gly Gly Ala Ala Ser Gly Leu 1 5 10 <210> 14 <400> 14 000 <210> 15 <400> 15 000 <210> 16 <211> 119 <212> PRT <213> Artificial sequence <220> <223> B2m amino acid sequence <400> 16 Met Ser Arg Ser Val Ala Leu Ala Val Leu Ala Leu Leu Ser Leu Ser 1 5 10 15 Gly Leu Glu Ala Ile Gin Arg Thr Pro Lys Ile Gin Val Tyr Ser Arg 20 25 30 His Pro Ala Glu Asn Gly Lys Ser Asn Phe Leu Asn Cys Tyr Val Ser 35 40 45 Gly Phe His Pro Ser Asp Ile Glu Val Asp Leu Leu Lys Asn Gly Glu 50 55 60 Arg Ile Glu Lys Val Glu His Ser Asp Leu Ser Phe Ser Lys Asp Trp 65 70 75 80 Ser Phe Tyr Leu Leu Tyr Tyr Thr Glu Phe Thr Pro Thr Glu Lys Asp 85 90 95 Glu Tyr Ala Cys Arg Val Asn His Val Thr Leu Ser Gin Pro Lys Ile 100 105 110 Val Lys Trp Asp Arg Asp Met 115 <210> 17 <211> 822 <212> PRT <213> Artificial sequence <220> <223> Alpha chain nucleotide sequence <400> 17 Ala Thr Gly Cys Thr Cys Cys Thr Gly Cys Thr Gly Cys Thr Cys Gly 1 5 10 15 Thr Cys Cys Cys Ala Gly Thr Gly Cys Thr Cys Gly Ala Gly Gly Thr 20 25 30 Gly Ala Thr Thr Thr Thr Thr Ala Cys Thr Cys Thr Gly Gly Gly Ala 35 40 45 Gly Gly Ala Ala Cys Cys Ala Gly Ala Gly Cys Cys Cys Ala Gly Thr 50 55 60 Cys Gly Gly Thr Gly Ala Cys Cys Cys Ala Gly Cys Thr Thr Gly Ala 65 70 75 80 Cys Ala Gly Cys Cys Ala Cys Gly Thr Cys Thr Cys Thr Gly Thr Cys 85 90 95 Thr Cys Thr Gly Ala Ala Gly Gly Ala Ala Cys Cys Cys Cys Gly Gly 100 105 110 Thr Gly Cys Thr Gly Cys Thr Gly Ala Gly Gly Thr Gly Cys Ala Ala 115 120 125 Cys Thr Ala Cys Thr Cys Ala Thr Cys Thr Thr Cys Thr Thr Ala Thr 130 135 140 Thr Cys Ala Cys Cys Ala Thr Cys Thr Cys Thr Cys Thr Thr Cys Thr 145 150 155 160 Gly Gly Thr Ala Thr Gly Thr Gly Cys Ala Ala Cys Ala Cys Cys Cys 165 170 175 Cys Ala Ala Cys Ala Ala Ala Gly Gly Ala Cys Thr Cys Cys Ala Gly 180 185 190 Cys Thr Thr Cys Thr Cys Cys Thr Gly Ala Ala Gly Thr Ala Cys Ala 195 200 205 Cys Ala Thr Cys Ala Gly Cys Gly Gly Cys Cys Ala Cys Cys Cys Thr 210 215 220 Gly Gly Thr Thr Ala Ala Ala Gly Gly Cys Ala Thr Cys Ala Ala Cys 225 230 235 240 Gly Gly Thr Thr Thr Thr Gly Ala Gly Gly Cys Thr Gly Ala Ala Thr 245 250 255 Thr Thr Ala Ala Gly Ala Ala Gly Ala Gly Thr Gly Ala Ala Ala Cys 260 265 270 Cys Thr Cys Cys Thr Thr Cys Cys Ala Cys Cys Thr Gly Ala Cys Gly 275 280 285 Ala Ala Ala Cys Cys Cys Thr Cys Ala Gly Cys Cys Cys Ala Thr Ala 290 295 300 Thr Gly Ala Gly Cys Gly Ala Cys Gly Cys Gly Gly Cys Thr Gly Ala 305 310 315 320 Gly Thr Ala Cys Thr Thr Cys Thr Gly Thr Gly Thr Thr Gly Thr Gly 325 330 335 Ala Gly Thr Thr Thr Thr Thr Cys Ala Gly Gly Ala Ala Ala Cys Ala 340 345 350 Cys Ala Cys Cys Thr Cys Thr Thr Gly Thr Cys Thr Thr Thr Gly Gly 355 360 365 Ala Ala Ala Gly Gly Gly Cys Ala Cys Ala Ala Gly Ala Cys Thr Thr 370 375 380 Thr Cys Thr Gly Thr Gly Ala Thr Thr Gly Cys Ala Ala Ala Thr Ala 385 390 395 400 Thr Cys Cys Ala Gly Ala Ala Cys Cys Cys Thr Gly Ala Cys Cys Cys 405 410 415 Thr Gly Cys Cys Gly Thr Gly Thr Ala Cys Cys Ala Gly Cys Thr Gly 420 425 430 Ala Gly Ala Gly Ala Cys Thr Cys Thr Ala Ala Ala Thr Cys Cys Ala 435 440 445 Gly Thr Gly Ala Cys Ala Ala Gly Thr Cys Thr Gly Thr Cys Thr Gly 450 455 460 Cys Cys Thr Ala Thr Thr Cys Ala Cys Cys Gly Ala Thr Thr Thr Thr 465 470 475 480 Gly Ala Thr Thr Cys Thr Cys Ala Ala Ala Cys Ala Ala Ala Thr Gly 485 490 495 Thr Gly Thr Cys Ala Cys Ala Ala Ala Gly Thr Ala Ala Gly Gly Ala 500 505 510 Thr Thr Cys Thr Gly Ala Thr Gly Thr Gly Thr Ala Thr Ala Thr Cys 515 520 525 Ala Cys Ala Gly Ala Cys Ala Ala Ala Ala Cys Thr Gly Thr Gly Cys 530 535 540 Thr Ala Gly Ala Cys Ala Thr Gly Ala Gly Gly Thr Cys Thr Ala Thr 545 550 555 560 Gly Gly Ala Cys Thr Thr Cys Ala Ala Gly Ala Gly Cys Ala Ala Cys 565 570 575 Ala Gly Thr Gly Cys Thr Gly Thr Gly Gly Cys Cys Thr Gly Gly Ala 580 585 590 Gly Cys Ala Ala Cys Ala Ala Ala Thr Cys Thr Gly Ala Cys Thr Thr 595 600 605 Thr Gly Cys Ala Thr Gly Thr Gly Cys Ala Ala Ala Cys Gly Cys Cys 610 615 620 Thr Thr Cys Ala Ala Cys Ala Ala Cys Ala Gly Cys Ala Thr Thr Ala 625 630 635 640 Thr Thr Cys Cys Ala Gly Ala Ala Gly Ala Cys Ala Cys Cys Thr Thr 645 650 655 Cys Thr Thr Cys Cys Cys Cys Ala Gly Cys Cys Cys Ala Gly Ala Ala 660 665 670 Ala Gly Thr Thr Cys Cys Thr Gly Thr Gly Ala Thr Gly Thr Cys Ala 675 680 685 Ala Gly Cys Thr Gly Gly Thr Cys Gly Ala Gly Ala Ala Ala Ala Gly 690 695 700 Cys Thr Thr Thr Gly Ala Ala Ala Cys Ala Gly Ala Thr Ala Cys Gly 705 710 715 720 Ala Ala Cys Cys Thr Ala Ala Ala Cys Thr Thr Thr Cys Ala Ala Ala 725 730 735 Ala Cys Cys Thr Gly Thr Cys Ala Gly Thr Gly Ala Thr Thr Gly Gly 740 745 750 Gly Thr Thr Cys Cys Gly Ala Ala Thr Cys Cys Thr Cys Cys Thr Cys 755 760 765 Cys Thr Gly Ala Ala Ala Gly Thr Gly Gly Cys Cys Gly Gly Gly Thr 770 775 780 Thr Thr Ala Ala Thr Cys Thr Gly Cys Thr Cys Ala Thr Gly Ala Cys 785 790 795 800 Gly Cys Thr Gly Cys Gly Gly Cys Thr Gly Thr Gly Gly Thr Cys Cys 805 810 815 Ala Gly Cys Thr Gly Ala 820 <210> 18 <211> 933 <212> PRT <213> Artificial sequence <220> <223> Beta chain nucleotide sequence <400> 18 Ala Thr Gly Gly Gly Cys Ala Cys Cys Ala Gly Cys Cys Thr Cys Cys 1 5 10 15 Thr Cys Thr Gly Cys Thr Gly Gly Ala Thr Gly Gly Cys Cys Cys Thr 20 25 30 Gly Thr Gly Thr Cys Thr Cys Cys Thr Gly Gly Gly Gly Gly Cys Ala 35 40 45 Gly Ala Thr Cys Ala Cys Gly Cys Ala Gly Ala Thr Ala Cys Thr Gly 50 55 60 Gly Ala Gly Thr Cys Thr Cys Cys Cys Ala Gly Gly Ala Cys Cys Cys 65 70 75 80 Cys Ala Gly Ala Cys Ala Cys Ala Ala Gly Ala Thr Cys Ala Cys Ala 85 90 95 Ala Ala Gly Ala Gly Gly Gly Gly Ala Cys Ala Gly Ala Ala Thr Gly 100 105 110 Thr Ala Ala Cys Thr Thr Thr Cys Ala Gly Gly Thr Gly Thr Gly Ala 115 120 125 Thr Cys Cys Ala Ala Thr Thr Thr Cys Thr Gly Ala Ala Cys Ala Cys 130 135 140 Ala Ala Cys Cys Gly Cys Cys Thr Thr Thr Ala Thr Thr Gly Gly Thr 145 150 155 160 Ala Cys Cys Gly Ala Cys Ala Gly Ala Cys Cys Cys Thr Gly Gly Gly 165 170 175 Gly Cys Ala Gly Gly Gly Cys Cys Cys Ala Gly Ala Gly Thr Thr Thr 180 185 190 Cys Thr Gly Ala Cys Thr Thr Ala Cys Thr Thr Cys Cys Ala Gly Ala 195 200 205 Ala Thr Gly Ala Ala Gly Cys Thr Cys Ala Ala Cys Thr Ala Gly Ala 210 215 220 Ala Ala Ala Ala Thr Cys Ala Ala Gly Gly Cys Thr Gly Cys Thr Cys 225 230 235 240 Ala Gly Thr Gly Ala Thr Cys Gly Gly Thr Thr Cys Thr Cys Thr Gly 245 250 255 Cys Ala Gly Ala Gly Ala Gly Gly Cys Cys Thr Ala Ala Gly Gly Gly 260 265 270 Ala Thr Cys Thr Thr Thr Cys Thr Cys Cys Ala Cys Cys Thr Thr Gly 275 280 285 Gly Ala Gly Ala Thr Cys Cys Ala Gly Cys Gly Cys Ala Cys Ala Gly 290 295 300 Ala Gly Cys Ala Gly Gly Gly Gly Gly Ala Cys Thr Cys Gly Gly Cys 305 310 315 320 Cys Ala Thr Gly Thr Ala Thr Cys Thr Cys Thr Gly Thr Gly Cys Cys 325 330 335 Ala Gly Cys Ala Gly Cys Thr Cys Cys Ala Gly Cys Thr Ala Thr Ala 340 345 350 Gly Cys Ala Ala Thr Cys Ala Gly Cys Cys Cys Cys Ala Gly Cys Ala 355 360 365 Thr Thr Thr Thr Gly Gly Thr Gly Ala Thr Gly Gly Gly Ala Cys Thr 370 375 380 Cys Gly Ala Cys Thr Cys Thr Cys Cys Ala Thr Cys Cys Thr Ala Gly 385 390 395 400 Ala Gly Gly Ala Cys Cys Thr Gly Ala Ala Cys Ala Ala Gly Gly Thr 405 410 415 Gly Thr Thr Cys Cys Cys Ala Cys Cys Cys Gly Ala Gly Gly Thr Cys 420 425 430 Gly Cys Thr Gly Thr Gly Thr Thr Thr Gly Ala Gly Cys Cys Ala Thr 435 440 445 Cys Ala Gly Ala Ala Gly Cys Ala Gly Ala Gly Ala Thr Cys Thr Cys 450 455 460 Cys Cys Ala Cys Ala Cys Cys Cys Ala Ala Ala Ala Gly Gly Cys Cys 465 470 475 480 Ala Cys Ala Cys Thr Gly Gly Thr Gly Thr Gly Cys Cys Thr Gly Gly 485 490 495 Cys Cys Ala Cys Ala Gly Gly Cys Thr Thr Cys Thr Thr Cys Cys Cys 500 505 510 Cys Gly Ala Cys Cys Ala Cys Gly Thr Gly Gly Ala Gly Cys Thr Gly 515 520 525 Ala Gly Cys Thr Gly Gly Thr Gly Gly Gly Thr Gly Ala Ala Thr Gly 530 535 540 Gly Gly Ala Ala Gly Gly Ala Gly Gly Thr Gly Cys Ala Cys Ala Gly 545 550 555 560 Thr Gly Gly Gly Gly Thr Cys Ala Gly Cys Ala Cys Gly Gly Ala Cys 565 570 575 Cys Cys Gly Cys Ala Gly Cys Cys Cys Cys Cys Thr Cys Ala Ala Gly Gly 580 585 590 Ala Gly Cys Ala Gly Cys Cys Cys Gly Cys Cys Cys Thr Cys Ala Ala 595 600 605 Thr Gly Ala Cys Thr Cys Cys Ala Gly Ala Thr Ala Cys Thr Gly Cys 610 615 620 Cys Thr Gly Ala Gly Cys Ala Gly Cys Cys Gly Cys Cys Thr Gly Ala 625 630 635 640 Gly Gly Gly Thr Cys Thr Cys Gly Gly Cys Cys Ala Cys Cys Thr Thr 645 650 655 Cys Thr Gly Gly Cys Ala Gly Ala Ala Cys Cys Cys Cys Cys Gly Cys 660 665 670 Ala Ala Cys Cys Ala Cys Thr Thr Cys Cys Gly Cys Thr Gly Thr Cys 675 680 685 Ala Ala Gly Thr Cys Cys Ala Gly Thr Thr Cys Thr Ala Cys Gly Gly 690 695 700 Gly Cys Thr Cys Thr Cys Gly Gly Ala Gly Ala Ala Thr Gly Ala Cys 705 710 715 720 Gly Ala Gly Thr Gly Gly Ala Cys Cys Cys Ala Gly Gly Ala Thr Ala 725 730 735 Gly Gly Gly Cys Cys Ala Ala Ala Cys Cys Cys Gly Thr Cys Ala Cys 740 745 750 Cys Cys Ala Gly Ala Thr Cys Gly Thr Cys Ala Gly Cys Gly Cys Cys 755 760 765 Gly Ala Gly Gly Cys Cys Thr Gly Gly Gly Gly Thr Ala Gly Ala Gly 770 775 780 Cys Ala Gly Ala Cys Thr Gly Thr Gly Gly Cys Thr Thr Thr Ala Cys 785 790 795 800 Cys Thr Cys Gly Gly Thr Gly Thr Cys Cys Thr Ala Cys Cys Ala Gly 805 810 815 Cys Ala Ala Gly Gly Gly Gly Thr Cys Cys Thr Gly Thr Cys Thr Gly 820 825 830 Cys Cys Ala Cys Cys Ala Thr Cys Cys Thr Cys Thr Ala Thr Gly Ala 835 840 845 Gly Ala Thr Cys Cys Thr Gly Cys Thr Ala Gly Gly Gly Ala Ala Gly 850 855 860 Gly Cys Cys Ala Cys Cys Cys Thr Gly Thr Ala Thr Gly Cys Thr Gly 865 870 875 880 Thr Gly Cys Thr Gly Gly Thr Cys Ala Gly Cys Gly Cys Cys Cys Thr 885 890 895 Thr Gly Thr Gly Thr Thr Gly Ala Thr Gly Gly Cys Cys Ala Thr Gly 900 905 910 Gly Thr Cys Ala Ala Gly Ala Gly Ala Ala Ala Gly Gly Ala Thr Thr 915 920 925 Thr Cys Thr Ala Gly 930 <210> 19 <400> 19 000 <210> 20 <400> 20 000 <210> 21 <400> 21 000 <210> 22 <400> 22 000 <210> 23 <400> 23 000 <210> 24 <400> 24 000 <210> 25 <400> 25 000 <210> 26 <400> 26 000 <210> 27 <400> 27 000 <210> 28 <400> 28 000 <210> 29 <400> 29 000 <210> 30 <400> 30 000 <210> 31 <400> 31 000 <210> 32 <400> 32 000 <210> 33 <400> 33 000 <210> 34 <400> 34 000 <210> 35 <400> 35 000 <210> 36 <400> 36 000 <210> 37 <400> 37 000 <210> 38 <400> 38 000 <210> 39 <400> 39 000 <210> 40 <400> 40 000 <210> 41 <400> 41 000 <210> 42 <400> 42 000 <210> 43 <400> 43 000 <210> 44 <400> 44 000 <210> 45 <400> 45 000 <210> 46 <400> 46 000 <210> 47 <400> 47 000 <210> 48 <400> 48 000 <210> 49 <400> 49 000 <210> 50 <400> 50 000 <210> 51 <400> 51 000 <210> 52 <211> 180 <212> PRT <213> Artificial sequence <220> <223> NY-ESO-1 amino acid sequence <400> 52 Met Gln Ala Glu Gly Arg Gly Thr Gly Gly Ser Thr Gly Asp Ala Asp 1 5 10 15 Gly Pro Gly Gly Pro Gly Ile Pro Asp Gly Pro Gly Gly Asn Ala Gly 20 25 30 Gly Pro Gly Glu Ala Gly Ala Thr Gly Gly Arg Gly Pro Arg Gly Ala 35 40 45 Gly Ala Ala Arg Ala Ser Gly Pro Gly Gly Gly Ala Pro Arg Gly Pro 50 55 60 His Gly Gly Ala Ala Ser Gly Leu Asn Gly Cys Cys Arg Cys Gly Ala 65 70 75 80 Arg Gly Pro Glu Ser Arg Leu Leu Glu Phe Tyr Leu Ala Met Pro Phe 85 90 95 Ala Thr Pro Met Glu Ala Glu Leu Ala Arg Arg Ser Leu Ala Gin Asp 100 105 110 Ala Pro Pro Leu Pro Val Pro Gly Val Leu Leu Lys Glu Phe Thr Val 115 120 125 Ser Gly Asn Ile Leu Thr Ile Arg Leu Thr Ala Ala Asp His Arg Gin 130 135 140 Leu Gin Leu Ser Ile Ser Ser Cys Leu Gin Gin Leu Ser Leu Leu Met 145 150 155 160 Trp Ile Thr Gin Cys Phe Leu Pro Val Phe Leu Ala Gin Pro Pro Ser 165 170 175 Gly Gin Arg Arg 180 <210> 53 <211> 21 <212> DNA <213> Artificial sequence <220> <223> siRNA-TCRa-1 <400> 53 guaaggauuc ugauguguat t 21 <210> 54 <211> 21 <212> DNA <213> Artificial sequence <220> <223> siRNA-TCRa-2 <400> 54 uacacaucag aauccuuact t 21 <210> 55 <211> 21 <212> DNA <213> Artificial sequence <220> <223> siRNA-TCRb-1 <400> 55 ccaccauccu cuaugagaut t 21 <210> 56 <211> 21 <212> DNA <213> Artificial sequence <220> <223> siRNA-TCRb-2 <400> 56 aucucauaga ggaugguggt t 21 <210> 57 <211> 24 <212> DNA <213> Artificial sequence <220> <223> 3 '-TCR alpha untranslated region primer <400> 57 ggagagttcc ctctgtttgg agag 24 <210> 58 <211> 43 <212> DNA <213> Artificial sequence <220> <223> Modified 5 '-RACE primer <400> 58 gtgtggtggt acgggaattc aagcagtggt atcaacgcag agt 43 <210> 59 <211> 43 <212> DNA <213> Artificial sequence <220> <223> 3'‑TCR‑a primer <400> 59 accactgtgc tggcggccgc tcagctggac cacagccgca gcg 43 <210> 60 <211> 56 <212> DNA <213> Artificial sequence <220> <223> β C region specific reverse primer 3 ‑CB ‑1 <400> 60 atcgtcgacc actgtgctgg cggccgctcg agttccaggg ctgccttcag aaatcc 56 <210> 61 <211> 59 <212> DNA <213> Artificial sequence <220> <223> β C region specific reverse primer 3'‑C B‑2 <400> 61 gaccactgtg ctggcggccg ctcgagctag cctctggaat cctttctctt gaccattgc 59 <210> 62 <211> 9 <212> PRT <213> Artificial sequence <220> <223> MAGE‑ A1289‑297 <400> 62 Arg Val Arg Phe Phe Phe Pro Ser Leu 1 5 <210> 63 <211> 10 <212> PRT <213> Artificial sequence <220> <223> HIV nef128-137 <400> 63 Thr Pro Gly Pro Gly Val Arg Tyr Pro Leu 1 5 10
Claims
1. A nucleic acid molecule comprising (i) a first nucleotide sequence encoding a recombinant anti-NY-ESO T-cell receptor TCR or its antigen-binding moiety thereof, the recombinant T-cell receptor TCR or its antigen-binding moiety specifically binding to a human NY-ESO-1 epitope consisting of the amino acid sequence shown in SEQ ID NO: 13, wherein the epitope is complexed with the HLA class I molecule HLA-B*07 allele; wherein the anti-NY-ESO-1 TCR comprises an α chain and a β chain, wherein the α chain comprises a variable domain comprising α chain CDR1, α chain CDR2, and α chain CDR3; and wherein the β chain comprises a variable domain comprising β chain CDR1, β chain CDR2, and β chain CDR3; and wherein: (a) The amino acid sequence of the β-chain CDR3 against NY-ESO-1TCR is shown in SEQ ID NO:10; (b) The amino acid sequence of the β-chain CDR2 against NY-ESO-1TCR is shown in SEQ ID NO:9; (c) The amino acid sequence of the β chain CDR1 against NY-ESO-1TCR is shown in SEQ ID NO:8; (d) The amino acid sequence of the α chain CDR3 against NY-ESO-1TCR is shown in SEQ ID NO:7; (e) The amino acid sequence of the α-chain CDR2 against NY-ESO-1TCR is shown in SEQ ID NO:6; (f) The amino acid sequence of the α-chain CDR1 against NY-ESO-1TCR is shown in SEQ ID NO:5; and (ii) a second nucleotide sequence, wherein the second nucleotide sequence or the polypeptide encoded by the second nucleotide sequence inhibits the expression of endogenous TCR.
2. The nucleic acid molecule as described in claim 1, wherein the HLA class I molecule HLA-B*07 allele is selected from HLA-B*07:01 allele, HLA-B*07:02 allele, HLA-B*07:03 allele, HLA-B*07:04 allele, HLA-B*07:05 allele and HLA-B*07:06 allele.
3. The nucleic acid molecule as described in claim 1, wherein... (i) The α chain of the anti-NY-ESO-1TCR contains an amino acid sequence as listed in SEQ ID NO:1; (ii) wherein the β chain of the anti-NY-ESO-1TCR comprises an amino acid sequence as listed in SEQ ID NO:2; or (iii)(i) and (ii) both.
4. The nucleic acid molecule according to any one of claims 1 to 3, wherein the second nucleotide sequence (i) One or more siRNAs for reducing the expression of endogenous TCR, wherein the one or more siRNAs are complementary to a target sequence within a nucleotide sequence encoding a constant region of the endogenous TCR; (ii) Encode Cas9; or (iii)(i) and (ii) both.
5. The nucleic acid molecule of claim 4, wherein the one or more siRNAs comprise one or more nucleotide sequences selected from the group consisting of SEQ ID NO:53-56.
6. A vector comprising the nucleic acid molecule of any one of claims 1 to 5.
7. The vector as described in claim 6, wherein the vector is a viral vector, a mammalian vector, or a bacterial vector.
8. The vector as described in claim 6, wherein the vector is a retroviral vector.
9. The vector of claim 6, wherein the vector is selected from the group consisting of: adenovirus vector, lentivirus vector, Sendai virus vector, baculovirus vector, Epstein-Barr virus vector, lactovirus vector, vaccinia virus vector, herpes simplex virus vector, hybrid vector and adeno-associated virus vector.
10. The vector as described in claim 6, wherein the vector is a lentiviral vector.
11. A cell comprising a nucleic acid molecule according to any one of claims 1 to 5 or a vector according to any one of claims 6 to 10.
12. The cell of claim 11, wherein the cell further expresses CD3.
13. The cell of claim 11, wherein the cell is a T cell.
14. The cell of claim 11, wherein the cell is a natural killer cell.
15. The cell of claim 11, wherein the cell is a natural killer T cell.
16. The cell of claim 11, wherein the cell is an ILC cell.
17. Use of the cells of claim 11 in the preparation of a medicament for treating melanoma in a subject of need.
18. The use as described in claim 17, wherein the melanoma is recurrent or refractory.
19. The use as claimed in claim 17, wherein the melanoma is locally advanced.
20. The use as claimed in claim 17, wherein the melanoma is advanced.
21. The use as claimed in claim 17, wherein the melanoma is metastatic.
22. The use as claimed in claim 17, wherein the cells are obtained from the subject.
23. The use as claimed in claim 17, wherein the cells are obtained from a donor other than the subject.
24. A method for engineering cells targeting an antigen, the method comprising transducing cells collected from a subject requiring T-cell therapy with the nucleic acid molecules of any one of claims 1-5.
25. The method of claim 24, wherein the cells targeting the antigen further express CD3.
26. The method of claim 24, wherein the cell is a T cell.
27. The method of claim 24, wherein the cell is a natural killer cell.
Citation Information
Patent Citations
Method for expression of specific gene
US20100273213A1
Use of Chimeric Antigen Receptor-Modified T-Cells to Treat Cancer
US20130287748A1
Compositions and libraries comprising recombinant t-cell receptors and methods of using recombinant t-cell receptors
CN108778291A
Methods and compositions for treating glioblastoma
CN118475597A
Conditional superagonist CTL ligands for the promotion of tumor-specific CTL responses
US20130108657A1