Delivery, uses, and therapeutic applications of CRISPR-CAS systems and compositions for targeting disorders and diseases with viral components
By developing and applying the CRISPR-Cas system, the problem of difficulty in realizing genome editing and gene therapy in the prior art is solved, flexible and efficient editing of the genome is achieved, and an affordable and easy-to-use tool is provided.
Patent Information
- Application Number
- CN202111206158.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2014-04-15
- Filing Date
- 2014-06-11
- Publication Date
- 2025-06-24
- Estimated Expiration
- 2034-06-11
AI Technical Summary
The prior art is difficult to provide an affordable, easy to establish, scalable, and capable of targeting multiple locations within the eukaryotic genome for genome editing and gene therapy.
The CRISPR-Cas system is developed and applied to cleave genomic DNA through CRISPR enzymes to achieve gene editing and gene therapy using the specific binding of guide RNA to target polynucleotides.
The technology simplifies the genome editing process, improves the ability to map biological functions and disease-related genetic factors, and provides a flexible and efficient tool for gene therapy and drug discovery.
Smart Images

Figure CN114015726B_ABST
Abstract
Description
[0001] Related Applications and Cross - References
[0002] This application claims priority for U.S. purposes from U.S. Provisional Patent Application 61 / 836,123, filed on June 17, 2013; 61 / 847,537, filed on July 17, 2013; 61 / 862,355, filed on August 5, 2013; 61 / 871,301, filed on August 28, 2013; 61 / 915,225, filed on December 12, 2013; 61 / 979,879, filed on April 15, 2014; and PCT / US2013 / 074667, filed on December 12, 2013, and this application is also a partial continuation application; and, to the extent permitted under U.S. law, the U.S. equivalents or national phase thereof may further claim and claim priority for PCT / US2013 / 074667 and for the applications from which PCT / US2013 / 074667 claims priority.
[0003] The foregoing applications, and all documents cited in them or during their examination proceedings or ("application - cited documents") and all documents cited or referenced in these application - cited documents, and all documents cited or referenced in this application ("documents cited herein"), and all documents cited or referenced in the documents cited herein, together with the instructions, specifications, product descriptions, and product sheets of any manufacturer of any product mentioned in this application or incorporated herein by reference, are hereby incorporated by reference into this application and may be used in the practice of the present invention. More specifically, all referenced documents are incorporated by reference into this application to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference. Field of the Invention
[0004] The present invention generally relates to the delivery, engineering, optimization, and therapeutic applications of systems, methods, and compositions for controlling gene expression involving sequence targeting, such as genomic interference or gene editing involving Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and its components. Specifically, the present invention relates to aspects related to viral vector delivery, gene therapy via viral vector delivery, and understanding gene function and creating models via viral vector delivery.
[0005] Recent advances in genomic sequencing technologies and analytical methods have significantly accelerated the ability to catalog and map genetic factors associated with a wide range of biological functions and diseases. Precise genome targeting technologies are needed to enable systematic reverse engineering of causal genetic variations by allowing selective perturbation of individual genetic elements, as well as to advance synthetic biology, biotechnological applications, and medical applications. Although genome editing technologies, such as designer zinc fingers, transcription activator-like effector (TALE), or homing meganucleases, are available for generating targeted genome perturbations, there is still a need for new genome engineering technologies that are affordable, easy to establish, scalable, and amenable to targeting multiple locations within the eukaryotic genome. Summary of the Invention
[0006] The present invention relates to the development and application of the CRISPR / Cas9 system as a tool for sequence targeting, such as genomic perturbation or gene editing of a gene or genome, to address diseases and disorders using viral components.
[0007] The CRISPR-Cas system does not require the generation of custom proteins for target-specific sequences. Instead, a single Cas enzyme can be programmed by short RNA molecules that recognize specific DNA targets. Adding the CRISPR-Cas system to the repertoire of genomic sequencing technologies and analytical methods can significantly simplify the methodology and improve the ability to catalog and map genetic factors associated with a wide range of biological functions and diseases. To effectively and harmlessly utilize the CRISPR-Cas system for genome editing, it is crucial to understand aspects such as the engineering, optimization, and cell type / tissue / organ-specific delivery of these genome engineering tools, which are aspects claimed in the present invention.
[0008] There is an urgent need for alternative robust systems and technologies for nucleic acid sequence targeting for a wide range of applications. Aspects of the present invention address this need and provide related advantages. Exemplary CRISPR complexes include a CRISPR enzyme complexed with a guide sequence that hybridizes to a target sequence within a target polynucleotide. The guide sequence is linked to a tracr pairing sequence that in turn hybridizes to a tracr sequence.
[0009] In a first aspect, the present invention provides a method for modifying a biological or non-human organism by manipulating a target sequence at a genomic locus of interest, the method comprising delivering a non-naturally occurring or engineered composition that can comprise a viral vector system, the viral vector system can comprise one or more viral vectors, the one or more viral vectors operably encode a composition for its expression, wherein the non-naturally occurring or engineered composition can comprise:
[0010] (A) A non-naturally occurring or engineered composition that can comprise a vector system, the vector system can comprise one or more vectors, the one or more vectors can comprise
[0011] I. A first regulatory element operably linked to a CRISPR-Cas system RNA polynucleotide sequence, wherein the polynucleotide sequence can comprise
[0012] (A) A guide sequence capable of hybridizing to a target sequence in a eukaryotic cell,
[0013] (b) A tracr pairing sequence, and
[0014] (c) A tracr sequence, and
[0015] II. A second regulatory element operably linked to an enzyme-encoding sequence encoding a CRISPR enzyme, the CRISPR enzyme optionally can comprise at least one or more nuclear localization sequences, wherein (A), (b) and (c) are arranged in a 5' to 3' direction,
[0016] wherein components I and II are on the same or different vectors of the system,
[0017] wherein upon transcription, the tracr pairing sequence hybridizes to the tracr sequence, and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and
[0018] wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) a guide sequence hybridized to the target sequence and (2) a tracr pairing sequence hybridized to the tracr sequence
[0019] (B) A non-naturally occurring or engineered composition that can comprise a vector system, the vector system can comprise one or more vectors, the one or more vectors can comprise
[0020] I. A first regulatory element operably linked to
[0021] (A) A guide sequence that is capable of hybridizing to a target sequence in a eukaryotic cell, and
[0022] (b) At least one or more tracr pairing sequences,
[0023] II. A second regulatory element that is operably linked to an enzyme-encoding sequence encoding a CRISPR enzyme, and
[0024] III. A third regulatory element that is operably linked to a tracr sequence,
[0025] wherein components I, II, and III are located on the same or different vectors of the system,
[0026] wherein upon transcription, the tracr pairing sequence hybridizes to the tracr sequence, and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and
[0027] wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) a guide sequence hybridized to the target sequence and (2) a tracr pairing sequence hybridized to the tracr sequence.
[0028] In one aspect, the present invention provides methods of using one or more elements of a CRISPR-Cas system. The CRISPR complexes of the present invention provide an effective means for modifying target polynucleotides. The CRISPR complexes of the present invention have a wide variety of utilities, including modifying (e.g., deleting, inserting, transposing, inactivating, activating) target polynucleotides in a variety of cell types in various tissues and organs. Because of this, the CRISPR complexes of the present invention have a broad spectrum of applications in, for example, gene or genome editing, gene therapy, drug discovery, drug screening, disease diagnosis, and prognosis. In vivo, in vitro, and ex vivo uses are envisioned.
[0029] Aspects of the present invention relate to a Cas9 enzyme and a nucleic acid molecule encoding it that are less in length than wild-type Cas9 enzyme, have improved targeting specificity, and are in a CRISPR-Cas9 system with a guide RNA having optimized activity, and a chimeric Cas9 enzyme, and methods of improving the targeting specificity of a Cas9 enzyme or designing a CRISPR-Cas9 system, the methods may include designing or preparing a guide RNA having optimized activity and / or selecting or preparing a Cas9 enzyme having a smaller size or length than wild-type Cas9, whereby packaging the nucleic acid encoding it into a delivery vector is more advanced (since less coding for it is in the delivery vector than wild-type Cas9), and / or generating a chimeric Cas9 enzyme.
[0030] The use of the sequences, vectors, enzymes or systems of the present invention in medicine is also provided. Their use in gene or genome editing is also provided. This relates to post-mitotic cell tissues or cells, whether in vivo or ex vivo,
[0031] In a further aspect of the invention, the Cas9 enzyme can comprise one or more mutations and can be used as a general DNA-binding protein with or without fusion to a functional domain. These mutations can be artificially introduced mutations or gain-of-function and loss-of-function mutations. These mutations can include, but are not limited to, mutations in one of the catalytic domains (D10 and H840) in the RuvC and HNH catalytic domains, respectively. Other mutations have been characterized. In one aspect of the invention, the transcriptional activation domain can be VP64. In other aspects of the invention, the transcriptional repressor domain can be KRAB or SID4X. Other aspects of the invention relate to mutant Cas9 enzymes fused to domains including, but not limited to, transcriptional activators, repressors, recombinases, transposases, histone remodelers, demethylases, DNA methyltransferases, cryptochromes, photoinducible / controllable domains or chemically inducible / controllable domains.
[0032] In a further embodiment, the present invention provides methods for generating mutant tracrRNAs and direct repeat sequences or mutant chimeric guide sequences that allow enhanced performance of these RNAs in cells. Aspects of the invention also provide the selection of said sequences.
[0033] Aspects of the invention also provide methods for simplifying the cloning and delivery of components of the CRISPR complex. In a preferred embodiment of the invention, a suitable promoter, such as the U6 promoter, is amplified together with a DNA oligonucleotide and added to the guide RNA. The resulting PCR product is then transfected into cells to drive the expression of the guide RNA. Aspects of the invention also relate to guide RNAs that are in vitro transcribed or ordered from a synthetic company and directly transfected.
[0034] In one aspect, the present invention provides methods for increasing activity by using a more active polymerase. In a preferred embodiment, the expression of these guide RNAs under the control of the T7 promoter is driven by the expression of T7 polymerase in the cell. In an advantageous embodiment, the cell is a eukaryotic cell. In a preferred embodiment, the eukaryotic cell is a human cell. In a more preferred embodiment, the human cell is a patient-specific cell.
[0035] In one aspect, the present invention provides methods for reducing the toxicity of Cas enzymes. In certain aspects, the Cas enzyme is any Cas9 as described herein, such as any naturally occurring bacterial Cas9 and any chimeric, mutant, homolog, or ortholog. In a preferred embodiment, the Cas9 is delivered into the cell in the form of mRNA. This allows transient expression of the enzyme, thereby reducing toxicity. In another preferred embodiment, the present invention also provides methods for expressing Cas9 under the control of an inducible promoter, and constructs used therein.
[0036] In another aspect, the present invention provides methods for improving the in vivo application of the CRISPR-Cas system. In the preferred embodiment, the Cas enzyme is the wild-type Cas9 or any modified version described herein, including any naturally occurring bacterial Cas9 and any chimeric, mutant, homolog, or ortholog. An advantageous aspect of the present invention provides a selection of Cas9 homologs that are readily packaged into viral vectors for delivery. Cas9 orthologs typically share a common structure of 3-4 RuvC domains and one HNH domain. The most 5' RuvC domain cleaves the non-complementary strand, while the HNH domain cleaves the complementary strand. All designations are with respect to the guide sequence.
[0037] The catalytic residues in the 5' RuvC domain were identified by homology comparison of the Cas9 of interest with other Cas9 orthologs (from the type II CRISPR locus of Streptococcus pyogenes, the CRISPR locus 1 of Streptococcus thermophilus, the CRISPR locus 3 of Streptococcus thermophilus, and the type II CRISPR locus of Franciscilla novicida), and the conserved Asp residue (D10) was mutated to alanine to convert Cas9 into a complementary strand nickase. Similarly, the conserved His and Asn residues in the HNH domain were mutated to alanine to convert Cas9 into a non-complementary strand nickase. In some embodiments, both sets of mutations can be made, converting Cas9 into a non-cleaving enzyme.
[0038] In some embodiments, the CRISPR enzyme is a type I or type III CRISPR enzyme, preferably a type II CRISPR enzyme. Such type II CRISPR enzymes can be any Cas enzyme. Preferred Cas enzymes can be identified as Cas9, as this can refer to a general class of enzymes that share homology with the largest nuclease having multiple nuclease domains from a type II CRISPR system. Most preferably, the Cas9 enzyme is from or derived from spCas9 or saCas9. By "derived", the applicant means that the derived enzyme is largely based on the meaning of having a high sequence homology with the wild-type enzyme, but has been mutated (modified) in certain aspects as described herein.
[0039] It should be understood that the terms "Cas" and "CRISPR enzyme" are generally used interchangeably herein, unless otherwise indicated. As mentioned above, many of the residue numbers used herein refer to the Cas9 enzyme from the type II CRISPR locus in Streptococcus pyogenes. However, it should be understood that the present invention encompasses more Cas9s from other microbial species, such as SpCas9, SaCas9, St1Cas9, etc. Additional examples are provided herein. A person skilled in the art will be able to determine the appropriate corresponding residues in Cas9 enzymes other than SpCas9 by comparing the relevant amino acid sequences. Thus, where a specific amino acid substitution refers to the use of SpCas9 numbering, then, unless the context clearly indicates otherwise, this is not intended to refer to other Cas9 enzymes, and the present disclosure is intended to cover the corresponding modifications in other Cas9 enzymes. SpCas or SaCas9 are particularly preferred Cas9 enzymes.
[0040] Examples of codon-optimized sequences optimized for humans in this context (i.e., optimized for expression in humans) are provided herein, see the SaCas9 human codon-optimized sequence. While this is optimized, it should be understood that other examples are possible and codon optimization for host species is known.
[0041] In additional embodiments, the present invention provides methods for enhancing the function of Cas9 by generating chimeric Cas9 proteins. The chimeric Cas9 protein, chimeric Cas9, can be a new Cas9 containing fragments from more than one naturally occurring Cas9. These methods can include fusing the N-terminal fragment of one Cas9 homolog with the C-terminal fragment of another Cas9 homolog. These methods also allow for the selection of new properties exhibited by these chimeric Cas9 proteins.
[0042] It should be understood that in the method of the present invention, in the case where the organism is an animal or a plant, the modification can be carried out ex vivo or in vitro, for example, in cell culture, and in some cases not in vivo. In other embodiments, it can be carried out in vivo.
[0043] In one aspect, the present invention provides a method for modifying an organism or a non-human organism by manipulating a target sequence at a genomic locus of interest, the method comprising:
[0044] delivering a non-naturally occurring or engineered composition, the composition comprising:
[0045] A)-I. A CRISPR-Cas system RNA polynucleotide sequence, optionally a chimeric RNA (chiRNA) polynucleotide sequence, wherein the polynucleotide sequence can comprise:
[0046] (a) A guide sequence that is capable of hybridizing to a target sequence in a eukaryotic cell,
[0047] (b) A tracr pairing sequence, and
[0048] (c) A tracr sequence, and
[0049] II. A polynucleotide sequence encoding a CRISPR enzyme comprising at least one or more nuclear localization sequences,
[0050] wherein (a), (b), and (c) are arranged in the 5' to 3' direction,
[0051] wherein upon transcription, the tracr pairing sequence hybridizes to the tracr sequence, and the guide sequence directs the sequence-specific binding of the CRISPR complex to the target sequence, and
[0052] wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) a guide sequence hybridized to the target sequence and (2) a tracr pairing sequence hybridized to the tracr sequence, and the polynucleotide sequence encoding the CRISPR enzyme is DNA or RNA,
[0053] or
[0054] (B)I. A polynucleotide, which can comprise:
[0055] (a) A guide sequence that is capable of hybridizing to a target sequence in a eukaryotic cell, and
[0056] (b) At least one or more tracr pairing sequences,
[0057] II. A polynucleotide sequence encoding a CRISPR enzyme, and
[0058] III. A polynucleotide sequence comprising a tracr sequence,
[0059] wherein upon transcription, the tracr pairing sequence hybridizes to the tracr sequence, and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and
[0060] wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence hybridized to the target sequence and (2) the tracr pairing sequence hybridized to the tracr sequence, and the polynucleotide sequence encoding the CRISPR enzyme is DNA or RNA.
[0061] In some embodiments, applicable to any or all aspects provided herein, the above second alternative (B) is preferred. However, the first alternative (A) is particularly preferred. This applies to all aspects of the invention characterized by these two alternative CRISPR pathways.
[0062] It should be understood that this application is directed to viral vector delivery, whether to the organ itself or the tissue within it, or to just one or more target cells. Target cells are those selected for delivery of the CRISPR-Cas system. For example, in the case of delivery to the liver, such target cells can be hepatocytes, preferably primary hepatocytes. Target cells can be contained within a vertebrate (a patient in the sense of an animal in need of CRISPR-directed gene therapy or a model organism), or can be in cell culture, an organoid, or other ex vivo tissue (such as a "liver-on-a-chip" in which hepatocytes are seeded and grown on a scaffold). Harvested hepatocytes from non-transplanted organs are also useful target cells. With the development of 3-D printing technology applied to biology, printed tissues are within reach, and it is entirely feasible to target liver cells or tissues printed in the form of an organoid or printed on a chip. The discussion of hepatocytes herein can equally apply to other liver cells and in fact generally to other cell types, such as brain or kidney cells, examples of which are provided herein.
[0063] Accordingly, there are provided model organisms that can include liver cells such as hepatocytes, to which the CRISPR-Cas system of the present invention has been delivered. Similarly, there are provided ex vivo collections of two or more liver cells such as hepatocytes, to which the CRISPR-Cas system of the present invention has been delivered. Such collections can include liver organs, liver organoids, liver cells ('liver-on-a-chip') that occupy a scaffold. Of course, non-liver alternatives such as the brain or kidney are again envisioned, although the liver is provided as an example herein because it is preferred. Methods for creating such models or collections are also provided.
[0064] Specifically, such target cells can express or include a polynucleotide capable of expressing a Cas enzyme. As discussed herein, this has the advantage of providing a ready-to-use model for interrogating gene function by gene interference (including knockdown). This is particularly useful in studying liver disorders such as amyloidosis and other items listed herein, along with more general disorders such as obesity.
[0065] Also provided herein are methods for interrogating liver gene function. These typically involve delivering the CRISPR-Cas system to target cells in vivo or ex vivo. However, if the cell already contains Cas, whether expressed as a protein or encoded by a polynucleotide already present within the cell, then only the CRISPR polynucleotide needs to be delivered. The method can include extracting from and optionally reinserting into a target tissue, organ, organoid, chip, or cell collection as discussed herein. By delivery is meant physically delivering the polynucleotide to the cell nucleus and transfecting it.
[0066] Methods for gene therapy are also envisioned. For example, correction of one or more defective genotypes (e.g., single point mutations) can be achieved by using the CRISPR-Cas system (including models) of the present invention as discussed herein in liver cells. Monogenic disorders associated with the liver are particularly preferred and are exemplified herein. See Example 38, where the CRISPR-Cas9 system target is ApoB, a lipid metabolism gene, effective in inducing a phenotypic change in vivo. Compositions for use in gene therapy are also provided.
[0067] The disorders for research and gene therapy are numerous and vary due to the wide application of CRIPS-Cas technology. Suitable examples are provided herein, including in Tables A, B, and C. Any one of these can be selected and each is preferred. Some particularly preferred but non-limiting examples are the disorders specifically exemplified herein and any monogenic disorder, and in particular cystic fibrosis (CFTR).
[0068] Although various Cas enzymes are envisioned, Cas9 is particularly preferred, and the Applicant has shown particular efficacy of SaCa9 in the liver. If the Cas enzyme is a Sa Cas enzyme, the Tracr sequence from Sa is also preferred. The PAM suitable in this case is NNGRR.
[0069] Although a single guide may be used, so-called multiplexing with two, three, four or more guides is particularly useful in interrogating gene function and model creation (to provide multiple gene knockdowns), and also particularly useful in gene therapy where multiple defective genotypes are to be corrected (multiple errors in a single gene, or more likely multiple errors distributed across several genes). Alternatively, multiplexing with two guides can be used in the dual incision enzyme pathway to reduce off-target effects or can be used simply to select multiple targets within a single gene to ensure Cas recruitment. Triple and quadruple guides are preferred. References to genes herein can be interchanged with genomic loci.
[0070] The intron pathway described herein is also useful in this regard, where the guide is located within the Cas intron.
[0071] Preferred delivery means include methods described by Kanasty et al. below, such as LNPs, especially where only the guide is to be delivered or it is to be delivered alone. However, viral vectors (including lentiviruses and AAVs) are generally preferred. Specifically, they are preferred for delivery to the liver because they have been successful so far. Among these, AAV is preferred, and especially serotype 8, where AAV2 / 8 has been shown to be effective.
[0072] Some preferred target disorders and genes, to the extent that they are present in the liver or kidney or are disorders of the liver or kidney, are metabolic disorders, such as any of the following: amyloid neuropathy (TTR, PALB); amyloidosis (APOA1, APP, AAA, CVAP, AD1, GSN, FGA, LYZ, TTR, PALB); cirrhosis (KRT18, KRT8, CIRH1A, NAIC, TEX292, KIAA1988); cystic fibrosis (CFTR, ABCC7, CF, MRP7); glycogen storage disease (SLC2A2, GLUT2, G6PC, G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM); hepatic adenoma, 142330 (TCF1, HNF1A, MODY3), liver failure, early onset and neurological disorders (SCOD1, SCO1), hepatic lipase deficiency (LIPC), hepatoblastoma, cancer and carcinomas (CTNNB1, PDGFRL, PDGRL, PRLTS, AXIN1, AXIN, CTNNB1, TP53, P53, LFS1, IGF2R, MPRI, MET, CASP8, MCH5; medullary cystic kidney disease (UMOD, HNFJ, FJHN, MCKD2, ADMCKD2); phenylketonuria (PAH, PKU1, QDPR, DHPR, PTS); polycystic kidney and liver disease (FCYT, PKHD1, ARPKD, PKD1, PKD2, PKD4, PKDTS, PRKCSH, G19P1, PCLD, SEC63). Other preferred targets include any one or more of the following, including one or more of the following: PCSK9; Hmgcr; SERPINA1; ApoB; and / or LDL.
[0073] It should be understood that methods of altering expression in target cells may not involve germline alterations, which may be excluded on ethical grounds. In fact, although transfection of stem cells is envisioned and is of course preferred in some embodiments, non-stem cells (i.e., post-mitotic cells) are particularly preferred, especially when they can be shown or stimulated to show some regeneration, as seen in hepatocytes.
[0074] Type II CRISPR is particularly preferred, especially for use in eukaryotes, as in the case of the present invention, where the liver is only found in eukaryotes, especially vertebrates (in any case).
[0075] The use of the CRISPR-Cas system to effect phenotypic changes is a particular advantage, especially in vivo.
[0076] When contemplating therapeutic applications, or other genome engineering in target cells, it will be understood that in cases where correction is needed, after the generation or cleavage of a nick in the genomic DNA target, correction via the HDR pathway is preferred. For gene knockdown, NHEJ is advantageous; however, correction via the HDR pathway is preferred for therapy. In such cases, it is preferred to deliver a repair template. This is most preferably ssDNA, although it is also possible that RNA provides the corresponding DNA template via a retroviral vector. One skilled in the art can readily put the present invention into practice based on the teachings contributing to the knowledge in this field; and in this regard, it should be mentioned that one skilled in the art can readily understand and implement the considerations regarding the length of the homologous arms based on the teachings contributing to the knowledge in this field. The patent applications and publications mentioned include those of the present inventor Zhang, including those cited herein. The repair template is preferably co-delivered with one or more elements of the CRISPR-Cas system.
[0077] Also provided is a method of altering the expression of at least one liver gene product, the method may include introducing an engineered, non-naturally occurring clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system into a eukaryotic cell (the cell containing and expressing a DNA molecule having a cellular target sequence and encoding the gene product), the system may include one or more vectors, the one or more vectors may include:
[0078] a) a first regulatory element that is operable in a eukaryotic cell and operably linked to at least one nucleotide sequence encoding a CRISPR-Cas system guide RNA that hybridizes to the target sequence, and
[0079] b) a second regulatory element that is operable in a eukaryotic cell and operably linked to a nucleotide sequence encoding a Type-II Cas9 protein,
[0080] wherein components (a) and (b) are located on the same or different vectors of the system, whereby the guide RNA targets the target sequence and the Cas9 protein cleaves the DNA molecule, whereby the expression of at least one liver gene product is altered; and, wherein the Cas9 protein and the guide RNA do not naturally occur together.
[0081] The mention of a target below will be understood to refer to a gene or a cell, but typically a gene, unless otherwise clearly indicated.
[0082] The same applies to all aspects of the present invention. When the liver may be mentioned herein, this is understood to refer generally to post-mitotic cells, in particular the kidney or the brain. The target sequence is preferably a post-mitotic cell target sequence. The post-mitotic cell may be in or from (i.e., the source of the cell or cell type) any of the following organs, or may be an organoid or an in vitro model or collection of cells comprising the following:
[0083] Kidney, such as glomerular cells;
[0084] The digestive system, including the stomach, pancreas, duodenum, ileum, and / or colon;
[0085] Heart;
[0086] Lung;
[0087] Brain, particularly neurons, and / or the overall CNS;
[0088] Eye, including retinal tissue;
[0089] Ear, including the inner ear;
[0090] Skin;
[0091] Muscle;
[0092] Bone; and / or
[0093] Liver (generally), although this is excluded in some embodiments as it is the subject of separate administration.
[0094] The brain and the kidney are particularly preferred. In some embodiments, the cell is a brain cell, such as a neuron. In some embodiments, the cell is a kidney cell.
[0095] Preferred kidney cells include any one or more of the following:
[0096] · Kidney glomerulus parietal cell;
[0097] · Glomerular podocyte;
[0098] · Renal proximal tubule brush border cell;
[0099] · Loop of Henle thin segment cell;
[0100] · Thick ascending limb cell;
[0101] · Renal distal tubule cell;
[0102] · Renal collecting duct cell; and
[0103] · Interstitial renal cells.
[0104] Preferred examples of target cells are provided in the table below, under the appropriate section such as titled 'Kidney' or 'Liver' or 'Bone' or 'Ear' (any of which is preferred), and in Table B. Any one or more of these targets are preferred. Examples 1 and 18 also target renal cells (although stem cells, which are not post-mitotic cells), but the taught re-delivery may be applicable.
[0105] In some particularly preferred embodiments, the manipulation causes a phenotypic change in the cell.
[0106] In some embodiments, the phenotypic change can be caused in the cell in vivo or maintained in the cell in vivo. The cell is transfected in vivo or extracted, transfected ex vivo and then re-inserted (transplanted) back into the same or a different host.
[0107] The expression of the CRISPR enzyme and optionally the guide sequence can be under the control of a promoter specific for the cell, which promoter is, for example, contained within an expression cassette capable of expressing the enzyme and optionally the guide sequence in the post-mitotic cell. In other words, the CRISPR enzyme and optionally the guide sequence are operably linked to the promoter specific for the target cell.
[0108] The target cell can be a post-mitotic cell. The AAV vector system is particularly preferred, especially when the post-mitotic cell is a neuron. Somatic cells are also preferred.
[0109] The promoter of the CRISPR enzyme and optionally the promoter of the guide sequence can be the same or different.
[0110] The discussion herein, especially below, also applies to any method, use or composition described herein. The CRISPR-Cas system RNA can be chimeric RNA (ChiRNA). The CRISPR-Cas system can be a multiplex CRISPR enzyme system, which further includes multiple chimeras and / or multiple multi-guide sequences and a single tracr sequence. The CRISPR enzyme can be a nuclease that guides cleavage of both strands at the target sequence position. The CRISPR enzyme can include one or more mutations. The CRISPR enzyme can include one or more mutations D10A, E762A, H840A, N854A, N863A or D986A. The one or more mutations can be in the RuvC1 domain of the CRISPR enzyme. The CRISPR enzyme can be a nickase that guides cleavage at the target sequence position. The nickase can be a dual nickase. At least two or more NLSs are preferred.
[0111] The CRISPR enzyme can be of type II, preferably Cas and most preferably Cas9. A reference to Cas or Cas9 (e.g., in CRISPR-Cas or CRISR Cas9) will be understood to be any Cas, most preferably Cas9 and in particular Sa Cas9 or Sp Cas9 (including all mutations such as D10A to provide DSB, nickase or dual nickase function).
[0112] The CRISPR enzyme can have one or more mutations in the catalytic domain, wherein upon transcription, the tracr pairing sequence hybridizes to the tracr sequence, and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and wherein the enzyme further comprises a functional domain. The functional domain can be a transcriptional activation domain. The transcriptional activation domain can be VP64.
[0113] The method can further comprise minimizing off-target modification by manipulating first and second target sequences on opposing strands of a DNA duplex at a genomic locus of interest in a cell, including
[0114] delivering a non-naturally occurring or engineered composition comprising:
[0115] I. A CRISPR-Cas system chimeric RNA (chiRNA) polynucleotide sequence, wherein the polynucleotide sequence comprises:
[0116] (a) A first guide sequence capable of hybridizing to the first target sequence,
[0117] (b) A first tracr pairing sequence,
[0118] (c) A first tracr sequence,
[0119] (d) A second guide sequence capable of hybridizing to the second target sequence,
[0120] (e) A second tracr pairing sequence, and
[0121] (f) A second tracr sequence, and
[0122] optionally, wherein a linker sequence is present between the first tracr sequence and the second guide sequence whereby the first guide sequence and the second guide sequence are in tandem; and
[0123] II. A polynucleotide sequence encoding a CRISPR enzyme comprising at least one or more nuclear localization sequences, wherein (a), (b), (c), (d), (e) and (f) are arranged in the 5' to 3' direction, wherein the polynucleotide sequence comprises a linker sequence between the first tracr sequence and the second guide sequence, whereby the first guide sequence and the second guide sequence are in tandem, and wherein upon transcription, the first tracr pairing sequence and the second tracr pairing sequence hybridize to the first tracr sequence and the second tracr sequence respectively, and the first guide sequence and the second guide sequence direct the sequence-specific binding of a first CRISPR complex and a second CRISPR complex to the first target sequence and the second target sequence respectively,
[0124] or
[0125] II. A second regulatory element, the second regulatory element being operably linked to an enzyme-encoding sequence encoding a CRISPR enzyme, and wherein components I and II are on the same or different vectors of the system, and upon transcription, the first tracr pairing sequence hybridizes to the first tracr sequence, and the first guide sequence and the second guide sequence direct the sequence-specific binding of a first CRISPR complex and a second CRISPR complex to the first target sequence and the second target sequence respectively;
[0126] wherein the first CRISPR complex comprises a CRISPR enzyme complexed with (1) the first guide sequence hybridized to the first target sequence, and (2) the first tracr pairing sequence hybridized to the first tracr sequence,
[0127] wherein the second CRISPR complex comprises a CRISPR enzyme complexed with (1) the second guide sequence hybridized to the second target sequence, and (2) the second tracr pairing sequence hybridized to the second tracr sequence,
[0128] wherein the polynucleotide sequence encoding the CRISPR enzyme is DNA or RNA, and
[0129] wherein the first guide sequence directs cleavage of one strand of the DNA duplex adjacent to the first target sequence, and the second guide sequence directs cleavage of the other strand of the DNA duplex adjacent to the second target sequence, thereby inducing a double-strand break, whereby the organism or the non-human organism is modified by minimizing off-target modifications.
[0130] In some embodiments, the second alternative (B) above is preferred. However, the first alternative (A) is particularly preferred. This applies to all aspects of the present invention characterized by these two alternative CRISPR pathways.
[0131] It should be understood that the present application is directed to post-mitotic cells, whether the organ itself or the tissue within it, or just one or the post-mitotic cells, such as neurons. Neurons and renal cells are preferred. Post-mitotic cells can be contained within a vertebrate (a patient in the sense of an animal in need of CRISPR-directed gene therapy or a model organism), or can be in cell culture, an organoid, or other ex vivo tissue (such as a 'liver-on-a-chip' where hepatocytes are seeded and grown on a scaffold). Harvested hepatocytes from non-transplanted organs are also useful targets. With the development of 3-D printing technology applied to biology, printed tissues are within reach, and it is entirely feasible that printed or printed-on-chip liver cells or tissues in the form of organoids can also be targeted. Non-liver alternatives are also envisioned, particularly for renal tissue or other post-mitotic cells / tissues.
[0132] Accordingly, there is provided a model organism comprising post-mitotic cells such as neurons or renal cells, to which the CRISPR-Cas system of the present invention has been delivered. Similarly, there is also provided an ex vivo collection of two or more post-mitotic cells such as neurons or renal cells, to which the CRISPR-Cas system of the present invention has been delivered. Such collections can include cells of post-mitotic organs, organoids, colonized scaffolds ('kidney-on-a-chip'). Methods for creating such models or collections are also provided.
[0133] Specifically, such post-mitotic cells can express or comprise a polynucleotide capable of expressing a Cas enzyme. As discussed herein, this has the advantage of providing a ready-to-use model for interrogating gene function by gene interference (including knockdown). This is particularly useful in studying disorders of post-mitotic cells such as the kidney or brain (such as those listed herein) along with more general disorders (such as obesity).
[0134] Also provided herein are methods for interrogating the gene function of post-mitotic cells. These typically involve delivering the CRISPR-Cas system to post-mitotic cells in vivo or ex vivo. However, if the cell already contains Cas, whether expressed as a protein or encoded by a polynucleotide already contained within the cell, then only the CRISPR polynucleotide needs to be delivered. The method can include extracting from the post-mitotic cell and optionally reinserting back into the post-mitotic cell. By delivery, it means physically delivering the polynucleotide to the nucleus and transfecting. Thus, delivery should also be construed to include transfection unless otherwise clearly indicated.
[0135] Also provided is a method of inducing gene interference in one or more animal or plant cells, the method comprising transducing a first cell population with a CRISPR-Cas system according to the invention, thereby altering the genome of the first cell population to obtain a second cell population. The method can be carried out ex vivo or in vitro, for example in cell culture or in an ex vivo or in vitro model (such as an organoid or 'animal or plant cell on a chip'). Alternatively, the method can be in vivo, in which case it can also include isolating the first cell population from the subject and transplanting (back) the second cell population into the subject. The gene interference can be directed against one or more, or two or more, or three or more, or four or more genes. The gene interference can be a reduction in gene function (i.e., the activity of the encoded gene product). This can be induced, for example, by altering the genome of the first cell population to obtain a second cell population, wherein the second cell population has a defective genotype, such as a monogenic disorder not present in the first cell population. This may require a corresponding repair template, as discussed herein, to provide the defective sequence, or it can be by induction of DSB. Specifically, the gene interference is gene knockdown. In some embodiments, the animal or plant cell is most preferably a post-mitotic cell, such as a kidney or brain (neuron) cell or a liver cell, such as a primary hepatocyte.
[0136] Alternatively, the gene interference can be an increase in gene function (i.e., the activity of the encoded gene product). This can be induced, for example, by altering the genome of the first cell population to obtain a second cell population, wherein the first cell population has a defective genotype, such as a monogenic disorder not present in (i.e., corrected in) the second cell population. This may require a corresponding repair template, as discussed herein, to provide the corrected sequence.
[0137] If multiplexing is used, a reduction of one or more genes and an increase of one or more genes are envisioned. This can be achieved by providing one or more guides (in a multiplex), and the corresponding repair templates can be used to reduce function, while one or more guides and their corresponding templates can be used to increase function.
[0138] Also provided is a method for interrogating the function of one or more genes in one or more animal or plant cells, the method comprising determining the expression change of one or more genes in a first animal or plant cell population, inducing gene interference in said first population to provide said second population having an altered genome (or genotype), and determining the expression change of one or more genes in the second animal or plant cell population, thereby interrogating the function of the one or more genes. In some embodiments, the animal or plant cell is most preferably a post-mitotic cell, such as a kidney or brain (neuron) cell or a liver cell, such as a primary hepatocyte.
[0139] Also provided is a model and a method for creating said model. The model can be an animal (in vivo model) comprising animal or plant cells, or it can be an ex vivo or in vitro model, such as an animal or plant organoid or 'animal or plant cells on a chip' or a collection of animal or plant cells (such as on a scaffold), as described herein. The animal or plant cells of either model will preferably be transfected with Cas9. Thus, there is provided exactly a model comprising one or more animal or plant cells comprising a CRISPR enzyme (preferably Cas9, such as SaCas9 or SpCas9). The model cells can have been transfected or transduced with a second regulatory element provided herein, the second regulatory element being operably linked to an enzyme-encoding sequence encoding a CRISPR enzyme, the CRISPR enzyme comprising at least one or more nuclear localization sequences (NLSs). The model can be an in vivo model as described above, or it can be an ex vivo or in vitro model. Such a model allows for rapid interrogation of the function of one or more genes, since only the CRISPR-Cas system polynucleotide sequence (comprising one or more guide sequences targeting the one or more genes) needs to be delivered to disrupt the function of the genes. In other words, the method for interrogating gene function in said model can comprise delivering only the CRISPR-Cas system polynucleotide sequence (comprising the one or more guide sequences), the Cas (CRISPR enzyme) having been provided in one or more cells of the model. Also provided are methods for creating such models, the methods comprising transducing or transfecting one or more animal or plant cells in a first animal or plant cell population with a second regulatory element operably linked to an enzyme-encoding sequence encoding a CRISPR enzyme, the CRISPR enzyme comprising at least one or more nuclear localization sequences (NLSs) as described herein, thereby providing a second animal or plant cell population comprising or expressing the CRISPR enzyme. In some embodiments, the animal or plant cell is most preferably a post-mitotic cell, such as a kidney or brain (neuron) cell or a liver cell, such as a primary hepatocyte.
[0140] Methods for creating gene perturbation models, particularly gene knockdown models, are also provided. These methods can typically include inducing gene interference of one or more genes in a first cell population, as described herein, thereby providing a second cell population having an altered genome (or genotype). The second cell population can then be seeded, for example, in a scaffold or on a chip, thereby providing an ex vivo or in vitro model. Alternatively, the second population can be included in an animal in vivo.
[0141] Methods of gene therapy are also envisioned. For example, correction of one or more defective genotypes (e.g., single point mutations) can be achieved by using the CRISPR-Cas systems (including the models) of the present invention discussed herein in post-mitotic cells. Single-gene disorders associated with post-mitosis are particularly preferred and are exemplified herein, see Example 36, where the CRISPR-Cas9 system target is ApoB (a lipid metabolism gene), effective in inducing a phenotypic change in vivo. Example 38 is instructive regarding the phenotypic behavioral changes seen in vivo in the brains of mice transduced with the systems of the present invention. Compositions for use in gene therapy are also provided.
[0142] Although various Cas enzymes are envisioned, Cas9 is particularly preferred, and we have shown particular efficacy for SaCas9 in the liver. If the Cas enzyme is a Sa Cas enzyme, the Tracr sequence from Sa is also preferred. The suitable PAM in this case is NNGRR.
[0143] Although one guide can be used, so-called multiplexing with two, three, four or more guides is particularly useful in interrogating gene function and model creation (to provide multiple gene knockdowns), and is also particularly useful in gene therapy where multiple defective genotypes are to be corrected (multiple errors in a single gene, or more likely multiple errors distributed across several genes). Alternatively, multiplexing with two guides can be used in a double-nicking enzyme approach to reduce off-target effects or can be used simply to select multiple targets within a single gene to ensure Cas recruitment. Triple and quadruple guides are preferred. References to genes herein can be interchanged with genomic loci.
[0144] The intron pathway described herein is also useful in this regard, where the guide is located within the Cas intron.
[0145] Preferred delivery means include methods described by Kanasty et al., such as LNPs, especially where only the guide is to be delivered or it is to be delivered alone. However, viral vectors including lentiviruses and AAVs are generally preferred for the liver as they have been successful to date. Among these, AAV is preferred, and especially serotype 8, where AAV2 / 8 has been shown to be effective. Some preferred targets, to the extent that they are present in the kidney or are kidney disorders, are metabolic disorders such as any of the following: amyloid neuropathy (TTR, PALB); amyloidosis (APOA1, APP, AAA, CVAP, AD1, GSN, FGA, LYZ, TTR, PALB); cirrhosis (KRT18, KRT8, CIRH1A, NAIC, TEX292, KIAA1988); cystic fibrosis (CFTR, ABCC7, CF, MRP7); glycogen storage disease (SLC2A2, GLUT2, G6PC, G6PT, G6PT1, GAA, LAMP2, LAMPB, AGL, GDE, GBE1, GYS2, PYGL, PFKM); hepatic adenoma, 142330 (TCF1, HNF1A, MODY3), liver failure, early onset and neurological disorders (SCOD1, SCO1), hepatic lipase deficiency (LIPC), hepatoblastoma, cancer and carcinomas (CTNNB1, PDGFRL, PDGRL, PRLTS, AXIN1, AXIN, CTNNB1, TP53, P53, LFS1, IGF2R, MPRI, MET, CASP8, MCH5; medullary cystic kidney disease (UMOD, HNFJ, FJHN, MCKD2, ADMCKD2); phenylketonuria (PAH, PKU1, QDPR, DHPR, PTS); polycystic kidney and liver disease (FCYT, PKHD1, ARPKD, PKD1, PKD2, PKD4, PKDTS, PRKCSH, G19P1, PCLD, SEC63). Other preferred targets include any one or more of the following: PCSK9, HMGCR, APOB, LDLR, ANGPTL3, F8, F9 / FIX, AAT, FAH, HPD, TAT, ATP7B, UGT1A1, OTC, ARH.
[0146] It should be understood that methods of altering expression in post-mitotic cells do not involve germline alterations, which may be excluded on ethical grounds. In fact, although transfection of stem cells is contemplated and in some embodiments is of course preferred, neurons or renal cells are particularly preferred, especially when they can show or be stimulated to show some regeneration.
[0147] Type II CRISPRs are particularly preferred, especially for use in eukaryotes, as in the case of the present invention, where the liver is only found in eukaryotes, especially vertebrates (in any case).
[0148] A particular advantage is the use of the CRISPR-Cas system to effect a phenotypic change, especially in vivo. We have shown this in the present application.
[0149] When contemplating therapeutic applications, or other genome engineering in post-mitotic cells, it will be understood that in cases where correction is needed, after cleavage or cutting of the genomic DNA target, correction via the HDR pathway is preferred. For gene knockdown, NHEJ is advantageous; however, correction via the HDR pathway is preferred for therapy. In such cases, it is preferred to deliver a repair template. This is most preferably ssDNA, although it is also possible that RNA provides the corresponding DNA template via a retroviral vector. A person skilled in the art can easily put the present invention into practice based on the teachings contributing to the knowledge in this field; and in this regard, it should be mentioned that a person skilled in the art can easily understand and implement the considerations regarding the length of the homologous arms based on the teachings contributing to the knowledge in this field. The patent applications and publications mentioned include those of the present inventor Zhang, including those cited herein. The repair template is preferably co-delivered with one or more elements of the CRISPR-Cas system.
[0150] There is also provided a method of altering the expression of at least one post-mitotic cell gene product, the method comprising introducing into a eukaryotic liver cell (the cell comprising and expressing a DNA molecule having a target sequence and encoding a gene product), such as a hepatocyte, an engineered, non-naturally occurring Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)-CRISPR associated (Cas) (CRISPR-Cas) system, the system comprising one or more vectors comprising:
[0151] a) a first regulatory element that is operable in a eukaryotic cell and operably linked to at least one nucleotide sequence encoding a CRISPR-Cas system guide RNA that hybridizes to the target sequence, and
[0152] b) a second regulatory element that is operable in a eukaryotic cell and operably linked to a nucleotide sequence encoding a Type-II Cas9 protein,
[0153] Component (a) and (b) are located on the same or different carriers of the system, whereby the guide RNA is targeted to the target sequence and the Cas9 protein cleaves the DNA molecule, whereby the expression of at least one post-mitotic cell gene product is altered; and, wherein the Cas9 protein and the guide RNA do not naturally occur together.
[0154] References to targets hereinafter will be understood to refer to post-mitotic cell targets or genes otherwise expressed in the post-mitotic cell, unless otherwise clearly indicated
[0155] Any or all of the polynucleotide sequences encoding the CRISPR enzyme, the guide sequence, the tracr pairing sequence or the tracr sequence may be RNA. The polynucleotide encoding the CRISPR enzyme sequence, the guide sequence, the tracr pairing sequence or the tracr sequence may be RNA and may be delivered via liposomes, nanoparticles, exosomes, microvesicles, or gene guns.
[0156] It should be understood that in the case of a polynucleotide referred to as RNA and considered to 'contain' such a tracr pairing sequence feature, the RNA sequence includes the feature. In the case where the polynucleotide is DNA and is considered to contain such a tracr pairing sequence feature, the DNA sequence is or can be transcribed into RNA including the feature under discussion. In the case where the feature is a protein, such as a CRISPR enzyme, the DNA or RNA sequence referred to is or can be translated (and in the case where the DNA is first transcribed).
[0157] Accordingly, in certain embodiments, the present invention provides methods of modifying an organism (e.g., by modifying post-mitotic cells of the organism) (e.g., a mammalian or non-human mammalian or organism including a human) by manipulating a target sequence at a genomic locus of interest, the method comprising delivering a non-naturally occurring or engineered composition comprising a viral or plasmid vector system, the vector system comprising one or more viral or plasmid vectors operably encoding a composition for its expression, wherein the composition comprises: (A) a non-naturally occurring or engineered composition comprising a vector system, the vector system comprising one or more vectors, the one or more vectors comprising: I. a first regulatory element operably linked to a CRISPR-Cas system chimeric RNA (chiRNA) polynucleotide sequence, wherein the polynucleotide sequence comprises (a) a guide sequence capable of hybridizing to a target sequence in a eukaryotic cell, (b) a tracr pairing sequence, and (c) a tracr sequence, and II. a second regulatory element operably linked to an enzyme-encoding sequence encoding a CRISPR enzyme, the CRISPR enzyme comprising at least one or more nuclear localization sequences (or optionally at least one or more nuclear localization sequences, as in some embodiments NLS may not be involved), wherein (a), (b), and (c) are arranged in a 5' to 3' direction, wherein components I and II are on the same or different vectors of the system, wherein upon transcription, the tracr pairing sequence hybridizes to the tracr sequence, and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence hybridized to the target sequence and (2) the tracr pairing sequence hybridized to the tracr sequence, or (B) a non-naturally occurring or engineered composition comprising a vector system, the vector system containing one or more vectors, the one or more vectors comprising I. a first regulatory element operably linked to (a) a guide sequence capable of hybridizing to a target sequence in a eukaryotic cell and (b) at least one or more tracr pairing sequences, II. a second regulatory element operably linked to an enzyme-encoding sequence encoding a CRISPR enzyme, and III.A third regulatory element, which is operably linked to the tracr sequence, wherein components I, II, and III are located on the same or different vectors of the system, wherein upon transcription, the tracr pairing sequence hybridizes to the tracr sequence, and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) a guide sequence that hybridizes to the target sequence and (2) a tracr pairing sequence that hybridizes to the tracr sequence. In some embodiments, components I, II, and III are located on the same vector. In other embodiments, components I and II are located on the same vector, while component III is located on another vector. In other embodiments, components I and III are located on the same vector, while component II is located on another vector. In other embodiments, components II and III are located on the same vector, while component I is located on another vector. In other embodiments, components I, II, and III are each located on a different vector. The present invention also provides a viral or plasmid vector system as described herein.
[0158] Preferably, the vector can be a viral vector, such as a lentivirus or baculovirus or preferably an adenovirus / adeno-associated virus vector, but other delivery means are also known (such as yeast systems, microvesicles, gene guns / means of attaching the vector to gold nanoparticles) and are provided. In some embodiments, one or more viral vectors or plasmid vectors can be delivered via liposomes, nanoparticles, exosomes, microvesicles, or gene guns.
[0159] By manipulating the target sequence, the applicant also intends epigenetic manipulation of the target sequence. This can be manipulation of the chromatin state of the target sequence, such as by modifying the methylation state of the target sequence (i.e., methylation or methylation pattern or addition or removal of CpG islands), histone modification, to increase or decrease the accessibility of the target sequence, or by means of 3D folding.
[0160] It should be understood that in the case of referring to a method of modifying a biological or mammalian (including human or non-human mammalian or biological) by manipulating a target sequence in a genomic locus of interest, this can apply to the biological (or mammalian) as a whole or only a single cell or cell population from such a biological (if the biological is multicellular). In the case of humans, for example, the applicant specifically contemplates single cells or cell populations, and these cells can preferably be modified ex vivo and then reintroduced. In this case, a biopsy or other tissue or biological fluid sample may be necessary. In this regard, stem cells are also particularly preferred. However, of course, in vivo embodiments are also contemplated.
[0161] In certain embodiments, the present invention provides a method of treating or inhibiting a disorder caused by a defect in a target sequence at a genomic locus of interest in a subject (e.g., a mammal or a human) or a non-human subject (e.g., a mammal) in need thereof, the method comprising modifying the subject or non-human subject by manipulating the target sequence, and wherein the disorder is sensitive to treatment or inhibition by means of a treatment that comprises manipulation of the target sequence that comprises: delivering a non-naturally occurring or engineered composition comprising an AAV or lentiviral vector system, the vector system comprising one or more AAV or lentiviral vectors, the vectors operably encoding a composition for its expression, wherein upon expression the target sequence is manipulated by the non-naturally occurring or engineered composition, wherein the non-naturally occurring or engineered composition comprises: (A) a non-naturally occurring or engineered composition comprising a vector system, the vector system comprising one or more vectors, the one or more vectors comprising: I. a first regulatory element operably linked to a CRISPR-Cas system chimeric RNA (chiRNA) polynucleotide sequence, wherein the polynucleotide sequence comprises (a) a guide sequence capable of hybridizing to a target sequence in a eukaryotic cell, (b) a tracr pairing sequence, and (c) a tracr sequence, and II. a second regulatory element operably linked to an enzyme-encoding sequence encoding a CRISPR enzyme, the CRISPR enzyme comprising at least one or more nuclear localization sequences (or optionally at least one or more nuclear localization sequences, as in some embodiments NLS may not be involved), wherein (a), (b), and (c) are arranged in a 5' to 3' direction, wherein components I and II are on the same or different vectors of the system, wherein upon transcription, the tracr pairing sequence hybridizes to the tracr sequence, and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) the guide sequence hybridized to the target sequence and (2) the tracr pairing sequence hybridized to the tracr sequence, or (B) a non-naturally occurring or engineered composition comprising a vector system, the vector system comprising one or more vectors, the one or more vectors comprising I. a first regulatory element operably linked to (a) a guide sequence capable of hybridizing to a target sequence in a eukaryotic cell and (b) at least one or more tracr pairing sequences, II. a second regulatory element operably linked to an enzyme-encoding sequence encoding a CRISPR enzyme, and III.A third regulatory element, the third regulatory element being operably linked to the tracr sequence, wherein components I, II, and III are on the same or different vectors of the system, wherein upon transcription, the tracr pairing sequence hybridizes to the tracr sequence, and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) a guide sequence hybridized to the target sequence and (2) a tracr pairing sequence hybridized to the tracr sequence. In some embodiments, components I, II, and III are on the same vector. In other embodiments, components I and II are on the same vector and component III is on another vector. In other embodiments, components I and III are on the same vector and component II is on another vector. In other embodiments, components II and III are on the same vector and component I is on another vector. In other embodiments, components I, II, and III are each on a different vector. The invention also provides a viral (e.g., AAV or lentiviral) vector system as described herein and can be part of a vector system as described herein.
[0162] Some methods of the invention can include inducing expression. In some methods of the invention, the organism or subject is a eukaryote (a mammal including a human), or a non-human eukaryote, or a non-human animal, or a non-human mammal. In some embodiments, the organism or subject is a non-human animal and can be an arthropod such as an insect, or can be a nematode. In some methods of the invention, the organism or subject is a plant. In some methods of the invention, the organism or subject is a mammal or a non-human mammal. The non-human mammal can be, for example, a rodent (preferably a mouse or a rat), an ungulate, or a primate. In some methods of the invention, the organism or subject is an alga including microalgae, or is a fungus. In some methods of the invention, the viral vector is AAV or lentiviral and can be part of a vector system as described herein. In some methods of the invention, the CRISPR enzyme is Cas9. In some methods of the invention, the expression of the guide sequence is under the control of a T7 promoter and is driven by the expression of T7 polymerase.
[0163] In some embodiments the invention encompasses a method of delivering a CRISPR enzyme, the method comprising delivering to a cell an mRNA encoding the CRISPR enzyme. In some of these methods of the invention, the CRISPR enzyme is Cas9.
[0164] The present invention also provides methods for preparing the vector systems of the present invention, particularly viral vector systems as described herein. In some embodiments, the present invention includes a method for preparing an AAV of the present invention, the method comprising transfecting one or more plasmids containing or consisting essentially of one or more nucleic acid molecules encoding an AAV into cells infected with AAV, and providing AAV rep and / or cap that are necessary for AAV replication and packaging. In some embodiments, the AAV rep and / or cap that are necessary for AAV replication and packaging are provided by transfecting these cells with one or more helper plasmids or one or more helper viruses. In some embodiments, the helper virus is a poxvirus, an adenovirus, a herpesvirus or a baculovirus. In some embodiments, the poxvirus is vaccinia virus. In some embodiments, the cells are mammalian cells. And in some embodiments, the cells are insect cells and the helper virus is a baculovirus. In other embodiments, the virus is a lentivirus.
[0165] In plants, pathogens are often host-specific. For example, Fusarium oxysporum f.sp.lycopersici causes tomato wilt and attacks only tomatoes, and F.oxysporum f.dianthii Puccinia graminisf.sp.tritici attacks only wheat. Plants have existing and inducible defenses against most pathogens. Mutations and recombination events across plant generations lead to genetic variability in susceptibility, especially when pathogens reproduce at a higher frequency than plants. Non-host resistance can exist in plants, for example, where the host and pathogen are incompatible. There can also be horizontal resistance, such as partial resistance against pathogens of all species typically controlled by many genes, and vertical resistance, such as complete resistance against certain species of pathogens but not others typically controlled by few genes. At the gene-for-gene level, plants and pathogens co-evolve, and genetic changes in one balance changes in the other. Thus, using natural variation, breeders combine the most useful genes for yield, quality, uniformity, tolerance, and resistance. Sources of resistance genes include natural or exotic varieties, Heirloom Varieties, related wild plants, and induced mutations, such as treating plant material with mutagens. Using the present invention, a new tool for inducing mutations is provided to plant breeders. Thus, those skilled in the art can analyze the genomes of sources of resistance genes and, in terms of varieties with desired characteristics or traits, use the present invention to induce the occurrence of resistance genes with better precision than previous mutagens and thus accelerate and improve plant breeding programs.
[0166] The present invention further includes the composition of the present invention or its CRISPR enzyme (including or alternatively an mRNA encoding the CRISPR enzyme), which is used in medicine or treatment. In some embodiments, the present invention includes the composition of the present invention or its CRISPR enzyme (including or alternatively an mRNA encoding the CRISPR enzyme), which is used in the method according to the present invention. In some embodiments, the present invention provides the use of the composition of the present invention or its CRISPR enzyme (including or alternatively an mRNA encoding the CRISPR enzyme) in ex vivo gene or genome editing. In certain embodiments, the present invention includes the use of the composition of the present invention or its CRISPR enzyme (including or alternatively an mRNA encoding the CRISPR enzyme) in the manufacture of a medicament for use in ex vivo gene or genome editing or in the method according to the present invention. In some embodiments, the present invention includes the composition of the present invention or its CRISPR enzyme (including or alternatively an mRNA encoding the CRISPR enzyme), wherein the target sequence is flanked at its 3' end by a PAM (protospacer adjacent motif) sequence, and the PAM sequence contains a 5'-motif, especially in the case where Cas9 is (or is derived from) Cas9 of Streptococcus pyogenes or Staphylococcus aureus. For example, suitable PAMs are 5'-NRG or 5'-NNGRR (where N is any nucleotide) for SpCas9 or SaCas9 enzymes (or derived enzymes), respectively, as mentioned below.
[0167] It should be understood that SpCas9 or SaCas9 are those from or derived from Cas9 of Streptococcus pyogenes or Staphylococcus aureus. It can of course be mutated from the wild type or otherwise altered to suit the intended use, as described herein. The double-nicking enzyme D10A mutant or variant is preferred, especially in combination with two overlapping guides directed to opposite sites on different strands of the same chromosome.
[0168] Aspects of the present invention include increasing the specificity of CRISPR enzyme-mediated gene targeting, such as Cas9, and reducing the likelihood of off-target modification via CRISPR enzymes, such as Cas9. In some embodiments, the present invention includes a method of modifying a biological or non-human organism by minimizing off-target modification by manipulating first and second target sequences on opposite strands of a DNA duplex at a genomic locus of interest in a cell, the method comprising delivering a non-naturally occurring or engineered composition, which may comprise:
[0169] I. A first CRISPR-Cas system chimeric RNA (chiRNA) polynucleotide sequence, wherein the first polynucleotide sequence comprises:
[0170] (a) A first guide sequence that is capable of hybridizing to the first target sequence,
[0171] (b) A first tracr pairing sequence, and
[0172] (c) A first tracr sequence,
[0173] II. A second CRISPR-Cas system chiRNA polynucleotide sequence, wherein the second polynucleotide sequence can comprise:
[0174] (a) A second guide sequence that is capable of hybridizing to the second target sequence,
[0175] (b) A second tracr pairing sequence, and
[0176] (c) A second tracr sequence, and
[0177] III. A polynucleotide sequence encoding a CRISPR enzyme that comprises at least one or more nuclear localization sequences and comprises one or more mutations, wherein (a), (b), and (c) are arranged in the 5' to 3' direction, wherein upon transcription, the first and second tracr pairing sequences hybridize to the first and second tracr sequences, respectively, and the first and second guide sequences direct the sequence-specific binding of the first and second CRISPR complexes to the first and second target sequences, respectively, wherein the first CRISPR complex comprises a CRISPR enzyme complexed with (1) a first guide sequence hybridized to the first target sequence and (2) a first tracr pairing sequence hybridized to the first tracr sequence, wherein the second CRISPR complex comprises a CRISPR enzyme complexed with (1) a second guide sequence hybridized to the second target sequence and (2) a second tracr pairing sequence hybridized to the second tracr sequence, wherein the polynucleotide sequence encoding the CRISPR enzyme is DNA or RNA, and wherein the first guide sequence directs the cleavage of one strand of the DNA duplex adjacent to the first target sequence, and the second guide sequence directs the cleavage of the other strand of the DNA duplex adjacent to the second target sequence, thereby inducing a double-strand break, whereby the organism or non-human organism is modified by minimizing off-target modification.
[0178] In some methods of the present invention, the polynucleotide sequence encoding the CRISPR enzyme, any one or all of the first and second guide sequences, the first and second tracr pairing sequences, or the first and second tracr sequences are RNA. In further embodiments of the present invention, the polynucleotide of the coding sequence encoding the CRISPR enzyme, the first and second guide sequences, the first and second tracr pairing sequences, or the first and second tracr sequences are RNA and are delivered via liposomes, nanoparticles, exosomes, microvesicles, or a gene gun. In certain embodiments of the present invention, the first and second tracr pairing sequences share 100% identity and / or the first and second tracr sequences share 100% identity. In some embodiments, the polynucleotides can be included in a vector system containing one or more vectors. In a preferred embodiment of the present invention, the CRISPR enzyme is a Cas9 enzyme, such as SpCas9. In one aspect of the present invention, the CRISPR enzyme comprises one or more mutations in the catalytic domain, wherein the one or more mutations are selected from the group consisting of D10A, E762A, H840A, N854A, N863A, and D986A. In a highly preferred embodiment, the CRISPR enzyme has a D10A mutation. In a preferred embodiment, the first CRISPR enzyme has one or more mutations such that the enzyme is a complementary strand nickase, and the second CRISPR enzyme has one or more mutations such that the enzyme is a non-complementary strand nickase. Alternatively, the first enzyme can be a non-complementary strand nickase while the second enzyme can be a complementary strand nickase.
[0179] In a preferred method of the present invention, the first guide sequence directs cleavage of one strand of the DNA duplex adjacent to the first target sequence and the second guide sequence directs cleavage of the other strand of the DNA duplex adjacent to the second target sequence to generate a 5' overhang. In an embodiment of the present invention, the 5' overhang has at most 200 base pairs, preferably at most 100 base pairs, or more preferably at most 50 base pairs. In an embodiment of the present invention, the 5' overhang has at least 26 base pairs, preferably at least 30 base pairs, or more preferably 34 - 50 base pairs. Most preferably, the overhang is between 5 and -1 base pairs.
[0180] In some embodiments, the present invention includes a method of modifying a biological or non-human organism by minimizing off-target modification by manipulating first and second target sequences on opposite strands of a DNA duplex at a genomic locus of interest in a cell, the method comprising delivering a non-naturally occurring or engineered composition comprising a vector system comprising one or more vectors, the one or more vectors comprising
[0181] I. A first regulatory element, the first regulatory element being operably connected to
[0182] (a) a first guide sequence, the first guide sequence being capable of hybridizing to the first target sequence, and
[0183] (b) at least one or more tracr pairing sequences,
[0184] II. A second regulatory element, the second regulatory element being operably connected to
[0185] (a) a second guide sequence, the second guide sequence being capable of hybridizing to the second target sequence, and
[0186] (b) at least one or more tracr pairing sequences,
[0187] III. A third regulatory element, the third regulatory element being operably connected to an enzyme-encoding sequence encoding a CRISPR enzyme, and
[0188] IV. A fourth regulatory element, the fourth regulatory element being operably connected to a tracr sequence,
[0189] wherein components I, II, III, and IV are on the same or different vectors of the system, and upon transcription, the tracr pairing sequences hybridize to the tracr sequence, and the first and second guide sequences direct the sequence-specific binding of the first and second CRISPR complexes to the first and second target sequences, respectively, wherein the first CRISPR complex comprises a CRISPR enzyme complexed with (1) a first guide sequence hybridized to the first target sequence and (2) a tracr pairing sequence hybridized to the tracr sequence, wherein the second CRISPR complex comprises a CRISPR enzyme complexed with (1) a second guide sequence hybridized to the second target sequence and (2) a tracr pairing sequence hybridized to the tracr sequence, wherein the polynucleotide sequence encoding the CRISPR enzyme is DNA or RNA, and wherein the first guide sequence directs the cleavage of one strand of the DNA duplex adjacent to the first target sequence, and the second guide sequence directs the cleavage of the other strand of the DNA duplex adjacent to the second target sequence, thereby inducing a double-strand break, whereby the organism or non-human organism is modified by minimizing off-target modifications.
[0190] The present invention also provides a vector system as described herein. The system can comprise one, two, three or four different vectors. Components I, II, III and IV can thus be located on one, two, three or four different vectors, and all combinations of the possible locations for these components are envisioned herein, for example: Components I, II, III and IV can be located on the same vector; Components I, II, III and IV can each be located on a different vector; Components I, II, III and IV can be located on a total of two or three different vectors, with all location combinations envisioned, and so on.
[0191] In some methods of the invention, the polynucleotide sequence encoding the CRISPR enzyme, any one or all of the first and second guide sequences, the first and second tracr pairing sequences or the first and second tracr sequences are RNA. In further embodiments of the invention, the first and second tracr pairing sequences share 100% identity and / or the first and second tracr sequences share 100% identity. In a preferred embodiment of the invention, the CRISPR enzyme is a Cas9 enzyme, such as SpCas9. In one aspect of the invention, the CRISPR enzyme comprises one or more mutations in the catalytic domain, wherein the one or more mutations are selected from the group consisting of: D10A, E762A, H840A, N854A, N863A and D986A. In a highly preferred embodiment, the CRISPR enzyme has the D10A mutation. In a preferred embodiment, the first CRISPR enzyme has one or more mutations such that the enzyme is a complementary strand nickase and the second CRISPR enzyme has one or more mutations such that the enzyme is a non-complementary strand nickase. Alternatively, the first enzyme can be a non-complementary strand nickase and the second enzyme can be a complementary strand nickase. In a further embodiment of the invention, one or more of these viral vectors can be delivered via liposomes, nanoparticles, exosomes, microvesicles, or a gene gun.
[0192] In a preferred method of the invention, the first guide sequence directs cleavage of one strand of the DNA duplex adjacent to the first target sequence and the second guide sequence directs cleavage of the other strand of the DNA duplex adjacent to the second target sequence to generate a 5' overhang. In an embodiment of the invention, the 5' overhang has at most 200 base pairs, preferably at most 100 base pairs, or more preferably at most 50 base pairs. In an embodiment of the invention, the 5' overhang has at least 26 base pairs, preferably at least 30 base pairs, or more preferably 34 - 50 base pairs.
[0193] In some embodiments, the present invention includes a method of modifying a genomic locus of interest by minimizing off-target modifications by introducing an engineered, non-naturally occurring CRISPR-Cas system into a cell containing and expressing a double-stranded DNA molecule encoding a gene product of interest, the CRISPR-Cas system comprising a Cas protein having one or more mutations and two guide RNAs that respectively target the first strand and the second strand of the DNA molecule, whereby the guide RNAs target the DNA molecule encoding the gene product and the Cas protein makes a nick in each of the first strand and the second strand of the DNA molecule encoding the gene product, thereby altering the expression of the gene product; and wherein the Cas protein and the two guide RNAs do not naturally occur together.
[0194] In a preferred method of the present invention, the Cas protein making a nick in each of the first strand and the second strand of the DNA molecule encoding the gene product results in a 5'-overhang. In an embodiment of the present invention, the 5'-overhang has at most 200 base pairs, preferably at most 100 base pairs, or more preferably at most 50 base pairs. In an embodiment of the present invention, the 5'-overhang has at least 26 base pairs, preferably at least 30 base pairs, or more preferably 34-50 base pairs.
[0195] Embodiments of the present invention also include a guide RNA comprising a guide sequence fused to a tracr pairing sequence and a tracr sequence. In one aspect of the present invention, the Cas protein is codon-optimized for expression in eukaryotic cells, preferably mammalian cells or human cells. In further embodiments of the present invention, the Cas protein is a type II CRISPR-Cas protein, such as a Cas9 protein. In a highly preferred embodiment, the Cas protein is a Cas9 protein, such as SpCas9. In aspects of the present invention, the Cas protein has one or more mutations selected from the group consisting of: D10A, E762A, H840A, N854A, N863A, and D986A. In a highly preferred embodiment, the Cas protein has a D10A mutation.
[0196] Aspects of the present invention relate to the expression of a reduced gene product or a template polynucleotide further introduced into the DNA molecule encoding the gene product or an intervening sequence precisely cleaved by allowing the two 5'-overhangs to reanneal and ligate, or the activity or function of an altered gene product, or the increased expression of the gene product. In one embodiment of the present invention, the gene product is a protein.
[0197] The present invention also includes an engineered, non-naturally occurring CRISPR-Cas system that includes a Cas protein having one or more mutations and guide RNAs that respectively target the first and second strands of a double-stranded DNA molecule encoding a gene product in a cell, whereby the guide RNAs target the DNA molecule encoding the gene product and the Cas protein makes a nick in each of the first and second strands of the DNA molecule encoding the gene product, thereby altering the expression of the gene product; and, wherein the Cas protein and the two guide RNAs do not naturally occur together.
[0198] In aspects of the present invention, the guide RNAs can include guide sequences fused to a tracr pairing sequence and a tracr sequence. In one embodiment of the present invention, the Cas protein is a type II CRISPR-Cas protein. In one aspect of the present invention, the Cas protein is codon-optimized for expression in eukaryotic cells, preferably mammalian cells or human cells. In additional embodiments of the present invention, the Cas protein is a type II CRISPR-Cas protein, such as a Cas9 protein. In a highly preferred embodiment, the Cas protein is a Cas9 protein, such as SpCas9. In aspects of the present invention, the Cas protein has one or more mutations selected from the group consisting of: D10A, E762A, H840A, N854A, N863A, and D986A. In a highly preferred embodiment, the Cas protein has a D10A mutation.
[0199] Aspects of the present invention relate to the expression of a reduced gene product or a template polynucleotide further introduced into the DNA molecule encoding the gene product or an intervening sequence precisely cleaved by allowing two 5' overhangs to reanneal and ligate, or the activity or function of an altered gene product, or the increased expression of a gene product. In one embodiment of the present invention, the gene product is a protein.
[0200] The present invention also includes an engineered, non-naturally occurring vector system comprising one or more vectors, the vectors comprising:
[0201] a) a first regulatory element operably linked to each of two CRISPR-Cas system guide RNAs that respectively target the first and second strands of a double-stranded DNA molecule encoding a gene product,
[0202] b) a second regulatory element operably linked to the Cas protein,
[0203] Component (a) and (b) are located on the same or different carriers of the system, whereby these guide RNAs target the DNA molecule encoding the gene product, and the Cas protein makes a nick in each of the first and second strands of the DNA molecule encoding the gene product, thereby altering the expression of the gene product; and, wherein the Cas protein and the two guide RNAs do not naturally occur together.
[0204] In aspects of the invention, the guide RNAs can comprise a guide sequence fused to a tracr pairing sequence and a tracr sequence. In one embodiment of the invention, the Cas protein is a type II CRISPR-Cas protein. In one aspect of the invention, the Cas protein is codon-optimized for expression in eukaryotic cells, preferably mammalian cells or human cells. In further embodiments of the invention, the Cas protein is a type II CRISPR-Cas protein, such as a Cas9 protein. In a highly preferred embodiment, the Cas protein is a Cas9 protein, such as SpCas9. In aspects of the invention, the Cas protein has one or more mutations selected from the group consisting of: D10A, E762A, H840A, N854A, N863A, and D986A. In a highly preferred embodiment, the Cas protein has the D10A mutation.
[0205] Aspects of the invention relate to the expression of a reduced gene product or a template polynucleotide further introduced into the DNA molecule encoding the gene product or an intervening sequence precisely cleaved by allowing two 5' overhangs to reanneal and ligate, or to the activity or function of an altered gene product, or to the increased expression of the gene product. In one embodiment of the invention, the gene product is a protein. In a preferred embodiment of the invention, the carriers of the system are viral vectors. In an additional embodiment, the carriers of the system are delivered via liposomes, nanoparticles, exosomes, microvesicles, or gene guns.
[0206] In one aspect, the present invention provides a method of modifying a target polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of the target polynucleotide, thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence that hybridizes to a target sequence within the target polynucleotide, wherein the guide sequence is linked to a tracr pairing sequence that in turn hybridizes to a tracr sequence. In some embodiments, the cleavage comprises cleavage of one or both strands at the target sequence position by the CRISPR enzyme. In some embodiments, the cleavage results in reduced transcription of the target gene. In some embodiments, the method further comprises repairing the cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein the repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of the target polynucleotide. In some embodiments, the mutation results in a change in one or more amino acids in a protein expressed from the gene comprising the target sequence. In some embodiments, the method further comprises delivering one or more vectors to the eukaryotic cell, wherein the one or more vectors drive the expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr pairing sequence, and the tracr sequence. In some embodiments, the vector is delivered to a eukaryotic cell in a subject. In some embodiments, the modification occurs in the eukaryotic cell in cell culture. In some embodiments, the method further comprises isolating the eukaryotic cell from the subject prior to the modification. In some embodiments, the method further comprises returning the eukaryotic cell and / or cells derived therefrom to the subject.
[0207] In one aspect, the present invention provides a method of modifying the expression of a polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the polynucleotide such that the binding results in an increase or decrease in the expression of the polynucleotide; wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence that hybridizes to a target sequence within the target polynucleotide, wherein the guide sequence is linked to a tracr pairing sequence that in turn hybridizes to a tracr sequence. In some embodiments, the method further comprises delivering one or more vectors to the eukaryotic cell, wherein the one or more vectors drive the expression of one or more of: the CRISPR enzyme, the guide sequence linked to the tracr pairing sequence, and the tracr sequence.
[0208] In one aspect, the present invention provides a method for generating a model eukaryotic cell comprising a mutated disease gene. In some embodiments, the disease gene is any gene associated with an increased risk of having or developing a disease. In some embodiments, the method comprises (a) introducing into the eukaryotic cell one or more vectors, wherein the one or more vectors drive the expression of one or more of the following: a CRISPR enzyme, a guide sequence linked to a tracr pairing sequence, and a tracr sequence; and (b) allowing the CRISPR complex to bind to a target polynucleotide to effect cleavage of the target polynucleotide within the disease gene, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) a guide sequence hybridized to a target sequence within the target polynucleotide, and (2) the tracr pairing sequence hybridized to the tracr, thereby generating a model eukaryotic cell comprising a mutated disease gene. In some embodiments, the cleavage comprises cleavage of one or both strands at the target sequence position by the CRISPR enzyme. In some embodiments, the cleavage results in reduced transcription of the target gene. In some embodiments, the method further comprises repairing the cleaved target polynucleotide by homologous recombination with an exogenous template polynucleotide, wherein the repair results in a mutation comprising an insertion, deletion, or substitution of one or more nucleotides of the target polynucleotide. In some embodiments, the mutation results in an alteration of one or more amino acids in the protein expressed from the gene comprising the target sequence.
[0209] In one aspect, the present invention provides a method for selecting one or more prokaryotic cells by introducing one or more mutations into the one or more prokaryotic cells, the method comprising: introducing one or more vectors into the one or more prokaryotic cells, wherein the one or more vectors drive the expression of one or more of the following: a CRISPR enzyme, a guide sequence linked to a tracr pairing sequence, a tracr sequence, and an editing template; wherein the editing template comprises one or more mutations that abolish CRISPR cleavage; allowing the editing template to undergo homologous recombination with a target polynucleotide in the one or more cells to be screened; allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of the target polynucleotide within the gene, wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) a guide sequence hybridized to a target sequence within the target polynucleotide and (2) a tracr pairing sequence hybridized to the tracr, wherein binding of the CRISPR complex to the target polynucleotide induces cell death, thereby allowing selection of the one or more prokaryotic cells in which one or more mutations have been introduced. In a preferred embodiment, the CRISPR enzyme is Cas9. In another aspect of the present invention, the cells to be selected can be eukaryotic cells, such as post-mitotic eukaryotic cells. Aspects of the present invention allow selection of specific cells without the need for a selection marker or a two-step method that may include a counter-selection system.
[0210] In one aspect, the present invention provides a method for modifying a target polynucleotide in a eukaryotic cell. In some embodiments, the method comprises allowing a CRISPR complex to bind to the target polynucleotide to effect cleavage of the target polynucleotide, thereby modifying the target polynucleotide, wherein the CRISPR complex comprises a CRISPR enzyme complexed with a guide sequence hybridized to a target sequence within the target polynucleotide, wherein the guide sequence is linked to a tracr pairing sequence, which in turn hybridizes to a tracr sequence.
[0211] In other embodiments, the present invention provides a method for modifying the expression of a polynucleotide in a eukaryotic cell. The method comprises increasing or decreasing the expression of a target polynucleotide by using a CRISPR complex that binds to the polynucleotide.
[0212] In some cases, to effect a modification of expression in a cell, one or more vectors comprising a tracr sequence, a guide sequence linked to the tracr pairing sequence, and a sequence encoding a CRISPR enzyme are delivered to the cell. In some methods, the one or more vectors comprise a regulatory element operably linked to an enzyme encoding sequence encoding the CRISPR enzyme, the CRISPR enzyme comprising a nuclear localization sequence; and a regulatory element operably linked to the tracr pairing sequence and one or more insertion sites for inserting the guide sequence upstream of the tracr pairing sequence. When expressed, the guide sequence directs sequence-specific binding of the CRISPR complex to a target sequence in the cell. Typically, the CRISPR complex comprises a CRISPR enzyme complexed with (1) a guide sequence hybridized to the target sequence and (2) a tracr pairing sequence hybridized to the tracr sequence.
[0213] In some methods, a target polynucleotide can be inactivated to effect a modification of expression in a cell. For example, when the CRISPR complex binds to a target sequence in the cell, the target polynucleotide is inactivated such that the sequence is not transcribed, the encoded protein is not produced, or the sequence does not function as a wild-type sequence. For example, a protein or microRNA encoding sequence can be inactivated such that the protein is not produced.
[0214] In certain embodiments, the CRISPR enzyme comprises one or more mutations selected from the group consisting of D10A, E762A, H840A, N854A, N863A, or D986A and / or the one or more mutations are in the RuvC1 or HNH domain of the CRISPR enzyme or are mutations as otherwise discussed herein. In some embodiments, the CRISPR enzyme has one or more mutations in the catalytic domain, wherein upon transcription, the tracr pairing sequence hybridizes to the tracr sequence and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence, and wherein the enzyme further comprises a functional domain. In some embodiments, the functional domain is a transcriptional activation domain, preferably VP64. In some embodiments, the functional domain is a transcriptional repressor domain, preferably KRAB. In some embodiments, the transcriptional repressor domain is SID, or a multimer of SID (e.g., SID4X). In some embodiments, the functional domain is an epigenetic modification domain, thereby providing an epigenetic modification enzyme. In some embodiments, the functional domain is an activation domain, which can be a P65 activation domain.
[0215] In some embodiments, the CRISPR enzyme is a type I or type III CRISPR enzyme, but preferably a type II CRISPR enzyme. Such type II CRISPR enzymes can be any Cas enzyme. A Cas enzyme can be identified as Cas9, as this can refer to a general class of enzymes that share homology with the largest nuclease having multiple nuclease domains from a type II CRISPR system. Most preferably, the Cas9 enzyme is from or derived from spCas9 or saCas9. By "derived", the applicant means that the derived enzyme is largely based on the meaning of having a high sequence homology with the wild-type enzyme, but has been mutated (modified) in certain aspects as described herein.
[0216] It should be understood that the terms "Cas" and "CRISPR enzyme" are generally used interchangeably herein, unless otherwise stated. As mentioned above, many of the residue numbers used herein refer to the Cas9 enzyme from the type II CRISPR locus in Streptococcus pyogenes. However, it should be understood that the present invention encompasses more Cas9s from other microbial species, such as SpCas9, SaCa9, St1Cas9, and the like.
[0217] Examples of codon-optimized sequences optimized for humans (i.e., optimized for expression in humans) in this context are provided herein, see the SaCas9 human codon-optimized sequence. While this is optimized, it should be understood that other examples are possible and codon optimization for host species is known.
[0218] Preferably, delivery is in the form of a vector, which can be a viral vector such as a lentivirus or baculovirus or preferably an adenovirus / adeno-associated virus vector, but other delivery means are also known (such as yeast systems, microvesicles, gene guns / means of attaching the vector to gold nanoparticles) and are provided. A vector may refer not only to a virus or yeast system (for example, in the case where the nucleic acid of interest can be operably linked to a promoter and under its control (in terms of expression, thus ultimately providing processed RNA)), but also to direct the delivery of the nucleic acid into a host cell. Although the vector can be a viral vector in the methods herein and AAV is advantageous here, other viral vectors as discussed herein can be employed, such as lentiviruses. For example, baculoviruses can be used for expression in insect cells. These insect cells can in turn be used to produce large amounts of other vectors, such as AAV or lentiviral vectors suitable for delivery of the present invention. Also contemplated is a method of delivering the CRISPR enzyme of the present invention, which comprises delivering mRNA encoding the CRISPR enzyme to a cell. It should be understood that in certain embodiments, the CRISPR enzyme is truncated, and / or consists of less than one thousand amino acids or less than four thousand amino acids, and / or is a nuclease or nickase, and / or is codon-optimized, and / or contains one or more mutations, and / or contains a chimeric CRISPR enzyme, and / or other options as discussed herein. AAV and lentiviral vectors are preferred.
[0219] In certain embodiments, the target sequence is flanked or downstream at its 3' end by a PAM suitable for the CRISPR enzyme (typically Cas, and especially Cas9).
[0220] For example, suitable PAMs are 5'-NRG or 5'-NNGRR for the SpCas9 or SaCas9 enzyme (or a derivative enzyme), respectively.
[0221] It should be understood that SpCas9 or SaCas9 are those derived from or derived from Cas9 of Streptococcus pyogenes or Staphylococcus aureus.
[0222] Accordingly, it is an object of the present invention that no prior art known product, process for making such product, or method of using such product is covered by the present invention, and the applicant reserves and hereby disclaims any right to any prior art known product, process, or method. Further, within the scope of the present invention, the present invention is not intended to cover any product, process, or method of making or using such product that does not meet the written description and enablement requirements of the USPTO (35 U.S.C. § 112, first paragraph) or the EPO (Article 83 of the EPC), and the applicant reserves and hereby disclaims any right to any previously described product, process for making such product, or method of using such product.
[0223] It should be noted that in this disclosure, particularly in the claims and / or paragraphs, terms such as "comprises", "comprised", "comprising", etc. may have the meaning ascribed to them in U.S. patent law; for example, they may mean "includes", "included", "including", etc.; and terms such as "consisting essentially of" and "consists essentially of" have the meaning ascribed to them in U.S. patent law, for example, they allow elements not recited explicitly, but exclude elements found in the prior art or that affect the basic or novel characteristics of the present invention.
[0224] These and other embodiments are disclosed in the following detailed description, or are obvious from and encompassed by it. BRIEF DESCRIPTION OF THE DRAWINGS
[0225] The novel features of the invention are set forth with particularity in the appended claims. A better understanding of the features and advantages of the invention will be obtained from the following detailed description of illustrative embodiments, in which the principles of the invention are utilized, and in the accompanying drawings:
[0226] Figure 1 A schematic model of the CRISPR system is shown. The Cas9 nuclease from Streptococcus pyogenes (yellow) targets genomic DNA via a synthetic guide RNA (sgRNA), which consists of a 20-nt guide sequence (blue) and a scaffold (red). Base pairing of the guide sequence with the DNA target (blue) occurs directly upstream of the required 5'-NGG protospacer adjacent motif (PAM; magenta-red), and Cas9 mediates a double-strand break (DSB) approximately 3 bp upstream of the PAM (red triangle).
[0227] Figure 2A -Panel F shows an exemplary CRISPR system, a possible mechanism of action, exemplary adaptation alterations for expression in eukaryotic cells, and the results of assays for evaluating nuclear localization and CRISPR activity.
[0228] Figures 3A-D show the results of the assessment of SpCas9 specificity for exemplary targets.
[0229] Figures 4A-G show an exemplary vector system and the results of its use in directing homologous recombination in eukaryotic cells.
[0230] Figure 5 A table of protospacer sequences is provided, and the results of modification efficiency of protospacer targets designed based on exemplary Streptococcus pyogenes and Streptococcus thermophilus CRISPR systems are summarized, which CRISPR systems have corresponding PAMs for loci in the human and mouse genomes. Cells are transfected with Cas9 and either pre-crRNA / tracrRNA or chimeric RNA, and analyzed 72 hours after transfection. Based on the results of Surveyor assays from the indicated cell lines, the indel percentages are calculated (for all protospacer targets N = 3, error is S.E.M., N.D. indicates not detected using Surveyor assay, and N.T. indicates not tested in this study).
[0231] Figures 6A-C show a comparison of different tracrRNA transcripts for Cas9-mediated gene targeting.
[0232] Figure 7 A schematic of the Surveyor nuclease assay for the detection of microinsertions and microdeletions induced by double-strand breaks is shown.
[0233] Figure 8A - B An exemplary bicistronic expression vector for the expression of CRISPR system components in eukaryotic cells is shown.
[0234] Figure 9A - C A histogram showing the distances between the adjacent Streptococcus pyogenes SF370 locus 1 PAM (NGG) (Figure 9A) and Streptococcus thermophilus LMD9 locus 2 PAM (NNAGAAW) (Figure 9B) in the human genome, and the distances for each PAM with respect to chromosome (Chr) (Figure 9C) is shown.
[0235] Figures 10A-D show an exemplary CRISPR system, exemplary adaptation alterations for expression in eukaryotic cells, and the results of assays for evaluating CRISPR activity.
[0236] Figure 11A - C Shows exemplary manipulations of the CRISPR system for targeting genomic loci in mammalian cells.
[0237] Figure 12A - B Shows the results of Northern blot analysis of crRNA processing in mammals.
[0238] Figure 13A - B Shows exemplary selection of protospacers in the human PVALB and mouse Th loci.
[0239] Figure 14 Shows exemplary protospacers and corresponding PAM sequence targets of the Streptococcus thermophilus CRISPR system in the human EMX1 locus.
[0240] Figure 15 Provides a table of primer and probe sequences for Surveyor, RFLP, genomic sequencing, and Northern blot analysis.
[0241] Figure 16A -C shows exemplary manipulations of the CRISPR system with chimeric RNAs and the results of SURVEYOR analysis of system activity in eukaryotic cells.
[0242] Figure 17A - B Shows a diagram of the results of SURVEYOR analysis of CRISPR system activity in eukaryotic cells.
[0243] Figure 18 Shows exemplary visualization of some Streptococcus pyogenes Cas9 target sites in the human genome using the UCSC Genome Browser.
[0244] Figure 19A -D shows a circular depiction of a phylogenetic analysis revealing five Cas9 families, which include three large groups of Cas9 (about 1400 amino acids) and two small groups of Cas9 (about 1100 amino acids).
[0245] Figure 20A -F shows a linear depiction of a phylogenetic analysis revealing five Cas9 families, which include three large groups of Cas9 (about 1400 amino acids) and two small groups of Cas9 (about 1100 amino acids).
[0246] Figure 21A-D shows genome editing via homologous recombination. (a) Schematic of SpCas9 nickase with a D10A mutation in the RuvC I catalytic domain. (b) Schematic showing homologous recombination (HR) at the human EMX1 locus using sense or antisense single-stranded oligonucleotides as repair templates. The red arrows above indicate the sgRNA cleavage sites; the PCR primers for genotyping (Tables J and K) are shown as arrows in the right panel. (c) Sequence of the region modified by HR. (d) SURVEYOR analysis (n = 3) for indels at the EMX1 target 1 locus mediated by wild-type (wt) and nickase (D10A) SpCas9. Arrows indicate the positions of the expected fragment sizes.
[0247] Figure 22A -B shows a single vector design for SpCas9.
[0248] Figure 23 A graph showing the length distribution representative of Cas9 orthologs is shown.
[0249] Figure 24A -M shows the sequence in the case where the mutation point is within the SpCas9 gene.
[0250] Figure 25A A conditional Cas9, Rosa26 targeting vector map is shown.
[0251] Figure 25B A constitutive Cas9, Rosa26 targeting vector map is shown.
[0252] Figure 26 A schematic showing important elements in constitutive and conditional Cas9 constructs is shown.
[0253] Figure 27 Delivery and in vivo mouse brain Cas9 expression data are shown.
[0254] Figure 28 RNA delivery of Cas9 and chimeric RNAs into cells is shown. (A) Delivery of GFP reporter gene as DNA or mRNA into Neuro-2A cells. (B) Delivery of Cas9 and chimeric RNAs against the Icam2 gene as RNA results in cleavage of one of the two tested spacers. (C) Delivery of Cas9 and chimeric RNAs against the F7 gene as RNA results in cleavage of one of the two tested spacers.
[0255] Figure 29Shows how DNA double-strand break (DSB) repair promotes gene editing. In the error-prone non-homologous end joining (NHEJ) pathway, the ends of the DSB are processed by the endogenous DNA repair machinery and religated together, which can result in random insertions / deletions (indels) mutations at the ligation site. Indel mutations occurring within the gene coding region can generate frameshifts and premature stop codons, leading to gene knockout. Alternatively, a repair template in the form of a plasmid or single-stranded oligodeoxynucleotide (ssODN) can be provided to utilize the homologous directed repair (HDR) pathway, which allows for high-fidelity and precise editing.
[0256] Figure 30A - C Shows the expected outcomes of HDR in HEK and HUES9 cells. (a) A targeting plasmid or ssODN (sense or antisense) with homologous arms can be used to edit the sequence cleaved by Cas9 (red triangle) at the target genomic locus. To analyze the efficiency of HDR, the applicant introduced a HindIII site (red bar) in the target locus and performed PCR amplification with primers annealing outside the homologous region. Digestion of the PCR product with HindIII revealed the presence of HDR events. (b) ssODNs oriented in the sense or antisense direction (s or a) relative to the genomic region of interest can be used in combination with Cas9 to achieve efficient HDR-mediated editing at the target locus. A minimum homologous region of 40 bp, and preferably 90 bp, is recommended on either side of the modification (red bar). (c) Examples of the role of ssODNs in HDR at the EMX1 locus are shown using both wild-type Cas9 and Cas9 nickase (D10A). Each ssODN contains 90-bp homologous arms flanking a 12-bp insert flanked by two restriction sites.
[0257] Figure 31 A-C show the repair strategy for the cystic fibrosis ΔF508 mutation.
[0258] Figure 32 A-B (a) shows a schematic diagram of the GAA repeat expansion in intron 1 of FXN and (b) shows a schematic diagram of the strategy employed to excise the GAA expansion region using the CRISPR / Cas system.
[0259] Figure 33 Shows efficient SpCas9-mediated targeted screening of the Tet1-3 and Dnmt1, 3a, and 3b loci. By using different gRNAs, Surveyor assays on DNA from transfected N2A cells demonstrated efficient DNA cleavage.
[0260] Figure 34Shows a multiplex genomic targeting strategy using a 2-vector system in the AAV1 / 2 delivery system. Tet1-3 and Dnmt1, 3a and 3b gRNAs are under the control of the U6 promoter. GFP-KASH is under the control of the human synapsin promoter. Restricted flanks show a simple gRNA replacement strategy via subcloning. HA-tagged SpCas9 flanked by two nuclear localization signals (NLS) is shown. Both vectors are delivered to the brain via AAV1 / 2 virus at a 1:1 ratio.
[0261] Figure 35 Shows the validation of the functionality of the multiplex DNMT targeting vector #1 using the Surveyor assay. N2A cells were co-transfected with the DNMT targeting vector #1(+) and the SpCas9-encoding vector to detect SpCas9-mediated cleavage of the DNMT gene family loci. The negative control was only gRNA(-). Cells were harvested for DNA purification and downstream processing was performed 48 hours after transfection.
[0262] Figure 36 Shows the validation of the functionality of the multiplex DNMT targeting vector #2 using the Surveyor assay. N2A cells were co-transfected with the DNMT targeting vector #1(+) and the SpCas9-encoding vector to detect SpCas9-mediated cleavage of the DNMT gene family loci. The negative control was only gRNA(-). Cells were harvested for DNA purification and downstream processing was performed 48 hours after transfection.
[0263] Figure 37 Shows a schematic overview of the short promoter and short polyA versions for in vivo HA-SpCas9 expression. The size of the coding region from the L-ITR to the R-ITR is shown on the right.
[0264] Figure 38 Shows a schematic overview of the short promoter and short polyA versions for in vivo HA-SaCas9 expression. The size of the coding region from the L-ITR to the R-ITR is shown on the right.
[0265] Figure 39 Shows the expression of SpCas9 and SaCas9 in N2A cells. Representative Western blots of HA-tagged SpCas9 and SaCas9 versions under the control of different short promoters and with a short polyA (spA) sequence. Tubulin is the loading control. mCherry (mCh) is the transfection control. Cells were harvested and further processed for Western blotting 48 hours after transfection.
[0266] Figure 40Shows the screening of efficient SaCas9-mediated targeting of the Tet3 gene locus. By using different gRNAs with the NNGGGT PUM sequence, Surveyor assays on DNA from transfected N2A cells demonstrated efficient DNA cleavage. GFP-transfected cells and cells expressing only SaCas9 were controls.
[0267] Figure 41 Shows the expression of HA-SaCas9 in the mouse brain. Animals were injected into the dentate gyrus with a virus driving the expression of HA-SaCas9 under the control of the human synapsin promoter. Animals were sacrificed 2 weeks after surgery. The HA tag was detected using a rabbit monoclonal antibody C29F4 (Cell Signaling). Nuclei were stained blue with DAPI dye.
[0268] Figure 42 Shows the expression of SpCas9 and SaCas9 in primary cortical neurons in culture 7 days after transduction. Representative Western blots of HA-tagged SpCas9 and SaCas9 versions under the control of different promoters and with either the bgh or short polyA (spA) sequence. Tubulin was the loading control.
[0269] Figure 43 Shows the LIVE / DEAD staining of primary cortical neurons 7 days after transduction with AAV1 particles carrying SpCas9 and multiplex gRNA constructs (example shown in the last panel for DNMT) with different promoters. Neurons after AAV transduction were compared to untransduced control neurons. Red nuclei indicate permeabilized dead cells (second row of the panel). Live cells are labeled green (third row of the panel).
[0270] Figure 44 Shows the LIVE / DEAD (dead / live) staining of primary cortical neurons 7 days after transduction with AAV1 particles carrying SaCas9 with different promoters. Red nuclei indicate permeabilized dead cells (second row of the panel). Live cells are labeled green (third row of the panel).
[0271] Figure 45 Shows the morphological comparison of neurons after transduction with AAV1 virus carrying SpCas9 and gRNA multiplexes for the TET and DNMT gene loci. Untransduced neurons are shown as controls.
[0272] Figure 46Shows the validation of the functionality of multiplex DNMT targeting vector #1 using the Surveyor assay in primary cortical neurons. Cells were co-transduced with DNMT targeting vector #1 and SpCas9 virus with different promoters to detect SpCas9-mediated cleavage of the DNMT gene family loci.
[0273] Figure 47 Shows the in vivo efficiency of SpCas9 cleavage in the brain. Mice were injected with AAV1 / 2 virus carrying gRNAs targeting multiplex DNMT family gene loci together with SpCas9 virus under the control of 2 different promoters (mouse Mecp2 and rat Map1b). Two weeks after injection, brain tissues were extracted, and nuclei were prepared and sorted using FACS based on GFP expression driven by the synapsin promoter from the gRNA multiplex construct. After gDNA extraction, the Surveyor assay was performed. + indicates GFP-positive nuclei, – is the control, GFP-negative nuclei from the same animal. The numbers on the gel indicate the evaluated SpCas9 efficiency.
[0274] Figure 48 Shows the purification of GFP-KASH-labeled nuclei from hippocampal neurons. The outer nuclear membrane (ONM) of the nuclear membrane was labeled with a fusion of GFP and the transmembrane domain of the KASH protein. GFP was strongly expressed in the brain one week after stereotactic surgery and AAV1 / 2 injection. A density gradient centrifugation step was performed to purify nuclei from the whole brain. The purified nuclei are shown. DyeCycle TM Chromatin staining with DyeCycle Ruby is shown in red, and GFP-labeled nuclei are green. Representative FACS plots of GFP+ and GFP– nuclei (red-violet: DyeCycle TM Ruby staining, green: GFP).
[0275] Figure 49 Shows the efficiency of SpCas9 cleavage in the mouse brain. Mice were injected with AAV1 / 2 virus carrying gRNAs targeting multiplex TET family gene loci together with SpCas9 virus under the control of 2 different promoters (mouse Mecp2 and rat Map1b). Three weeks after injection, brain tissues were extracted, and nuclei were prepared and sorted using FACS based on GFP expression driven by the synapsin promoter from the gRNA multiplex construct. After gDNA extraction, the Surveyor assay was performed. + indicates GFP-positive nuclei, – is the control, GFP-negative nuclei from the same animal. The numbers on the gel indicate the evaluated SpCas9 efficiency.
[0276] Figure 50 Shows GFP-KASH expression in cortical neurons in culture. Neurons were transduced with AAV1 virus carrying a gRNA multiplex construct targeting the TET gene locus. Due to the KASH domain localization, the strongest signal is around the nucleus.
[0277] Figure 51 Shows (top) a list of the spacers between guide RNAs (as indicated by the alignment pattern of two PAM sequences). When used with the SpCas9(D10A) nickase, only guide RNA pairs that satisfy patterns 1, 2, 3, and 4 exhibit indels. (Bottom) Gel images show that the combination of SpCas9(D10A) with guide RNA pairs that satisfy patterns 1, 2, 3, and 4 results in the formation of indels at the target site.
[0278] Figure 52 Shows a list of U6 reverse primer sequences used to generate U6-guide RNA expression cassettes. Each primer needs to pair with the U6 forward primer "gcactgagggcctatttcccatgattc" in order to generate amplicons containing U6 and the desired guide RNA.
[0279] Figure 53 Shows a genomic sequence map from the human Emx1 locus, showing the positions of the 24 patterns listed in Figure 33 .
[0280] Figure 54 Shows (right) gel images indicating indel formation at the target site when there are variable 5' overhangs after cleavage by Cas9 nickase targeted by different guide RNA pairs. (Left) A table indicating the lane numbers and different parameters on the right gel, including the guide RNA pairs used for identification and the length of the 5' overhangs present after cleavage by Cas9 nickase.
[0281] Figure 55 Shows a genomic sequence map from the human Emx1 locus, which shows the positions of different guide RNA pairs that result in the Figure 54 (right) gel pattern and are further described in Example 35.
[0282] Figure 56A - KShows CRISPR-Cas9 targeting of Mecp2 in primary cortical neurons. (A) AAV SpCas9 and sgRNA expression vectors. The sgRNA vector contains the coding sequence of the GFP-KASH fusion protein for identification of transduced neurons. (B) Neurons in cultures co-transduced with Cas9 and sgRNA vectors show expression of HA-tagged Cas9 (HA-Cas9) and GFP-KASH. Nuclei are labeled with DAPI. Scale bar, 20 μm. (C) GFP-KASH + (n = 635) and co-infection efficiency of HA-Cas9 (n = 659) in primary cortical neurons. (D) Graphic representation of the mouse Mecp2 locus showing the Cas9 target sites; sgRNAs are indicated in blue. The PAM sequence is marked in purple. (E) SURVEYOR TM assay gels show modification of the Mecp2 locus in cortical neurons. (F) Western blot of MeCP2 protein levels and quantification of MeCP2 protein levels after CRISPR-Cas9 targeting of the Mecp2 locus (t-test, ***p < 0.0001, n = 7). (G) Reduced complexity of dendritic trees in neurons after CRISPR-Cas9 targeting of the Mecp2 locus. Scale bar, 20 μm. (H) Dendritic tree morphology assessed by the number of dendritic endings, and (I) Sholl analysis (t-test, ***p < 0.0001, n = 40). (J) Changes in dendritic spine morphology in neurons targeted by Cas9 and Mecp2 sgRNA. Scale bar, 10 μm. (K) Spine density quantification (t-test, ***p < 0.0001, n = 40).
[0283] Figure 57A - I Shows delivery of the CRISPR-Cas9 system and targeting of Mecp2 in the mouse brain. (A) Strategy for purification of nuclei from CRISPR-Cas9-targeted cells from the mouse brain. (B) Expression of HA-Cas9 and GFP-KASH (sgRNA) in the dorsal dentate gyrus (DG) of the mouse hippocampus. Scale bar, 100 μm. (C) Quantification of cells efficiently targeted by the dual-vector Cas9-CRISPR system. (D) SURVEYOR TMThe assay gel shows the modification of the Mecp2 locus 2 weeks after AAV delivery in the DG region. FACS-sorted GFP-KASH-positive cells show a higher level of Mecp2 locus modification. (E) Western blot analysis of MeCP2 protein expression in the targeted brain regions and quantification of MeCP2 protein levels in the dorsal DG (t-test, **p < 0.001, n = 4). (F) Images of the dorsal DG region 2 weeks after CRISPR-Cas9 targeting of the Mecp2 locus. Scale bar, 150 μm. (G) Quantification of MeCP2-positive cell populations in the targeted brain regions compared to control parallel sites (t-test, ****p < 0.0001, n = 290 and 249 cells, respectively). (H) Example of Golgi-Cox staining showing the morphology of dendritic spines of granule cells in the dorsal DG region 1 week after CRISPR-Cas9 delivery. Scale bar, 10 μm. (I) Quantification of dendritic spine density in the dorsal DG region (t-test, ***p < 0.0001, n = 20).
[0284] Figure 58A - F Multiplex gene editing synchronized in the mouse brain is shown. (A) Schematic of the CRISPR-Cas9 system designed for multiplex genome targeting. (B) Graphic representation of the targeted DNMT mouse locus. Guide RNAs are indicated in blue. PAM sequences are labeled in purple. (C) Next-generation sequencing of the on-target modification rates of DNMT family genes in FACS-sorted cell nuclei from the dentate gyrus after CRISPR-Cas9 delivery. MLE (maximum likelihood estimate) scores are shown. (D) Western blot analysis of Dnmt3a and Dnmt1 proteins (top) after in vivo delivery of the CRISPR-Cas9 system targeting DNMT family genes. Western immunoblot quantification of Dnmt3a and Dnmt1 protein levels in the DG after in vivo CRISPR-Cas9 targeting (bottom; t-test, **p < 0.001, *p < 0.05, Dnmt3a: n = 7; Dnmt1: n = 5). (E, F) Contextual learning deficits 8 weeks after targeting the DNMT gene using SPR-Cas9 in the DG region of the hippocampus, tested in training (E) and a changed context (F) (t-test, ***p < 0.0001, n = 18).
[0285] Figure 59A - EShows the cloning and expression of HA-tagged SpCas9 (HA-Cas9) for AAV packaging. (A) Schematic overview of the CRISPR / Cas9 system. Single-guide RNA (sgRNA)-mediated Cas9 targeting leads to double-strand breaks (DSBs) at the targeted gene locus. The non-homologous end joining (NHEJ) mechanism results in indel mutations at the targeted genomic locus. (B) Schematic overview of different cloning strategies to minimize the Cas9 expression cassette size, using the short rat Map1b promoter (rMap1b), truncated forms of the mouse Mecp2 promoter (sMecp2), and short polyA motif (spA). (C) Western blot analysis of primary cortical neuron cultures expressing Cas9 using different Cas9 expression cassettes. (D) Mecp2 promoter drives Cas9 (red) expression in neurons (Map1b, NeuN; arrowheads) but not in astroglia (GFAP, arrows). Nuclei are labeled with DAPI (blue). Scale bar, 20 μm. (E) At 7 days post-viral delivery, cells were stained with kit. DAPI + and quantification of dead (DEAD + ) cells. (ITR – inverted terminal repeat; HA – hemagglutinin tag; NLS – nuclear localization signal; spA – synthetic polyadenylation signal; U6-PolIII promoter; sgRNA – single-guide RNA; hSyn – human synapsin 1 promoter; GFP - green fluorescent protein; KASH – Klarsicht, ANC1, Syne homologous nuclear transmembrane domain; bGHpA – bovine growth hormone polyadenylation signal; WPRE – woodchuck hepatitis virus post-transcriptional regulatory element).
[0286] Figure 60A - B Shows targeting of Mecp2 in Neuro-2a cells. (A) Mecp2 targeting sequence and corresponding protospacer adjacent motif (PAM). (B) Evaluation of 6 Mecp2 sgRNAs co-transfected into Neuro-2a cells with Cas9. Analysis of locus modification efficiency at 48 h post-transfection using SURVEYOR TM assay.
[0287] Figure 61 Shows CRISPR-Cas9 delivery in primary cortical neurons. Immunofluorescence staining of MeCP2 (red) in cultured neurons at 7 days post AAV-CRISPR transduction (green, GFP-KASH). Reduced MeCP2 immunofluorescence in cells transduced with AAV-CRISPR targeting Mecp2 is shown (middle panel). Nuclei are labeled with DAPI (blue). Scale bar, 20 μm.
[0288] Figure 62A - C Shows GFP labeling of targeted cell nuclei. (A) Schematic overview of GFP labeling. Enhanced green fluorescent protein (GFP) fused to the nuclear transmembrane KASH domain and GFP-KASH integration into the outer nuclear membrane are shown. (B) Expression of GFP-KASH driven by the human synapsin promoter 4 weeks after viral delivery into the dentate gyrus. Hematoxylin / eosin staining (top) reveals no morphological abnormalities. Immunofluorescence analysis shows normal tissue morphology in the hippocampus expressing GFP-KASH (middle, green) (NeuN shown in red, middle panel) and no signs of astrogliosis (GFAP shown in red, bottom panel). Cell nuclei are labeled with DAPI (blue). Scale bar, 200 μm. (C) By using cell type-specific promoters, GFP-KASH can be targeted to different cell types. Expression of GFP-KASH (green) in astrocytes (red) in the mouse hippocampus driven by the glial fibrillary acidic protein (GFAP) promoter. Cell nuclei are labeled with DAPI (blue). The inset shows a higher magnification. Scale bar, 50 μm. (KASH-Klarsicht, ANC1, Syne homology nuclear transmembrane domain) (ONM–outer nuclear membrane; INM–inner nuclear membrane).
[0289] Figure 63A - B Shows multiplex genomic targeting of DNMT family members in vitro. (A) Target sequences and corresponding protospacer adjacent motifs (PAMs) of Dnmt3a, Dnmt1, and Dnmt3b. (B) SURVEYOR nuclease assay analysis of Neuro-2a cells 48 hours after transfection with Cas9 and DNMT 3xsgRNA vectors targeting the Dnmt3a, Dnmt1, and Dnmt3b loci. Efficient genomic editing of all three target genes is shown. TM Nuclease assay analysis shows efficient genomic editing of all three target genes.
[0290] Figure 64A - C Shows next-generation sequencing of targeted Dnmt3a, Dnmt1, and Dnmt3b loci. Examples of sequencing results of the mutant Dnmt3a (A), Dnmt1 (B), and Dnmt3b (C) loci after in vivo delivery of Cas9 and DNMT 3xsgRNA into the mouse dentate gyrus. Green: wild-type sequence, red dashed line: deleted base, red base: insertion or mutation. Red arrows indicate CRISPR-Cas9 cleavage sites.
[0291] Figure 65 Panel A shows that guide (target) 1 induces the highest percentage of indels in ApoB.
[0292] Figure 65 Panel B shows the results of the Surveyor nuclease gel assay for indel formation efficiency at 4 weeks post-injection.
[0293] Figure 66 Shows Oil Red staining used to detect the hepatic lipid accumulation phenotype in vivo following AAV-Cas9-sgRNA delivery. Scale bar in each square represents 20 microns.
[0294] Figure 67 Shows that the 21-ntd / base pair (bp) indicated by the grey bars is the optimal spacer length across a range of targets and within two different genes (AAVS1 and EMX1), at least compared to 20 or 22 base pairs (represented by black and white bars respectively).
[0295] Figure 68 Shows whether the guide sequence can be inserted into the Cas9 intron sequence
[0296] Figure 69 Shows that the full-length H1 promoter (grey bar) is still weaker than the U6 promoter (black bar), as U6 shows an increased percentage of indel formation for each target tested.
[0297] Figure 70 Shows that the short H1 promoter is weaker than the full-length H1.
[0298] Figure 71 Shows the distance between the 5' ends of the two guide sequences in the construct, which was measured in relation to the cleavage efficiency of the D10A SaCAs9 nickase.
[0299] Figure 72 Shows delivery of the CRISPR-Cas9 system and targeting of the Mecp2 locus in the mouse brain. (a) AAV-SpCas9 and AAV-SpGuide(Mecp2) expression vectors. The sgRNA vector contains the coding sequence for a GFP-KASH fusion protein for identification of transduced neurons. (b) Expression of HA-Cas9 and GFP-KASH in the dorsal dentate gyrus (DG) of the mouse hippocampus. Scale bar, 100 μm. (c) Quantification of cells efficiently targeted by the dual-vector Cas9-CRISPR system. (d) Schematic representation of the mouse Mecp2 locus showing the Cas9 target positions; sgRNAs are indicated in blue. The PAM sequences are marked in purple. Representative mutation patterns detected by sequencing of the Mecp2 locus are shown as follows: green - wild-type sequence; red dashed line - deleted bases; red bases: insertions or mutations; red arrows indicate the CRISPR-Cas9 cleavage sites. (e) SURVEYOR TMThe assay gel shows modification of the Mecp2 locus 2 weeks after AAV delivery in the DG region. (f) Western blot analysis of MeCP2 protein expression in the targeted brain regions and quantification of MeCP2 protein levels in the dorsal DG (t-test, **p < 0.001, n = 4, from 3 animals, error bars: s.e.m.). (g) Images of the dorsal DG region 2 weeks after CRISPR-Cas9 targeting of the Mecp2 locus. Scale bar, 150 μm. (h) Quantification of the MeCP2-positive cell population compared to the control parallel sites in all detected cells (DAPI staining) in the targeted brain regions (t-test, ****p < 0.0001, n = 290 and 249 cells, from 2 animals respectively; error bars: s.e.m.). (ITR – inverted terminal repeat; HA – hemagglutinin tag; NLS – nuclear localization signal; spA – synthetic polyadenylation signal; U6-PolIII promoter; sgRNA – single guide RNA; hSyn – human synapsin 1 promoter; GFP – green fluorescent protein; KASH – Klarsicht, ANC1, Syne homologous nuclear transmembrane domain; bGH pA – bovine growth hormone polyadenylation signal; WPRE – woodchuck hepatitis virus post-transcriptional regulatory element).
[0300] Figure 73 Analysis of gene expression in Cas9-mediated MeCP2 knockdown neurons is shown. (a) Strategy for purification of nuclei from CRISPR-Cas9-targeted cells from mouse brain. (b) Hierarchical clustering of differentially expressed genes (t-test, p < 0.01, n = 19 populations of sorted nuclei, from 8 animals), detected by RNAseq. The relative log2(TPM + 1) expression levels of genes are normalized for each row and presented on a red-blue scale. Each column represents a population of 100 targeted neuronal nuclei sorted by FACS from isolated dentate gyrus cell populations, from control or from Mecp2 sgRNA-transduced animals, as indicated.
[0301] Figure 74 Cell-autonomous defects in the cellular response properties of neurons after CRISPR-mediated MeCP2 knockdown are shown. (a) Cartoon showing the in vivo experimental setup and visual stimulus parameters from the mouse visual cortex. GFP + neurons are shown. Scale bar, 20 μm. (b) Cartoon showing the configuration for recording in layer 2 / 3 excitatory neurons that receive both contralateral and ipsilateral eye-specific inputs. Genomically modified GFP +The cells are green while the unmodified cells are grey. The normalized spike shapes show regular spiking excitatory neurons. (c, d) Mean OSI (c) and evoked FR (d) were measured from GFP + cells expressing Mecp2 and control sgRNA respectively (t-test, *p < 0.05; the numbers in the figure indicate the number of recorded cells; n = 2 - 3 animals; error bars: s.e.m.).
[0302] Figure 75 Multiplex gene editing synchronized in the mouse brain is shown. (a) Schematic of the CRISPR-Cas9 system designed for multiplex genome targeting. (b) Graphic representation of the targeted DNMT mouse locus. Guide RNAs are indicated in blue. The PAM sequences are labeled in purple. (c) SURVEYOR TM assay gels show modification of the DNMT locus in FACS-sorted GFP-KASH positive cells 4 weeks after AAV delivery in the DG region. (d) Deep sequencing-based analysis of DNMT locus modification in single cells, showing co-occurrence of modifications at multiple loci. (e) Western blot analysis of Dnmt3a and Dnmt1 proteins (top) after in vivo delivery of the CRISPR-Cas9 system targeting DNMT family genes. Western immunoblot quantification of Dnmt3a and Dnmt1 protein levels in the DG after in vivo CRISPR-Cas9 targeting (bottom; t-test, **p < 0.001, *p < 0.05, Dnmt3a: n = 7; Dnmt1: n = 5, from 5 animals; error bars: s.e.m.). (f) Contextual learning deficits 8 weeks after targeting the DNMT gene with SpCas9 in the DG region of the hippocampus, tested in the training and altered context (t-test, ***p < 0.0001, n = 18 animals, 2 independent experiments; error bars: s.e.m.).
[0303] Figure 76Shows the cloning and expression of HA-tagged SpCas9 (HA-SpCas9) for AAV packaging. (a) Schematic overview of different cloning strategies to minimize the SpCas9 expression cassette size, using a short rat Map1b promoter (pMap1b), a truncated form of the mouse Mecp2 promoter (pMecp2), and a short polyA motif (spA). (b) Western blot analysis of primary cortical neuron cultures expressing HA-SpCas9 using different SpCas9 expression cassettes. (c) Mecp2 promoter drives HA-SpCas9 (red) expression in neurons (Map1b, NeuN; arrowheads) but not in astroglia (GFAP, arrows). Co-expression of HA-SpCas9 and GFP-KASH is shown (bottom). Nuclei are labeled with DAPI (blue). Scale bar, 20 μm. (d) Schematic overview of GFP-tagging. Enhanced green fluorescent protein (GFP) fused to the nuclear transmembrane KASH domain and GFP-KASH integration into the outer nuclear membrane are shown. (e) Co-infection efficiency calculation, showing the cell population expressing both HA-SpCas9 and GFP-KASH (n = 973 neurons, from 3 cultures; error bars: s.e.m.). (f) At 7 days post-viral delivery, cells were stained with reagent kit. DAPI + and dead (DEAD + ) cells were quantified (control n = 518 DAPI + nuclei; SpCas9 / GFP-KASH n = 1003 DAPI + nuclei, from 2 cultures; error bars: s.e.m.). (ITR – inverted terminal repeat; HA – hemagglutinin tag; NLS – nuclear localization signal; spA – synthetic polyadenylation signal; U6-PolIII promoter; sgRNA – single guide RNA; hSyn – human synapsin 1 promoter; GFP – green fluorescent protein; KASH – Klarsicht, ANC1, Syne homology nuclear transmembrane domain; bGH pA – bovine growth hormone polyadenylation signal; WPRE – woodchuck hepatitis virus post-transcriptional regulatory element).
[0304] Figure 77 Shows the targeting of Mecp2 in Neuro-2a cells. (a) Mecp2 targeting sequences and the corresponding protospacer adjacent motif (PAM). (b) Evaluation of 6 Mecp2 sgRNAs co-transfected into Neuro-2a cells with SpCas9. Analysis of on-target modification efficiency was performed 48 h post-transfection using SURVEYOR TM assay.
[0305] Figure 78 shows CRISPR-SpCas9 targeting of Mecp2 in primary cortical neurons. (a) Immunofluorescence staining of MeCP2 (red) in cultured neurons 7 days after AAV-CRISPR transduction (green, GFP-KASH). Nuclei were labeled with DAPI (blue). Scale bar, 20 μm. (b) SURVEYOR TM assay gel, evaluation of Mecp2 locus targeting when using SpCas9 or dSpCas9 together with Mecp2 sgRNA or a control (targeting the bacterial lacZ gene) sgRNA. (c) Quantification of MeCP2-positive nuclei in the targeted population of neurons (GFP + ). (d) Western blot of MeCP2 protein levels and quantification of MeCP2 protein levels after CRISPR-SpCas9 targeting of the Mecp2 locus (t-test, **p < 0.001, n = 5, from 3 cultures, error bars: s.e.m).
[0306] Figure 79 shows morphological changes in neuronal dendritic trees upon in vitro SpCas9-mediated knockdown of MeCP2. (a) Reduced complexity of dendritic trees in neurons after CRISPR-SpCas9 targeting of the Mecp2 locus. Scale bar, 20 μm. (b) Changes in dendritic spine morphology in neurons targeted by SpCas9 and Mecp2 sgRNA. Scale bar, 10 μm. The morphology of the cells was visualized by co-transfection with a mCherry construct. Cells for morphological analysis were selected based on the results of Mecp2 staining. (c) Dendritic tree morphology assessed by the number of dendritic endings, and (d) Sholl analysis (t-test, ***p < 0.0001, n = 40, from 2 cultures). (e) Quantification of dendritic spine density (t-test, ***p < 0.0001, n = 40, from 2 cultures, error bars: s.e.m).
[0307] Figure 80Shows RNAseq of neuronal nuclei from control animals and SpCas9-mediated Mecp2 knockdown. Box plots presenting the number of detected genes across the RNA-seq libraries (19 libraries, 100 nuclei each from control sgRNA or Mecp2 sgRNA-transduced nuclei; n = 4 animals / group) / expression level quantiles. All genes were binned into 10 deciles by their average log2(TPM+1) expression level, and then the number of genes detected for each decile in each sample (log2(TPM+1)>2) was counted. The three target sequences shown are SEQ ID NO:___, SEQ ID NO:___, and SEQ ID NO:___ for Dnmt3a, Dnmt1, and Dnmt3b, respectively.
[0308] Figure 81 Shows multiplex genomic targeting of DNMT family members in vitro. (a) Dnmt3a, Dnmt1, and Dnmt3b target sequences and corresponding protospacer adjacent motifs (PAMs). (b) SURVEYOR nuclease assay analysis of Neuro-2a cells 48 hours after transfection with SpCas9 and DNMT 3xsgRNA vectors targeting the Dnmt3a, Dnmt1, and Dnmt3b loci. Efficient genomic editing of all three target genes is shown. TM Nuclease assay analysis. Efficient genomic editing of all three target genes is shown.
[0309] Figure 82 Shows next-generation sequencing of the targeted Dnmt3a, Dnmt1, and Dnmt3b loci. Examples of sequencing results of the mutant Dnmt3a (a), Dnmt1 (b), and Dnmt3b (c) loci after in vivo delivery of SpCas9 and DNMT 3xsgRNA into the mouse dentate gyrus. Green: wild-type sequence, red dashed line: deleted base, red base: insertion or mutation. Red arrows indicate the CRISPR-SpCas9 cleavage sites. The complete sequences used in this figure are provided as SEQ ID NO:, SEQ ID NO:, and SEQ ID NO: for the Dnmt3a, Dnmt1, and Dnmt3b loci, respectively. They are: SEQ ID NO: (Dnmt3a): CCT CCG TGT CAG CGA CCC ATG CCA A, SEQ ID NO: (Dnmt1): CCA GCG TCG AAC AGC TCC AGC CCG, and SEQ ID NO: (Dnmt3b) AGA GGG TGC CAG CGG GTA TAT GAG G
[0310] The figures in this document are for illustrative purposes only and are not necessarily drawn to scale.
[0311] Detailed Description of the Invention
[0312] General information regarding the CRISPR-Cas system: Refer to U.S. Provisional Patent Applications 61 / 758,468; 61 / 802,174; 61 / 806,375; 61 / 814,263; 61 / 819,803 and 61 / 828,130, filed on January 30, 2013; March 15, 2013; March 28, 2013; April 20, 2013; May 6, 2013 and May 28, 2013, respectively. Also refer to U.S. Provisional Patent Application 61 / 836,123, filed on June 17, 2013. Also refer to U.S. Provisional Patent Applications 61 / 736,527 and 61 / 748,427, filed on December 12, 2012 and January 2, 2013, respectively. Also refer to U.S. Provisional Patent Application 61 / 791,409, filed on March 15, 2013. Also refer to U.S. Provisional Patent Application 61 / 799,800, filed on March 15, 2013. Also refer to U.S. Provisional Patent Applications 61 / 835,931; 61 / 835,936; 61 / 836,127; 61 / 836,101; 61 / 836,080 and 61 / 835,973, each filed on June 17, 2013. Further refer to U.S. Provisional Patent Applications 61 / 862,468 and 61 / 862,355, filed on August 5, 2013; 61 / 871,301, filed on August 28, 2013; 61 / 960,777, filed on September 25, 2013 and 61 / 961,980, filed on October 28, 2013. Each of these applications, as well as all documents cited in them or during their prosecution ("application cited documents") and all documents cited or referenced in these application cited references, together with any specifications, descriptions, product specifications, and product sheets for any product mentioned therein or in any of the documents mentioned therein and incorporated by reference therein, are hereby incorporated by reference herein and may be used in the practice of the present invention. All documents (e.g., these applications and application cited documents) are incorporated by reference herein to the same extent as if each individual document was specifically and individually identified as being incorporated by reference.
[0313] Regarding additional general information on the CRISPR-Cas system, it is noted that:
[0314] Multiplex genome engineering using CRISPR / Cas systems. Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., & Zhang, F. Science Feb 15; 339(6121):819-23 (2013);
[0315] RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Jiang, W., Bikard, D., Cox, D., Zhang, F, Marraffini, L.A. Nat Biotechnol Mar; 31(3):233-9 (2013);
[0316] One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR / Cas-Mediated Genome Engineering. Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F., Jaenisch, R. Cell May 9; 153(4):910-8 (2013);
[0317] Optical control of mammalian endogenous transcription and epigenetic states. Konermann S, Brigham MD, Trevino AE, Hsu PD, Heidenreich M, Cong L, Platt RJ, Scott DA, Church GM, Zhang F. Nature. August 22, 2013;500(7463):472-6.doi:10.1038 / nature12466. Epub August 23, 2013;
[0318] Double Nicking by RNA-Guided CRISPR Cas9 for Enhanced Genome Editing Specificity. Ran, FA., Hsu, PD., Lin, CY., Gootenberg, JS., Konermann, S., Trevino, AE., Scott, DA., Inoue, A., Matoba, S., Zhang, Y., & Zhang, F. Cell August 28. pii: S0092-8674(13)01015-5. (2013);
[0319] DNA targeting specificity of RNA-guided Cas9 nucleases. Hsu, P., Scott, D., Weinstein, J., Ran, F. A., Konermann, S., Agarwala, V., Li, Y., Fine, E., Wu, X., Shalem, O., Cradick, T. J., Marraffini, L. A., Bao, G., & Zhang, F. Nat Biotechnol doi:10.1038 / nbt.2647 (2013);
[0320] Genome engineering using the CRISPR-Cas9 system. Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., & Zhang, F. Nature Protocols November; 8(11):2281-308. (2013);
[0321] Genome-Scale CRISPR-Cas9 Knockout Screening in Human Cells. Shalem, O., Sanjana, N. E., Hartenian, E., Shi, X., Scott, D. A., Mikkelson, T., Heckl, D., Ebert, B. L., Root, D. E., Doench, J. G., & Zhang, F. Science December 12. (2013). [e-pub ahead of print];
[0322] Crystal structure of Cas9 in complex with guide RNA and target DNA. Nishimasu, H., Ran, F. A., Hsu, P. D., Konermann, S., Shehata, S. I., Dohmae, N., Ishitani, R., Zhang, F., Nureki, O. Cell Feb. 27, (2014). 156(5):935-49;
[0323] Genome-wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Wu, X., Scott, D. A., Kriz, A. J., Chiu, A. C., Hsu, P. D., Dadon, D. B., Cheng, A. W., Trevino, A. E., Konermann, S., Chen, S., Jaenisch, R., Zhang, F., Sharp, P. A. Nat Biotechnol. (2014) Apr 20. doi:10.1038 / nbt.2889, and
[0324] Development and Applications of CRISPR-Cas9 for Genome Engineering, Hsu, et al., Cell 157, 1262-1278 (June 5, 2014) (Hsu 2014), each of these documents is incorporated herein by reference and briefly discussed as follows:
[0325] ■ Cong et al. modified the type II CRISPR / Cas system based on both Streptococcus thermophilus Cas9 and Streptococcus pyogenes Cas9 for use in eukaryotic cells, and demonstrated that the Cas9 molecule can be directed by short RNAs to induce precise cleavage of DNA in human and mouse cells. Their study further showed that Cas9, when converted into a nickase, can be used to promote homology-directed repair in eukaryotic cells with minimal mutagenic activity. Additionally, their study demonstrated that multiple guide sequences can be encoded into a single CRISPR array to enable simultaneous editing of several endogenous genomic loci within the mammalian genome, demonstrating the facile programmability and broad applicability of RNA-guided nuclease technology. This ability to use RNA to program sequence-specific DNA cleavage within cells defines a new class of genome editing tools. These studies further showed that other CRISPR loci may be transplantable into mammalian cells and can also mediate mammalian genome cleavage. Importantly, it is conceivable that several aspects of the CRISPR / Cas system can be further improved to increase its efficiency and versatility.
[0326] ■ Jiang et al. used the clustered regularly interspaced short palindromic repeats (CRISPR)–associated Cas9 endonuclease, complexed with dual-RNAs, to introduce precise mutations into the genomes of Streptococcus pneumoniae and Escherichia coli. This approach relies on dual-RNA:Cas9-guided cleavage at target genomic loci to kill unmutated cells and obviates the need for selectable markers or counter-selection systems. The study reported reprogramming dual-RNA:Cas9 specificity by altering the sequence of the short CRISPR RNA (crRNA) such that single- and multiple polynucleotide changes are carried on the editing template. The study showed that simultaneous use of two crRNAs enables multiplex mutagenesis. Additionally, when this approach was used in combination with recombineering, nearly 100% of the cells recovered using the described approach in S. pneumoniae contained the desired mutation, and 65% recovered in E. coli contained the mutation.
[0327] ■ Konermann et al. addressed the need in the art for a general and robust technology that enables optical and chemical regulation of DNA-binding domains based on the CRISPR Cas9 enzyme and transcription activator-like effector
[0328] As discussed in this specification, the Cas9 nuclease from microbial CRISPR-Cas systems targets specific genomic loci via a 20-nt guide sequence, which can tolerate some mismatches with the DNA target and thereby promote unwanted off-target mutagenesis. To address this issue, Ran et al. described a pathway for introducing targeted double-strand breaks by combining a Cas9 nickase mutant with paired guide RNAs. Since single nicks in the genome are repaired with high fidelity, simultaneous nicking via appropriately complementary guide RNAs is required for double-strand breaks, and the nick formation extends the number of specifically recognized bases for target cleavage. The authors demonstrated that using paired nick formation can reduce off-target activity in cell lines 50- to 1,500-fold and thereby facilitate gene knockout in mouse zygotes without sacrificing on-target cleavage efficiency. This general strategy enables a wide variety of highly specific genome editing applications.
[0329] Hsu et al. characterized SpCas9 targeting specificity in human cells to inform target site selection and avoid off-target effects. This study evaluated >700 guide RNA variants and SpCas9-induced indel mutation levels at >100 predicted genomic off-target loci in 293T and 293FT cells. These authors showed that SpCas9 tolerates mismatches between guide RNA and target DNA at different positions in a sequence-dependent manner, being sensitive to the number, position, and distribution of the mismatches. These authors further showed that SpCas9-mediated cleavage is not affected by DNA methylation, and the doses of SpCas9 and sgRNA can be titrated to minimize off-target modification. Additionally, to facilitate mammalian genome engineering applications, these authors reported providing a web-based software tool to guide target sequence selection and validation along with off-target analysis.
[0330] Ran et al. described a set of tools for Cas9-mediated genome editing via non-homologous end joining (NHEJ) or homology-directed repair (HDR) in mammalian cells, along with generating modified cell lines (for downstream functional studies). To minimize off-target cleavage, these authors further described a dual-nicking strategy using a Cas9 nickase mutant with paired guide RNAs. The protocols provided by these authors experimentally derived guidelines for selecting target sites, evaluating cleavage efficiency, and analyzing off-target activity. These studies showed that starting with target design, gene modification can be achieved in as few as 1-2 weeks, and modified clonal cell lines can be derived within 2-3 weeks.
[0331] ■ Shalem et al. described new ways to interrogate gene function on a genome-wide scale. Their study showed that delivery of a genome-scale CRISPR-Cas9 knockout (GeCKO) library targeting 18,080 genes with 64,751 unique guide sequences enabled both negative and positive selection screens in human cells. First, the authors showed that the GeCKO library was used to identify genes essential for cell viability in cancer and pluripotent stem cells. Next, in a melanoma model, the authors screened for genes whose loss was involved in resistance to vemurafenib, a therapeutic agent that inhibits the mutant protein kinase BRAF. Their study showed that top candidates included the previously validated genes NF1 and MED12 along with the novel hits NF2, CUL3, TADA2B, and TADA1. The authors observed a high level of concordance between independent guide RNAs targeting the same gene and a high rate of hit confirmation, and thus validated the promise of genome-scale screening using Cas9.
[0332] ■ Nishimasu et al. reported the crystal structure of Streptococcus pyogenes Cas9 complexed with sgRNA and its target DNA at 2.5 Å resolution. The structure revealed a two-lobe architecture composed of a target recognition and a nuclease lobe that accommodates the sgRNA:DNA heteroduplex in a positively charged groove at their interface. Whereas the recognition lobe is essential for binding sgRNA and DNA, the nuclease lobe contains the HNH and RuvC nuclease domains that are appropriately positioned for cleavage of the complementary and non-complementary strands of the target DNA, respectively. The nuclease lobe also contains a carboxy-terminal domain responsible for interaction with the protospacer adjacent motif (PAM). This high-resolution structure and the accompanying functional analysis have revealed the molecular mechanism of RNA-guided DNA targeting by Cas9, thus paving the way for rational design of new general genome editing technologies.
[0333] ■ Wu et al. mapped the genome-wide binding sites of catalytically inactive Cas9 (dCas9) from Streptococcus pyogenes (loaded with single guide RNA (sgRNA)) in mouse embryonic stem cells (mESCs). These authors showed that each of the four sgRNAs tested targeted dCas9 to between dozens and thousands of genomic sites, which were frequently characterized by the 5-nucleotide seed region and the NGG protospacer adjacent motif (PAM) in the sgRNA. Chromatin inaccessibility reduced the binding of dCas9 to other sites with matching seed sequences; thus, 70% of the off-target sites were gene-associated. These authors showed that targeted sequencing of 295 dCas9 binding sites in mESCs transfected with catalytically active Cas9 identified only one mutant site above background levels. These authors proposed a two-state model for Cas9 binding and cleavage, in which seed matching triggers binding but extensive pairing with the target DNA is required for cleavage.
[0334] ■ Hsu 2014 is a review article that generally discusses the history of CRISPR-Cas9 from yogurt to genome editing, including gene screening in cells, information, data, and findings in applications in the lineage of this specification filed before June 5, 2014. The general teachings of Hsu 2014 do not relate to the specific models or animals of this specification.
[0335] The present invention relates to the engineering and optimization of systems, methods, and compositions for controlling gene expression involving sequence targeting, such as genome interference or gene editing involving the CRISPR-Cas system and its components. In advantageous embodiments, the Cas enzyme is Cas9.
[0336] CRISPR-Cas polynucleotide sequences are generally referred to herein as guides, or even as single guide RNAs (sgRNAs), but it will be understood that this term is not as commonly used as before. Additionally, the CRISPR-Cas9 system is mentioned herein, but it will be understood that this broadly refers to any Cas, provided that it has nuclease function to induce DSBs, nicks, or double nicks, although Cas9 is preferred and SaCas9 is particularly preferred.
[0337] Some key points in the liver data of the present invention are summarized below and can be transferred to post-mitotic cells in general, as liver cells are typically post-mitotic:
[0338] AAV2 / 8
[0339] Preferred delivery for CRISPR-Cas systems is by viral vectors. The vector can be a lentiviral vector or an AAV vector, as discussed at some length herein. What we have specifically shown is that AAV is a preferred example of a viral vector. In which, we go on to show that AAV8 and in particular AAV2 / 8 (AAV8 packaged with AAV2 packaging signal ITR) can be used for delivery to the liver, especially in vivo.
[0340] Phenotypic changes seen in vivo
[0341] As discussed elsewhere, we have been able to show that phenotypic changes can be detected in vivo. This is a significant advance as often at the RNAi level of deficiency no lasting effects are seen. For the present invention, phenotypic changes can be seen for the first time in the liver. A preferred arrangement for achieving this is to use it in Example 36. Its important elements are preferably alone or in combination, namely:
[0342] · Sa Cas9;
[0343] · Use of chimeric guide RNAs, including a guide, a tracr sequence and a tracr mate;
[0344] · For the tracr sequence, Sa tracr is preferred to recruit Sa Cas9;
[0345] · AAV8 or more preferably AAV2 / 8;
[0346] · For experimental purposes, Rosa26 is a useful negative control;
[0347] · Although it is helpful to use the CMV promoter in AAV vectors, it is particularly effective to use a liver-specific promoter (for liver targeting) such as TBG;
[0348] · The one or more targets can be a wide range, as it has been shown that once the guide is successfully delivered and the Css9 enzyme is suitably expressed, CRISPR has broad applicability across targets. However, preferred targets in the liver (for which guides can be designed) still include one or more of the following: PCSK9; Hmgcr; SERPINA1; ApoB; and / or LDL.
[0349] Thus, in some embodiments, it is particularly preferred that the Cas enzyme is SaCas9. Preferably, the CRISPR-Cas polynucleotide sequence is chimeric and preferably includes Sa tracr, wherein the Cas9 is SaCas9. A viral vector can be used, which is preferably AAV2 / 8. In addition, a liver-specific promoter is desirable, and a preferred example is TBG. All of these can be used in combination to provide a chimeric CRISPR-Cas polynucleotide sequence comprising Sa tracr, wherein the Cas9 is SaCas9, and the vector is AAV2 / 8, wherein at least the Cas9 is under the control of a liver-specific promoter such as TBG. Any of the above targets can be used for this system, particularly ApoB, due to its importance in obesity.
[0350] The later Nature Biotech Paper by Yin and Anderson (NBT 2884, incorporated herein by reference) provides further support for the in vivo phenotypic changes that we have shown.
[0351] Then we provide additional data therein by demonstrating efficient in vivo editing of somatic liver tissue via Cas9, which provides further support. In addition, delivery via AAV2 / 8 and the use of SaCas9 again demonstrate the utility of this particular in vivo approach. The preferred ApoB was again targeted.
[0352] Later Examples 36 and 37 show excellent in vivo data regarding efficacy, including in vivo phenotypic changes: particularly ApoB (a lipid metabolism gene), while Example 38 demonstrates the applicability of the technique on post-mitotic cells, of which the liver is an important example. Example 39 shows that multiple epitope tags are preferred for detection purposes.
[0353] Although viral vectors are preferred, in some embodiments, the use of cell-penetrating peptides is a viable alternative and is thus also preferred.
[0354] Example 36 shows that both genotype and key phenotypic changes are found in the CRISPR-Cas system. Moreover, the CRISPR-Cas9 system is also effective in inducing in vivo phenotypic changes.
[0355] In particular, the target is ApoB, a lipid metabolism gene. Encouragingly, ApoB can be considered a "gold standard" in liver delivery and is widely used in mouse obesity models. In some embodiments, the liver is the preferred post-mitotic cell, but in other embodiments it can also be excluded. Regardless, this work provides the following proof of principle: phenotypic changes can be seen even in vivo, and this also applies to other post-mitotic cells. Indeed, Example 39 provides further proof of this in a discrete tissue brain with post-mitotic neurons.
[0356] Delivery in Example 37 was via intravenous injection. An AAV vector was used, along with a liver-specific promoter (TBG) for Cas9.
[0357] As can be seen here, delivery via expression from a viral vector is an improvement over hydrodynamic delivery as used by Anderson / Yin's (NBT 2884) as the delivery method, because hydrodynamic delivery requires injection of several milliliters of fluid, which is stressful for the mouse and can be lethal. Hydrodynamic delivery is most suitable for delivery of plasmid (naked) DNA, whereas the applicant has shown that packaging the guide and Cas9 sequences within a viral delivery vector is preferred in terms of greatly increased efficiency. Indeed, only a relatively small volume needs to be introduced, and this can be done via intravenous (i.v.) injection, which is likely to be more therapeutically acceptable.
[0358] Particularly encouraging is not only the genotypic change seen in the liver "gold standard" gene such as ApoB, but also the phenotypic change that was recorded. Previous work with PCSK9 has shown not only genotypic change, but also phenotypic change, and thus the phenotypic change seen with ApoB validates the rationale for CRISPR delivery to the liver and its ability to effect phenotypic change in the liver. This is combined with a more therapeutically acceptable delivery means (i.v., as compared to hydrodynamic delivery). Thus, viral delivery of the CRISPR-Cas9 system (guide and Cas9) is preferred, especially via intravenous injection.
[0359] Potential targets include, but are not limited to, PCSK9, HMGCR, APOB, LDLR, ANGPTL3, F8, F9 / FIX, AAT, FAH, HPD, TAT, ATP7B, UGT1A1, OTC, ARH.
[0360] Accordingly, methods for inducing phenotypic changes in vivo are provided, which include administering a CRISPR-Cas9 system to target cells, such as the liver. Suitable delivery routes are described herein, but in some embodiments, i.v. injection is preferred. Viral vectors are preferred, especially AAV, particularly AAV serotype 2 / 8.
[0361] A CRISPR-Cas9 system is also provided, which includes one or more guides targeting lipid metabolism genes (such as ApoB). Methods for treating obesity are also contemplated, which include administering the CRISPR Cas9 system. Mouse models with knockdown of one or more liver genes (especially one or more lipid metabolism genes such as including ApoB) are preferred.
[0362] Liver-specific promoters for Cas9 will be apparent, but may include those mentioned herein. Preferred examples are TBG.
[0363] As shown in Example 38, the guide can be 18-23 nucleotides in length. It can be 18-22, or 19-22, or 18-21, 20-22, but preferably 22, and most preferably 21 nucleotides in length.
[0364] A proof of concept for successfully packaging guide sequences into the SaCas9 intron is also provided. Accordingly, a CRISPR-Cas9 system in which one or more guide sequences are packaged (positioned or inserted) into the Cas9 intron is preferred.
[0365] The H1 promoter can be used and is preferred in some cases.
[0366] Building on the work by Ran (Cell, 154, August 21, 2013), the degree of overlap in the dual-guide pathway using the D10A nickase was studied. The best results showed between -5 and +1 bp (5' to 5'). Accordingly, it is more preferred to use the dual-guide pathway to minimize off-target effects. These preferably overlap, or are close to overlapping, at their 5' ends, on different strands of the DNA at the genomic target. Preferably, the overlap is in the range of -5 to +1 bp. In these cases, it should be understood that the Cas9 is a nickase, such as the preferred D10A variant.
[0367] Multiple or repeated epitope tags are preferred for the Cas9. Specifically, a triple epitope tag is shown in Example 39 to improve detection. The tag is preferably a repeat, more preferably a triple repeat. HA is the preferred Cas9 epitope tag. Accordingly, a triple HA epitope tag is preferred in some embodiments.
[0368] Example 39 presents the following specific points. It provides:
[0369] The first confirmation of successful in vivo AAV-mediated Cas9 delivery together with efficient genome modification in post-mitotic neurons;
[0370] Development of a nuclear labeling technique that enables easy isolation of neuronal nuclei from cells expressing Cas9 and sgRNA;
[0371] Confirmation of the application of RNAseq analysis to the neuronal transcriptome;
[0372] How electrophysiological studies and other techniques can be integrated with Cas9-mediated genome perturbation to determine phenotypic changes; and
[0373] Confirmation of the ability of multiplex targeting and the use of Cas9-mediated genome editing to study gene function with respect to rodent behavior.
[0374] Based on this, it can be seen that Example 39 provides further proof of concept in two areas: in the understanding and testing of gene function, including the creation and testing of models; and in gene therapy.
[0375] Another aspect to be further discussed below is regarding the method for nuclear labeling.
[0376] It will be understood that the CRISPR-Cas9 system referred to herein is an abbreviation for the Cas9 enzyme provided herein in combination with a guide or guides for targeting one or more genomic sequences. The reference to one or more guides includes sgRNA, together with the chimeric polynucleotide sequences described herein, which chimeric polynucleotide sequences include a guide sequence capable of hybridizing to a target sequence in the genome of a subject, a tracr pairing sequence, and a tracr sequence.
[0377] These data essentially show phenotypic changes resulting from gene knockdown, which was achieved in this case by using two separate CRISPR-Cas9 systems according to the present invention (guide RNA combined with Cas9 enzyme) to successfully perturb gene function. The tissue selected was brain tissue, and the results provide proof of concept for a wide range of Post - mitotic tissues. This is an important distinction because previous work has focused on dividing cells (i.e., pre-mitotic).
[0378] In other words, given that SpCas9 has been widely used to engineer dividing cells, Applicants have demonstrated that SpCas9 can also be used to engineer the genomes of post-mitotic neurons. This was done with high efficiency via NHEJ-mediated indel generation to produce knockdown, but therapeutic uses involving correction via the HDR mechanism (when a repair template is provided) are also envisioned. Both depend on the successful delivery and functional expression of Cas9 and one or more RNA guides, as shown herein.
[0379] The fact that genotype changes induced by the CRISPR-Cas9 system then lead to phenotype changes is important for both of the above aspects (gene function and gene therapy).
[0380] The first CRISPR-Cas9 system employed a guide sequence targeting Mecp2. The dual-vector CRISPR-Cas9 system was successfully employed, where one vector contained the guide and one vector contained Cas9, showing further proof-of-concept for such a dual-vector system. The dual-vector CRISPR-Cas9 system was successfully delivered via stereotactic injection to two independent locations in the brain, specifically the hippocampal dentate gyrus and the visual cortex. In both cases, gene interference of the same gene, Mecp2, was seen, indicating that the dual-vector system was successfully delivered and acted via transcriptional and functional activity in the Cas9 enzyme (in this case SpCas9) and successful recruitment of Cas9 to the genomic target sequence via the guide sequence.
[0381] AAV-mediated in vivo delivery of SpCas9 and sgRNA provides a rapid and powerful technique for achieving precise genomic interference within Complete neural circuits. Thus, the vectors used were AAV vectors, adding additional evidence for their use, particularly in post-mitotic cells and tissues and especially in the brain, in general use and in the dual-vector CRISPR-Cas9 system.
[0382] Of course, it should be understood that the choice of promoter is important in achieving expression from the CRISPR-Cas9 system (particularly Cas9 or both one or more guides and Cas9). Suitable examples for cell and cell life cycle stage specificity can be determined from the literature. Nevertheless, some non-limiting examples include: TBG, a liver-specific promoter, and is used herein to drive the expression of SaCas9; the H1 promoter; the truncated H1 promoter; the U6 promoter. Also, since guides do not necessarily require a specific promoter, one or more guides can similarly be packaged into one / the Cas9 intron.
[0383] The second CRISPR-Cas9 system used includes a multiplex approach. A key advantage of the SpCas9 system is its ability to facilitate multiplex genome editing. This second system successfully targets three or more genes from the same family (in this case Dmnt1, 3a, and 3b) by inclusion of suitable guides and results in stable knockout of multiple genes. This has broad implications for probing the functions of not only individual genes but entire gene families in tissues of live animals. This is particularly important for tissues such as the brain where previously this has not been possible or has only been achievable through years of classical genetics. The applicant has shown that single or multiple gene interference (even complete knockdown) can occur in post-mitotic cells of normal animals. However, this can equally apply to model organisms (e.g., a model organism that already carries a gene mutation or interference or includes some type of altered expression) or transgenic organisms, providing a rapid alternative to existing methods of generating and using model organisms to understand gene function. Additional guides (and / or complete CRISPR-Cas9 systems) can be employed to create subsequent rounds of gene interference and / or rescue (restore gene function, e.g., by correcting the disrupted gene by providing a repair template such as ssDNA suitable for HDR) within the same organism.
[0384] In fact, in general, SpCas9-mediated targeting of single or multiple genes can recapitulate the morphological, electrophysiological, and behavioral phenotypes observed using classical, more time-consuming genetic mouse models.
[0385] Instead of knocking down entire gene families or related genes, the data presented here also provides proof of principle that simultaneous knockdown of three or more unrelated genes is equally feasible. This applies to all tissues but is particularly strongly presented with respect to post-mitotic tissues, especially the brain.
[0386] Another useful aspect of this work is that it shows that a combinatorial, or integrated, approach can be taken to study gene function, using CRISPR to generate genotype alterations and then using classical tools such as electrophysiology (especially relevant to brain and CNS tissues), biochemistry, sequencing, electrophysiology, and / or behavioral readouts to establish what (if any) phenotypic alterations are due to the genotype alterations induced by the CRISPR-Cas9 system. For example, in the brain, this allows us to study the functions of individual genes as well as gene clusters in neural processes in vivo and their role in brain disorders.
[0387] The successful interference with genes in this work is equally applicable to the correction or restoration of gene function, i.e., the use of the CRISPR-Cas9 system in gene therapy. This is particularly relevant to targeting post-mitotic cells, especially the brain.
[0388] Generally, the use of the CRISPR-Cas9 system shows improvements over the prior art, such as zinc fingers, which take a long time to design and produce and cannot be diversified; and shRNA, which has too many off-target effects while the CRISPR off-target effects can be minimized by using the dual-nicking enzyme approach.
[0389] Targeted tissue
[0390] The work herein supports the use of the CRISPR-Cas9 system to target genes in post-mitotic cells by delivering the CRISPR-Cas9 system to the appropriate location (i.e., to cells within an organ or tissue of interest). Preferred tissues are within the following organs:
[0391] Kidney;
[0392] Digestive system, including the stomach, pancreas, duodenum, ileum, and / or colon;
[0393] Heart;
[0394] Lung;
[0395] Brain, particularly neurons, and / or the overall CNS;
[0396] Eye, including retinal tissue;
[0397] Ear, including the inner ear;
[0398] Skin;
[0399] Muscle;
[0400] Bone; and / or
[0401] Liver (generally).
[0402] It should be understood that many of the above organs may include pre-mitotic cells, but this aspect of the invention is directed to post-mitotic cells or tissues within those organs.
[0403] Specifically, the applicant preferably selects the organ to be the kidney or the brain. Within the brain, the data specifically shows delivery to the dentate gyrus of the hippocampus and the visual cortex (which are preferred tissues), although in some embodiments other tissues are also preferably included, any one or more of the following: primary motor cortex, primary auditory cortex, primary somatosensory cortex, cerebellum, main olfactory bulb, prefrontal cortex, piriform nucleus, amygdala, substantia nigra, striatum, globus pallidus, thalamus, hypothalamus, parabrachial nucleus, superior olivary complex, cochlear nucleus, mammillary nucleus.
[0404] Cells from the brain, and particularly neurons, are especially preferred.
[0405] The selection of a promoter for driving the expression of the CRISPR-Cas9 system, particularly Cas9, is important, as mentioned above. The stage of the cell cycle (early / late) and cell type are considered when selecting a promoter, as the promoter will be specific for one or more cell types and cell cycle stages. In some embodiments, suitable promoters may include one or more of the following:
[0406]
[0407] The dual-vector CRISPR-Cas9 system used for targeting the brain, particularly the dentate gyrus of the hippocampus, packages SpCas9 and sgRNA on two separate viral vectors. Thus, Cas9, particularly SpCAs9, is preferably delivered via an adenoviral vector, particularly AAV (i.e., as AAV-SpCas9). The guide is preferably delivered as an sgRNA expression cassette via an adenoviral vector, particularly AAV (i.e., as AAV-SpGuide). The preferred route for this tissue (dentate gyrus of the hippocampus) and for the brain in general is stereotactic injection.
[0408] Understanding and testing of gene function and creation and use of models therefor
[0409] Disorders that can be considered include Huntington's disease, but essentially any disorder found in post-mitotic cells, and particularly those that can benefit from in vivo studies or lack useful models.
[0410] As described above, the CRISPR-Cas9 system can be used to interrogate the function of one or more genes in post-mitotic cells. This can be achieved by delivering the CRISPR-Cas9 system to post-mitotic cells and expressing it therein, where one or more guides of the CRISPR-Cas9 system are designed to recruit Cas9 to one or more genomic targets of interest. Similarly, in the case where Cas9 is already present in the post-mitotic cell in protein (transcribed) form, delivery of the guide to the post-mitotic cell will be sufficient. In the case where Cas9 is already present in the post-mitotic cell in polynucleotide (untranscribed) form, delivery of the guide to the post-mitotic cell together with induction of transcription of the Cas9 polynucleotide will be required. It may be advantageous here to place the Cas9 under the control of an inducible or repressible promoter, such as the tet (tetracycline) switch system.
[0411] One particularly promising aspect is the integration of CRISPR technology with phenotypic assays to determine phenotypic changes, if any, resulting from gene perturbation, particularly knockdown. For example, Example 39 shows what can be achieved with targeted genomic perturbation coupled with quantitative readouts to provide understanding of the biological function of specific genomic elements. Specifically, Cas9-mediated in vivo genome editing in the brain can also be coupled with electrophysiological recordings to study the effect of genomic perturbation on specific cell types or circuit components. In a broader sense, use of the CRISPR-Cas9 system (to provide Cas9-mediated genomic perturbation) can be combined with biochemical, sequencing, electrophysiological, and behavioral assays to study the function of targeted genomic elements.
[0412] Accordingly, in one aspect, provided is: a method of interrogating the function of one or more genes in post-mitotic cells, the method comprising:
[0413] inducing a defective genotype or gene knockdown as described below; and
[0414] determining a change in the expression of the one or more genes in a disorder, thereby interrogating the function of the one or more genes.
[0415] Optionally, the method may further comprise:
[0416] transplanting a second cell population into a subject, thereby inducing a disorder associated with the defective genotype or gene knockdown. This may precede the determining step.
[0417] The following applies broadly to several suitable aspects of the invention. The cells can be in a subject such as a human, animal, or model organism, such that gene function can be interrogated in vivo. However, it is also contemplated that the cells can be ex vivo, such as in cell culture or in a model organ or organoid. In some embodiments, the method can include isolating a first cell population from a subject, optionally culturing them and transducing them with one or more CRISPR-Cas9 systems. Additional optional culturing may be followed. The transduced cells can then be transplanted back into the subject.
[0418] The cell can be from any tissue or organ described herein. The brain is a preferred example, providing the method for interrogating the function of one or more genes, wherein the post-mitotic cell is a brain cell, such as a neuron. In particular in vivo, this allows for the interrogation of gene function with respect to animal behavior. The animal is preferably a mammal, such as a rodent. Given the complexity of the nervous system consisting of an intricate network of heterogeneous cell types, the ability to efficiently edit the genome of neurons in vivo enables the conduct of tests on gene function in relevant cell types embedded in their native context. This is supported by the applicant's data, where knockout mice showed impaired memory consolidation when tested under training context conditions. The applicant's results demonstrate that CRIPSR-Cas9-mediated knockout of DNMT family members in dentate gyrus neurons is sufficient to probe the function of genes in behavioral tasks.
[0419] This shows the versatility of Cas9 in promoting targeted gene knockout in the mammalian brain in vivo for studying gene function and particularly for dissecting neuronal circuits. Introducing stable knockout of multiple genes in the brain of living animals will have potentially far-reaching applications, such as the causal interrogation of multi-gene mechanisms in physiological and neuropathological disorders.
[0420] This work is characterized in that the applicant selected the mouse Mecp2 promoter (235bp, pMecp2)7 and the minimal polyadenylation signal (48bp, spA) based on their ability to achieve sufficient levels of SpCas9 expression in cultured primary mouse cortical neurons. The Mecp2 gene plays a major role in Rett syndrome, which is a type of autism spectrum disorder. To target Mecp2, the applicant first designed several sgRNAs targeting exon 3 of the mouse Mecp2 gene and evaluated their efficacy using Neuro-2a cells. The SURVEYOR nuclease assay was used to identify the most efficient sgRNA. The delivery was via stereotaxic injection of a mixture of high-titer AAV-SpCas9 and AAV-SpGuide (1:1 ratio). The applicant also successfully tested the possibility of multiplex genome editing in the brain. The applicant designed a multiplex sgRNA expression vector consisting of three tandem sgRNAs together with GFP-KASH for nuclear labeling.
[0421] Accordingly, methods of inducing a disorder are also provided, characterized by knockdown of one or more genes in post-mitotic cells. Examples of such disorders are numerous, but may include, by way of example, Rett syndrome. Suitable promoters will be apparent, and the Mecp2 promoter is desirable for Rett syndrome. One way to select a promoter to drive expression of the CRISPR-Cas9 system (specifically Cas9) is to select the promoter for the gene of interest.
[0422] Accordingly, in one aspect, provided is: a method of inducing a disorder, characterized by a defect in one or more genes (or genotypes) or knockdown of genes in post-mitotic cells, the method may include:
[0423] transducing a first cell population with a composition comprising a non-naturally occurring or engineered vector system, the vector system comprising one or more vectors, the vectors comprising
[0424] a first regulatory element operably linked to a CRISPR-Cas system chimeric RNA (chiRNA) polynucleotide sequence, wherein the polynucleotide sequence comprises
[0425] one, two, three, four or more guide sequences capable of hybridizing to three or more target sequences in the genome of the subject,
[0426] a tracr pairing sequence, and
[0427] a tracr sequence, and
[0428] a second regulatory element operably linked to an enzyme-encoding sequence encoding a CRISPR enzyme, the CRISPR enzyme comprising at least one or more nuclear localization sequences (NLSs), wherein (a), (b) and (c) are arranged in a 5' to 3' direction,
[0429] wherein components I and II are on the same or different vectors of the system, wherein upon transcription, the tracr pairing sequence hybridizes to the tracr sequence, and the guide sequence directs sequence-specific binding of the CRISPR complex to the target sequence,
[0430] wherein the CRISPR complex comprises a CRISPR enzyme complexed with (1) a guide sequence hybridized to the target sequence and (2) a tracr pairing sequence hybridized to the tracr sequence,
[0431] wherein the CRISPR enzyme alters the genome of the first cell population to obtain a second cell population carrying the one or more defective genes or knockdown genes.
[0432] Optionally, the method may further comprise:
[0433] Isolating a first cell population from the subject.
[0434] Optionally, the method may further comprise:
[0435] Transplanting the second cell population into the subject thereby inducing a proliferative disorder.
[0436] This may involve introducing a non-functional (including partially non-functional) genotype into target cells, thereby providing a model for research (including future restoration of functional genotypes).
[0437] In cell assays, the CRISPR-Cas9 system can also be used to assist in the study of gene function by enabling targeted knockout in post-mitotic neurons.
[0438] Methods for delivering nucleotides to neuronal cells are well known and reviewed by Karra and Dahm in the Journal of Neuroscience (May 5, 2010, 30(18):6171-6177; doi: 10.1523 / JNEUROSCI.0183-10.2010). Examples include electroporation methods (such as electropermeabilization, nucleofection, and single-cell electroporation); chemical transfection methods (such as Ca2+-phosphate co / precipitation and lipid transfection); viral delivery (such as adenovirus, adeno-associated virus (AAV), lentivirus, and herpes simplex virus); and physical transfection methods (such as microinjection and gene gun (DNA-coated gold particles). All of these can be used to deliver the CRISPR-Cas9 system, but lipid transfection or viral methods are preferred, especially AAV or lentivirus.
[0439] Model
[0440] The model is provided with single or multiple gene knockdowns. One example would be a rodent model for Rett syndrome, Mecp2 knockdown. Others include Dmnt family knockdowns, especially Dmnt1, 3a, and 3b knockdowns. Thus, a model for studying neurological disorders is provided. All that is needed to complete this is to identify the target gene of interest, design a suitable one or more guides, and include these in a suitable CRISPR-Cas9 system and deliver it to one or more post-mitotic cells, either in vivo or ex vivo (as needed). For example, these models can have altered dendritic tree morphology, and / or provide dendritic spine density.
[0441] As mentioned above, model organisms are also provided, such as organoids or "liver-on-a-chip" or non-liver equivalents thereof supported on, for example, a chip or a scaffold, such as ear, kidney, and brain tissue. Animal models and model organisms are preferred. These may already be transformed with Cas9 such that they comprise Cas9 in nucleotide or protein form, as mentioned above. These have the advantage that Cas9 does not need to be delivered in conjunction with one or more guides, and this can in turn allow a greater degree of (guide) multiplexing to be accommodated within the delivery vehicle. Again, the use of an inducible or repressible system such as tet-on or tet-off may be advantageous here.
[0442] All such models can be obtained using the CRISPR-Cas9 system as described above. Due to the versatility of the CRISPR-Cas9 system, the range of possible models, whether human, rodent, mammalian or otherwise, is highly variable, and this can be established by the simple selection of one or more appropriate guides. Methods for creating such models are also provided, including
[0443] Gene therapy
[0444] The data in Example 39 focused on gene perturbation, mainly knockdown. Gene knockdown may only be a small (if significant) part of the overall population of possible applications of the CRISPR-Cas9 system in gene therapy. As already shown in the Yin and Anderson paper (Nature Biotech 28:84, online publication, March 30, 2014), a functional phenotype can be restored after correcting a defective mutation in type I hereditary tyrosinemia (HTI), a condition that is otherwise fatal and is caused by a mutation in fumarylacetoacetate hydrolase (FAH) (G to A in the last nucleotide of exon 8), which results in the skipping of exon 8 during splicing and leads to the formation of a truncated and unstable FAH protein, causing the accumulation of toxic metabolites. Correction of the A mutation back to the wild-type G genotype results in a restored phenotype.
[0445] Thus, the approach taken herein demonstrates that the present invention can be reasonably applied to gene therapy. Specifically, the dual-vector approach, the nuclear labeling approach, the characteristics of brain delivery (the injection form used, the promoter cassette / or viral vector), together with the multiplexing (using multiple guides targeting multiple targets within the same gene or different genes) can be equally applied to corrective gene therapy (i.e., where the defective genotype is corrected) as applied to the exemplified gene knockdown. The main difference between corrective gene therapy and gene knockdown is that, in order to correct a defective genotype, such as a point mutation (e.g., cystic fibrosis, see reference Schwank et al., Cell Stem Cell 13, 653-658, December 5, 2013), it is advantageous to provide a repair template to stimulate the HDR mechanism and also desirably provide a suitable Cas9 nickase.
[0446] Accordingly, the vectors of the present invention preferably target post-mitotic cells. When one or more guides target a defective genotype, it is also preferred to provide a repair template corresponding to the sequence to be corrected (the genotype providing the functional phenotype), e.g., ssDNA. Repair templates are described herein. Cas9 can be provided in the same or a different vector from the vector of the one or more guides. These vectors are preferably viral vectors, more preferably adenoviral vectors, and most preferably AAV vectors. Delivery to the cells is preferably by intravenous injection or by stereotactic injection, as appropriate. The choice of promoter can also be important, and advantageous examples are provided herein.
[0447] A method of treating a genetic disease or disorder caused by or associated with a defective genotype in post-mitotic cells is provided, the method comprising delivering a CRISPR-Cas9 system to appropriate cells. The defective genotype can be a non-wild-type genotype. Specifically, single point mutations and / or single gene disorders are particularly suitable for treatment using the CRISPR-Cas9 system. When multiple genes need to be edited or corrected, a multiplex approach can be used to target them all simultaneously. Alternatively, two or more rounds of different CRISPR-Cas9 systems can be envisioned. Preferably, the wild-type genotype is corrected. It does not necessarily have to be the most common genotype, provided that function is restored or improved in terms of phenotype.
[0448] Examples of restored phenotypes are hearing restoration, restoration of VGLUT3 function, and thereby restoration of hearing in the inner ear of mice (Omar Akil, Rebecca P. Seal, Kevin Burke, Chuansong Wang, Aurash Alemi, Matthew During, Robert H. Edwards, Lawrence R. Lustig. Restoration of Hearing in the VGLUT3 Knockout Mouse Using Virally Mediated Gene Therapy. Neuron, 2012;75(2):283 DOI:10.1016 / j.neuron.2012.05.019). This was using AAV-mediated delivery of VGLUT3 itself, but it is entirely reasonable that the CRISPR-Cas9 system could also be used, preferably also using an AAV vector, to target inner ear cells and correct the non-functional VGLUT3 genotype, with a similar phenotypic result, i.e., restoration of hearing. Thus, it is preferred to use an AAV vector to deliver the CRISPR-Cas9 system to the inner ear, thereby treating hearing loss. In fact, restoration of gene function in sensory organs such as the eye (including the retina), nose, and ear (especially the inner ear) is preferred.
[0449] A relatively recent review that includes a discussion of disorders in post-mitotic tissues (eye, ear, etc.) is Kaufmann et al. (EMBO Mol Med (2013), 5, p1642 - 1661). This confirms the usefulness of AAV in correcting monogenic disorders in post-mitotic tissues. It states that, "Combined with other features such as low inflammatory activity, they have been shown to have excellent safety and are thus very attractive tools for in vivo gene therapy. In fact, alipogene is a recombinant AAV for direct intramuscular injection..." The review of this cited paper reviewed gene therapy in the retina, central nervous system, liver, bone, and myocardium as target tissues. And, under the citation, it indicates that "Initial studies explored the prototype AAV serotype 2 vector, and the collection of AAV vectors has recently expanded to include additional serotypes and even engineered capsids." The literature cited in Kaufmann and Kaufmann is hereby incorporated by reference in its entirety.
[0450] RNAseq analysis of transcriptome
[0451] The combination of SpCas9-mediated genome interference and population-level RNAseq analysis provides a way to characterize transcriptional regulation and to suggest genes that may be important for a particular function or disease process in the cells under consideration. Specifically, the cells are from the brain, particularly neurons. Fast-acting technologies such as the CRISPR-Cas9 system are advantageous in studying the transcriptome, which is transient in nature. Thus, the use of the CRISPR-Cas9 system according to the invention in analyzing the transcriptome (RNAseq) is provided.
[0452] Nuclear labeling method
[0453] To facilitate immunofluorescent identification of neurons expressing SpCas9, the applicant tagged SpCas9 with an HA-epitope tag (derived from human influenza hemagglutinin, a common epitope tag widely used in expression vectors).
[0454] For the AAV-SpGuide vector, the applicant packaged a U6-sgRNA expression cassette together with a green fluorescent protein (GFP) driven by the human synapsin I promoter fused to the KASH nuclear transmembrane domain. This GFP-KASH fusion protein directs GFP to the outer nuclear membrane and enables fluorescence-based identification and purification of intact neurons transduced with AAV-SpGuide.
[0455] Thus, these vectors of the invention are preferably adapted in a similar manner. Thus, there are provided these vectors, wherein the Cas9 is tagged with an epitope tag such as an HA-epitope tag. The Cas9 can be any Cas9 described herein, such as Sp or SaCas9, and can be any variant (e.g., D10A nickase, etc.), provided that it is or can be appropriately tagged.
[0456] These vectors of the invention can also be adapted such that the guide RNA is packaged within an expression cassette that contains:
[0457] a reporter protein; and
[0458] optionally, a suitable promoter for the guide RNA, such as U6;
[0459] wherein the reporter protein is fused to a nuclear transmembrane domain operably linked to a suitable promoter therefor.
[0460] The reporter protein is preferably a fluorescent protein, such as one of green, red or yellow fluorescent protein (GFP, RFP, YFP), etc.
[0461] Examples of nuclear transmembrane domains include KASH-like domains, Sun2 domains, and LEM domains. In some preferred embodiments, the nuclear transmembrane domain is a KASH nuclear transmembrane. Preferably, the promoter for this transmembrane domain is the human synapsin I promoter; see also the documents cited herein.
[0462] This tagging approach can be used in single or dual vector systems, but is preferably within a dual vector system because space is limited in a single vector system and also reduces the need for individual tags.
[0463] In addition, each aspect of this tagging technology can be used independently of one another such that the epitope tagging of Cas9 can be used alone, or the reporter protein / fluorescent protein cassette approach can be used alone, or more preferably both can be used together.
[0464] Kanasty and Anderson (Nature Materials, Volume 12, November 2013) is a useful review, originally submitted on March 11, 2013 and the delivery of RNAi was publicly available online on October 23, 2013. Due to the similarity between RNAi and CRISPR guide sequences, the teachings in this and other areas regarding RNAi provide information on the mechanism for delivering guides in the applicant's CRISPR-Cas9 system. Some of the techniques described are also applicable to the delivery of Cas9. In some cases, it may be useful to deliver the guides of the applicant's CRISPR-Cas9 system independently of Cas9 delivery.
[0465] This can be part of a dual-vector delivery system, where the vectors are considered, in the broadest sense, to be any delivery means that are not specific viral vectors. It is envisioned that the Cas9 can be delivered via a viral vector and the guide(s) specific for the genomic target(s) are delivered separately. As discussed herein, the guide(s) can be delivered via the same vector type as the Cas9, such as a dual-vector system where the Cas9 is delivered in an AAV vector and the one or more guides are delivered in separate AAV vectors. This can be done substantially simultaneously (i.e., co-delivery), but it can also be done at separate time points, separated even by weeks or months. For example, if a first round of the CRISPR-Cas9 system has been delivered, but then additional guides are subsequently needed, the original Cas9, which hopefully still has function in the target cells, can be re-used. If the Cas9 is under the control of an inducible promoter, induction of transcription of the new Cas9 in the target cells is preferred. Similarly, if a Cas9-expression model as provided herein is used, delivery of only the one or more guides is required. Thus, when delivery of the one or more guides needs to be independent of the Cas9, it can be delivered in a very similar manner to RNAi.
[0466] Thus, Khanna's review helps to point out the number of known pathways that are suitable, particularly focused on the liver, although these delivery means are generally suitable for a wide range of cells. Examples include:
[0467] "Liposome delivery systems, together with siRNAs conjugated to lipophilic molecules, interact with serum lipoproteins and are subsequently taken up by hepatocytes that absorb those lipoproteins;"
[0468] PEGylation;
[0469] Conjugates such as:
[0470] Dynamic polyconjugates (DPCs, 10 nm nanoparticles) have been shown to deliver RNAi to successfully inhibit ApoB (thus intersecting with the applicant's work on targeting ApoB via the CRISPR-Cas9 system); and
[0471] Trifunctional GalNAc conjugates
[0472] are "all highly effective", particularly GalNAc;
[0473] Other nanoparticles include:
[0474] Cyclodextrin polymer nanoparticles (CDP), which include additional formulation components such as adamantane-PEG (AD-PEG) and adamantane-PEG-transferrin (AD-PEG-Tf);
[0475] Lipid nanoparticles (LNP), including cationic or ionizable lipids, shielding lipids, cholesterol, and endogenous or exogenous targeting ligands. Examples of endogenous targeting ligands are retinol-binding protein (RBP), which can be used to target liver and pancreatic stellate cells expressing the RBP receptor. Examples of exogenous targeting ligands are GalNac, which also targets the liver via the asialoglycoprotein receptor on hepatocytes. The combined approach is seen in Anlylam's ALN-VSP;
[0476] "The fenestrations in the liver endothelium allow molecules with a diameter of 100 - 200 nm to diffuse out of the bloodstream and into hepatocytes and other liver cells";
[0477] Ligands such as GalNAc are suitable for delivery to non-parenchymal liver cells expressing the mannose receptor and to hepatocytes, and the conjugation of a suitable siRNA to the GalNAc ligand has been shown to successfully inhibit PCSK9; and
[0478] Oligonucleotide nanoparticles (ONP), composed of complementary DNA fragments designed to hybridize to a predefined 3D structure. Using a suitable 3' overhang sequence, 6 siRNA strands can be attached to each particle, even at specific positions. The hydrodynamic diameter is approximately 29 nm.
[0479] These methods are preferred in some embodiments for delivering at least guides for the CRISPR-Cas9 system. Particularly preferred are dynamic polyconjugates or the use of endogenous targeting ligands (such as retinol-binding protein) or exogenous targeting ligands (such as GalNac).
[0480] In yet another embodiment, CRISPR-Cas9-mediated genome editing can be used to correct disease mutations and / or phenotypes. CRISPR-Cas9-mediated genome editing can be used to correct disease mutations and / or phenotypes in the liver and / or hepatocytes, as set forth in the following manuscript, entitled "Genome editing with Cas9 in adult mice corrects a disease mutation and phenotype", Hao Yin et al., Nature Biotechnology, online publication on March 30, 2014; online correction on March 31, 2014, available at the URL nature.com / doifinder / 10.1038 / nbt.2884, which is incorporated herein by reference in its entirety. This paper relates to the CRISPR-Cas9-mediated correction of the Fah mutation in hepatocytes in a mouse model of the human disease hereditary tyrosinemia. It is shown that delivery of the components of the CRISPR-Cas9 system by hydrodynamic injection results in the initial expression of wild-type Fah protein in approximately 1 / 250 of the hepatocytes. It is further shown that the expansion of Fah-positive hepatocytes rescues the weight loss phenotype.
[0481] One advantage of the method of the present invention is that the CRISPR system avoids off-target binding and the side effects associated therewith. This is achieved by using a system that is arranged to have a high degree of sequence specificity for the target DNA.
[0482] Cas9
[0483] Cas9 optimization can be used to enhance function or to develop new functions, and one can generate chimeric Cas9 proteins. Examples generated by the applicant are provided in Example 6. Chimeric Cas9 proteins can be made by combining fragments from different Cas9 homologs. For example, two exemplary chimeric Cas9 proteins are derived from the Cas9 described herein. For example, the applicant fused the N-terminus of St1Cas9 (the fragment from this protein is in bold) to the C-terminus of SpCas9. Benefits of making chimeric Cas9 include any one or all of the following: reduced toxicity; improved expression in eukaryotic cells; enhanced specificity; reduced protein molecular weight, e.g., making the protein smaller by combining minimal domains from different Cas9 homologs; and / or altering the PAM sequence requirements.
[0484] The Cas9 can be used as a general DNA-binding protein. For example, as shown in Example 7, by mutating two catalytic domains (D10 and H840) responsible for cleaving both strands of the DNA target, the applicant used Cas9 as a general DNA-binding protein. To upregulate gene transcription at the target locus, the applicant fused a transcriptional activation domain (VP64) to Cas9. Other transcriptional activation domains are known. As shown in Example 17, transcriptional activation is possible. Also as shown in Example 17, using a Cas9 repressor (DNA-binding domain) that binds to the target gene sequence, gene repression (in the case of the β-catenin gene) is possible, thereby repressing its activity.
[0485] Cas9 and one or more guide RNAs can be delivered using adeno-associated virus (AAV), lentivirus, adenovirus, or other plasmid or viral vector types, in particular, using the formulations and dosages from the following documents: for example, U.S. Patent No. 8,454,972 (formulation, dosage for adenovirus), 8,404,658 (formulation, dosage for AAV), and 5,846,946 (formulation, dosage for DNA plasmid) and from clinical trials and publications on clinical trials involving lentivirus, AAV, and adenovirus. For example, for AAV, the administration route, formulation, and dosage can be as in U.S. Patent No. 8,454,972 and as in clinical trials involving AAV. For adenovirus, the administration route, formulation, and dosage can be as in U.S. Patent No. 8,404,658 and as in clinical trials involving adenovirus. For plasmid delivery, the administration route, formulation, and dosage can be as in U.S. Patent No. 5,846,946 and as in clinical trials involving plasmids. The dosage can be based on or inferred for an individual of average 70 kg and can be adjusted for patients, subjects, mammals of different weights and species. The frequency of administration is within the purview of a medical or veterinary practitioner (e.g., physician, veterinarian), which depends on conventional factors including the age, sex, general health status, other conditions of the patient or subject, and the particular condition or symptom being addressed.
[0486] The viral vector can be injected into the tissue of interest. For cell type-specific genomic modification, the expression of Cas9 can be driven by a cell type-specific promoter. For example, liver-specific expression can use the albumin promoter, while neuron-specific expression can use the synapsin I promoter.
[0487] Transgenic animals and plants
[0488] Transgenic animals (models) are also provided, and the following also applies to ex vivo model tissues and collections of tissues, such as organoids, liver-on-a-chip, and the like. Preferred examples include animals containing Cas9 (either in terms of the polynucleotide encoding Cas9 or the protein itself). Mice, rats, and rabbits are preferred. To generate transgenic mice with these constructs as exemplified herein, one can inject pure linear DNA into the pronuclei of zygotes from pseudopregnant females (e.g., CB56 females). The founder mice are then identified, genotyped, and backcrossed to CB57. Then, the constructs are cloned and optionally confirmed, for example, by Sanger sequencing. In cases where, for example, one or more genes are knocked out in the model, knockouts are envisioned. However, knock-ins (either alone or in combination) are also envisioned. An exemplary Cas9 knock-in mouse was generated, and this is exemplary, but Cas9 knock-in is preferred. To generate a Cas9 knock-in mouse, one can target the same constitutive or conditional construct to the Rosa26 locus as described herein ( Figure 25A -B and 26). The methods of U.S. Patent Publication Nos. 20120017290 and 20110265198, assigned to Sangamo BioSciences, Inc., that target the Rosa locus can be modified to utilize the CRISPR Cas system of the present invention. In another embodiment, the method of U.S. Patent Publication No. 20130236946, assigned to Cellectis, that targets the Rosa locus can also be modified to utilize the CRISPR Cas system of the present invention.
[0489] Utility of conditional Cas9 mice: The Applicant has shown in 293 cells that the conditional Cas9 expression construct can be activated by co-expression with Cre. The Applicant has also shown that correctly targeted R1 mESCs can have active Cas9 when Cre is expressed. Since there is a P2A peptide cleavage sequence after Cas9 and then EGFP, the Applicant identified successful expression by observing EGFP. The Applicant has demonstrated Cas9 activation in mESCs. This same concept is what makes conditional Cas9 mice so useful. The Applicant can cross their conditional Cas9 mice with mice that ubiquitously express Cre (ACTB-Cre line) and can obtain mice that express Cas9 in every cell. Only the delivery of chimeric RNA should be employed in order to induce genome editing in embryonic or adult mice. Interestingly, if the conditional Cas9 mice are crossed with mice that express Cre under a tissue-specific promoter, Cas9 will only be present in the tissues that also express Cre. By delivering chimeric RNA into the same tissues, this approach can be used to edit the genome only in precise tissues.
[0490] As mentioned above, transgenic animals are also provided, as are transgenic plants, especially crops and algae. Transgenic plants can be used in applications other than providing disease models. These applications can include food or feed production by expressing, for example, higher levels of proteins, carbohydrates, nutrients, or vitamins than are typically visible in wild-type. In this regard, transgenic plants, especially legumes and tubers, and animals, especially mammals, such as livestock (cows, sheep, goats, and pigs), as well as poultry and edible insects, are preferred.
[0491] Transgenic algae or other plants, such as rapeseed, can be particularly useful in the production of vegetable oils or biofuels such as alcohols (especially methanol and ethanol). These can be engineered to express or overexpress high levels of oils or alcohols for use in the oil or biofuel industry.
[0492] Adeno - associated virus (AAV)
[0493] In terms of in vivo delivery, AAV is advantageous compared to other viral vectors for several reasons:
[0494] Low toxicity (which may be due to the purification method not requiring ultracentrifugation of cell particles, which may activate the immune response)
[0495] Low probability of causing insertional mutagenesis because it does not integrate into the host genome.
[0496] AAV has a packaging limit of 4.5 or 4.75 Kb. This means that Cas9, as well as the promoter and transcription terminator, must all fit within the same viral vector. Constructs larger than 4.5 or 4.75 Kb will result in a significant reduction in virus production. SpCas9 is quite large, with its gene alone exceeding 4.1 Kb, making it difficult to package into AAV. Therefore, embodiments of the present invention include using shorter Cas9 homologs. For example:
[0497] Species Cas9 Size
[0498] Corynebacterium diphtheriae 3252
[0499] Eubacterium ventriosum 3321
[0500] Streptococcus pasteurianus 3390
[0501] Lactobacillus farciminis 3378
[0502] Sphaerochaeta globus 3537
[0503] Azospirillum sp. B510 3504
[0504] Gluconacetobacter diazotrophicus 3150
[0505] Neisseria cinerea 3246
[0506] Roseburia intestinalis 3420
[0507] Parvibaculum lavamentivorans 3111
[0508] Staphylococcus aureus 3159
[0509] Nitratifractor salsuginis DSM 16511 3396
[0510] Campylobacter lari CF89-12 3009
[0511] Streptococcus thermophilus LMD-9 3396
[0512] Thus, these species are generally preferred Cas9 species. The Applicant has shown delivery and in vivo mouse brain Cas9 expression data.
[0513] Two ways of packaging Cas9-encoding nucleic acid molecules, such as DNA, into viral vectors for mediating in vivo genome modification are preferred:
[0514] To achieve NHEJ-mediated gene knockout:
[0515] Single viral vector:
[0516] Vector containing two or more expression cassettes:
[0517] Promoter - Cas9-encoding nucleic acid molecule - Terminator
[0518] Promoter - gRNA1 - Terminator
[0519] Promoter - gRNA2 - Terminator
[0520] Promoter - gRNA(N) - Terminator (up to the vector size limit)
[0521] Dual viral vector:
[0522] Vector 1 containing one expression cassette for driving Cas9 expression
[0523] Promoter - Cas9-encoding nucleic acid molecule - Terminator
[0524] Vector 2 containing one or more expression cassettes for driving the expression of one or more guide RNAs
[0525] Promoter - gRNA1 - Terminator
[0526] Promoter - gRNA(N) - Terminator (up to the vector size limit)
[0527] To mediate homology-directed repair. In addition to the above single and dual viral vector approaches, additional vectors can be used to deliver homology-directed repair templates.
[0528] Promoters used to drive the expression of Cas9-encoding nucleic acid molecules include:
[0529] AAV ITR can be used as a promoter: This is advantageous for eliminating the need for additional promoter elements (which can take up space in the vector). The additional space freed up can be used to drive the expression of additional elements (gRNA, etc.). Also, ITR activity is weak, so it can be used to reduce toxicity due to overexpression of Cas9.
[0530] For ubiquitous expression, promoters such as CMV, CAG, CBh, PGK, SV40, ferritin heavy or light chain, etc. can be used.
[0531] For brain expression, promoters such as synapsin I for all neurons, CaMKIIα for excitatory neurons, GAD67 or GAD65 or VGAT for GABAergic neurons, etc. can be used.
[0532] For liver expression, the albumin promoter can be used.
[0533] For lung expression, SP-B can be used.
[0534] For endothelial cells, ICAM can be used.
[0535] For hematopoietic cells, IFNβ or CD45 can be used.
[0536] For osteoblasts, OG-2 can be used.
[0537] Promoters used to drive guide RNAs can include:
[0538] Pol III promoters such as U6 or H1
[0539] Use a Pol II promoter and an intron cassette to express gRNA
[0540] Regarding AAV, the AAV can be AAV1, AAV2, AAV5 or any combination thereof. One can select the AAV of the AAV to be targeted to the cells to be targeted; for example, one can select AAV serotype 1, 2, 5 or hybrid capsid AAV1, AAV2, AAV5 or any combination thereof for targeting the brain or neuronal cells; and one can select AAV4 for targeting cardiac tissue. AAV8 can be used for delivery to the liver. The above promoters and vectors are individually preferred.
[0541] RNA delivery is also a useful in vivo delivery method. Figure 27 Delivery and in vivo mouse brain Cas9 expression data are shown. It is possible to deliver Cas9 and gRNA (and, for example, the HR repair template) into cells using liposomes or nanoparticles. Therefore, the delivery of CRISPR enzymes such as Cas9 and / or the RNA of the present invention can be in the form of RNA and carried out via microvesicles, liposomes or nanoparticles. For example, Cas9 mRNA and gRNA can be packaged into liposome particles for in vivo delivery. Liposome transfection reagents such as lipofectamine from Life Technologies and other commercially available reagents can effectively deliver RNA molecules into the liver.
[0542] Increasing NHEJ or HR efficiency also aids delivery. Preferably, NHEJ efficiency is enhanced by co-expressing end-processing enzymes such as Trex2 (Dumitrache et al., Genetics. August 2011; 188(4):787–797). Preferably, HR efficiency is increased by transiently inhibiting NHEJ machinery such as Ku70 and Ku86. HR efficiency can also be increased by co-expressing prokaryotic or eukaryotic homologous recombinases such as RecBCD, RecA.
[0543] Various delivery means are described herein and are further discussed in this section.
[0544] Viral delivery: The CRISPR enzyme, such as Cas9, and / or any RNA of the invention, such as guide RNA, can be delivered using adeno-associated virus (AAV), lentivirus, adenovirus, or other viral vector types, or combinations thereof. Cas9 and one or more guide RNAs can be packaged into one or more viral vectors. In some embodiments, the viral vector can be delivered, for example, by intramuscular injection into the tissue of interest, and sometimes viral delivery is via intravenous, percutaneous, intranasal, oral, mucosal, or other delivery methods. Such delivery can be via a single dose or multiple doses. Those skilled in the art will understand that the actual dose to be delivered herein can vary greatly depending on a variety of factors such as vector selection, target cell, organism, or tissue, the general condition of the subject to be treated, the degree of transformation / modification sought, the route of administration, the mode of administration, the type of transformation / modification sought, and so on.
[0545] Such a dose may further contain, for example, a carrier (water, saline, ethanol, glycerol, lactose, sucrose, calcium phosphate, gelatin, dextran, agar, pectin, peanut oil, sesame oil, etc.), a diluent, a pharmaceutically acceptable carrier (e.g., phosphate buffered saline), a pharmaceutically acceptable excipient, and / or other compounds known in the art. Such a dose formulation can be readily determined by those skilled in the art. The dosage form may further contain one or more pharmaceutically acceptable salts, such as inorganic acid salts like hydrochloride, hydrobromide, phosphate, sulfate, etc.; and organic acid salts such as acetate, propionate, malonate, benzoate, etc. Additionally, adjuvant substances may be present, such as wetting agents or emulsifiers, pH buffering substances, gels or gelling materials, flavoring agents, coloring agents, microspheres, polymers, suspending agents, etc. Additionally, one or more other conventional pharmaceutical ingredients may be present, such as preservatives, humectants, suspending agents, surfactants, antioxidants, anticaking agents, fillers, chelating agents, coating agents, chemical stabilizers, etc., especially when the dosage form is in a reconstitutable form. Suitable exemplary ingredients include microcrystalline cellulose, sodium carboxymethyl cellulose, polysorbate 80, phenethyl alcohol, chlorobutanol, potassium sorbate, ascorbic acid, sulfur dioxide, propyl gallate, parabens, ethyl vanillin, glycerol, phenol, p-chlorophenol, gelatin, albumin, and combinations thereof. A thorough discussion of pharmaceutically acceptable excipients can be obtained from REMINGTON'S PHARMACEUTICAL SCIENCES (Mack Publishing Company, New York, 1991), which is incorporated herein by reference.
[0546] In one embodiment herein, delivery is via an adenovirus, which can be a single boost dose containing at least 1x10 5 adenoviral vector particles (also referred to as particle units, pu). In one embodiment herein, the dose is preferably at least about 1x10 6 particles (e.g., about 1x10 6 -1x10 12 particles), more preferably at least about 1x10 7 particles, even more preferably at least about 1x10 8 particles (e.g., about 1x10 8 -1x10 11 particles or about 1x10 8 -1x10 12 particles), and most preferably at least about 1x10 0 particles (e.g., about 1*x10 9 -1x10 10 particles or about 1x10 9-1 x 10 12 particles), or even at least about 1 x 10 10 particles (e.g., about 1 x 10 10 -1 x 10 12 particles). Alternatively, the dose contains no more than about 1 x 10 14 particles, preferably no more than about 1 x 10 13 particles, even more preferably no more than about 1 x 10 12 particles, even more preferably no more than about 1 x 10 11 particles, and most preferably no more than about 1 x 10 10 particles (e.g., no more than about 1 x 10 9 particles). Thus, the dose can contain a single dose of an adenovirus vector having, for example, about 1 x 10 6 particle units (pu), about 2 x 10 6 pu, about 4 x 10 6 pu, about 1 x 10 7 pu, about 2 x 10 7 pu, about 4 x 10 7 pu, about 1 x 10 8 pu, about 2 x 10 8 pu, about 4 x 10 8 pu, about 1 x 10 9 pu, about 2 x 10 9 pu, about 4 x 10 9 pu, about 1 x 10 10 pu, about 2 x 10 10 pu, about 4 x 10 10 pu, about 1 x 10 11 pu, about 2 x 10 11 pu, about 4 x 10 11 pu, about 1 x 10 12 pu, about 2 x 10 12 pu, or about 4 x 10 12 pu of an adenovirus vector. See, for example, the adenovirus vector in U.S. Patent No. 8,454,972 B2, issued to Nabel et al. on June 4, 2013 (incorporated herein by reference) and the dosage form at column 29, lines 36 - 58 thereof. In one embodiment herein, the adenovirus is delivered via multi - dose.
[0547] In one embodiment herein, the delivery is via AAV. A therapeutically effective dose for in vivo delivery of AAV to humans is considered to be in the range of containing from about 1 x 10 10 to about 1 x 10 10The dose of the functional AAV / ml solution is in the range of saline solution from about 20 to about 50 ml. This dose can be adjusted to balance the therapeutic benefit against any side effects. In one embodiment herein, the AAV dose is generally from about 1x10 5 to 1x10 50 genomic AAVs, from about 1x10 8 to 1x10 20 genomic AAVs, from about 1x10 10 to about 1x10 16 genomes, or about 1x10 11 to about 1x10 16 genomic AAVs. The human dose can be about 1x10 13 genomic AAVs. Such concentrations can be delivered in a vector solution from about 0.001 ml to about 100 ml, about 0.05 to about 50 ml, or about 10 to about 25 ml. By routine testing to establish a dose-response curve, one of ordinary skill in the art can readily establish other effective doses. See, for example, U.S. Patent No. 8,404,658B2, issued to Hajjar et al. on March 26, 2013, at column 27, lines 45-60.
[0548] In one embodiment herein, the delivery is via plasmid. In such plasmid compositions, the dose should be the amount of plasmid sufficient to elicit a response. For example, an appropriate amount of plasmid DNA in the plasmid composition can be from about 0.1 to about 2 mg, or from about 1 μg to about 10 μg.
[0549] The doses herein are based on an individual of average 70 kg. The dosing frequency is within the purview of a medical or veterinary practitioner (e.g., physician, veterinarian) or a skilled scientist in the art. The mice used in the experiments were about 20 g. Based on the amount given to the 20 g mice, one can extrapolate to a 70 kg individual.
[0550] Lentivirus
[0551] Lentiviruses are complex retroviruses that have the ability to infect and express their genes in both mitotic and post-mitotic cells. The most well-known lentivirus is the human immunodeficiency virus (HIV), which uses the envelope glycoproteins of other viruses to target a wide range of cell types.
[0552] Lentiviruses can be prepared as follows. After cloning pCasES10 (containing the lentiviral transfer plasmid backbone), HEK293FT cells at a low passage number (p = 5) are seeded in a T-75 flask until 50% confluent in DMEM with 10% fetal bovine serum and without antibiotics one day before transfection. After 20 hours, the medium is changed to OptiMEM (serum-free) medium, and transfection is carried out 4 hours later. The cells are transfected with 10 μg of the lentiviral transfer plasmid (pCasES10) and the following packaging plasmids: 5 μg of pMD2.G (VSV-g pseudotype), and 7.5 μg of psPAX2 (gag / pol / rev / tat). Transfection is carried out in 4 mL of OptiMEM with a cationic lipid delivery agent (50 μL of Lipofectamine 2000 and 100 μL of Plus reagent). After 6 hours, the medium is changed to DMEM without antibiotics with 10% fetal bovine serum.
[0553] Lentiviruses can be purified as follows. The viral supernatant is harvested after 48 hours. First, the debris in the supernatant is removed and filtered through a 0.45 μm low protein-binding (PVDF) membrane. Then they are spun in an ultracentrifuge at 24,000 rpm for 2 hours. The viral pellet is resuspended in 50 μL of DMEM and incubated overnight at 4°C. Then they are aliquoted and immediately frozen at -80°C.
[0554] In another embodiment, a minimal non-primate lentiviral vector based on equine infectious anemia virus (EIAV) is also contemplated, especially for ocular gene therapy (see, e.g., Balagaan, J Gene Med 2006;8:275-285, online publication Nov 21, 2005 in Wiley InterScience (www.interscience.wiley.com). DOI:10.1002 / jgm.845). In another embodiment, a lentiviral gene therapy vector based on equine infectious anemia virus that expresses angiogenesis inhibitory proteins (endostatin and angiostatin) for the treatment of wet age-related macular degeneration via subretinal injection (see, e.g., Binley et al., HUMAN GENE THERAPY 23:980–991 (September 2012)), which can be modified for the CRISPR-Cas system of the present invention.
[0555] In another embodiment, a self-inactivating lentiviral vector can be used in and / or is suitable for the CRISPR-Cas system of the present invention. The self-inactivating lentiviral vector has siRNA targeting the shared exon of HIV tat / rev, a nucleolus-localized TAR decoy, and an anti-CCR5 specific hammerhead ribozyme (see, for example, DiGiusto et al. (2010) Sci Transl Med 2:36ra43). At least 2.5×10 6 CD34+ cells / kg patient body weight can be collected and pre-stimulated in X-VIVO 15 medium (Lonza) at a density of 2×10 6 cells / ml for 16 to 20 hours. The medium contains 2 mM L-glutamine, stem cell factor (100 ng / ml), Flt-3 ligand (Flt-3L) (100 ng / ml), and thrombopoietin (10 ng / ml) (CellGenix). The pre-stimulated cells can be transduced with lentivirus at a multiplicity of infection of 5 in a 75-cm 2 tissue culture flask coated with fibronectin (25 mg / cm 2 )(RetroNectin, Takara Bio Inc.) for 16 to 24 hours.
[0556] Lentiviral vectors are also disclosed in the treatment of Parkinson's disease, see, for example, U.S. Patent Publication No. 20120295960 and U.S. Patent Nos. 7303910 and 7351585. Lentiviral vectors have also been disclosed in the treatment of eye diseases, see, for example, U.S. Patent Publication Nos. 20060281180, 20090007284, US 20110117189; US20090017543; US 20070054961, US 20100317109. Lentiviral vectors have also been disclosed in delivery to the brain, see, for example, U.S. Patent Publication Nos. US 20110293571; US 20110293571, US 20040013648, US20070025970, US 20090111106 and U.S. Patent No. US 7259015.
[0557] RNA delivery
[0558] RNA Delivery: The CRISPR enzyme, such as Cas9, and / or any RNA of the present invention, such as guide RNA, can also be delivered in the form of RNA. Cas9 mRNA can be generated by in vitro transcription. For example, a PCR cassette containing the following elements can be used to synthesize Cas9 mRNA: T7_promoter-Kozak sequence (GCCACC)-Cas9-3'UTR from β-globin-polyA tail (a string of 120 or more adenines). This cassette can be used for transcription via T7 polymerase. Guide RNA can also be transcribed by in vitro transcription from a cassette containing a T7_promoter-GG-guide RNA sequence.
[0559] To enhance expression and reduce toxicity, the CRISPR enzyme and / or guide RNA can be modified with pseudo-U or 5-methyl-C.
[0560] mRNA delivery methods are particularly promising for current liver delivery. Specifically, AAV8 is particularly preferred for delivery to the liver.
[0561] Nanoparticle
[0562] CRISPR enzyme mRNA and guide RNA can be co-delivered using nanoparticles or lipid envelopes.
[0563] For example, Su X, Fricke J, Kavanagh DG, Irvine DJ ("In vitro and in vivo mRNA delivery using lipid-enveloped pH-responsive polymer nanoparticles" (Mol Pharm. 2011 Jun 6;8(3):774-87. doi: 10.1021 / mp100390w. Epub 2011 Apr 1)) describe biodegradable core-shell structured nanoparticles having a poly(β-amino ester) (PBAE) core encapsulated by a phospholipid bilayer shell. These were developed for in vivo mRNA delivery. The pH-responsive PBAE was selected to facilitate endosomal rupture, while the lipid surface layer was selected to minimize the toxicity of the polycationic core. Thus, these are preferred for delivering the RNA of the present invention.
[0564] In one embodiment, nanoparticles based on self-assembling bioadhesive polymers are considered, which can be applied to oral delivery of peptides, intravenous delivery of peptides, and nasal delivery of peptides, all delivered to the brain. Other embodiments also consider, for example, oral absorption and ocular delivery of hydrophobic drugs. The molecular encapsulation technology involves engineered polymer encapsulation that is protected and delivered to the site of disease (see, e.g., Mazza M. et al., ACS Nano, 2013.7(2):1016-1026; Siew A. et al., Mol Pharm, 2012.9(1):14-28; Lalatsa A. et al., J Contr Rel, 2012.161(2):523-36; Lalatsa A. et al., Mol Pharm, 2012.9(6):1665-80; Lalatsa A. et al., Mol Pharm, 2012.9(6):1764-74; Garrett N.L. et al., JBiophotonics, 2012.5(5-6):458-68; Garrett N.L. et al., JRaman Spect, 2012.43(5):681-688; Ahmad S. et al., JRoyal Soc Interface, 2010.7:S423-33; Uchegbu I.F., Expert Opin Drug Deliv, 2006.3(5):629-40; Qu X. et al., Biomacromolecules, 2006.7(12):3452-9, and Uchegbu I.F. et al., Int J Pharm, 2001.224:185-199). A dose of approximately 5 mg / kg is considered, in single-dose or multi-dose form, depending on the target tissue.
[0565] In one embodiment, nanoparticles developed at MIT by Dan Anderson’s lab that can deliver RNA to cancer cells to halt tumor growth can be used and / or adapted for the CRISPR Cas system of the present invention. Specifically, Anderson’s lab developed a fully automated combinatorial system for the synthesis, purification, characterization, and formulation of novel biomaterials and nanopreparations. See, e.g., Alabi et al., Proc Natl Acad Sci U S A., Aug. 6, 2013; 110(32):12881-6; Zhang et al., Adv Mater., Sep. 6, 2013; 25(33):4641-5; Jiang et al., Nano Lett., Mar. 13, 2013; 13(3):1059-64; Karagiannis et al., ACS Nano., Oct. 23, 2012; 6(10):8484-7; Whitehead et al., ACS Nano., Aug. 28, 2012; 6(8):6922-9; and Lee et al., Nat Nanotechnol., Jun. 3, 2012; 7(6):389-93.
[0566] U.S. Patent Application 20110293703 relates to lipid compounds that are also particularly useful in the administration of polynucleotides and can be adapted for delivering the CRISPR Cas system of the present invention. In one aspect, amino alcohol lipid compounds are combined with an agent to be delivered to a cell or subject to form microparticles, nanoparticles, liposomes, or micelles. The agent to be delivered by the particle, liposome, or micelle can be in gaseous, liquid, or solid form, and the agent can be a polynucleotide, protein, peptide, or small molecule. These amino alcohol lipid compounds can form particles with other amino alcohol lipid compounds, polymers (synthetic or natural), surfactants, cholesterol, carbohydrates, proteins, lipids, etc. The particles can then optionally be combined with a pharmaceutical excipient to form a pharmaceutical composition.
[0567] U.S. Patent Publication No. 0110293703 also provides a method for preparing amino alcohol lipid compounds. One or more equivalents of an amine are reacted with one or more equivalents of an epoxide-terminated compound under suitable conditions to form the amino alcohol lipid compounds of the present invention. In certain embodiments, all of the amino groups of the amine fully react with the epoxide-terminated compound to form a tertiary amine. In other embodiments, all of the amino groups of the amine do not fully react with the epoxide-terminated compound to form a tertiary amine, thereby generating a primary or secondary amine in the amino alcohol lipid compound. These primary or secondary amines are left as such or can react with another electrophile such as a different epoxide-terminated compound. As will be understood by those skilled in the art, reacting an amine with an epoxide-terminated compound that is not in excess will produce a variety of different amino alcohol lipid compounds having different numbers of tails. Certain amines can be fully functionalized with two epoxide-derived compound tails, while other molecules will not be fully functionalized with epoxide-derived compound tails. For example, a diamine or polyamine can include one, two, three, or four epoxide-derived compound tails leaving different amino moieties of the molecule, thereby producing primary, secondary, and tertiary amines. In certain embodiments, not all amino groups are fully functionalized. In certain embodiments, two of the same type of epoxide-terminated compound are used. In other embodiments, two or more different epoxide-terminated compounds are used. The synthesis of the amino alcohol lipid compounds is carried out with or without a solvent, and the synthesis can be carried out at a temperature ranging from 30°C to 100°C, preferably at a higher temperature of approximately 50°C to 90°C. Optionally, the prepared amino alcohol lipid compounds can be purified. For example, a mixture of amino alcohol lipid compounds can be purified to produce amino alcohol lipid compounds having a specific number of epoxide-derived compound tails. Alternatively, the mixture can be purified to produce specific stereoisomers or regioisomers. These amino alcohol lipid compounds can also be alkylated using an alkyl halide (e.g., methyl iodide) or other alkylating agent, and / or they can be acylated.
[0568] U.S. Patent Publication No. 0110293703 also provides a library of amino alcohol lipid compounds prepared by the inventive method. Using high-throughput techniques involving liquid handlers, robots, microtiter plates, computers, etc., these amino alcohol lipid compounds can be prepared and / or screened. In certain embodiments, the ability of these amino alcohol lipid compounds to transfect polynucleotides or other agents (e.g., proteins, peptides, small molecules) into cells is screened.
[0569] U.S. Patent Publication No. 20130302401 relates to a class of poly(β-amino alcohols) (PBAAs) that have been prepared using combinatorial polymerization. These inventive PBAAs can be used as coatings (such as coatings for thin films or multilayer films for medical devices or implants), additives, materials, excipients, non-biofouling agents, micropatterning agents, and cellular encapsulation agents in biotechnological and biomedical applications. When used as surface coatings, these PBAAs elicit varying levels of inflammation both in vitro and in vivo, depending on their chemical structure. The great chemical diversity of this class of materials allows us to identify polymer coatings that inhibit macrophage activation in vitro. Additionally, after subcutaneous implantation of carboxylated polystyrene microparticles, these coatings reduce the recruitment of inflammatory cells and mitigate fibrosis. These polymers can be used to form polyelectrolyte complex capsules for cell encapsulation. The present invention may also have many other biological applications, such as antimicrobial coatings, DNA or siRNA delivery, and stem cell tissue engineering. The teachings of U.S. Patent Publication No. 20130302401 can be applied to the CRISPR-Cas system of the present invention.
[0570] In another embodiment, lipid nanoparticles (LNPs) are contemplated. Specifically, anti-transthyretin small interfering RNA encapsulated in lipid nanoparticles (see, e.g., Coelho et al., N Engl J Med 2013;369:819-29) can be applied to the CRISPR-Cas system of the present invention. A dose of about 0.01 to about 1 mg / kg body weight is contemplated for intravenous administration. Medications for reducing the risk of infusion-related reactions are contemplated, such as dexamethasone, acetampinophen, diphenhydramine or cetirizine, and ranitidine. A multi-dose of about 0.3 mg / kg, once every 4 weeks, for five doses is contemplated.
[0571] LNPs have been shown to be highly effective in delivering siRNA to the liver (see, e.g., Tabernero et al., Cancer Discovery, April 2013, Vol. 3, No. 4, pp. 363-470), and are thus considered for delivering CRISPR Cas to the liver. A dosage of approximately four doses of 6 mg / kg of LNP (or RNA of the CRISPR-Cas system) can be considered, once every two weeks. Tabernero et al. demonstrated that after the first 2 cycles of administering LNP at 0.7 mg / kg, tumor regression was observed, and after the end of 6 cycles, the patient had achieved a partial response, with complete regression of lymph node metastases and significant atrophy of liver tumors. Complete response was obtained after 40 doses were administered to this patient, and after receiving the doses for 26 months, he remained in remission and was completely cured. Two patients with RCC and extrahepatic disease including the kidney, lung, and lymph nodes that progressed after prior treatment with VEGF pathway inhibitors had stable disease at all sites for approximately 8 to 12 months, and one patient with PNET and liver metastases continued to have stable disease in an extended study for 18 months (36 doses).
[0572] However, the charge of the LNP must be taken into account. When cationic lipids bind to negatively charged lipids, non-bilayer structures that facilitate intracellular delivery are induced. Since charged LNPs are rapidly cleared from the circulation after intravenous injection, ionizable cationic lipids with a pKa value below 7 have been developed (see, e.g., Rosin et al., Molecular Therapy, Vol. 19, No. 12, pp. 1286-2200, December 2011). Negatively charged polymers such as siRNA oligonucleotides can be loaded into the LNP at low pH (e.g., pH 4), at which the ionizable lipids exhibit a positive charge. However, at physiological pH, the LNP exhibits a low surface charge compatible with a longer circulation time. Four ionizable cationic lipids have been of interest, namely 1,2-dilinoleyol-3-dimethylammonium-propane (DLinDAP), 1,2-dilinoleoyloxy-3-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleoyloxy-keto-N,N-dimethyl-3-aminopropane (DLinKDMA), and 1,2-dilinoleoyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLinKC2-DMA). It has been shown that LNP siRNA systems containing these lipids exhibit significantly different gene silencing properties in vivo in hepatocytes, with the potential varying according to the DLinKC2-DMA>DLinKDMA>DLinDMA>>DLinDAP series using the factor VII gene silencing model (see, e.g., Rosin et al., Molecular Therapy, Vol. 19, No. 12, pp. 1286-2200, December 2011). A dose level of 1 μg / ml can be considered, especially for formulations containing DLinKC2-DMA.
[0573] The preparation of LNPs and CRISPR Cas encapsulation can be used and / or adapted from Rosin et al., Molecular Therapy, Volume 19, Issue 12, pages 1286 - 2200, December 2011). The cationic lipids 1,2-dilinoleoyl-3-dimethylammonium-propane (DLinDAP), 1,2-dilinoleoyloxy-3-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleoyloxyketo-N,N-dimethyl-3-aminopropane (DLinK-DMA), 1,2-dilinoleoyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLinKC2-DMA), (3-o-[2″-(methoxypolyethylene glycol 2000) succinyl]-1,2-dimyristoyl-sn-glycerol (PEG-S-DMG), and R-3-[(ω-methoxy-poly(ethylene glycol) 2000) carbamoyl]-1,2-dimyristoyloxypropyl-3-amine (PEG-C-DOMG) can be provided by Tekmira Pharmaceuticals (Vancouver, Canada) or synthesized. Cholesterol can be purchased from Sigma (St. Louis, Missouri). Specific CRISPR Cas RNA can be encapsulated in LNPs containing DLinDAP, DLinDMA, DLinK-DMA, and DLinKC2-DMA (cationic lipid:DSPC:CHOL:PEG-S-DMG or PEG-C-DOMG molar ratio of 40:10:40:10). When needed, 0.2% SP-DiOC18 (Invitrogen, Burlington, Canada) can be incorporated to assess cell uptake, intracellular delivery, and biodistribution. Encapsulation is carried out by dissolving a mixture consisting of cationic lipid:DSPC:cholesterol:PEG-c-DOMG (40:10:40:10 molar ratio) in ethanol until the final lipid concentration is 10 mmol / l. This ethanolic solution of lipids can be added dropwise to 50 mmol / l citrate at pH 4.0 to form multilamellar vesicles, resulting in a final concentration of 30% (vol / vol) ethanol. After extruding the multilamellar vesicles through two overlapping 80 nm Nuclepore polycarbonate membranes using an extruder (Northern Lipids, Vancouver, Canada), large unilamellar vesicles can be formed.Encapsulation can be achieved by the following steps: 2 mg / ml of RNA dissolved in 50 mmol / l citrate at pH 4.0 containing 30% ethanol (vol / vol) was added dropwise to the extruded large unilamellar vesicles and incubated at 31 °C for 30 minutes with continuous mixing until the final RNA / lipid weight ratio was 0.06 / 1 (wt / wt). Ethanol removal and neutralization of the formulated buffer were carried out by dialysis for 16 hours using a Spectra / Por 2 regenerated cellulose dialysis membrane in phosphate buffered saline (PBS) at pH 7.4. The nanoparticle size distribution can be determined by dynamic light scattering using a NICOMP 370 particle size analyzer, vesicle / intensity mode, and Gaussian fitting (Nicomp Particle Sizing Systems, Santa Barbara, CA). The diameter of the nanoparticles can be approximately 70 nm for all three LNP systems. The siRNA encapsulation efficiency can be determined by removing free siRNA from the samples collected before and after analysis using a VivaPureD MiniH column (Sartorius StedimBiotech). The encapsulated RNA was extracted from the eluted nanoparticles and quantified at 260 nm. The ratio of siRNA to lipid was determined by measuring the cholesterol content in the vesicles using a cholesterol E enzymatic assay from Wako Chemicals USA (Richmond, VA). PEGylated liposomes (or LNPs) can also be used for delivery.
[0574] The preparation of large LNPs can be used and / or adapted from Rosin et al., Molecular Therapy, Vol. 19, No. 12, pp. 1286 - 2200, December 2011. A lipid premix solution (total lipid concentration of 20.4 mg / ml) can be prepared in ethanol containing DLinKC2-DMA, DSPC, and cholesterol in a molar ratio of 50:10:38.5. Sodium acetate can be added to the lipid premix in a molar ratio of 0.75:1 (sodium acetate:DLinKC2-DMA). Subsequently, the lipids can be hydrated by combining the mixture with 1.85 volumes of citrate buffer (10 mmol / l, pH 3.0) with vigorous stirring, resulting in spontaneous liposome formation in an aqueous buffer containing 35%. The liposome solution can be incubated at 37 °C to allow for a time-dependent increase in particle size. Aliquots can be removed at different times during incubation by dynamic light scattering (Nano Zetasizer ZS, Malvern Instruments, Worcestershire, UK) to study changes in liposome size. Once the desired particle size is achieved, an aqueous PEG-lipid solution (stock solution = 10 mg / ml PEG-DMG in 35% (vol / vol) ethanol) can be added to the liposome mixture to give a final PEG molar concentration of 3.5% of the total lipid. After addition of the PEG-lipid, the liposomes should have their size effectively inhibited from further growth. Then, RNA can be added to the empty liposomes at an siRNA to total lipid ratio of approximately 1:10 (wt:wt), and then incubated at 37 °C for 30 minutes to form the loaded LNPs. Subsequently, the mixture can be dialyzed overnight in PBS and filtered through a 0.45-μm syringe filter.
[0575] Spherical nucleic acids (SNA TM ) constructs and other nanoparticles, especially gold nanoparticles, are also considered as means to deliver the CRISPR / Cas system to the intended target. Important data indicate that the AuraSense therapeutic spherical nucleic acid (SNA TM ) construct based on nucleic acid-functionalized gold nanoparticles is superior to alternative platforms based on several key success factors, such as:
[0576] High in vivo stability. Due to their dense loading, most of the payload (DNA or siRNA) remains conjugated to the construct inside the cell, conferring nucleic acid stability and resistance to enzymatic degradation.
[0577] Deliverability. For all cell types studied (e.g., neurons, tumor cell lines, etc.), these constructs demonstrated 99% transfection efficiency without the need for a carrier or transfection agent.
[0578] Therapeutic targeting. The unique target-binding affinity and specificity of these constructs allow for precise specificity for the matching target sequence (i.e., restricted off-target effects).
[0579] Superior efficacy. These constructs significantly outperform first-in-class conventional transfection reagents (Lipofectamine 2000 and Cytofectin).
[0580] Low toxicity. These constructs can enter a variety of cultured cells, primary cells, and tissues without significant toxicity.
[0581] No significant immune response. These constructs cause minimal changes in global gene expression, as measured by whole-genome microarray studies and cytokine-specific protein assays.
[0582] Chemical modifiability. Any number of individual or combinatorial agents (e.g., proteins, peptides, small molecules) can be used to modify the surface of these constructs.
[0583] This platform for nucleic acid-based therapeutics can be applicable to many disease states, including inflammatory and infectious diseases, cancer, skin disorders, and cardiovascular diseases.
[0584] Citable references include: Cutler et al., J. Am. Chem. Soc. 2011, 133, 9254 - 9257; Hao et al., Small 2011, 7, 3158 - 3162; Zhang et al., ACS Nano 2011, 5, 6962 - 6970; Cutler et al., J. Am. Chem. Soc. 2012, 134, 1376 - 1391; Young et al., Nano Lett. 2012, 12, 3867 - 3871; Zheng et al., Proc. Natl. Acad. Sci. USA 2012, 109, 11975 - 11980; Mirkin, Nanomedicine 2012, 7, 635 - 638; Zhang et al., J. Am. Chem. Soc. 2012, 134, 16488 - 16491; Weintraub, Nature 2013, 495, S14 - S16; Choi et al., Proc. Natl. Acad. Sci. USA 2013, 110(19), 7625 - 7630; Jensen et al., Sci Transl Med 2013, 5, 209ra152; and Mirkin et al., Small, doi.org / 10.1002 / smll.201302143.
[0585] Self-assembling nanoparticles with siRNA can be constructed with polyethyleneimine (PEI) that is polyethylene glycolylated, where an Arg-Gly-Asp (RGD) peptide ligand is attached at the distal end of polyethylene glycol (PEG), for example, as a means to target the neovasculature of tumors expressing integrin and as a means to deliver siRNA that inhibits the expression of vascular endothelial growth factor receptor 2 (VEGFR2) and thereby inhibits tumor angiogenesis (see, e.g., Schiffelers et al., Nucleic Acids Research, 2004, Vol. 32, No. 19). Nanobundles are prepared by mixing equal volumes of aqueous solutions of the cationic polymer and the nucleic acid to yield a net molar excess of ionizable nitrogen (polymer) over phosphate (nucleic acid) in the range of 2 to 6, whereby electrostatic interactions between the cationic polymer and the nucleic acid result in the formation of polyplexes having an average particle size distribution of about 100 nm, hereinafter referred to as nanobundles. A dose of about 100 to 200 mg of CRISPR Cas is envisioned for delivery in the self-assembling nanoparticles of Schiffelers et al.
[0586] The nanobundles of Bartlett et al. (PNAS, September 25, 2007, Vol. 104, No. 39) can also be applied to the present invention. The nanobundles of Bartlett et al. are prepared by mixing equal volumes of aqueous solutions of a cationic polymer and nucleic acid to produce a net molar excess of ionizable nitrogen (polymer) over phosphate (nucleic acid) in the range of 2 to 6. The electrostatic interaction between the cationic polymer and the nucleic acid results in the formation of polyplexes having an average particle size distribution of about 100 nm, hereinafter referred to as nanobundles. The DOTA-siRNA of Bartlett et al. is synthesized as follows: 1,4,7,10-tetraazacyclododecane-1,4,7,10-tetraacetic acid mono(N-hydroxysuccinimide ester) (DOTA-NHS ester) was ordered from Macrocyclics (Dallas, Tex.). An amine-modified RNA sense strand having a 100-fold molar excess of DOTA-NHS-ester in carbonate buffer (pH 9) was added to a microcentrifuge tube. These contents were reacted by stirring at room temperature for 4 hours. The DOTA-RNA sense conjugate was precipitated with ethanol, resuspended in water, and annealed to an unmodified antisense strand to produce DOTA-siRNA. All liquids were pretreated with Chelex-100 (Bio-Rad, Hercules, Calif.) to remove trace metal contaminants. Tf-targeted and non-targeted siRNA nanoparticles can be formed by using a polycation containing cyclodextrin. Typically, the nanoparticles are formed in water at a feed ratio of 3(+ / -) and a siRNA concentration of 0.5 g / l. One percent of the adamantane-PEG molecules on the surface of the targeted nanoparticles are modified with Tf (adamantane-PEG-Tf). The nanoparticles are suspended in a 5% (wt / vol) glucose carrier solution for injection.
[0587] Davis et al. (Nature, Vol. 464, April 15, 2010) conducted a siRNA clinical trial (ClinicalTrials.gov identifier NCT00689065) using a targeted nanoparticle delivery system. Patients with solid cancers refractory to standard-of-care treatment were given doses of the targeted nanoparticles by 30-minute intravenous infusion on Days 1, 3, 8, and 10 of a 21-day cycle. These nanoparticles contain a synthetic delivery system that includes: (1) a linear, cyclodextrin-based polymer (CDP), (2) a human transferrin (TF) targeting ligand for engaging the TF receptor (TFR) on the surface of cancer cells, displayed on the exterior of the nanoparticles, (3) a hydrophilic polymer (polyethylene glycol (PEG) used to promote nanoparticle stability in biological fluids), and (4) siRNA designed to reduce the expression of RRM2 (the sequence used in the clinic, previously designated siR2B+5). The TFR has long been known to be downregulated in malignant cells, and RRM2 is an established anti-cancer target. These nanoparticles (the clinical version designated CALAA-01) have been shown to be well tolerated in multi-dose studies in non-human primates. Although siRNA has been administered to a single patient with chronic myeloid leukemia by liposomal delivery, the clinical trial by Davis et al. was the first human trial to systemically deliver siRNA with a targeted delivery system and treat patients with solid cancers. To determine whether the targeted delivery system could effectively deliver functional siRNA to human tumors, Davis et al. studied biopsies from three patients in three different dose cohorts; Patients A, B, and C all had metastatic melanoma and received 18, 24, and 30 mg m -2 of CALAA-01 doses of siRNA. Similar doses can also be considered for the CRISPR Cas systems of the present invention. Delivery of the present invention can be achieved with nanoparticles containing a linear cyclodextrin-based polymer (CDP), a human transferrin (TF) targeting ligand for engaging the TF receptor (TFR) on the surface of cancer cells, displayed on the exterior of the nanoparticles, and / or a hydrophilic polymer (e.g., polyethylene glycol (PEG) used to promote nanoparticle stability in biological fluids).
[0588] Exosome
[0589] Exosomes are endogenous nanovesicles that can deliver short interfering (si) RNA to the mouse brain, along with transfer RNA and proteins. To reduce immunogenicity, Alvarez-Erviti et al. (2011, Nature Biotechnology 29:341) used self-derived dendritic cells for exosome production. Targeting was achieved by engineering dendritic cells to express Lamp2b, an exosomal membrane protein fused to the neuron-specific RVG peptide. Purified exosomes were loaded with exogenous siRNA by electroporation. Intravenous injection of RVG-targeted exosomes specifically delivered GAPDH siRNA to neurons, microglia, and oligodendrocytes in the brain, resulting in specific gene knockout. Pre-exposure to RVG exosomes did not attenuate knockdown, and no non-specific uptake was observed in other tissues. The therapeutic potential of exosome-mediated siRNA delivery was demonstrated by strong mRNA (60%) and protein (62%) knockdown of BACE1, a therapeutic target in Alzheimer's disease.
[0590] To obtain a pool of immunologically inert exosomes, Alvarez-Erviti et al. harvested bone marrow from inbred C57BL / 6 mice with a homologous major histocompatibility complex (MHC) haplotype. Since immature dendritic cells produce large amounts of exosomes lacking T cell activators such as MHC-II and CD86, Alvarez-Erviti et al. selected dendritic cells with granulocyte / macrophage colony-stimulating factor (GM-CSF) for 7 days. The next day, exosomes were purified from the culture supernatant using a well-established ultracentrifugation protocol. The exosomes produced were physically homogeneous, with a peak particle size distribution of 80 nm in diameter, as determined by nanoparticle tracking analysis (NTA) and electron microscopy. Alvarez-Erviti et al. obtained 6-12 μg of exosomes (based on protein concentration measurement) / per 10 6 cells.
[0591] Secondly, Alvarez-Erviti et al. investigated the possibility of loading modified exosomes with exogenous cargo using a perforation protocol suitable for nanoscale applications. Since electroporation has not been well characterized for nanoscale membrane particles, non-specific Cy5-labeled siRNA was used for empirical optimization of the electroporation protocol. The amount of encapsulated siRNA was determined after exosome ultracentrifugation and lysis. Electroporation at 400 V and 125 μF resulted in the best retention of siRNA and was used for all subsequent experiments.
[0592] Alvarez-Erviti administered 150 μg of each BACE1 siRNA encapsulated in 150 μg of RVG exosomes to normal C57BL / 6 mice and compared the knockdown efficiency with four controls: untreated mice, mice injected only with RVG exosomes, mice injected with BACE1 siRNA complexed with an in vivo cationic liposome reagent, and mice injected with BACE1 siRNA complexed with RVG-9R, the RVG peptide conjugated with nine D-arginines electrostatically bound to the siRNA. Three days after administration, cortical tissue samples were analyzed, and significant protein knockdown was observed in both siRNA-RVG-9R-treated and siRNA-RVG exosome-treated mice (45%, P < 0.05, compared to 62%, P < 0.01), due to significant decreases in BACE1 mRNA levels (66% [+ or -] 15%, P < 0.001 and 61% [+ or -] 13%, P < 0.01, respectively). Moreover, the applicant demonstrated a significant decrease in total [β]-amyloid 1-42 levels (55%, P < 0.05) in RVG-exosome-treated animals, where β-amyloid is a major component of amyloid plaques in Alzheimer pathology. The decrease observed was greater than the β-amyloid 1-40 decrease demonstrated in normal mice after intracerebroventricular injection of a BACE1 inhibitor. Alvarez-Erviti performed 5'-cDNA end rapid amplification (RACE) on BACE1 cleavage products, which provided evidence of RNAi-mediated knockdown via siRNA.
[0593] Finally, Alvarez-Erviti et al. studied whether siRNA-RVG exosomes induced an immune response in vivo by assessing the serum concentrations of IL-6, IP-10, TNFα, and IFN-α. After treatment with siRNA-RVG exosomes, non-significant changes were registered in all cytokines, similar to those after treatment with a siRNA transfection reagent, which strongly stimulates IL-6 secretion, confirming the immunologically inert properties of this exosome treatment. Assuming that exosomes only encapsulate 20% of the siRNA, delivery with RVG-exosomes appears to be more efficient than delivery with RVG-9R, because comparable mRNA knockdown and better protein knockdown were achieved with five-fold less siRNA, without a corresponding level of immune stimulation. This experiment demonstrated the therapeutic potential of the RVG-exosome technology, which is potentially suitable for the long-term silencing of genes associated with neurodegenerative diseases. The exosome delivery system of Alvarez-Erviti et al. can be used to deliver the CRISPR-Cas system of the present invention to therapeutic targets, especially neurodegenerative diseases. A dose of about 100 to 1000 mg of CRISPR Cas encapsulated in about 100 to 1000 mg of RVG exosomes can be considered for the present invention.
[0594] El-Andaloussi et al. (Nature Protocols 7, 2112–2126 (2012)) disclosed how exosomes derived from cultured cells can be used for in vitro and in vivo delivery of siRNA. This protocol first describes the generation of targeted exosomes by transfection of an expression vector containing an exosomal protein fused to a peptide ligand. Secondly, El-Andaloussi et al. explained how to purify and characterize exosomes from the transfected cell supernatant. Next, El-Andaloussi et al. detailed the key steps for loading siRNA into exosomes. Finally, El-Andaloussi et al. outlined how to use exosomes for efficient in vitro delivery of siRNA and in vivo delivery to the mouse brain. Examples of expected results were also provided, where exosome-mediated siRNA delivery was evaluated by functional analysis and imaging. The entire protocol takes about 3 weeks. Delivery or administration according to the present invention can be carried out using exosomes generated from autologous dendritic cells.
[0595] In another embodiment, plasma exosomes of Wahlgren et al. (Nucleic Acids Research, 2012, Vol. 40, No. 17, e130) are considered. Exosomes are nanovesicles (30–90 nm in size) produced by many cell types including dendritic cells (DCs), B cells, T cells, mast cells, epithelial cells, and tumor cells. These vesicles are formed by inward budding of late endosomes and are then released into the extracellular environment after fusion with the plasma membrane. Since exosomes naturally transport RNA between cells, this property may be useful in gene therapy.
[0596] Exosomes from plasma are prepared as follows: The buffy coat is centrifuged at 900 g for 20 minutes to separate the plasma, after which the cell supernatant is harvested, centrifuged at 300 g for 10 minutes to remove cells, and centrifuged at 16,500 g for 30 minutes, after which it is filtered through a 0.22 mm filter. The exosomes are precipitated by centrifugation at 120,000 g for 70 minutes. Chemical transfection of siRNA into exosomes is carried out according to the manufacturer's instructions in the RNAi Human / Mouse Starter Kit (Quiagen, Hilden, Germany). The siRNA is added to 100 ml of PBS at a final concentration of 2 mmol / ml. After adding the HiPerFect transfection reagent, the mixture is incubated at room temperature for 10 minutes. To remove excess micelles, the exosomes are re-separated using aldehyde / sulfate latex beads. Chemical transfection of CRISPR Cas into exosomes can be carried out analogously to siRNA. The exosomes can be co-cultured with monocytes and lymphocytes isolated from the peripheral blood of healthy donors. Thus, it is contemplated that exosomes containing CRISPR Cas can be introduced into human monocytes and lymphocytes and re-introduced in an autologous manner. Therefore, plasma exosomes can be used for delivery or administration according to the present invention.
[0597] Liposome
[0598] Delivery or administration according to the present invention can be carried out using liposomes. Liposomes are spherical vesicle structures composed of a single or multiple lipid bilayers surrounding an internal aqueous compartment and a relatively impermeable outer lipophilic phospholipid bilayer. Liposomes have received considerable attention as drug delivery carriers because they are biocompatible, non-toxic, can deliver hydrophilic and lipophilic drug molecules, protect their payloads from degradation by plasma enzymes, and transport their payloads across biological membranes and the blood-brain barrier (BBB) (for a review, see, e.g., Spuch and Navarro, Journal of Drug Delivery, Volume 2011, Article ID 469679, page 12, 2011. doi:10.1155 / 2011 / 469679).
[0599] Liposomes can be manufactured from several different types of lipids; however, phospholipids are most commonly used to produce liposomes as drug carriers. Although liposome formation is spontaneous when a lipid membrane is mixed with an aqueous solution, it can also be accelerated by applying force in the form of shaking using a homogenizer, an ultrasonic generator, or an extrusion device (for a review, see, e.g., Spuch and Navarro, Journal of Drug Delivery, Volume 2011, Article ID 469679, page 12, 2011. doi:10.1155 / 2011 / 469679).
[0600] Several other additives can be added to liposomes in order to modify their structure and properties. For example, cholesterol or sphingomyelin can be added to the liposome mixture in order to help stabilize the liposome structure and prevent leakage of the liposome internal payload. In addition, liposomes are prepared from hydrogenated phosphatidylcholine or phosphatidylcholine, cholesterol, and dicetyl phosphate, and the average vesicle size of the liposomes is adjusted to about 50 to 100 nm. (For a review, see, e.g., Spuch and Navarro, Journal of Drug Delivery, Volume 2011, Article ID 469679, page 12, 2011. doi:10.1155 / 2011 / 469679).
[0601] Conventional liposome formulations are mainly composed of natural phospholipids and lipids such as 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), sphingomyelin, phosphatidylcholine, and monosialoganglioside. Since such formulations consist only of phospholipids, liposome formulations have encountered many challenges, one of which is instability in plasma. Several attempts have been made to overcome these challenges, especially in the treatment of the lipid membrane. One of these attempts has focused on the treatment of cholesterol. Adding cholesterol to conventional formulations slows down the rapid release of encapsulated bioactive compounds into plasma, or adding 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) increases stability (for a review, see, e.g., Spuch and Navarro, Journal of Drug Delivery, Volume 2011, Article ID 469679, page 12, 2011. doi:10.1155 / 2011 / 469679).
[0602] In a particularly advantageous embodiment, Trojan Horse liposomes (also known as molecular Trojans) are desirable and the protocol can be seen at http: / / cshprotocols.cshlp.org / content / 2010 / 4 / pdb.prot5407.long. These particles allow for the delivery of transgenes to the entire brain after intravascular injection. Without limitation, neutral lipid particles surface-bound with specific antibodies allow crossing of the blood-brain barrier via endocytosis. The applicant hypothesizes that using Trojan Horse liposomes to deliver the CRISPR family of nucleases to the brain via intravascular injection would allow for whole-brain transgenic animals without the need for embryonic manipulation. For in vivo administration in liposomes, about 1-5 g of nucleic acid molecules, such as DNA or RNA, can be considered.
[0603] In another embodiment, the CRISPR Cas system can be administered in liposomes, such as a stable nucleic acid-lipid particle (SNALP) (see, e.g., Morrissey et al., Nature Biotechnology, Vol. 23, No. 8, August 2005). Daily intravenous injection of specific CRISPR Cas in targeted SNALP at about 1, 3, or 5 mg / kg / day is contemplated. The daily treatment can be for about three days, followed by weekly treatment for about five weeks. In another embodiment, SNALP encapsulating specific CRISPR Cas administered by intravenous injection at a dose of about 1 or 2.5 mg / kg is also contemplated (see, e.g., Zimmerman et al., Nature Letters, Vol. 441, May 4, 2006). The SNALP formulation can contain lipids 3-N-[(ω-methoxypoly(ethylene glycol)2000)carbamoyl]-1,2-dimyristyloxy-propylamine (PEG-C-DMA), 1,2-dilinoleyloxy-N,N-dimethyl-3-aminopropane (DLinDMA), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), and cholesterol in a molar percentage of 2:40:10:48 (see, e.g., Zimmerman et al., Nature Letters, Vol. 441, May 4, 2006).
[0604] In another embodiment, it has been demonstrated that stable nucleic acid-lipid particles (SNALPs) effectively deliver molecules to highly vascularized HepG2-derived liver tumors, but not to poorly vascularized HCT-116-derived liver tumors (see, e.g., Li, Gene Therapy (2012) 19, 775–780). These SNALP liposomes can be prepared by formulating D-Lin-DMA and PEG-C-DMA with distearoylphosphatidylcholine (DSPC), cholesterol, and siRNA using a lipid / siRNA ratio of 25:1 and a molar ratio of cholesterol / D-Lin-DMA / DSPC / PEG-C-DMA of 48 / 40 / 10 / 2. The resulting SNALP liposomes are approximately 80 - 100 nm in size.
[0605] In yet another embodiment, the SNALP can comprise synthetic cholesterol (Sigma-Aldrich, St. Louis, Missouri, USA), dipalmitoylphosphatidylcholine (Avanti PolarLipids, Alabaster, Alabama, USA), 3-N-[(ω-methoxypoly(ethylene glycol)2000)carbamoyl]-1,2-dimyristyloxypropylamine, and the cationic 1,2-dilinoleyloxy-3-N,N-dimethylaminopropane (see, e.g., Geisbert et al., Lancet 2010;375:1896-905). A dose of about 2 mg / kg total CRISPR Cas / dose can be considered, for example, for intravenous bolus administration.
[0606] In yet another embodiment, the SNALP can comprise synthetic cholesterol (Sigma-Aldrich), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC; Avanti PolarLipids), PEG-cDMA, and 1,2-dilinoleyloxy-3-(N;N-dimethyl)aminopropane (DLinDMA) (see, e.g., Judge, J. Clin. Invest. 119:661-673 (2009)). Formulations for in vivo studies can comprise a final lipid / RNA mass ratio of about 9:1.
[0607] The safety of RNAi nanomedicines has been reviewed by Barros and Gollob of Alnylam Pharmaceuticals (see, e.g., Advanced Drug Delivery Reviews 64 (2012) 1730–1737). Stable nucleic acid lipid particles (SNALP) are composed of four different lipids—a cationic ionizable lipid (DLinDMA) that is cationic at low pH, a neutral helper lipid, cholesterol, and a diffusible polyethylene glycol (PEG)-lipid. The particles are approximately 80 nm in diameter and are electrically neutral at physiological pH. During formulation, the ionizable lipid is used to condense the lipids with the anionic siRNA during particle formation. When positively charged under increasing acidic endosomal conditions, the ionizable lipid also mediates the fusion of the SNALP with the endosomal membrane, allowing for the release of the siRNA into the cytoplasm. The PEG-lipid stabilizes the particles and reduces aggregation during formulation, subsequently providing a neutral hydrophilic exterior to improve pharmacokinetic properties.
[0608] To date, two clinical programs have been initiated using SNALPsiRNA formulations. Tekmira Pharmaceuticals recently completed a Phase I single-dose study of SNALP-ApoB in adult volunteers with elevated LDL cholesterol. ApoB is primarily expressed in the liver and jejunum and is required for the assembly and secretion of VLDL and LDL. ApoB has also been successfully targeted by the applicant's CRISPR-Cas system, see Examples 37-38. Seventeen subjects received a single dose of SNALP-ApoB (dose escalation across 7 dose levels). There was no evidence of liver toxicity (the potential dose-limiting toxicity expected based on preclinical studies). One of the two subjects at the highest dose experienced flu-like symptoms consistent with immune system stimulation, and a decision was made to end the trial.
[0609] Alnylam Pharmaceuticals has similarly launched ALN-TTR01, which uses the above SNALP technology and targets the hepatic production of mutant and wild-type TTR to treat TTR amyloidosis (ATTR). Three ATTR syndromes have been described: familial amyloid polyneuropathy (FAP) and familial amyloid cardiomyopathy (FAC) - both caused by autosomal dominant mutations in TTR; and senile systemic amyloidosis (SSA) caused by wild-type TTR. A placebo-controlled single-dose escalation Phase I trial of ALN-TTR01 was recently completed in patients with ATTR. ALN-TTR01 was administered as a 15-minute intravenous infusion to 31 patients (23 with the study drug, 8 with placebo) in the dose range of 0.01 to 1.0 mg / kg (based on siRNA). The treatment was well tolerated, with no significant increase in liver function tests. Infusion-related reactions were noted in 3 of 23 patients at ≥0.4 mg / kg; the infusion rate was slowed in response to all patients and all patients continued to participate in the study. Minimal and transient elevations of serum cytokines IL-6, IP-10, and IL-1ra were noted in two patients at the highest dose of 1 mg / kg (as expected based on preclinical and NHP studies). The expected pharmacological effect of ALN-TTR01 was observed at 1 mg / kg, i.e., a reduction in serum TTR.
[0610] In yet another embodiment, SNALP can be made by dissolving cationic lipid, DSPC, cholesterol, and PEG-lipid at a molar ratio of 40:10:40:10 in ethanol, respectively (see Semple et al., Nature Biotechnology, Vol. 28, No. 2, February 2010, pp. 172-177). The lipid mixture was added to an aqueous buffer (50 mM citrate, pH 4), and mixed to final ethanol and lipid concentrations of 30% (vol / vol) and 6.1 mg / ml, respectively. It was allowed to equilibrate at 22 °C for 2 minutes and then extruded. Using a Lipex extruder (Northern Lipids), the hydrated lipids were passed through two 80 nm pore size filters (Nuclepore) at 22 °C until vesicles with a diameter of 70–90 nm were obtained, as determined by dynamic light scattering analysis. This generally requires 1–3 passes. The siRNA (dissolved in an aqueous solution containing 30% ethanol in 50 mM citrate, pH 4) was added to the pre-equilibrated (35 °C) vesicles at a rate of approximately 5 ml / min under mixing. After reaching a final target siRNA / lipid ratio of 0.06 (wt / wt), the mixture was incubated at 35 °C for an additional 30 minutes to allow vesicle reorganization and encapsulation of the siRNA. Ethanol was then removed and the external buffer was replaced with PBS (155 mM NaCl, 3 mM Na2HPO4, 1 mM KH2PO4, pH 7.5) by dialysis or tangential flow filtration. The siRNA was encapsulated in SNALP using a controlled stepwise dilution process. The lipid components of KC2-SNALP were DLin-KC2-DMA (cationic lipid), dipalmitoyl phosphatidylcholine (DPPC; Avanti Polar Lipids), synthetic cholesterol (Sigma), and PEG-C-DMA used at a molar ratio of 57.1:7.1:34.3:1.4. After formation of the loaded particles, the SNALP was dialyzed in PBS and sterile filtered through a 0.2 μm filter before use. The average particle size was 75–85 nm, and 90%-95% of the siRNA was encapsulated within the lipid particles. The final siRNA / lipid ratio in the formulation for in vivo testing was approximately 0.15 (wt / wt). Immediately before use, the LNP-siRNA system containing factor VII siRNA was diluted to an appropriate concentration in sterile PBS and intravenously administered via the lateral tail vein at a total volume of 10 ml / kg. This method can be analogized to the CRISPR Cas system of the present invention.
[0611] Other lipids
[0612] Other cationic lipids, such as the amino lipid 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), can be used to encapsulate CRISPR Cas similarly to siRNA (see, e.g., Jayaraman, Angew. Chem. Int. Ed. 2012, 51, 8529-8533). Preformed vesicles with the following lipid composition can be considered: amino lipid, distearoylphosphatidylcholine (DSPC), cholesterol, and (R)-2,3-bis(octadecyloxy)propyl-1-(methoxypoly(ethylene glycol) 2000)propyl carbonate (PEG-lipid) at molar ratios of 40 / 10 / 40 / 10, respectively, and an FVII siRNA / total lipid ratio of approximately 0.05 (w / w). To ensure a narrow particle size distribution in the range of 70–90 nm and a low polydispersity index of 0.11 ± 0.04 (n = 56), the particles can be extruded through an 80 nm membrane up to three times before adding CRISPR CasRNA. Particles containing the highly effective amino lipid 16 can be used, and the molar ratio of the four lipid components 16, DSPC, cholesterol, and PEG-lipid (50 / 10 / 38.5 / 1.5) can be further optimized to enhance in vivo activity.
[0613] Michael S D Kormann et al. ("Expression of therapeutic proteins after delivery of chemically modified mRNA in mice": Nature Biotechnology, Vol. 29, pp. 154–157, (2011) Online publication on January 9, 2011) described the use of lipid envelopes for RNA delivery. The use of lipid envelopes is also preferred in the present invention.
[0614] In another embodiment, the lipid can be formulated with the CRISPR Cas system of the present invention to form lipid nanoparticles (LNPs). Lipids include, but are not limited to, DLin-KC2-DMA4, C12-200, and co-lipids distearoyl phosphatidylcholine, cholesterol, and PEG-DMG, which can be formulated with CRISPR Cas rather than siRNA using a spontaneous vesicle formation procedure (see, e.g., Novobrantseva, Molecular Therapy–Nucleic Acids (2012) 1, e4; doi:10.1038 / mtna.2011.3). The component molar ratio can be approximately 50 / 10 / 38.5 / 1.5 (DLin-KC2-DMA or C12-200 / distearoyl phosphatidylcholine / cholesterol / PEG-DMG). In the case of DLin-KC2-DMA and C12-200 lipid nanoparticles (LNPs), the final lipid:siRNA weight ratios can be approximately 12:1 and 9:1, respectively. The formulation can have an average particle size of approximately 80 nm with a coating efficiency of >90%. A dose of 3 mg / kg can be considered.
[0615] Tekmira has a portfolio of approximately 95 family patents in the United States and abroad directed to various aspects of LNPs and LNP formulations (see, e.g., U.S. Patent Nos. 7,982,027; 7,799,565; 8,058,069; 8,283,333; 7,901,708; 7,745,651; 7,803,397; 8,101,741; 8,188,263; 7,915,399; 8,236,943 and 7,838,658 and European Patent Nos. 1766035; 1519714; 1781593 and 1664316), all of which are available for and / or applicable to the present invention.
[0616] The CRISPR Cas system can be encapsulated in PLGA microspheres for delivery, as further described, for example, in U.S. Patent Application Publications 20130252281, 20130245107, and 20130244279 (assigned to Moderna Therapeutics), which relate to the formulation of compositions comprising modified nucleic acid molecules that can encode a protein, a protein precursor, or a partial or fully processed form of the protein or protein precursor. The formulation has a molar ratio of 50:10:38.5:1.5 - 3.0 (cationic lipid: fusogenic lipid: cholesterol: PEG lipid). The PEG lipid can be selected from, but is not limited to, PEG-c-DOMG, PEG-DMG. The fusogenic lipid can be DSPC. See also, Schrum et al., "Delivery and Formulation of Engineered Nucleic Acids," U.S. Patent Application Publication 20120251618.
[0617] Nanomerics' technology addresses the bioavailability challenges for a wide range of therapeutics, including therapeutics based on low molecular weight hydrophobic drugs, peptides, and nucleic acids (plasmids, siRNA, miRNA). The technology has demonstrated significant advantages for specific routes of administration, including the oral route, delivery across the blood-brain barrier, delivery to solid tumors, and delivery to the eye. See, for example, Mazza et al., ACS Nano. February 26, 2013; 7(2):1016 - 26; Uchegbu and Siew, J Pharm Sci. 2013; 102(2):305 - 10; and Lalatsa et al., J Control Release. July 20, 2012; 161(2):523 - 36.
[0618] U.S. Patent Publication No. 20050019923 describes cationic dendrimers for delivering bioactive molecules such as polynucleotide molecules, peptides and polypeptides, and / or pharmaceuticals to the mammalian body. These dendrimers are suitable for targeting the delivery of bioactive molecules to, for example, the liver, spleen, lung, kidney, or heart. Dendrimers are three-dimensional macromolecules prepared in a stepwise manner from simple branched monomer units, and their properties and functionality can be easily controlled and altered. Dendrimers are synthesized by repeated addition of structural units (building blocks) to a multifunctional core (divergent synthesis) or towards a multifunctional core (convergent synthesis), and each addition of the three-dimensional shell of the structural unit results in the formation of a higher level of dendrimer. Polypropyleneimine dendrimers start from a diaminobutane core and twofold the number of amino groups are added thereto by a double Michael addition reaction of acrylonitrile to the primary amine, followed by hydrogenation of the nitrile. This results in the doubling of the amino groups. Polypropyleneimine dendrimers contain 100% protonatable nitrogen and up to 64 terminal amino groups (generation 5, DAB 64). Protonatable groups are often amine groups capable of accepting protons at neutral pH. The use of dendrimers as gene delivery agents has largely focused on the use of polyamidoamines and phosphorus-containing compounds, where mixtures of amines / amides or N-P(O2)S serve as conjugation units respectively, and no work has been reported on the use of lower generation polypropyleneimine dendrimers for gene delivery. Polypropyleneimine dendrimers have also been investigated as pH-sensitive controlled release systems for drug delivery and for the encapsulation of their guest molecules when chemically modified with peripheral amino groups. The cytotoxicity of polypropyleneimine dendrimers and their interaction with DNA as well as the transfection efficiency of DAB 64 have also been investigated.
[0619] U.S. Patent Publication No. 20050019923 is based on observations contrary to earlier reports: cationic dendrimers such as polypropyleneimine dendrimers exhibit suitable properties, such as, specific targeting and low toxicity, for use in the targeted delivery of bioactive molecules such as gene materials. Additionally, derivatives of cationic dendrimers also exhibit suitable properties for the targeted delivery of bioactive molecules. See also, Bioactive Polymers, U.S. Published Application 20080267903, which discloses different polymers, including cationic polyamine polymers and dendrimers, which are shown to have anti-proliferative activity and can therefore be used to treat disorders characterized by unwanted cell proliferation, such as neoplasms and tumors, inflammatory disorders (including autoimmune disorders), psoriasis, and atherosclerosis. These polymers can be used alone as active agents or as delivery vehicles for other therapeutic agents, such as drug molecules or nucleic acids for gene therapy. In such cases, the anti-tumor activity inherent in these polymers can complement the activity of the agent to be delivered.
[0620] Supercharged protein
[0621] Supercharged proteins are a class of engineered or naturally occurring proteins with very high positive or negative theoretical net charges. Both super negatively charged proteins and super positively charged proteins exhibit significant resistance to heat-induced or chemically induced aggregation. Super positively charged proteins are also able to penetrate mammalian cells. Binding of cargoes to these proteins, such as plasmid DNA, siRNA, or other proteins, enables functional delivery of these macromolecules to mammalian cells in vitro and in vivo. The establishment and characterization of supercharged proteins was reported by the David Liu lab in 2007 (Lawrence et al., 2007, Journal of the American Chemical Society 129, 10110–10112).
[0622] Non-viral delivery of siRNA and plasmid DNA into mammalian cells is valuable for both research and therapeutic applications (Akinc et al., 2010, Nat. Biotech. 26, 561–569). Purified +36GFP protein (or other hyperpositively charged proteins) is mixed with siRNA in a suitable serum-free medium and allowed to complex before addition to cells. Inclusion of serum at this stage will inhibit the formation of the hypercharged protein-siRNA complex and reduce the therapeutic effect. The following protocol has been found to be effective for a variety of cell lines (McNaughton et al., 2009, Proc. Natl. Acad. Sci. USA 106, 6111–6116). However, pilot experiments varying the protein and siRNA doses should be conducted to optimize the procedure for a specific cell line.
[0623] (1) One day prior to treatment, plate cells at 1x10 5 cells / well in a 48-well plate.
[0624] (2) On the day of treatment, dilute purified +36GFP protein in serum-free medium until a final concentration of 200 nM. Add siRNA to a final concentration of 50 nM. Vortex and incubate for 10 minutes at room temperature.
[0625] (3) During the incubation, aspirate the medium from the cells and wash again with PBS.
[0626] (4) After incubating the +36GFP and siRNA, add the protein-siRNA complex to the cells.
[0627] (5) Incubate the cells with the complex for 4 hours at 37 °C.
[0628] (6) After incubation, aspirate the medium and wash three times with heparin PBS at 20 U / mL. Incubate the cells for an additional 48 hours or longer with serum-containing medium, depending on the assay used for knockdown.
[0629] (7) Analyze the cells by immunoblotting, qPCR, phenotypic analysis, or other appropriate methods.
[0630] +36GFP has been found to be an effective plasmid delivery reagent in a range of cells. Since plasmid DNA is a larger cargo than siRNA, effective complexation of plasmid requires a proportionally larger amount of +36GFP protein. For effective plasmid delivery, the applicant has developed a +36GFP variant with a C-terminal HA2 peptide tag, which is a known endosome-disrupting peptide derived from the influenza virus hemagglutinin protein. The following protocol is effective in a variety of cells, but as noted above, it is recommended to optimize the dose of the supercharged protein for plasmid DNA for specific cell lines and delivery applications.
[0631] (1) One day prior to treatment, plate at 1x10 5 / well in a 48-well plate.
[0632] (2) On the day of treatment, dilute the purified GFP protein in serum-free medium until a final concentration of 2 mM. Add 1 mg of plasmid DNA. Vortex and incubate at room temperature for 10 minutes.
[0633] (3) During the incubation, aspirate the medium from the cells and wash again with PBS.
[0634] (4) After incubating GFP and plasmid DNA, gently add the protein-DNA complex to the cells.
[0635] (5) Incubate the cells with the complex at 37 °C for 4 hours.
[0636] (6) After incubation, aspirate the medium and wash with PBS. Incubate the cells in serum-containing medium and incubate for an additional 24 - 48 hours.
[0637] (7) Analyze plasmid delivery, if appropriate (e.g., by plasmid-driven gene expression).
[0638] See also, e.g., McNaughton et al., Proc. Natl. Acad. Sci. USA 106, 6111-6116 (2009); Cronican et al., ACS Chemical Biology 5, 747-752 (2010); Cronican et al., Chemistry & Biology 18, 833-838 (2011); Thompson et al., Methods in Enzymology 503, 293-319 (2012); Thompson D.B. et al., Chemistry & Biology 19(7), 831-843 (2012). These methods for supercharged proteins can be used and / or adapted for delivery of the CRISPR Cas systems of the present invention.
[0639] Cell - penetrating peptide
[0640] In yet another embodiment, cell-penetrating peptides (CPPs) are contemplated for delivery of the CRISPR Cas system. CPPs are short peptides that facilitate cellular uptake of diverse molecular cargoes, ranging from nanoparticles to small chemical molecules and large fragments of DNA. As used herein, the term "cargo" includes, but is not limited to, the group consisting of: therapeutic agents, diagnostic probes, peptides, nucleic acids, antisense oligonucleotides, plasmids, proteins, nanoparticles, liposomes, chromophores, small molecules, and radioactive substances. In aspects of the present invention, the cargo may further include any component of the CRISPR Cas system or the entire functional CRISPR Cas system. Aspects of the present invention further provide methods for delivering a desired cargo into a subject, the methods comprising: (a) preparing a complex comprising a cell-penetrating peptide of the present invention and the desired cargo, and (b) administering the complex orally, intra-articularly, intraperitoneally, intrathecally, intrarterially, intranasally, intradermally, subcutaneously, intramuscularly, intravenously, rectally, or topically to a subject. The cargo is associated with the peptides via chemical bonds, either covalently or through non-covalent interactions.
[0641] The function of CPP is to deliver the cargo into the cell, a process that typically occurs through endocytosis, where the cargo is delivered to the endosome of a living mammalian cell. Cell-penetrating peptides have different sizes, amino acid sequences, and charges, but all CPPs share a distinct characteristic, which is the ability to translocate the plasma membrane and assist in delivering cargo of various molecular weights to the cytoplasm or organelles. CPP translocation can be divided into three main entry mechanisms: direct penetration into the membrane, endocytosis-mediated entry, and translocation through the formation of transient structures. CPPs have found many applications as drug delivery agents in drugs (including cancer and virus inhibitors) for treating different diseases, along with many applications in contrast agents for cell labeling. Examples of the latter include acting as carriers for GFP, MRI contrast agents, or quantum dots. CPPs have great potential as in vitro and in vivo delivery carriers for research and medicine. CPPs typically have an amino acid composition that contains a high relative abundance of negatively charged amino acids, such as lysine or arginine, or have a sequence that contains an alternating pattern of polar / charged amino acids and nonpolar hydrophobic amino acids. These two types of structures are called polycationic or amphiphilic, respectively. A third class of CPPs are hydrophobic peptides that contain only nonpolar residues, have a low net charge, or have hydrophobic amino acid groups that are crucial for cellular uptake. One of the first CPPs discovered was the trans-activating transcriptional activator (Tat) from human immunodeficiency virus 1 (HIV-1), which was found to be efficiently taken up from the surrounding medium by many cell types in culture. Since then, the number of known CPPs has expanded significantly, and small molecule synthetic analogues with more efficient protein transduction properties have been generated. CPPs include, but are not limited to, penetratin, Tat(48-60), Transportan, and (R-AhX-R4) (Ahx = aminocaproyl).
[0642] U.S. Patent 8,372,951 provides a CPP derived from eosinophil cationic protein (ECP) that exhibits high cell penetration efficiency and low toxicity. Also provided are various aspects of delivering the CPP with its cargo into a vertebrate subject. Other aspects of CPPs and their delivery can be found in U.S. Patents 8,575,305; 8; 614,194 and 8,044,019.
[0643] The CRISPR-Cas system can be delivered using CPPs, as also provided in the manuscript "Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA", Suresh Ramakrishna, Abu-Bonsrah Kwaku Dad, Jagadish Beloor, et al., Genome Res. April 2, 2014 [e-pub ahead of print], incorporated by reference in its entirety, which demonstrated that treatment with CPP-conjugated recombinant Cas9 protein and CPP-complexed guide RNA resulted in endogenous gene disruption in human cell lines. In that paper, the Cas9 protein was conjugated to the CPP via a thioether bond, while the guide RNA was complexed with the CPP to form condensed, negatively charged nanoparticles. It has been shown that simultaneous and sequential treatment of human cells, including embryonic stem cells, dermal fibroblasts, HEK293T cells, HeLa cells, and embryonal carcinoma cells, with modified Cas9 and guide RNA results in efficient gene disruption, with reduced off-target mutations relative to plasmid transfection.
[0644] Implantable device
[0645] In another embodiment, implantable devices for the delivery of CRISPR Cas systems are also contemplated. For example, U.S. Patent Publication 20110195123 discloses an implantable medical device that elutes drugs locally and over an extended period of time, including several types of such devices, modes of treatment implemented, and methods of implantation. The device comprises a polymeric substrate, e.g., a matrix that serves as the body of the device, and a drug, and in some cases includes additional scaffold materials, such as metals or additional polymers, and materials that enhance visibility and imaging. The choice of drug is based on the advantages of releasing the drug locally and over an extended period of time, where the drug is released directly into the extracellular matrix (ECM) of the diseased area, such as a tumor, inflammation, degeneration, or for symptomatic purposes, or into damaged smooth muscle cells, or for prophylaxis. One drug is a gene silencing drug based on RNA interference (RNAi), including but not limited to siRNA, shRNA, or antisense RNA / DNA, ribozymes, and nucleoside analogs. Thus, this system can be used for and / or is applicable to the CRISPR Cas system of the present invention. In some embodiments, the mode of implantation is an existing implantation procedure currently being developed and used for other treatments, including brachytherapy and needle biopsy. In such cases, the size of the new implant described in the present invention is similar to the initial implant. Typically, few devices are implanted in the same treatment procedure.
[0646] As described in U.S. Patent Publication 20110195123, a drug delivery implantable or insertable system is provided that is suitable for cavities such as the abdominal cavity and / or any other type of administration where the drug delivery system is not anchored or attached, and which comprises a bio-stable and / or biodegradable and / or bioabsorbable polymeric substrate, which can optionally be, for example, a matrix. It should be noted that the term "insert" also includes implant. The drug delivery system is preferably implemented as a "Loder" as described in U.S. Patent Publication 20110195123.
[0647] The polymer or polymers are biocompatible and bind one agent and / or multiple agents such that the agent is released at a controlled rate, where the total volume of the polymeric substrate, such as the matrix, is optionally and preferably not greater than the maximum volume that allows reaching the therapeutic level of the agent in some embodiments. As a non-limiting example, such a volume is preferably in the range of 0.1 m 3 to 1000 mm 3 as required by the volume of the agent load. The Loder is optionally larger, for example when combined with a device whose size is determined by functionality, such as, but not limited to, the knee joint, intrauterine device, or cervical ring, etc.
[0648] In some embodiments, the drug delivery system (for delivering the composition) is designed to preferably employ a degradable polymer, where the main release mechanism is bulk erosion; or in some embodiments, a non-degradable or slowly degradable polymer is used, where the main release mechanism is diffusion rather than bulk erosion, such that the outer portion serves as a membrane and the inner portion serves as a reservoir that is substantially unaffected by the environment over an extended period (e.g., from about one week to about several months). Combinations of different polymers with different release mechanisms can also be optionally used. During important periods of the total drug release period, the concentration gradient at the surface is preferably maintained effectively constant, and thus the diffusion rate is effectively constant (referred to as "zero-mode" diffusion). Regarding the term "constant", it means that the diffusion rate is preferably maintained above the low threshold of the therapeutic effect, but can still optionally have the characteristics of an initial burst release and / or fluctuations, such as increasing and decreasing to a certain extent. The diffusion rate is preferably maintained for such an extended period and is considered constant relative to a certain level in order to optimize the therapeutic effective period, such as the effective silent period.
[0649] The drug delivery system is optionally and preferably designed to protect nucleotide-based therapeutic agents from degradation, regardless of chemical nature or attack by enzymes and other factors in the subject's body.
[0650] The drug delivery system as described in U.S. Patent Publication 20110195123 is optionally associated with sensing and / or activation devices that are operated at the time of and / or after implantation of the device by non-invasive and / or minimally invasive methods of activation and / or acceleration / deceleration, such as optionally including but not limited to thermal heating and cooling, laser beams, and ultrasound, including focused ultrasound and / or RF (radio frequency) methods or devices.
[0651] According to the following embodiments of U.S. Patent Publication 20110195123, the sites for local delivery can optionally include target sites characterized by highly abnormal cell proliferation and inhibited apoptosis, including tumors, active and / or chronic inflammation and infection, including autoimmune disease states, degenerated tissues (including muscle and nerve tissues), chronic pain, degenerated sites, and fracture sites and other wound sites for enhancing tissue regeneration, as well as damaged myocardium, smooth muscle, and striated muscle. The sites for local delivery can also optionally include sites capable of performing preventive activities (including pregnancy), preventing infection and aging.
[0652] The site for implanting the composition, or the target site, is preferably characterized by a radius, area, and / or volume small enough for targeted local delivery. For example, the target site optionally has a diameter in the range from about 0.1 mm to about 5 cm.
[0653] The location of the target site is preferably selected for maximum therapeutic efficacy. For example, the composition of the drug delivery system (optionally together with the device for implantation as described above) is optionally and preferably implanted within or near the tumor environment or the associated blood supply.
[0654] For example, the composition (optionally together with the device) is optionally implanted within or near the pancreas, prostate, breast, liver, through the nipple, within the vascular system, etc.
[0655] The target location is optionally selected from the group consisting of (merely as non-limiting examples, since optionally any site within the body may be suitable for implanting a loader): 1. Brain, at degenerated sites such as the basal ganglia, white matter, and gray matter in Parkinson's disease or Alzheimer's disease; 2. Spine, as in the case of amyotrophic lateral sclerosis (ALS); 3. Cervix to prevent HPV infection; 4. Active or chronic inflamed joints; 5. Dermis in the case of psoriasis; 6. Sympathetic and sensory nerve sites for analgesic effects; 7. Intraosseous implants; 8. Acute and chronic infection sites; 9. Intravaginal; 10. Intra-aural - the auditory system, the labyrinth of the inner ear, the vestibular system; 11. Intratracheal; 12. Intra-cardiac; coronary arteries, epicardium; 13. Bladder; 14. Biliary system; 15. Parenchymal tissues, including but not limited to the kidney, liver, spleen; 16. Lymph nodes; 17. Salivary glands; 18. Gums; 19. Intra-articular (into the joint); 20. Intra-ocular; 21. Brain tissue; 22. Ventricles; 23. Cavities, including the abdominal cavity (e.g., but not limited to, ovarian cancer); 24. Intra-esophageal; and 25. Intra-rectal.
[0656] Optionally, the insertion of the system (e.g., the device containing the composition) is related to the injection of materials into the ECM at and near the target site, thereby affecting the local pH and / or temperature in the ECM at and near the target site and / or affecting other biological factors such as the diffusion and / or pharmacokinetics of the drug.
[0657] Optionally, according to some embodiments, the release of the agent can be associated with sensing and / or activation appliances, which are operated by non-invasive and / or minimally invasive methods and / or other methods of activation and / or acceleration / deceleration before and / or during and / or after insertion, the methods including laser beams, radiation, thermal heating and cooling, and ultrasound, including focused ultrasound and / or RF (radio frequency) methods or devices, as well as chemical activators.
[0658] According to other embodiments of US Patent Publication 20110195123, the drug preferably comprises a gene-silencing bioRNAi drug, e.g., for localized cancer conditions, in the breast, pancreas, brain, kidney, bladder, lung, and prostate, as described below. Moreover, many drugs other than siRNA are suitable for encapsulation in the loader and can be associated with the present invention, provided that such drugs can be encapsulated in the loader substrate (e.g., like a matrix). Such drugs include approved drugs currently delivered by methods other than the present invention, including amphotericin B for fungal infections; e.g., antibiotics for osteomyelitis; painkillers, such as anesthetics; e.g., anti-degenerative agents in Alzheimer's or Parkinson's disease, in the case of back pain in a loader implanted near the spine. Such systems can be used for and / or are suitable for delivering the CRISPR Cas system of the present invention.
[0659] For example, for a particular application, such as preventing the growth and regrowth of smooth muscle cells (damaged during a stent placement procedure and thus prone to proliferation), the drug can optionally be siRNA that silences smooth muscle cells (including H19 silencing), or a drug selected from the group consisting of paclitaxel, rapamycin, and rapamycin analogs. In such a case, the loader is preferably a drug-eluting stent (DES) that releases at a constant rate, or a dedicated device implanted separately in association with the stent. Both can be used for and / or are suitable for the CRISPR Cas system of the present invention.
[0660] As another example of a particular application, neuromuscular degenerative diseases occur due to abnormal gene expression. Local delivery of silencing RNA can have therapeutic properties that interfere with such abnormal gene expression. Local delivery of anti-apoptotic, anti-inflammatory, and anti-degenerative drugs, including small molecule drugs and macromolecules, can also optionally be therapeutic. In such a case, the loader is used to release at a constant rate and / or through a dedicated device implanted separately. Both can be used for and / or are suitable for the CRISPR Cas system of the present invention.
[0661] As yet another example of a particular application, gene modifiers are used to treat mental and cognitive disorders. Gene knockdown with silencing RNA is a treatment option. Delivery devices for local delivery of nucleotide-based agents to sites in the central nervous system are treatment options for mental and cognitive disorders including, but not limited to, psychosis, bipolar disease, neurological disorders, and behavioral maladies. These delivery devices can also locally deliver drugs including small molecule drugs and macromolecules when implanted at specific brain sites. This can all be used in and / or be applicable to the CRISPR Cas system of the present invention.
[0662] As another example of a particular application, silencing of innate and / or adaptive immune mediators at local sites enables prevention of organ transplant rejection. Local delivery of silencing RNA and immunomodulatory agents with delivery devices implanted into the transplanted organ and / or the implantation site results in local immunosuppression via rejection immune cells such as CD8 activated against the transplanted organ. This can all be used in and / or be applicable to the CRISPR Cas system of the present invention.
[0663] As another example of a particular application, angiogenic growth factors including, but not limited to, VEGF and angiopoietin and others are required for new blood vessel formation. Local delivery of these factors, peptides, peptidomimetics or inhibitors that inhibit them is an important therapeutic modality; silencing of repressors and local delivery of these factors, peptides, macromolecules, and small molecule drugs that stimulate angiogenesis with delivery devices are therapeutic for peripheral vascular disease, systemic vascular disease, and cardiovascular disease.
[0664] Insertion methods such as implantation can optionally have been used for other types of tissue implantation and / or for tissue sampling, optionally without modification in such methods, or alternatively optionally only with non-critical modifications. Such methods optionally include, but are not limited to, brachytherapy methods, biopsies, endoscopic examinations with and / or without ultrasound such as ERCP, stereotactic methods for accessing brain tissue, laparoscopy including implantation into joints, abdominal organs, bladder walls, and body cavities with a laparoscope.
[0665] CRISPR enzyme mRNA and guide RNA
[0666] The CRISPR enzyme mRNA and guide RNA can also be delivered separately. The CRISPR enzyme mRNA can be delivered at a time such that the guide RNA is given before the CRISPR enzyme is expressed. The CRISPR enzyme mRNA can be given 1 - 12 hours (preferably about 2 - 6 hours) before the guide RNA is given.
[0667] Alternatively, the CRISPR enzyme mRNA and the guide RNA can be co-administered. Advantageously, a second booster dose of the guide RNA can be administered 1 - 12 hours (preferably about 2 - 6 hours) after the initial administration of the CRISPR enzyme mRNA + guide RNA.
[0668] To achieve the most effective level of genome modification, additional administration of the CRISPR enzyme mRNA and / or the guide RNA can be useful.
[0669] To minimize toxicity and off-target effects, it is important to control the concentration of the delivered CRISPR enzyme mRNA and guide RNA. The optimal concentration of the CRISPR enzyme mRNA and guide RNA can be determined by testing different concentrations in cell or animal models and using deep sequencing analysis to assess the extent of modification at potential off-target genomic loci. For example, for a guide sequence targeting 5’-GAGTCCGAGCAGAAGAAGAA-3’ in the EMX1 gene of the human genome, deep sequencing can be used to evaluate the modification levels at the following two off-target sites: 1: 5’-GAGTCCTAGCAGGAGAAGAA-3’ and 2: 5’-GAGTCTAAGCAGAAGAAGAA-3’. For in vivo delivery, the concentration that produces the highest on-target modification level while minimizing the off-target modification level should be selected.
[0670] Alternatively, to minimize the toxicity level and off-target effects, the CRISPR enzyme nickase mRNA (e.g., Streptococcus pyogenes Cas9 with a D10A mutation) can be delivered with a pair of guide RNAs targeting the site of interest. The two guide RNAs need to be spaced as follows. The guide sequences in red (single underline) and blue (double underline) (these examples are based on the PAM required by Streptococcus pyogenes Cas9).
[0671]
[0672]
[0673]
[0674]
[0675]
[0676] Further interrogation of the system provided evidence of 5' overhangs to the applicant (see, e.g., Ran et al., Cell, September 12, 2013; 154(6):1380 - 9 and U.S. Provisional Patent Application Serial No. 61 / 871,301, filed August 28, 2013). The applicant further identified parameters involved in efficient cleavage by the Cas9 nickase mutant when bound to two guide RNAs, and these parameters include, but are not limited to, the length of the 5' overhang. In embodiments of the invention, the 5' overhang has at most 200 base pairs, preferably at most 100 base pairs, or more preferably at most 50 base pairs. In embodiments of the invention, the 5' overhang has at least 26 base pairs, preferably at least 30 base pairs, or more preferably 34 - 50 base pairs or 1 - 34 base pairs. In other preferred methods of the invention, a first guide sequence that directs cleavage of one strand of a DNA duplex adjacent to the first target sequence and a second guide sequence that directs cleavage of the other strand adjacent to the second target sequence produce a blunt end or a 3' overhang. In embodiments of the invention, the 3' overhang has at most 150, 100, or 25 base pairs, or at least 15, 10, or 1 base pair. In preferred embodiments, the 3' overhang has 1 - 100 base pairs.
[0677] Aspects of the invention relate to the expression of a reduced gene product or a template polynucleotide further introduced into a DNA molecule encoding a gene product or an intervening sequence precisely cleaved by allowing two 5' overhangs to reanneal and ligate, or to the activity or function of an altered gene product, or to the increased expression of a gene product. In one embodiment of the invention, the gene product is a protein.
[0678] Only sgRNA pairs that produce 5' overhangs with less than 8 bp overlap between these guide sequences (offsets greater than -8 bp) can mediate detectable indel formation. Importantly, when paired with wild-type Cas9, each guide used in these assays was important for efficient indel induction, indicating that the relative position of these guide pairs is the most important parameter in predicting double cleavage activity.
[0679] Since Cas9n and Cas9H840A cleave opposite strands of DNA, for a given pair of sgRNAs, replacing Cas9n with Cas9H840A results in an inversion of the overhang type. For example, a pair of sgRNAs that would produce a 5' overhang with Cas9n would, in principle, conversely produce the corresponding 3' overhang. Thus, a pair of sgRNAs that results in a 3' overhang with Cas9n can be used with Cas9H840A to produce a 5' overhang. Unexpectedly, the applicant tested Cas9H840A with a set of sgRNA pairs designed to produce both 5' and 3' overhangs (offset ranging from -278 to +58 bp), but no indel information could be observed. Further work may be needed to identify the necessary design rules for sgRNA pairing to allow for dual cleavage via Cas9H840A.
[0680] Liver, proprotein convertase subtilisin / kexin type 9 (PCSK9)
[0681] This data shows phenotypic conversion.
[0682] Proprotein convertase subtilisin / kexin type 9 (PCSK9) is a member of the subtilisin serine protease family. PCSK9 is mainly expressed by the liver and is crucial for the downregulation of LDL receptor expression in hepatocytes. Plasma LDL-C levels are highly elevated in humans who have acquired PCSK9 gain-of-function mutations, and these individuals are classified as having severe hypercholesterolemia. Thus, PCSK9 is an attractive target for CRISPR. CRISPR targeting PCS9K can be formulated in lipid particles and administered intravenously, for example, at approximately 15, 45, 90, 150, 250, and 400 μg / kg (see, e.g., http: / / www.alnylam.com / capella / wp-content / uploads / 2013 / 08 / ALN-PCS02-001-Protocol-Lancet.pdf).
[0683] Insulin delivery by ex vivo somatic cell gene therapy was disclosed by Bailey et al. in J Mol Med (Berl). January 1999;77(1):244-9, which involves removing non-B cell somatic cells (such as fibroblasts) from a diabetic patient and genetically altering them in vitro to produce and secrete insulin. These cells can be grown in culture and transfused back into the donor as an insulin replacement source. Cells modified in this way can be evaluated prior to implantation and the stock solution cryopreserved. By using the patient's own cells, the procedure would avoid the need for im...
Claims
1. Use of a composition in the manufacture of an agent for modifying neuronal cells in a mammalian subject, wherein the composition comprises one or more adeno-associated virus (AAV) vectors encoding a CRISPR-Cas system, wherein the CRISPR-Cas system comprises Cas9, a guide sequence capable of hybridizing to a target sequence expressed in a neuronal cell, a tracr pairing sequence, and a tracr sequence, wherein the Cas9 comprises at least one nuclear localization sequence (NLS), and Wherein: (I) the Cas9 is Streptococcus pyogenes Cas9, which is encoded on a first AAV vector, and the guide sequence, tracr pairing sequence, and tracr sequence are encoded on a second AAV vector, or (II) the Cas9 is Staphylococcus aureus Cas9, and the Cas9, guide sequence, tracr pairing sequence, and tracr sequence are encoded on a single AAV vector.
2. The use according to claim 1, wherein the CRISPR-Cas system alters the expression of a gene product in a neuronal cell, thereby producing a phenotypic change in the mammalian subject.
3. The use according to claim 1, wherein the target sequence is related to a gene involved in a neuronal disease or disorder.
4. The use according to claim 1, wherein the one or more AAV vectors comprise: (a) a first regulatory element operably linked to a polynucleotide sequence encoding a guide sequence, a tracr pairing sequence, and a tracr sequence, and (b) a second regulatory element operably linked to a polynucleotide sequence encoding Cas9 and at least one nuclear localization sequence.
5. The use according to claim 1, wherein the one or more AAV vectors comprise: (a) a polynucleotide sequence encoding a guide sequence, a tracr pairing sequence, and a tracr sequence, and (b) a polynucleotide sequence encoding Cas9 and at least one nuclear localization sequence, wherein the tracr pairing sequence hybridizes to the tracr sequence, and wherein the guide sequence directs sequence-specific binding of the CRISPR complex comprising Cas9 to the target sequence.
6. The use according to claim 1, wherein the one or more AAV vectors comprise: (a) a polynucleotide sequence encoding a guide sequence and a tracr pairing sequence, (b) a polynucleotide sequence encoding Cas9 and at least one nuclear localization sequence, and (c) a polynucleotide sequence encoding a tracr sequence, wherein the tracr pairing sequence hybridizes to the tracr sequence, and wherein the guide sequence directs sequence-specific binding of the CRISPR complex comprising Cas9 to the target sequence.
7. The use according to claim 1, wherein two or more neuronal gene products are altered.
8. The use according to claim 1, wherein the guide sequence is fused to the tracr pairing sequence and the tracr sequence in a CRISPR-Cas system chimeric RNA.
9. The use according to claim 4, 5 or 6, wherein the polynucleotide sequence encoding Cas9 is operably linked to a brain-specific promoter.
10. The use according to claim 4, 5 or 6, wherein the polynucleotide sequence encoding Cas9 is operably linked to a promoter selected from the group consisting of CamkII, parvalbumin, vGAT, DR1, DR2, GFAP and Arc.
11. The use of claim 4, 5 or 6, wherein the polynucleotide sequence encoding Cas9 is codon optimized for expression in the mammalian subject.
12. The use of claim 1, wherein the one or more AAV vectors comprise AAV1, AAV2, AAV4, AAV5, AAV8, AAV9 or a combination thereof.
13. The method of claim 1, wherein the Cas9 is Streptococcus pyogenes Cas9.
14. The use of claim 1, wherein the Cas9 is Staphylococcus aureus Cas9.
15. The use of claim 1, wherein the Cas9 comprises at least two NLSs.
16. The method of claim 1, wherein the Cas9 is a Streptococcus pyogenes Cas9 with a D10A mutation, or wherein the Cas9 is a Streptococcus pyogenes Cas9 with a H840A mutation.
17. The method of claim 16, wherein the Cas9 is fused to one or more heterologous protein domains.
18. The method of claim 17, wherein the heterologous protein domain has one or more of the following activities: methylase activity, demethylase activity, transcription activation activity, transcription repression activity, transcription release factor activity, histone modification activity, RNA cleavage activity, and nucleic acid binding activity.
19. The use of claim 1, wherein the composition further comprises a template polynucleotide for targeted insertion, wherein the template polynucleotide overlaps with at least 5 nucleotides of the target sequence.
20. The use of claim 1, wherein the composition is formulated for stereotactic injection or intravenous injection.
Citation Information
Patent Citations
Transgenic animals secreting desired proteins into milk
EP0264166A1
Polyethyleneglycol-modified lipid compounds and uses thereof
EP1664316A1
Regulation of endogenous gene expression in cells using zinc finger proteins
US20030087817A1
Vector system
US20040013648A1
Recombinational cloning using nucleic acids having recombination sites
US20040171156A1