SNP molecular markers for selecting fertilization rate of hens laying eggs for 10 days and their application

Abstract

The present invention provides a SNP molecular marker for selecting the fertilization rate of hens laying eggs for 10 days and an application thereof. A SNP site located on the caveolin-1 gene is found by a restriction endonuclease length polymorphism (PCR-RFLP) technical method, and the association analysis between the genotype at the position and the fertilization rate of hens laying eggs for 10 days is performed. For the first time, a SNP molecular marker significantly associated with the fertilization rate of hens laying eggs for 10 days is screened on the caveolin-1 gene, which is polymorphic at the 25216421st base (GGA5) of chromosome 1, and the base is A or G. The SNP molecular marker is used for selecting and improving the fertilization rate of hens laying eggs for 10 days.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker selection of livestock reproductive traits, and specifically relates to a SNP molecular marker associated with the fertilization rate of hens laying eggs for 10 days and an application thereof. Background Art

[0002] Caveolae are depressions with a depth of 50-75 nm located on the cell plasma membrane (PM). They are a type of membrane lipid rafts (MLR) and are composed of three caveolin proteins (cav-1, cav-2 and cav-3). They are inserted into the caveolae through palmitoylated cysteine ​​residues and fixed to the inner leaflet of the plasma membrane. Cav-1 is the main structural protein of caveolin. In humans, many studies have been conducted on the function of the Cav-1 gene. There is a significant association between the Cav-1 gene rs3807989 polymorphism and susceptibility to atrial fibrillation (AF). Cav-1 is also closely related to cell polarization and directional migration. Cav-1 also plays a vital role in the coordination mechanism of lipid metabolism and proliferation response in the liver after mouse cell damage. Existing literature shows that Cav-1 has a very close relationship with cholesterol, and the raw material for the synthesis of some sex hormones is cholesterol, such as estradiol. Therefore, it is suspected that whether the variation of the Cav-1 gene will cause changes in certain reproductive performance of hens (such as fertilization rate).

[0003] The present invention discovered a SNP on exon 3 of the caveolin-1 gene, and used a restriction fragment length polymorphism (PCR-RFLP) analysis method to conduct an association analysis between the sequenced SNP and the fertilization rate of hens laying eggs for 10 days in a large population, which can further determine the function of the SNP. Summary of the invention

[0004] The purpose of the present invention is to provide a SNP molecular marker for selecting the fertilization rate of hens laying eggs for 10 days and its application. Restriction endonuclease length polymorphism (PCR-RFLP) analysis found that the polymorphism of the caveolin-1 gene on chromosome 1 is associated with the fertilization rate of hens laying eggs for 10 days.

[0005] In order to achieve the above object, the present invention is implemented by the following technical solutions:

[0006] The SNP molecular marker used to select the fertilization rate of hens laying eggs for 10 days is located in the caveolin-1 gene on chromosome 1. The polymorphic site is located at the 25216421 base of the chromosome, and its base is A or G, comprising the nucleotide sequence shown in SEQ ID NO.1, and the 43rd base R is A or G.

[0007] The above SNP molecular markers were screened and obtained by the following method:

[0008] 1) Experimental sample collection: blood samples were collected from experimental chickens for DNA extraction; eggs were collected from experimental chickens after artificial insemination to determine the fertilization rate of hens;

[0009] 2) Determination of the fertilization rate of hens during the 10th day of egg laying: Measure the percentage of the number of fertilized eggs and the total number of eggs laid by the hens 10 days after artificial insemination of the test chickens. Repeat the measurement three times and take the average of the three measurement results as the phenotypic value of the fertilization rate of the test chickens during the sperm storage period;

[0010] 3) Extraction and detection of chicken genomic DNA: Extract chicken genomic DNA from experimental chicken blood samples to prepare hen whole genome DNA samples;

[0011] 4) Genotype determination and correlation analysis between genotype and fertilization rate of chicken eggs at 10 days of laying:

[0012] The fertilization rate of 907 hens at 10 days of egg laying was measured, and PCR-RFLP analysis was performed using the extracted DNA samples. SPSS statistical analysis software was used to correlate the PCR-RFLP analysis results with the phenotypic value of the fertilization rate at 10 days of egg laying, which confirmed that the polymorphism of this SNP site was significantly associated with the egg laying rate of hens in the later stage of egg laying (P<0.05). The alleles of the SNP site are all G, which is a favorable marker for the fertilization rate of hens and can be used for the selection and improvement of the fertilization rate of hens in the later stage of egg laying.

[0013] The application of the above SNP molecular markers in the selection or improvement of fertilization rate of hens is as follows:

[0014] Chicken genomic DNA was extracted and the product was amplified using primers (SEQ ID NO. 2 and 3). After Bst4CI digestion, the AA genotype showed 1 band (124bp), the GG genotype showed 1 band (146bp), and the heterozygous AG showed 2 bands (146bp+124bp). All the alleles were G, which is a favorable marker for the fertilization rate of hens.

[0015] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0016] The PCR-RFLP (restricted fragment length polymorphism) analysis method was used to conduct an association analysis on the correlation between this SNP and the fertilization rate of hens laying eggs for 10 days in a group of 907. Using molecular marker-assisted breeding, a new SNP molecular marker was provided for the selection and improvement of the fertilization rate of hens laying eggs for 10 days.

[0017] The above research work was completed with the joint support of the National Key R&D Program (2017YFE0113700; 2018YFD0501301), the National Foundation (Project No.: 31772585), Hubei Province Livestock and Poultry Quality Improvement and Green Breeding Science and Technology Innovation Action (Project No.: 2018skjcx05), the Independent Innovation Fund of Huazhong Agricultural University (2662018PY088) and the International Cooperation Joint Laboratory of Modern Agricultural Technology of the Ministry of Education. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the sequencing result of caveolin-1 gene.

[0019] Figure 2 The PCR-RFLP restriction enzyme digestion map of caveolin-1 gene. M: Marker I, lanes 1, 3, 5, 7, 9, 11, 12, 13, 15, 17, 19 are AA type, lanes 2, 8, 10, 14, 18, 20, 21, 22, 23, 24 are AG type, and lanes 4, 6, 16 are GG type. DETAILED DESCRIPTION

[0020] Screening and validation of SNP molecular markers associated with fertilization rate of hens laying eggs on day 10

[0021] The present invention finds that there is a SNP site located at the 25216421 base of chromosome 1 in the exon 3 sequence of the caveolin-1 gene, and the base is A or G, which leads to the change of the Bst4CI restriction site. The PCR-RFLP technology is further used to detect the distribution of the SNP site in the hen population to verify the correlation between the polymorphism of the SNP site and the fertilization rate of hens laying eggs for 10 days.

[0022] 1) Experimental sample collection:

[0023] The experimental group consisted of 907 healthy hens, which were from the parent group (400 days old) of the "Jinghong No. 1" laying hen core breeding farm. All hens were hatched in the same batch. They were raised in Jingzhou Yukou Poultry Co., Ltd., and were raised in single cages with a 14-hour light system and free access to food and water. During the breeding period, the temperature, humidity, ventilation, light and other conditions were the same, which was a conventional method.

[0024] 2) Determination of fertilization rate of chickens laying eggs for 10 days:

[0025] The semen of the roosters is collected once every 10 days. The semen must be free of feces, feathers, and blood contamination, otherwise it will be discarded. The mixed semen is used to inseminate the hens (25 microliters / hen). During insemination, avoid the stimulation of the insemination device. At the same time, to avoid infection during insemination, the insemination device head should be replaced after each insemination. The specific operation shall be carried out in accordance with the "Technical Regulations for Artificial Insemination of Chickens" (DB12 / T290-2006). Collect the breeding eggs and mark the cage number. After the same batch of breeding eggs are incubated at a constant temperature (37.8℃, relative humidity 50%) for 7 days, the eggs are illuminated and the fertilized and unfertilized breeding eggs are recorded.

[0026] After one artificial insemination of the test chickens, the number of fertilized eggs laid for 10 days and the percentage of eggs laid by the hens during this period were recorded as the phenotype of the fertilization rate of the hens during the sperm storage period. The measurement was repeated three times and the average of the three measured results was taken as the phenotypic value of the fertilization rate of the hens during the sperm storage period of the test chickens.

[0027] After the experiment of determining the fertilization rate of hens during sperm storage was completed, 0.5 mL of blood was collected from the subwing vein of the experimental chickens, placed in a 1.5 mL EP tube with 0.3 mL of anticoagulant added in advance, mixed and stored at -20°C for DNA extraction.

[0028] 3) Extraction and detection of chicken genomic DNA:

[0029] Chicken genomic DNA was extracted from the experimental chicken blood samples using the phenol-chloroform method, and the integrity of the DNA was determined by gel electrophoresis. The quality of the extracted DNA was tested, and the concentration was adjusted to 50 ng / μL to prepare a hen whole genome DNA sample.

[0030] 4) Genotype determination and correlation analysis between genotype data and fertilization rate of hens laying eggs for 10 days:

[0031] Primer sequences:

[0032] CAV-E3-F206:AAAATACTGGTTTTATCGCT(SEQ ID NO.2)

[0033] CAV-E3-R332:TGCACTGGATCTCAATCAGG(SEQ ID NO.3)

[0034] Reaction system: 2×PCR buffer (including Taq enzyme, etc.) 5μL; CAV-E3-F206: 0.12μL (10μM); CAV-E3-R332: 0.12μL (10μM); DNA template: 1.2μL; ddH2O: 3.56μL, total: 10μL.

[0035] Amplification conditions: 95°C for 5 min; (95°C for 30 s; 51.5°C for 30 s; 72°C for 30 s) for 35 cycles; 72°C for 5 min; 25°C for 1 min.

[0036] Enzyme digestion and electrophoresis: PCR product 5.0 μL, 10× enzyme digestion buffer 1.0 μL, ddH2O: 4.0 μL, Bst4CI enzyme 1 UI.

[0037] The amplified product can be cut into two fragments of 22bp and 124bp after Bst4CI digestion. The AA genotype shows one band (124bp), the GG genotype shows one band (146bp), and the heterozygous AG shows two bands (146bp+124bp). The various genotypes are shown in Figure 2 .

[0038] 5) Analyze the results

[0039] We used a total of 907 hens in a group whose fertilization rate at 10 days of egg laying had been measured to perform restriction fragment length polymorphism analysis (PCR-RFLP) on the SNP and compare the fertilization rate at 10 days of egg laying of hens with different genotypes. From the results in Table 1, it can be seen that the polymorphism of this SNP site is significantly associated with the fertilization rate at 10 days of egg laying of hens (P<0.05), and the GG genotype is a favorable marker for the fertilization rate of hens.

[0040] Table 1 Results of association analysis between SNP loci and fertilization rate of hens laying eggs for 10 days

[0041]

[0042] Note: 10-day fertilization rate: the proportion of fertilized eggs in eggs produced by hens within 10 days after artificial insemination; SNP genotypes with different shoulder marks in the trait indicate significant differences (P<0.05). * indicates significant difference, P<0.05, and the trait values ​​(10-day fertilization rate) in the table are mean ± standard deviation. Sequence Listing <110> Hubei Xinhua Ecological Livestock and Poultry Development Co., Ltd. <120> SNP molecular markers for selecting fertilization rate of hens laying eggs for 10 days and their application <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 60 <212> DNA <213> Artificial Sequence <400> 1 ttttaccact ttcactgtaa caaaatactg gttttatcgc ttrctgtcag caatctttgg 60 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 aaaatactgg ttttatcgct 20 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 tgcactggat ctcaatcagg 20

Claims

1. Application of a reagent for detecting SNP markers in selecting or improving the fertilization rate of Jinghong No. 1 hens, characterized in that: The polymorphic site of the SNP marker is located at the 43rd base of the nucleotide sequence shown in SEQ ID NO. 1, the 43rd base R is A or G, and hens with the GG genotype have a high fertilization rate after laying eggs for 10 days.

2. The use according to claim 1, characterized in that: The primers for amplifying the SNP marker are shown in SEQ ID NOs. 2 and 3.

Images