Novel condensed ring compounds and their applications in medicine

Abstract

The present invention relates to a novel fused ring compound and its application in medicine, especially its application as a medicine for treating and preventing hepatitis B. Specifically, the present invention relates to a compound represented by general formula (I) or its stereoisomers, tautomers, nitrogen oxides, solvates, metabolites, pharmaceutically acceptable salts or prodrugs, and their application as medicine, especially their application as a medicine for treating and / or preventing hepatitis B, wherein each variable is defined as in the specification.

Description

Technical Field

[0001] The present invention belongs to the field of medicine. Specifically, it relates to a novel fused ring compound and its use as a medicine, especially as a medicine for treating and / or preventing hepatitis B. The present invention also relates to a composition containing the novel fused ring compound and other antiviral agents, and its use in treating and / or preventing hepatitis B virus (HBV) infection. Background Art

[0002] Hepatitis B virus belongs to the family of Hepatoviridae. It can cause acute and / or progressive chronic diseases. Hepatitis B virus can also cause many other clinical manifestations in pathological morphology - especially chronic inflammation of the liver, cirrhosis and carcinogenesis of liver cells. According to the World Health Organization, 2 billion people have been infected with HBV, about 350 million are chronically infected, and about 1 million people die each year from liver failure, cirrhosis and primary hepatocellular carcinoma (HCC) caused by HBV infection.

[0003] Currently, the main treatment for chronic hepatitis B (CHB) is antiviral therapy. Interferon α (IFN-α) and pegylated IFN-α and five nucleoside (acid) analogs (lamivudine, adefovir dipivoxil, entecavir, telbivudine and tenofovir) have been approved by the US Food and Drug Administration (FDA) for clinical treatment. Interferon is the first anti-HBV drug approved by the FDA. It mainly eliminates the virus through direct antiviral effects and inducing the body's immune response. However, its application is subject to many restrictions due to its low response rate, multiple side effects, high price and limited treatment targets. The common point of nucleoside (acid) drugs against HBV is that they specifically act on viral DNA polymerase and have a strong effect of inhibiting viral replication. Patients have better tolerance to drugs than interferon. However, the widespread and long-term use of nucleoside (acid) drugs can induce DNA polymerase mutations to form drug resistance, leading to the continuous emergence of drug-resistant strains, making the treatment far from achieving the ideal therapeutic effect.

[0004] Therefore, there is still a need for new compounds that can be effectively used as antiviral drugs, especially as drugs for the treatment and / or prevention of hepatitis B. Summary of the invention

[0005] The present invention relates to a novel fused ring compound and its use in preparing a drug for treating and preventing HBV infection. In particular, the present invention relates to a novel fused ring compound and a pharmaceutically acceptable composition thereof, wherein the compound has the advantages of good solubility, good stability, substantially no induction effect on liver drug enzymes, and low toxicity, and especially has very good pharmacokinetic properties. The compound of the present invention can effectively inhibit HBV infection, and has a good application prospect in anti-HBV.

[0006] In one aspect, the present invention relates to a compound as represented by formula (I) or a stereoisomer, tautomer, nitrogen oxide, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof of the compound as represented by formula (I),

[0007]

[0008] Wherein, R is the structure shown below:

[0009]

[0010] wherein the formula (I-1), formula (I-2) and formula (I-3) are each independently unsubstituted or substituted with 1, 2, 3, 4 or 5 R 5 replaced by;

[0011] Ring A is phenyl, heteroaryl consisting of 5-6 atoms or heterocyclic group consisting of 4-6 atoms, wherein the phenyl, heteroaryl consisting of 5-6 atoms and heterocyclic group consisting of 4-6 atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R 6 replaced by;

[0012] Each R 2 and R 3 are independently hydrogen, deuterium, F, Cl, Br, I, CN, amino, nitro, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, methoxy, ethoxy, N-methylamino or N-ethylamino;

[0013] Each R 5 and R 6are independently deuterium, F, Cl, Br, I, CN, amino, nitro, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, methoxy, ethoxy, N-methylamino or N-ethylamino;

[0014] Each R 1 and R 4 are independently hydrogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl or C 1-4 Haloalkyl;

[0015] R x Hydrogen, carboxyl C 1-6 Alkyl, -C 1-4 Alkyl-C(=O)OC 1-6 Alkyl, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Haloalkyl, C 3-6 Cycloalkyl, C 6-10 Aryl, -C 1-3 Alkylene-phenyl, -C 1-3 Alkylene-5-6 atoms composed of heteroaryl or 5-6 atoms composed of heteroaryl, wherein the carboxyl C 1-6 Alkyl, -C 1-4 Alkyl-C(=O)OC 1-6 Alkyl, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Haloalkyl, C 3-6 Cycloalkyl, C 6-10 Aryl, -C 1-3 Alkylene-phenyl, -C 1-3 Alkylene-5-6 atoms consisting of heteroaryl and 5-6 atoms consisting of heteroaryl are each independently unsubstituted or substituted with 1, 2, 3, 4 or 5 R y replaced by;

[0016] R y It is F, Cl, Br, I, =O, -NO2, CN, -OH, -COOH, -C(=O)-NR a R b、-C(=O)OC 1-6 Alkyl, -S(=O)2-C 1-6 Alkyl, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, -OC 6-10 Aryl, C 1-6 Alkylamino, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 atoms, C 6-10 Aryl or heteroaryl composed of 5-10 atoms, wherein the -C(=O)OC 1-6 Alkyl, -S(=O)2-C 1-6 Alkyl, -C(=O)-NR a R b , C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, -OC 6-10 Aryl, C 1-6 Alkylamino, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 atoms, C 6-10 The aryl group and the 5-10-atom heteroaryl group are each independently unsubstituted or substituted with 1, 2, 3 or 4 R z replaced by;

[0017] Each R a and R b are independently hydrogen, deuterium, C 1-6 Alkyl, C 2-6 Alkenyl or C 2-6 Alkynyl;

[0018] Each R z are independently F, Cl, Br, CN, -OH, -COOH, -C(=O)OC 1-6 Alkyl, amino, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, carboxyl C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Haloalkoxy or C 1-6 Alkoxy, wherein the C 1-6 The alkoxy group is unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, Cl, Br and C 1-6 The alkoxy group is substituted with an alkoxy substituent.

[0019] In some embodiments, the ring A of the present invention is phenyl, azetidinyl, oxetanyl, thietanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the The phenyl, azetidinyl, oxetanyl, thietanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4 R 6 is substituted, wherein the R 6 Has the meaning as described in the present invention.

[0020] In some embodiments, the present invention has a compound as shown in formula (II) or a stereoisomer, tautomer, nitrogen oxide, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof of a compound as shown in formula (II),

[0021]

[0022] Among them, each R 6a and R 6b R is independently hydrogen, deuterium, F, Cl, Br, I, CN, amino, nitro, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, methoxy, ethoxy, N-methylamino or N-ethylamino, wherein each R 1 , R 2 , R 3 , R 4 and R have the meanings as defined in the present invention.

[0023] In some embodiments, the R x Hydrogen, carboxyl C 1-4 Alkyl, -C1-2 Alkyl-C(=O)OC 1-4 Alkyl, C 1-4 Alkyl, C 2-4 Alkenyl, C 2-4 Alkynyl, C 1-4 Haloalkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, -methylene-phenyl, -C 1-2 Alkylene-5-atom heteroaryl, -C 1-2 Alkylene-6 atoms composed of heteroaryl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the carboxyl C 1-4 Alkyl, -C 1-2 Alkyl-C(=O)OC 1-4 Alkyl, C 1-4 Alkyl, C 2-4 Alkenyl, C 2-4 Alkynyl, C 1-4 Haloalkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, -methylene-phenyl, -C 1-2 Alkylene-5-atom heteroaryl, -C 1-2 Alkylene-6 atoms consisting of heteroaryl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1, 2, 3, 4 or 5 R y is substituted, wherein the R y Has the meaning described in the present invention.

[0024] In some embodiments, the R xis hydrogen, -CH2COOH, -CH2CH2COOH, -CH2CH2CH2COOH, -CH2-C(=O)OCH3, -CH2-C(=O)OCH2CH3, -CH2-C(=O)OCH2CH2CH3, -CH2-C(=O)OCH(CH3)2, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, vinyl, allyl, propenyl, ethynyl, propargyl, propynyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, - CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, -methylene-phenyl, -methylene-pyridyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the -CH 2COOH, -CH2CH2COOH, -CH2CH2CH2COOH, -CH2-C(=O)OCH3, -CH2-C(=O)OCH2CH3, -CH2-C(=O)OCH2CH2CH3, -CH2-C(=O)OCH(CH3)2, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, vinyl, allyl, propenyl, ethynyl, propargyl, propynyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH 2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, -methylene-phenyl, -methylene-pyridyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1, 2, 3, 4 or 5 R y is substituted, wherein the R y Has the meaning described in the present invention.

[0025] In some embodiments, the R yIt is F, Cl, Br, I, =O, -NO2, CN, -OH, -COOH, -C(=O)-NR a R b , -C(=O)OCH3, -C(=O)OCH2CH3, -C(=O)OCH2CH2CH3, -C(=O)OCH(CH3)2, -S(=O)2C 1-4 Alkyl, C 1-4 Alkyl, C 1-4 Alkoxy, C 1-4 Halogenated alkoxy, C 1-4 Haloalkyl, C 2-4 Alkenyl, C 2-4 Alkynyl, -O-phenyl, C 1-4 Alkylamino, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, a heterocyclic group consisting of 4 to 6 atoms, phenyl, naphthyl, a heteroaryl group consisting of 5 to 6 atoms or a heteroaryl group consisting of 9 atoms, wherein the -C(=O)OC 1-4 Alkyl, -S(=O)2C 1-4 Alkyl, C 1-4 Alkyl, C 1-4 Alkoxy, C 1-4 Halogenated alkoxy, C 1-4 Haloalkyl, C 2-4 Alkenyl, C 2-4 Alkynyl, -O-phenyl, C 1-4 Alkylamino, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, heterocyclic radical consisting of 4-6 atoms, phenyl, naphthyl, heteroaryl consisting of 5-6 atoms and heteroaryl consisting of 9 atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R z is substituted, wherein the R z Has the meaning as described in the present invention.

[0026] In some embodiments, the R y It is F, Cl, Br, I, =O, -NO2, CN, -OH, -COOH, -C(=O)-NR a R b , -C(=O)OCH3, -C(=O)OCH2CH3, -C(=O)OCH2CH2CH3, -C(=O)OCH(CH3)2, -S(=O)2CH3, -S(=O)2CH2CH3, -S(=O)2CH2CH2CH3, -S(=O)2CH(CH3)2, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, ethoxy, n-propoxy, isopropoxy, C 1-3haloalkoxy, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, vinyl, allyl, propenyl, ethynyl, propargyl, propynyl, -O-phenyl, C 1-4 alkylamino, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, naphthyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidine or indolyl, wherein the -C(=O)OCH3, -C(=O)OCH2CH3, -C(=O)OCH2CH2CH3, -C(=O)OCH(CH3)2, -S(=O)2CH3, -S(=O)2CH2CH3, -S(=O)2CH2CH2CH3, -S(=O)2CH(CH3)2, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, ethoxy, n-propoxy, isopropoxy, C 1-3 haloalkoxy, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, vinyl, allyl, propenyl, ethynyl, propargyl, propynyl, -O-phenyl, C 1-4 Alkylamino, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, naphthyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidine and indolyl are each independently unsubstituted or substituted with 1, 2, 3 or 4 R z is substituted, wherein the R zHas the meaning described in the present invention.

[0027] In some embodiments, each R described in the present invention a and R b are independently hydrogen, deuterium, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, vinyl, allyl, propenyl, ethynyl, propargyl or propynyl;

[0028] Each R z independently F, Cl, Br, CN, -OH, -COOH, -C(=O)OCH3, -C(=O)OCH2CH3, -C(=O)OCH2CH2CH3, -C(=O)OCH(CH3)2, amino, C 1-4 Alkyl, C 2-4 Alkenyl, C 2-4 Alkynyl, carboxyl C 1-4 Alkyl, C 1-4 Haloalkyl, C 1-4 Haloalkoxy or C 1-4 Alkoxy, wherein the C 1-4 The alkoxy group is unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, Cl, Br and C 1-4 The alkoxy group is substituted with an alkoxy substituent.

[0029] In some embodiments, each R described in the present invention z are independently F, Cl, Br, CN, -OH, -COOH, -C(=O)OCH3, -C(=O)OCH2CH3, -C(=O)OCH2CH2CH3, -C(=O)OCH(CH3)2, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 2-4 Alkenyl, C 2-4Alkynyl, carboxymethyl, hydroxyethyl, hydroxy-n-propyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, -OCH2F, -OCH2Cl, -OCHF2, -OCHCl2, -OCF3, -OCH2CH2F, -OCH CH2CH2Cl, -OCH2CHF2, -OCH2CHCl2, -OCHFCH2F, -OCHClCH2Cl, -OCH2CF3, -OCH(CF3)2, -OCF2CH2CH3, -OCH2CH2CH2F, -OCH2CH2CHF2, -OCH2CH2CF3, methoxy, ethoxy, n-propoxy, isopropoxy or n-butoxy, wherein the methoxy, ethoxy, n-propoxy, isopropoxy and n-butoxy are unsubstituted or substituted with 1, 2, 3 or 4 substituents selected from F, Cl, Br, methoxy, ethoxy, n-propoxy and isopropoxy.

[0030] On the other hand, the present invention also provides a pharmaceutical composition comprising the compound of the present invention and pharmaceutically acceptable excipients.

[0031] In some embodiments, the pharmaceutical composition of the present invention further comprises other anti-HBV drugs.

[0032] In some embodiments, in the pharmaceutical composition of the present invention, the other anti-HBV drug is a HBV polymerase inhibitor, an immunomodulator or an interferon.

[0033] In some embodiments, the pharmaceutical composition described in the present invention, wherein the other anti-HBV drug is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, Alfaferone, Alloferon, simu-leukin, clavudine, emtricitabine, famciclovir, interferon, Baoganling CP, Intefen, interferon α-1b, interferon α, interferon α-2a, interferon β-1a, interferon α-2, interleukin-2, mivotilide, nitazoxanide, polyethylene glycol interferon α-2a, ribavirin, rointerferon-A, sizoran, Euforavac, Ampligen, Phosphazid, Heplisav, interferon α-2b, levamisole or propagermanium.

[0034] On the other hand, the present invention also provides use of the compound or the pharmaceutical composition in preparing a drug for preventing, treating or alleviating viral diseases in patients.

[0035] In some embodiments, the use described in the present invention, wherein the viral disease refers to hepatitis B virus infection or a disease caused by hepatitis B virus infection.

[0036] In other embodiments, the use described in the present invention, wherein the disease caused by hepatitis B virus infection refers to cirrhosis or hepatocellular carcinoma.

[0037] On the other hand, the present invention relates to the use of the compound or pharmaceutical composition in the preparation of a drug for preventing, treating or alleviating hepatitis B disease in a patient, comprising administering an effective therapeutic dose of the compound or pharmaceutical composition of the present invention to the patient.

[0038] Another aspect of the present invention relates to a method for preventing, treating or ameliorating HBV symptoms in a patient, the method comprising administering to the patient a pharmaceutically acceptable effective dose of a compound of the present invention.

[0039] Another aspect of the present invention relates to a method for preventing, treating or ameliorating HBV symptoms in a patient, the method comprising administering to the patient a pharmaceutical composition containing a compound of the present invention in a pharmaceutically acceptable effective dose.

[0040] Another aspect of the present invention relates to the use of a compound of the present invention to prepare a medicament for preventing or treating HBV disease in a patient and reducing its severity.

[0041] Another aspect of the present invention relates to the use of a pharmaceutical composition comprising the compound of the present invention to prepare a medicament for preventing or treating HBV disease in a patient and reducing its severity.

[0042] Another aspect of the present invention relates to a method for inhibiting HBV infection, which comprises contacting cells with a compound or pharmaceutical composition of the present invention at a dose that is effective in inhibiting HBV. In some other embodiments, the method further comprises contacting cells with other anti-HBV therapeutic agents.

[0043] Another aspect of the present invention relates to a method for treating HBV disease in a patient, the method comprising administering an effective therapeutic dose of a compound of the present invention or a pharmaceutical composition thereof to a patient in need of treatment. In some other embodiments, the method further comprises administering an effective therapeutic dose of other anti-HBV drugs to a patient in need of treatment.

[0044] Another aspect of the present invention relates to a method for inhibiting HBV infection in a patient, the method comprising administering an effective therapeutic dose of a compound of the present invention or a pharmaceutical composition thereof to a patient in need of treatment. In some other embodiments, the method further comprises administering an effective therapeutic dose of other anti-HBV drugs to a patient in need of treatment.

[0045] Another aspect of the present invention relates to methods for preparing, isolating and purifying the compounds encompassed by formula (I) or formula (II).

[0046] The foregoing description only summarizes certain aspects of the present invention, but is not limited to these aspects. These aspects and other aspects will be described in more detail and complete below.

[0047] Detailed description of the invention

[0048] Definitions and general terms

[0049] The present invention will list the literature corresponding to the determined specific content in detail, and the embodiments are accompanied by diagrams of structural formulas and chemical formulas. The present invention is expected to cover all options, variants and equivalents, which may be included in the existing invention field as defined in the claims. Those skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which can be applied to the practice of the present invention. The present invention is by no means limited to the description of methods and materials. There are many documents and similar materials that are different from or conflict with the present application, including but not limited to the definition of terms, the usage of terms, the technology described, or the scope controlled by the present application.

[0050] The following definitions shall apply to the present invention unless otherwise indicated. For the purposes of the present invention, the chemical elements are those according to the Periodic Table of the Elements, CAS version and the Handbook of Chemicals, 75, th Ed, 1994. In addition, the general principles of organic chemistry are defined in "Organic Chemistry," Thomas Sorrell, University Science Books, Sausalito: 1999, and "March's Advanced Organic Chemistry," by Michael B. Smith and Jerry March, John Wiley & Sons, New York: 2007, and all contents are incorporated by reference.

[0051] As described herein, the compounds of the present invention may be optionally substituted with one or more substituents, such as the above general formula compounds, or as the specific examples, subclasses, and classes of compounds included in the embodiments.

[0052] In various parts of this specification, substituents of the compounds of the present invention are disclosed according to group types or ranges. It is specifically pointed out that the present invention includes each independent subcombination of the individual members of these group types and ranges. For example, the term "C 1-6 "Alkyl" specifically refers to methyl, ethyl, C3 alkyl, C4 alkyl, C5 alkyl and C6 alkyl as disclosed independently.

[0053] The term "alkyl" used in the present invention includes 1-20 carbon atoms saturated straight or branched monovalent hydrocarbon groups, wherein the alkyl group can be independently optionally substituted with one or more substituents described in the present invention. In some embodiments, the alkyl group contains 1-12 carbon atoms, in other embodiments, the alkyl group contains 1-10 carbon atoms, in other embodiments, the alkyl group contains 1-8 carbon atoms, in other embodiments, the alkyl group contains 1-6 carbon atoms, in other embodiments, the alkyl group contains 1-4 carbon atoms, and in other embodiments, the alkyl group contains 1-3 carbon atoms. Further examples of alkyl groups include, but are not limited to, methyl (Me, -CH3), ethyl (Et, -CH2CH3), n-propyl (n-Pr, -CH2CH2CH3), isopropyl (i-Pr, -CH(CH3)2), n-butyl (n-Bu, -CH2CH2CH2CH3), 2-methylpropyl or isobutyl (i-Bu, -CH2CH(CH3)2), 1-methylpropyl or sec-butyl (s-Bu, -CH(CH3)CH 2CH3), tert-butyl (t-Bu, -C(CH3)3), n-pentyl (-CH2CH2CH2CH2CH3), 2-pentyl (-CH(CH3)CH2CH2CH3), 3-pentyl (-CH(CH2CH3)2), 2-methyl-2-butyl (-C(CH3)2CH2CH3), 3-methyl-2-butyl (-CH(CH3)CH(CH3)2), 3-methyl-1-butyl (-CH2CH2CH(CH3) 2), 2-methyl-1-butyl (-CH2CH(CH3)CH2CH3), n-hexyl (-CH2CH2CH2CH2CH2CH3), 2-hexyl (-CH(CH3)CH2CH2CH2CH3), 3-hexyl (-CH(CH2CH3)(CH2CH2CH3)), 2-methyl-2-pentyl (-C(CH3)2CH2CH2CH3), 3-methyl-2-pentyl (-CH(CH3)CH(CH3)C H2CH3), 4-methyl-2-pentyl (-CH(CH3)CH2CH(CH3)2), 3-methyl-3-pentyl (-C(CH3)(CH2CH3)2), 2-methyl-3-pentyl (-CH(CH2CH3)CH(CH3)2), 2,3-dimethyl-2-butyl (-C(CH3)2CH(CH3)2), 3,3-dimethyl-2-butyl (-CH(CH3)C(CH3)3), n-heptyl, n-octyl, and the like.

[0054] The term "carbonyl", whether used alone or in combination with other terms (such as "aminocarbonyl" or "acyloxy"), refers to -(C=O)-.

[0055] The terms "alkylamino" and "alkylamino" are used interchangeably and include "N-alkylamino" and "N,N-dialkylamino" wherein the amino group is independently substituted by one or two C 1-12 In some embodiments, the alkylamino group is one or two C 1-12 The alkyl group is a lower alkylamino group attached to the nitrogen atom. In some embodiments, the alkylamino group is C 1-6 In some embodiments, the alkylamino group is C 1-4 Suitable alkylamino groups can be monoalkylamino or dialkylamino, such examples include, but are not limited to, N-methylamino, N-ethylamino, N,N-dimethylamino, N,N-diethylamino, N-propylamino, N,N-dipropylamino, and the like, wherein the alkylamino groups can be independently unsubstituted or substituted with one or more substituents described herein.

[0056] The term "alkylene" means a saturated divalent or polyvalent hydrocarbon radical obtained by removing two or more hydrogen atoms from a saturated straight or branched hydrocarbon radical. Unless otherwise specified, an alkylene group contains 1-12 carbon atoms. In some embodiments, an alkylene group contains 1-6 carbon atoms; in other embodiments, an alkylene group contains 1-4 carbon atoms; in still other embodiments, an alkylene group contains 1-3 carbon atoms; in still other embodiments, an alkylene group contains 1-2 carbon atoms. Examples of alkylene groups include, but are not limited to, methylene (-CH2-), ethylene (-CH2CH2-), n-propylene (-CH2CH2CH2-), isopropylene (-CH(CH3)CH2-), and the like.

[0057] The term "alkenyl" refers to a straight or branched monovalent hydrocarbon radical containing 2 to 12 carbon atoms, or 2 to 8 carbon atoms, or 2 to 6 carbon atoms, or 2 to 4 carbon atoms, wherein at least one position of CC is sp 2 Double bond, wherein the alkenyl group can be independently unsubstituted or substituted with one or more substituents described in the present invention, including "cis", "trans" or "Z", "E" isomers, specific examples of which include, but are not limited to, vinyl (-CH=CH2), propenyl (-CH=CHCH3), allyl (-CH2CH=CH2) and the like, wherein the alkenyl group can be independently unsubstituted or substituted with one or more substituents described in the present invention.

[0058] The term "alkynyl" means a straight or branched monovalent hydrocarbon group containing 2-12 carbon atoms, or 2-8 carbon atoms, or 2-6 carbon atoms, or 2-4 carbon atoms, wherein at least one position of CC is an sp triple bond, wherein the alkynyl group may be independently unsubstituted or substituted with one or more substituents described in the present invention, specific examples include, but are not limited to, ethynyl (-C≡CH), propargyl (-CH2C≡CH), propynyl (-C≡C-CH3), 1-ynylbutyl (-CH2CH2C≡CH), 2-ynylbutyl (-CH2C≡CCH3), 3-ynylbutyl (-C≡CCH2CH3) and the like, wherein the alkynyl group may be independently unsubstituted or substituted with one or more substituents described in the present invention.

[0059] The term "haloalkyl", "haloalkenyl" or "haloalkoxy" means an alkyl, alkenyl or alkoxy group substituted by one or more halogen atoms, wherein alkyl, alkenyl and alkoxy have the meanings described herein. Such examples include, but are not limited to, difluoroethyl (-CH2CHF2, -CF2CH3, -CHFCH2F), trifluoroethyl (-CH2CF3, -CF2CH2F, -CFHCHF2), trifluoromethyl (-CF3), trifluoromethoxy (-OCF3), fluorovinyl (-CH=CHF, -CF=CH2), etc.

[0060] The term "arylalkyl" means an alkyl group substituted with one or two aryl substituents, wherein alkyl and aryl have the meanings described herein. Such examples include, but are not limited to, -CH2phenyl, -CH2CH2phenyl, -C(CH3)2phenyl, etc.

[0061] The term "carboxyalkyl" means an alkyl group substituted with one or two carboxyl substituents, wherein alkyl and carboxyl have the meanings described herein. Such examples include, but are not limited to, -CH2COOH, -CH2CH2COOH, -CH2CH2CH2COOH, -CH2CH2CH2COOH, etc.

[0062] The term "alkoxy" means an alkyl group attached to the rest of the molecule via an oxygen atom, wherein the alkyl group has the meaning as described herein. Unless otherwise specified, the alkoxy group contains 1-12 carbon atoms. In some embodiments, the alkoxy group contains 1-8 carbon atoms; in other embodiments, the alkoxy group contains 1-6 carbon atoms; in other embodiments, the alkoxy group contains 1-4 carbon atoms; in yet other embodiments, the alkoxy group contains 1-3 carbon atoms. The alkoxy group may be optionally substituted with one or more substituents described herein.

[0063] Examples of alkoxy groups include, but are not limited to, methoxy (MeO, -OCH3), ethoxy (EtO, -OCH2CH3), 1-propoxy (n-propoxy, n-PrO, n-propoxy, -OCH2CH2CH3), 2-propoxy (isopropoxy, i-PrO, i-propoxy, -OCH(CH3)2), 1-butoxy (n-BuO, n-butoxy, -OCH2CH2CH2CH3), 2-methyl-l-propoxy (i-BuO, i-butoxy, -OCH2CH(CH3)2), 2-butoxy (s-BuO, s-butoxy, -OCH(CH3)CH2CH3), 2- methyl-2-propoxy (t-BuO, t-butoxy, -OC(CH3)3), 1-pentyloxy (n-pentyloxy, -OCH2CH2CH2CH2CH3), 2-pentyloxy (-OCH(CH3)CH2CH2CH3), 3-pentyloxy (-OCH(CH2CH3)2), 2-methyl-2-butoxy (-OC(CH3)2CH2CH3), 3-methyl-2-butoxy (-OCH(CH3)CH(CH3)2), 3-methyl-l-butoxy (-OCH2CH2CH(CH3)2), 2-methyl-l-butoxy (-OCH2CH(CH3)CH2CH3), and the like.

[0064] The term "M-M1 ring atoms" or "M-M1 atoms" means that the cyclic group is composed of M-M1 ring atoms, and the ring atoms include carbon atoms and / or heteroatoms such as O, N, S, and P. For example, "6-10 atoms composed of heteroaryl" means that it includes 6, 7, 8, 9 or 10 ring atoms.

[0065] The term "cycloalkyl" refers to a saturated, monocyclic, bicyclic or tricyclic ring system containing 3 to 12 ring carbon atoms having one or more points of attachment to the rest of the molecule. The term "heterocyclyl" includes monocyclic, bicyclic or polycyclic fused, spiro or bridged ring systems. In some embodiments, the cycloalkyl group is a spiro bicycloalkyl group consisting of 6-10 atoms; in other embodiments, the cycloalkyl group is a fused bicycloalkyl group consisting of 6-10 atoms; in other embodiments, the cycloalkyl group is a ring system containing 3-10 ring carbon atoms; in other embodiments, the cycloalkyl group is a ring system containing 3-8 ring carbon atoms; in other embodiments, the cycloalkyl group is a ring system containing 3-7 ring carbon atoms; in other embodiments, the cycloalkyl group is a ring system containing 5-8 ring carbon atoms; in other embodiments, the cycloalkyl group is a ring system containing 3-6 ring carbon atoms; in other embodiments, the cycloalkyl group is a ring system containing 5-6 ring carbon atoms; examples of cycloalkyl groups include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc., and the cycloalkyl groups can be independently unsubstituted or substituted with one or more substituents described in the present invention.

[0066] The terms "heterocyclyl" and "heterocycle" are used interchangeably herein and both refer to a saturated or partially unsaturated, non-aromatic monocyclic, bicyclic or tricyclic ring system containing 3-12 ring atoms, wherein at least one ring atom is selected from nitrogen, sulfur and oxygen atoms, and the ring system has one or more points of attachment to the rest of the molecule. The term "heterocyclyl" includes monocyclic, bicyclic or polycyclic fused, spiro or bridged heterocyclic ring systems, and also includes polycyclic ring systems in which the heterocyclic ring may be fused to one or more non-aromatic carbocyclic or heterocyclic rings or one or more aromatic rings or combinations thereof, wherein the radical or point of attachment is on the heterocyclic ring. Bicyclic heterocyclyls include bridged bicyclic heterocyclyls, fused bicyclic heterocyclyls and spiro bicyclic heterocyclyls. Unless otherwise specified, the -CH2- group of the heterocyclyl group may be optionally replaced by -C(=O)-. The sulfur atom of the ring may be optionally oxidized to an S-oxide. The nitrogen atom of the ring may be optionally oxidized to an N-oxide. In some embodiments, heterocyclyl is a ring system consisting of 3-12 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 3-8 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 3-6 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 4-6 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 5-7 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 5-8 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 6-8 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 5-6 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 3 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 4 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 5 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 6 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 7 ring atoms; in other embodiments, heterocyclyl is a ring system consisting of 8 ring atoms.

[0067] Examples of heterocycles include, but are not limited to, pyrrolidinyl, tetrahydrofuranyl, dihydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, dihydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, thioxanyl, piperazinyl, homopiperazinyl, azetidinyl, oxetanyl, thietanyl, homopiperidinyl, oxirane, azepanyl, oxetanyl, thiepanyl, oxazepanyl, oxetanyl, oxetanyl, oxazepan ... Base, diazepine Base, thiazolin 1,2,3,4-tetrahydroisoquinolinyl, 3-azabicyclo[3.1.0]hexyl, 3-azabicyclo[4.1.0]heptyl, azabicyclo[2.2.2]hexyl, 3H-indolylquinolizinyl and N-pyridyl urea. Examples of heterocyclic groups also include 1,1-dioxothiomorpholinyl; examples of ring carbon atoms substituted by oxo (=O) groups include, but are not limited to, pyrimidinedione, 1,2,4-thiadiazole-5(4H)-one, 1,2,4-oxadiazole-5(4H)-one, 1H-1,2,4-triazole-5(4H)-one, etc.; examples of ring carbon atoms substituted by =S groups include, but are not limited to, 1,2,4-oxadiazole-5(4H)-thione, 1,3,4-oxadiazole-2(3H)-thione, etc. The heterocyclic group may be optionally substituted by one or more substituents described in the present invention.

[0068] The terms "fused bicyclic ring", "fused ring", "fused bicyclic group" and "fused cyclic group" are used interchangeably herein and refer to a monovalent or polyvalent, saturated or partially unsaturated but non-aromatic ring system in which two rings share a bond. Such a system may contain independent or conjugated unsaturated systems, but its core structure does not contain aromatic rings or heteroaromatic rings (although aromatic groups may be substituents thereon).

[0069] The terms "spirocyclyl", "spirocycle", "spirobicyclyl" or "spirobicyclic" are used interchangeably herein and refer to a monovalent or multivalent, saturated or partially unsaturated ring system in which one ring originates from a specific ring carbon atom of the other ring and the two rings have only one atom in common.

[0070] For example, as described in the following formula a-1, a saturated ring system (ring B and B') is called a "fused bicyclic ring", while ring A' and ring B share a carbon atom and are called "spiro" or "spiro bicyclic ring". Each ring of the fused bicyclic group and the spiro bicyclic group can be a carbocyclic group or a heterocyclic group, and each ring is optionally substituted with one or more substituents described herein.

[0071]

[0072] The term "aryl" may be used alone or as a part of "aralkyl", "aralkyloxy" or "aryloxyalkyl" to refer to monocyclic, bicyclic, and tricyclic carbon ring systems containing 6-14 carbon atoms, or 6-12 carbon atoms, or 6-10 carbon atoms, wherein at least one of the ring systems is aromatic, wherein each ring system contains 3-7 carbon atoms and has one or more points of attachment to the rest of the molecule. The term "aryl" may be used interchangeably with the term "aromatic ring" or "aromatic ring", such as aryl may include phenyl, naphthyl and anthracenyl. The aryl groups may be independently unsubstituted or substituted with one or more substituents described herein.

[0073] The term "heteroaryl" may be used alone or as a large part of "heteroarylalkyl" or "heteroarylalkoxy" to refer to a monocyclic, bicyclic or tricyclic ring system containing 5-16 ring atoms, wherein at least one of the ring systems is aromatic and at least one of the ring systems contains one or more heteroatoms, wherein each ring system contains 5-7 ring atoms and has one or more points of attachment to the rest of the molecule. The term "heteroaryl" may be used interchangeably with the terms "heteroaromatic ring" or "heteroaromatic compound". In some embodiments, heteroaryl is a heteroaryl consisting of 5-14 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5-12 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5-10 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5-8 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5-7 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5-6 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 5 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 6 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N. In other embodiments, heteroaryl is a heteroaryl consisting of 9 ring atoms containing 1, 2, 3 or 4 heteroatoms independently selected from O, S and N.

[0074] In other embodiments, heteroaryl includes the following monocyclic groups, but is not limited to these monocyclic groups: 2-furanyl, 3-furanyl, N-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl, 3-isoxazolyl, 4-isoxazolyl, 5-isoxazolyl, 2-oxazolyl, 4-oxazolyl, 5-oxazolyl, N-pyrrolyl, 2-pyrrolyl, 3-pyrrolyl, 2-pyridyl, 3-pyridyl, 4-pyridyl, 2-pyrimidinyl, 4-pyrimidinyl, 5-pyrimidinyl, pyridazinyl (such as 3-pyridazinyl), 2-thiazolyl, 4-thiazolyl, 5-thiazolyl, tetrazolyl (such as 5H-tetrazolyl, 2H-tetrazolyl), triazolyl (such as 2-triazolyl, 5-triazolyl, 4H-1,2,4-triazolyl, 1H-1,2,4-triazolyl, 1,2,3-triazolyl), 2-thienyl, 3-thienyl, pyrazolyl (e.g., 2-pyrazolyl and 3-pyrazolyl), isothiazolyl, 1,2,3-oxadiazolyl, 1,2,5-oxadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-oxadiazolyl, 1,2,3-thiodiazolyl, 1,3,4-thiodiazolyl, 1,2,5-thiodiazolyl, pyrazinyl, 1,3,5-triazinyl; also includes The following bicyclic or tricyclic groups, but in no way limited to these groups: benzimidazolyl, benzofuranyl, benzothienyl, indolyl (such as 2-indolyl), purinyl, quinolyl (such as 2-quinolyl, 3-quinolyl, 4-quinolyl), isoquinolyl (such as 1-isoquinolyl, 3-isoquinolyl or 4-isoquinolyl), phenoxathiol, dibenzimidazolyl, dibenzofuranyl or dibenzothienyl, etc. The heteroaryl group is optionally substituted with one or more substituents described in the present invention.

[0075] In addition, it should be noted that, unless explicitly stated otherwise, the description methods used throughout this article, "each... and... are independently", "... and... are each independently", and "... and... are respectively independently" are interchangeable and should be understood in a broad sense, which can mean that in different groups, the specific options expressed by the same symbols do not affect each other, or that in the same group, the specific options expressed by the same symbols do not affect each other.

[0076] Unless otherwise indicated, the structural formulas described in the present invention include all isomeric forms (such as enantiomers, diastereomers, and geometric isomers (or conformational isomers): for example, R, S configurations containing asymmetric centers, (Z), (E) isomers of double bonds, and (Z), (E) conformational isomers. Therefore, single stereochemical isomers of the compounds of the present invention or mixtures of their enantiomers, diastereomers, or geometric isomers (or conformational isomers) are all within the scope of the present invention.

[0077] The term "prodrug" as used in the present invention refers to a compound that is converted into a compound represented by formula (I) or (II) in vivo. Such conversion is affected by the hydrolysis of the prodrug in the blood or the conversion of the prodrug into the parent structure by enzymes in the blood or tissues. The prodrug compound of the present invention can be an ester. In the prior invention, esters that can be used as prodrugs include phenyl esters, aliphatic (C 1-24 ) esters, acyloxymethyl esters, carbonates, carbamates and amino acid esters. For example, a compound of the present invention contains a hydroxyl group, which can be acylated to obtain a prodrug form of the compound. Other prodrug forms include phosphates, such as these phosphate compounds obtained by phosphorylation of the hydroxyl group on the parent. For a complete discussion of prodrugs, please refer to the following literature: T. Higuchi and V. Stella, Pro-drugs as Novel Delivery Systems, Vol. 14 of the ACSSymposium Series, Edward B. Roche, ed., Bioreversible Carriers in Drug Design, American Pharmaceutical Association and Pergamon Press, 1987, J. Rautio et al, Prodrugs: Design and Clinical Applications, Nature Review Drug Discovery, 2008, 7, 255-270, and SJ Hecker et al, Prodrugs of Phosphates and Phosphonates, Journal of Medicinal Chemistry, 2008, 51, 2328-2345.

[0078] Unless otherwise indicated, all tautomeric forms of the compounds of the present invention are included within the scope of the present invention. In addition, unless otherwise indicated, the structural formulas of the compounds described in the present invention include enriched isotopes of one or more different atoms.

[0079] "Metabolite" refers to a product obtained by the metabolism of a specific compound or salt thereof in vivo. The metabolites of a compound can be identified by techniques known in the art, and their activity can be characterized by experimental methods as described herein. Such products can be obtained by administering the compound through oxidation, reduction, hydrolysis, amidation, deamidation, esterification, defatting, enzymatic cleavage, etc. Accordingly, the present invention includes metabolites of compounds, including metabolites produced by contacting a compound of the present invention with a mammal for a period of time.

[0080] The definitions and conventions of stereochemistry used in this invention are generally based on the following references: SP Parker, Ed., McGraw-Hill Dictionary of Chemical Terms (1984) McGraw-Hill Book Company, New York; and Eliel, E. and Wilen, S., "Stereochemistry of Organic Compounds", John Wiley & Sons, Inc., New York, 1994. The compounds of the present invention may contain asymmetric centers or chiral centers and therefore exist in different stereoisomers. All stereoisomeric forms of the compounds of the present invention, including but not limited to diastereomers, enantiomers, atropisomers, and mixtures thereof, such as racemic mixtures, constitute a part of the present invention. Many organic compounds exist in optically active forms, that is, they have the ability to rotate the plane of plane polarized light. When describing optically active compounds, the prefixes D, L or R, S are used to indicate the absolute configuration of the chiral center of the molecule. The prefixes d, l or (+), (-) are used to name the sign of rotation of plane polarized light of a compound, (-) or l means that the compound is levorotatory, and the prefix (+) or d means that the compound is dextrorotatory. These stereoisomers have the same chemical structure, but their stereostructures are different. Specific stereoisomers can be enantiomers, and a mixture of isomers is usually called an enantiomeric mixture. A 50:50 mixture of enantiomers is called a racemic mixture or racemate, which may result in no stereoselectivity or stereospecificity during chemical reactions. The terms "racemic mixture" and "racemate" refer to an equimolar mixture of two enantiomers that lacks optical activity. The term "tautomer" or "tautomeric form" refers to structural isomers of different energies that can be interconverted through a low energy barrier. For example, proton tautomers (i.e., prototropic tautomers) include interconversions through proton migration, such as keto-enol and imine-enamine isomerization. Valence (chemical valency) tautomers include interconversions that reorganize bonding electrons. Unless otherwise indicated, all tautomeric forms of the compounds of the invention are within the scope of the invention.

[0081] The "pharmaceutically acceptable salt" used in the present invention refers to the organic salt and inorganic salt of the compound of the present invention. Pharmaceutically acceptable salts are well known in the art, as described in the literature: SM Berge et al., describe pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19, 1977. Pharmaceutically acceptable salts formed by non-toxic acids include, but are not limited to, inorganic acid salts formed by reaction with amino groups, such as hydrochlorides, hydrobromides, phosphates, sulfates, perchlorates, and organic acid salts such as acetates, oxalates, maleates, tartrates, citrates, succinates, malonates, or other methods described in books and literature, such as ion exchange methods, to obtain these salts. Other pharmaceutically acceptable salts include adipate, malate, 2-hydroxypropionate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, cyclopentylpropionate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate, hexanoate, hydroiodide, 2-hydroxy-ethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, stearate, thiocyanate, p-toluenesulfonate, undecanoate, valerate, and the like. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium and N + (C 1-4 The present invention also contemplates quaternary ammonium salts formed by any compound containing a N group. Water-soluble or oil-soluble or dispersible products can be obtained by quaternization. Alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. Pharmaceutically acceptable salts further include appropriate, non-toxic ammonium, quaternary ammonium salts and amine cations formed by counter ions, such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, C 1-8 Sulfonates and aromatic sulfonates.

[0082] The "solvate" of the present invention refers to an association formed by one or more solvent molecules and the compound of the present invention. Solvents that form solvates include, but are not limited to, water, isopropanol, ethanol, methanol, dimethyl sulfoxide, ethyl acetate, acetic acid, aminoethanol. The term "hydrate" refers to an association formed when the solvent molecule is water.

[0083] The term "protecting group" or "Pg" refers to a substituent that reacts with another functional group, usually used to block or protect a specific functionality. For example, an "amino protecting group" refers to a substituent attached to an amino group to block or protect the functionality of the amino group in the compound. Suitable amino protecting groups include acetyl, trifluoroacetyl, tert-butyloxycarbonyl (BOC), benzyloxycarbonyl (CBZ) and 9-fluorenylmethyleneoxycarbonyl (Fmoc). Similarly, a "hydroxy protecting group" refers to a substituent of a hydroxy group used to block or protect the functionality of the hydroxy group. Suitable protecting groups include acetyl and silyl. A "carboxyl protecting group" refers to a substituent of a carboxyl group used to block or protect the functionality of the carboxyl group. Typical carboxyl protecting groups include -CH2CH2SO2Ph, cyanoethyl, 2-(trimethylsilyl)ethyl, 2-(trimethylsilyl)ethoxymethyl, 2-(p-toluenesulfonyl)ethyl, 2-(p-nitrobenzenesulfonyl)ethyl, 2-(diphenylphosphino)ethyl, nitroethyl, and the like. For a general description of protecting groups, reference may be made to: T W. Greene, Protective Groups in Organic Synthesis, John Wiley & Sons, New York, 1991; and P J Kocienski, Protecting Groups, Thieme, Stuttgart, 2005.

[0084] Description of the compounds of the present invention

[0085] The compounds involved in the present invention and their pharmaceutically acceptable compositions can effectively inhibit HBV infection.

[0086] In one aspect, the present invention relates to a compound as represented by formula (I) or a stereoisomer, tautomer, nitrogen oxide, solvate, metabolite, pharmaceutically acceptable salt or prodrug thereof of the compound as represented by formula (I),

[0087]

[0088] Wherein, R is the structure shown below:

[0089]

[0090] wherein the formula (I-1), formula (I-2) and formula (I-3) are each independently unsubstituted or substituted with 1, 2, 3, 4 or 5 R 5 replaced by;

[0091] Ring A is phenyl, heteroaryl consisting of 5-6 atoms or heterocyclic group consisting of 4-6 atoms, wherein the phenyl, heteroaryl consisting of 5-6 atoms and heterocyclic group consisting of 4-6 atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R 6 replaced by;

[0092] Each R 2 and R 3 are independently hydrogen, deuterium, F, Cl, Br, I, CN, amino, nitro, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, methoxy, ethoxy, N-methylamino or N-ethylamino;

[0093] Each R 5 and R 6 are independently deuterium, F, Cl, Br, I, CN, amino, nitro, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, methoxy, ethoxy, N-methylamino or N-ethylamino;

[0094] Each R 1 and R 4 are independently hydrogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl or C 1-4 Haloalkyl;

[0095] R x Hydrogen, carboxyl C 1-6 Alkyl, -C 1-4 Alkyl-C(=O)OC 1-6 Alkyl, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Haloalkyl, C 3-6 Cycloalkyl, C 6-10 Aryl, -C1-3 Alkylene-phenyl, -C 1-3 Alkylene-5-6 atoms composed of heteroaryl or 5-6 atoms composed of heteroaryl, wherein the carboxyl C 1-6 Alkyl, -C 1-4 Alkyl-C(=O)OC 1-6 Alkyl, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-6 Haloalkyl, C 3-6 Cycloalkyl, C 6-10 Aryl, -C 1-3 Alkylene-phenyl, -C 1-3 Alkylene-5-6 atoms consisting of heteroaryl and 5-6 atoms consisting of heteroaryl are each independently unsubstituted or substituted with 1, 2, 3, 4 or 5 R y replaced by;

[0096] R y It is F, Cl, Br, I, =O, -NO2, CN, -OH, -COOH, -C(=O)-NR a R b 、-C(=O)OC 1-6 Alkyl, -S(=O)2-C 1-6 Alkyl, C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, -OC 6-10 Aryl, C 1-6 Alkylamino, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 atoms, C 6-10 Aryl or heteroaryl composed of 5-10 atoms, wherein the -C(=O)OC 1-6 Alkyl, -S(=O)2-C 1-6 Alkyl, -C(=O)-NR a R b , C 1-6 Alkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, -OC 6-10 Aryl, C 1-6 Alkylamino, C 3-6 Cycloalkyl, heterocyclic group consisting of 3-6 atoms, C 6-10The aryl group and the 5-10-atom heteroaryl group are each independently unsubstituted or substituted with 1, 2, 3 or 4 R z replaced by;

[0097] Each R a and R b are independently hydrogen, deuterium, C 1-6 Alkyl, C 2-6 Alkenyl or C 2-6 Alkynyl;

[0098] Each R z are independently F, Cl, Br, CN, -OH, -COOH, -C(=O)OC 1-6 Alkyl, amino, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, carboxyl C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Haloalkoxy or C 1-6 Alkoxy, wherein the C 1-6 The alkoxy group is unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, Cl, Br and C 1-6 The alkoxy group is substituted with an alkoxy substituent.

[0099] In some embodiments, the ring A of the present invention is phenyl, azetidinyl, oxetanyl, thietanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the The phenyl, azetidinyl, oxetanyl, thietanyl, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl groups are each independently unsubstituted or substituted with 1, 2, 3 or 4 R 6 is substituted, wherein the R 6 Has the meaning described in the present invention.

[0100] In some embodiments, the compound of the present invention is a compound as shown in formula (II),

[0101]

[0102] Among them, each R 6aand R 6b are independently hydrogen, deuterium, F, Cl, Br, I, CN, amino, nitro, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, methoxy, ethoxy, N-methylamino or N-ethylamino, wherein R, R 1 , R 2 , R 3 and R 4 Has the meaning described in the present invention.

[0103] In some embodiments, the R x Hydrogen, carboxyl C 1-4 Alkyl, -C 1-2 Alkyl-C(=O)OC 1-4 Alkyl, C 1-4 Alkyl, C 2-4 Alkenyl, C 2-4 Alkynyl, C 1-4 Haloalkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, -methylene-phenyl, -C 1-2 Alkylene-5-atom heteroaryl, -C 1-2 Alkylene-6 atoms composed of heteroaryl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the carboxyl C 1-4 Alkyl, -C 1-2 Alkyl-C(=O)OC 1-4 Alkyl, C 1-4 Alkyl, C 2-4 Alkenyl, C 2-4 Alkynyl, C 1-4 Haloalkyl, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, -methylene-phenyl, -C 1-2 Alkylene-5-atom heteroaryl, -C 1-2 Alkylene-6 atoms consisting of heteroaryl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1, 2, 3, 4 or 5 R yis substituted, wherein the R y Has the meaning described in the present invention.

[0104] In some embodiments, the R x is hydrogen, -CH2COOH, -CH2CH2COOH, -CH2CH2CH2COOH, -CH2-C(=O)OCH3, -CH2-C(=O)OCH2CH3, -CH2-C(=O)OCH2CH2CH3, -CH2-C(=O)OCH(CH3)2, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, vinyl, allyl, propenyl, ethynyl, propargyl, propynyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, - CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, -methylene-phenyl, -methylene-pyridyl, pyrrolyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl or pyrimidinyl, wherein the -CH 2COOH, -CH2CH2COOH, -CH2CH2CH2COOH, -CH2-C(=O)OCH3, -CH2-C(=O)OCH2CH3, -CH2-C(=O)OCH2CH2CH3, -CH2-C(=O)OCH(CH3)2, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, vinyl, allyl, propenyl, ethynyl, propargyl, propynyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH 2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, pyrrolyl, -methylene-phenyl, -methylene-pyridyl, pyridyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl and pyrimidinyl are each independently unsubstituted or substituted with 1, 2, 3, 4 or 5 R y is substituted, wherein the R yHas the meaning as described in the present invention.

[0105] In some embodiments, the R y It is F, Cl, Br, I, =O, -NO2, CN, -OH, -COOH, -C(=O)-NR a R b , -C(=O)OCH3, -C(=O)OCH2CH3, -C(=O)OCH2CH2CH3, -C(=O)OCH(CH3)2, -S(=O)2C 1-4 Alkyl, C 1-4 Alkyl, C 1-4 Alkoxy, C 1-4 Halogenated alkoxy, C 1-4 Haloalkyl, C 2-4 Alkenyl, C 2-4 Alkynyl, -O-phenyl, C 1-4 Alkylamino, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, a heterocyclic group consisting of 4 to 6 atoms, phenyl, naphthyl, a heteroaryl group consisting of 5 to 6 atoms or a heteroaryl group consisting of 9 atoms, wherein the -C(=O)OC 1-4 Alkyl, -S(=O)2C 1-4 Alkyl, C 1-4 Alkyl, C 1-4 Alkoxy, C 1-4 Halogenated alkoxy, C 1-4 Haloalkyl, C 2-4 Alkenyl, C 2-4 Alkynyl, -O-phenyl, C 1-4 Alkylamino, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, heterocyclic radical consisting of 4-6 atoms, phenyl, naphthyl, heteroaryl consisting of 5-6 atoms and heteroaryl consisting of 9 atoms are each independently unsubstituted or substituted with 1, 2, 3 or 4 R z is substituted, wherein the R z Has the meaning as described in the present invention.

[0106] In some embodiments, the R y It is F, Cl, Br, I, =O, -NO2, CN, -OH, -COOH, -C(=O)-NR a R b, -C(=O)OCH3, -C(=O)OCH2CH3, -C(=O)OCH2CH2CH3, -C(=O)OCH(CH3)2, -S(=O)2CH3, -S(=O)2CH2CH3, -S(=O)2CH2CH2CH3, -S(=O)2CH(CH3)2, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, ethoxy, n-propoxy, isopropoxy, C 1-3 haloalkoxy, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, vinyl, allyl, propenyl, ethynyl, propargyl, propynyl, -O-phenyl, C 1-4 alkylamino, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, naphthyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidine or indolyl, wherein the -C(=O)OCH3, -C(=O)OCH2CH3, -C(=O)OCH2CH2CH3, -C(=O)OCH(CH3)2, -S(=O)2CH3, -S(=O)2CH2CH3, -S(=O)2CH2CH2CH3, -S(=O)2CH(CH3)2, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, methoxy, ethoxy, n-propoxy, isopropoxy, C 1-3 haloalkoxy, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, vinyl, allyl, propenyl, ethynyl, propargyl, propynyl, -O-phenyl, C 1-4Alkylamino, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, azetidinyl, oxetanyl, thietanyl, oxirane, pyrrolidinyl, pyrazolidinyl, imidazolidinyl, tetrahydrofuranyl, tetrahydrothiophenyl, tetrahydropyranyl, tetrahydrothiopyranyl, piperidinyl, morpholinyl, thiomorpholinyl, piperazinyl, phenyl, naphthyl, pyrrolyl, pyridinyl, pyrazolyl, imidazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, 1,3,5-triazinyl, thiazolyl, thienyl, pyrazinyl, pyridazinyl, pyrimidine and indolyl are each independently unsubstituted or substituted with 1, 2, 3 or 4 R z is substituted, wherein the R z Has the meaning described in the present invention.

[0107] In some embodiments, each R described in the present invention a and R b and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34

[0108] In some embodiments, each R described in the present invention z independently F, Cl, Br, CN, -OH, -COOH, -C(=O)OCH3, -C(=O)OCH2CH3, -C(=O)OCH2CH2CH3, -C(=O)OCH(CH3)2, amino, C 1-4 Alkyl, C 2-4 Alkenyl, C 2-4 Alkynyl, carboxyl C 1-4 Alkyl, C 1-4 Haloalkyl or C 1-4 Alkoxy, C 1-4 A haloalkoxy group, wherein the C 1-4 The alkoxy group is unsubstituted or substituted with 1, 2, 3 or 4 groups selected from F, Cl, Br and C 1-4 The alkoxy group is substituted with an alkoxy substituent.

[0109] In some embodiments, each R described in the present invention z are independently F, Cl, Br, CN, -OH, -COOH, -C(=O)OCH3, -C(=O)OCH2CH3, -C(=O)OCH2CH2CH3, -C(=O)OCH(CH3)2, amino, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, C 2-4 Alkenyl, C 2-4Alkynyl, carboxymethyl, hydroxyethyl, hydroxy-n-propyl, -CH2F, -CH2Cl, -CHF2, -CHCl2, -CF3, -CH2CH2F, -CH2CH2Cl, -CH2CHF2, -CH2CHCl2, -CHFCH2F, -CHClCH2Cl, -CH2CF3, -CH(CF3)2, -CF2CH2CH3, -CH2CH2CH2F, -CH2CH2CHF2, -CH2CH2CF3, -OCH2F, -OCH2Cl, -OCHF2, -OCHCl2, -OCF3, -OCH2CH2F, -OCH CH2CH2Cl, -OCH2CHF2, -OCH2CHCl2, -OCHFCH2F, -OCHClCH2Cl, -OCH2CF3, -OCH(CF3)2, -OCF2CH2CH3, -OCH2CH2CH2F, -OCH2CH2CHF2, -OCH2CH2CF3, methoxy, ethoxy, n-propoxy, isopropoxy or n-butoxy, wherein the methoxy, ethoxy, n-propoxy, isopropoxy and n-butoxy are unsubstituted or substituted with 1, 2, 3 or 4 substituents selected from F, Cl, Br, methoxy, ethoxy, n-propoxy and isopropoxy.

[0110] In some embodiments, the present invention comprises a structure that is one of the following:

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117] Its stereoisomers, tautomers, N-oxides, solvates, metabolites, pharmaceutically acceptable salts or prodrugs thereof.

[0118] On the other hand, the present invention also provides a pharmaceutical composition comprising the compound of the present invention and pharmaceutically acceptable excipients.

[0119] In some embodiments, the pharmaceutical composition of the present invention further comprises other anti-HBV drugs.

[0120] In some embodiments, in the pharmaceutical composition of the present invention, the other anti-HBV drug is a HBV polymerase inhibitor, an immunomodulator or an interferon.

[0121] In some embodiments, the pharmaceutical composition described in the present invention, wherein the other anti-HBV drug is lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, Alfaferone, Alloferon, simu-leukin, clavudine, emtricitabine, famciclovir, interferon, Baoganling CP, Intefen, interferon α-1b, interferon α, interferon α-2a, interferon β-1a, interferon α-2, interleukin-2, mivotilide, nitazoxanide, polyethylene glycol interferon α-2a, ribavirin, rointerferon-A, sizoran, Euforavac, Ampligen, Phosphazid, Heplisav, interferon α-2b, levamisole or propagermanium.

[0122] On the other hand, the present invention also provides use of the compound or the pharmaceutical composition in preparing a drug for preventing, treating or alleviating viral diseases in patients.

[0123] In some embodiments, the use described in the present invention, wherein the viral disease refers to hepatitis B virus infection or a disease caused by hepatitis B virus infection.

[0124] In other embodiments, the use described in the present invention, wherein the disease caused by hepatitis B virus infection refers to cirrhosis or hepatocellular carcinoma.

[0125] In another aspect, the compound or the pharmaceutical composition of the present invention is used to prepare a drug for preventing, treating or alleviating a viral disease in a patient.

[0126] In some embodiments, in the use of the compound or the pharmaceutical composition of the present invention, the viral disease refers to hepatitis B virus infection or a disease caused by hepatitis B virus infection.

[0127] In other embodiments, in the use of the compound or the pharmaceutical composition of the present invention, the disease caused by the hepatitis B virus infection is liver cirrhosis or hepatocellular carcinoma.

[0128] Another aspect of the present invention relates to a method for preventing, treating or ameliorating HBV symptoms in a patient, the method comprising administering to the patient a pharmaceutical composition containing a compound of the present invention in a pharmaceutically acceptable effective dose.

[0129] In some embodiments, in the method of the present invention, the viral disease refers to hepatitis B virus infection or a disease caused by hepatitis B virus infection.

[0130] In other embodiments, in the method of the present invention, the disease caused by hepatitis B virus infection refers to cirrhosis or hepatocellular carcinoma.

[0131] On the other hand, the present invention relates to the use of the compound or pharmaceutical composition in the preparation of a medicine for preventing, treating or alleviating hepatitis B disease in a patient.

[0132] Another aspect of the present invention relates to a method for preventing, treating or ameliorating HBV symptoms in a patient, the method comprising administering to the patient a pharmaceutically acceptable effective dose of a compound of the present invention.

[0133] Another aspect of the present invention relates to the use of a compound of the present invention to prepare a medicament for preventing or treating HBV disease in a patient and reducing its severity.

[0134] Another aspect of the present invention relates to the use of a pharmaceutical composition comprising the compound of the present invention to prepare a medicament for preventing or treating HBV disease in a patient and reducing its severity.

[0135] In some embodiments, the patient is a mammal, and in other embodiments, the patient is a human. In other embodiments, the use further comprises contacting the cell with an anti-HBV therapeutic agent.

[0136] Another aspect of the present invention relates to a method for inhibiting HBV infection, which comprises contacting cells with a compound or pharmaceutical composition of the present invention at a dose that is effective in inhibiting HBV. In some other embodiments, the method further comprises contacting cells with other anti-HBV therapeutic agents.

[0137] Another aspect of the present invention relates to a method for treating HBV disease in a patient, the method comprising administering to a patient in need of treatment an effective therapeutic dose of a compound of the present invention or a pharmaceutical composition thereof.

[0138] In other embodiments, the method further comprises administering to the patient in need of treatment a therapeutically effective amount of another anti-HBV therapeutic agent.

[0139] Another aspect of the present invention relates to a method for inhibiting HBV infection in a patient, the method comprising administering an effective therapeutic dose of a compound of the present invention or a pharmaceutical composition thereof to a patient in need of treatment. In some other embodiments, the method further comprises administering an effective therapeutic dose of another anti-HBV therapeutic agent to a patient in need of treatment.

[0140] Another aspect of the present invention relates to methods for preparing, isolating and purifying the compounds encompassed by formula (I) or formula (II).

[0141] The present invention also relates to the use of the compound of the present invention and its pharmaceutically acceptable salt in producing a pharmaceutical product to effectively inhibit HBV infection, and the use of the compound of the present invention in producing a drug that effectively inhibits HBV infection. The compound of the present invention is also used to produce a pharmaceutical product for alleviating, preventing, controlling or treating the symptoms of hepatitis B in patients.

[0142] Unless otherwise indicated, all stereoisomers, tautomers, N-oxides, hydrates, solvates, metabolites, pharmaceutically acceptable salts and prodrugs of the compounds of the invention are within the scope of the invention.

[0143] In particular, the salts are pharmaceutically acceptable salts. The term "pharmaceutically acceptable" includes that the substance or composition must be suitable chemically and toxicologically with the other ingredients that make up the formulation and with the mammal to be treated.

[0144] The salts of the compounds of the present invention also include intermediates used in the preparation or purification of the compounds of formula (I) or (II) or salts of separated enantiomers of the compounds of formula (I) or (II), but are not necessarily pharmaceutically acceptable salts.

[0145] If the compound of the present invention is basic, the desired salt can be prepared by any suitable method provided in the literature, for example, using inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid and phosphoric acid, etc. Or using organic acids such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, malic acid, 2-hydroxypropionic acid, citric acid, oxalic acid, glycolic acid and salicylic acid; pyranose acids such as glucuronic acid and galacturonic acid; α-hydroxy acids such as citric acid and tartaric acid; amino acids such as aspartic acid and glutamic acid; aromatic acids such as benzoic acid and cinnamic acid; sulfonic acids such as p-toluenesulfonic acid, benzenesulfonic acid, methanesulfonic acid, ethanesulfonic acid, trifluoromethanesulfonic acid, etc. or combinations thereof.

[0146] If the compound of the present invention is acidic, the desired salt can be prepared by a suitable method, for example, using an inorganic base or an organic base, such as ammonia (primary, secondary, tertiary), an alkali metal hydroxide, ammonium, N + (R 14 )4 and alkaline earth metal hydroxides, and the like. Suitable salts include, but are not limited to, organic salts derived from amino acids, such as glycine and arginine, amines, such as primary, secondary and tertiary amines, N + (R 14 )4 salts, such as R 14 It is H, C 1-4 Alkyl, C 6-10 Aryl, C 6-10 Aryl C 1-4alkyl, etc., and cyclic amines such as piperidine, morpholine and piperazine, etc., and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum and lithium. Also included are appropriate, non-toxic ammonium, quaternary ammonium salts and amine cations that counteract the formation of counterions, such as halides, hydroxides, carboxylates, sulfates, phosphates, nitrates, C 1-8 Sulfonates and aromatic sulfonates.

[0147] Pharmaceutical compositions, formulations, administration and uses of the compounds and pharmaceutical compositions of the present invention

[0148] According to another aspect, the pharmaceutical composition of the present invention is characterized by comprising a compound represented by formula (I) or formula (II), a compound listed in the present invention, or an example compound, and a pharmaceutically acceptable excipient. The compound in the pharmaceutical composition of the present invention can effectively inhibit hepatitis B virus, and is suitable for the treatment of viral diseases, especially acute and chronic persistent HBV infection. Chronic viral diseases caused by HBV may lead to severe morbidity, and chronic hepatitis B virus infection may lead to cirrhosis and / or hepatocellular carcinoma in many cases.

[0149] Areas of disease treatment that may be mentioned for the compounds according to the invention are, for example, the treatment of acute and chronic viral infections which may lead to infectious hepatitis, for example hepatitis B virus infection. The compounds according to the invention are particularly suitable for the treatment of chronic hepatitis B infections and acute and chronic hepatitis B virus infections.

[0150] The present invention includes pharmaceutical preparations which, in addition to non-toxic, inert pharmaceutically suitable excipients, also contain one or more compounds of formula (I) or (II) of the present invention or their pharmaceutical compositions or contain one or more active ingredients of compounds of formula (I) or (II) or the pharmaceutical compositions of the present invention.

[0151] The above-mentioned pharmaceutical preparation may also contain other active pharmaceutical ingredients besides the compound represented by formula (I) or formula (II).

[0152] The compounds of the present invention exist in free form, or are suitable as pharmaceutically acceptable derivatives. According to the present invention, pharmaceutically acceptable derivatives include, but are not limited to, pharmaceutically acceptable prodrugs, salts, esters, salts of esters, or any other adducts or derivatives that can be directly or indirectly administered according to the needs of patients, compounds described in other aspects of the present invention, their metabolites or their residues.

[0153] As described in the present invention, the pharmaceutical composition of the present invention comprises any compound represented by formula (I) or formula (II) of the present invention, and further comprises a pharmaceutically acceptable excipient, such as any solvent, solid excipient, diluent, binder, disintegrant, or other liquid excipient, dispersant, flavoring agent or suspending agent, surfactant, isotonic agent, thickener, emulsifier, preservative, solid binder or lubricant, etc., suitable for a specific target dosage form. As described in the following documents: In Remington: The Science and Practice of Pharmacy, 21st edition, 2005, ed. DB Troy, Lippincott Williams & Wilkins, Philadelphia, and Encyclopedia of Pharmaceutical Technology, eds. J. Swarbrick and JC Boylan, 1988-1999, Marcel Dekker, New York, the contents of the documents herein are summarized, indicating that different excipients can be applied to the preparation of pharmaceutically acceptable compositions and their known preparation methods. Except insofar as any conventional excipients are incompatible with the compounds of the present invention, for example by producing any undesirable biological effect or interacting in a deleterious manner with any other component of the pharmaceutically acceptable composition, their use is contemplated by the present invention.

[0154] Substances that can be used as pharmaceutically acceptable excipients include, but are not limited to, ion exchangers; aluminum; aluminum stearate; lecithin; serum proteins, such as human serum albumin; buffer substances such as phosphates; glycine; sorbic acid; potassium sorbate; partial glyceride mixtures of saturated vegetable fatty acids; water; salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts; colloidal silicon; magnesium trisilicate; polyvinyl pyrrolidone; polyacrylates; waxes; polyethylene-polyoxypropylene-blocking polymers; lanolin; sugars, such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as carboxymethyl cellulose; Sodium cellulose, ethylcellulose and cellulose acetate; gum powder; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycol compounds such as propylene glycol and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol; phosphate buffer solution; and other non-toxic suitable lubricants such as sodium lauryl sulfate and magnesium stearate; colorants; release agents; coatings; sweeteners; flavorings; fragrances; preservatives and antioxidants.

[0155] The pharmaceutical composition of the compound of the present invention can be administered in any of the following ways: oral administration, spray inhalation, topical administration, rectal administration, nasal administration, topical administration, vaginal administration, parenteral administration such as subcutaneous, intravenous, intramuscular, intraperitoneal, intrathecal, intraventricular, intrasternal, or intracranial injection or infusion, or medication by means of an explanted reservoir. The preferred mode is oral administration, intramuscular injection, intraperitoneal administration or intravenous injection.

[0156] The compound of the present invention or its pharmaceutical composition can be administered in a unit dosage form. The dosage form can be a liquid dosage form or a solid dosage form. The liquid dosage form can be a true solution, a colloid, a microparticle dosage form, or a suspension dosage form. Other dosage forms include tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, suppositories, freeze-dried powder injections, inclusion compounds, implants, patches, liniments, etc.

[0157] Tablets and capsules for oral administration may contain excipients such as binders, such as syrup, gum arabic, sorbitol, tragacanth, or polyvinyl pyrrolidone; fillers, such as lactose, sucrose, corn starch, calcium phosphate, sorbitol, aminoacetic acid; lubricants, such as magnesium stearate, talc, polyethylene glycol, silica; disintegrants, such as potato starch; or acceptable wetting agents such as sodium lauryl sulfate. Tablets may be coated by methods known in the pharmaceutical industry.

[0158] Oral liquid can be made into suspension, solution, emulsion, syrup or elixir of hydrated oil, or it can be made into dry product, and water or other suitable medium is added before use. Such liquid preparations can contain conventional additives, such as suspending agent, sorbitol, methyl cellulose, glucose syrup, gel, hydroxyethyl cellulose, carboxymethyl cellulose, aluminum stearate gel, hydrogenated edible oil, emulsifier, such as lecithin, sorbitan monooleate, gum arabic; or non-aqueous excipients (which may contain edible oil), such as almond oil, oil such as glycerol, ethylene glycol, or ethanol; preservatives, such as methyl or propyl parahydroxybenzoate, sorbic acid. Flavoring agents or coloring agents can be added as needed.

[0159] Suppositories may contain conventional suppository bases such as cocoa butter or other glycerides.

[0160] For extragastric administration, liquid dosage forms are usually made of the compound and a sterile excipient. The excipient is preferably water. Depending on the selected excipient and the drug concentration, the compound can be dissolved in the excipient or made into a suspension solution. When making an injection solution, the compound is first dissolved in water, filtered and sterilized, and then filled into a sealed bottle or ampoule.

[0161] When applied topically to the skin, the compounds of the present invention can be made into the form of suitable ointments, lotions, or creams, in which the active ingredient is suspended or dissolved in one or more excipients, wherein the excipients that can be used for ointment preparations include but are not limited to: mineral oil, liquid petrolatum, white petrolatum, propylene glycol, polyethylene oxide, polypropylene oxide, emulsifying wax and water; the excipients that can be used for lotions and creams include but are not limited to: mineral oil, sorbitan monostearate, Tween 60, hexadecyl esters wax, hexadecene aromatic alcohol, 2-octyldodecanol, benzyl alcohol and water.

[0162] In general, it has proven to be advantageous that the total amount of the active compound of the invention administered per 24 hours is about 0.5-500 mg, preferably 1-100 mg / kg body weight, if appropriate, in a plurality of single doses, in order to achieve the desired effect, both in human medicine and in veterinary medicine. The amount of active compound contained in a single dose is preferably about 1-80 mg, more preferably 1-50 mg / kg body weight, but it may not be in accordance with the above dosage, i.e., it depends on the type and weight of the treated subject, the nature and severity of the disease, the type of preparation and the mode of administration of the drug, as well as the administration cycle or time interval.

[0163] The pharmaceutical composition provided by the present invention also contains anti-HBV drugs, wherein the anti-HBV drugs are HBV polymerase inhibitors, immunomodulators or interferons.

[0164] The anti-HBV drugs include lamivudine, telbivudine, tenofovir dipivoxil, entecavir, adefovir dipivoxil, Alfaferone, Alloferon, simu-leukin, clavudine, emtricitabine, facloprid, interferon, Baoganling CP, Intefen, interferon α-1b, interferon α, interferon α-2a, interferon β-1a, interferon α-2, interleukin-2, mivotilide, nitazoxanide, pegylated interferon α-2a, ribavirin, rointerferon-A, sizoran, Euforavac, Ampligen, Phosphazid, Heplisav, interferon α-2b, levamisole or propagermanium, etc.

[0165] Another aspect of the present invention relates to the use of a compound or pharmaceutical composition of the present invention to prepare a medicine for preventing, treating or alleviating hepatitis B disease in a patient, comprising administering a pharmaceutically acceptable effective dose to the patient. Hepatitis B disease refers to liver disease caused by hepatitis B virus infection or hepatitis B infection, including acute hepatitis, chronic hepatitis, cirrhosis and hepatocellular carcinoma. Acute hepatitis B virus infection can be asymptomatic or manifest as symptoms of acute hepatitis. Chronic viral infection patients suffer from active disease and can develop cirrhosis and liver cancer.

[0166] Anti-HBV drugs can be administered separately from the composition comprising the compounds of the invention as part of a multiple dosing regimen. Alternatively, those drugs can be part of a single dosage form, mixed with the compounds of the invention to form a single composition. If administered as part of a multiple dosing regimen, the two active agents can be delivered to each other simultaneously, continuously or over a period of time, so as to obtain the desired agent activity.

[0167] The amount of the compound and pharmaceutical composition (those containing a pharmaceutical composition such as described herein) that can be combined with the excipient materials to produce a single dosage form will vary depending on the indication and the particular mode of administration. Normally, the amount of the pharmaceutical composition of the present invention will not exceed the amount normally administered in a composition containing the agent as the only active agent. On the other hand, the amount of the pharmaceutical composition disclosed herein ranges from about 50% to 100% of the normal amount of existing pharmaceutical compositions containing the agent as the only active therapeutic agent. In those compositions containing the agent, the composition will act synergistically with the compound of the present invention.

[0168] The compounds of the present invention show strong antiviral effects. Such compounds have unexpected antiviral activity against HBV and are therefore suitable for treating various diseases caused by the virus, especially diseases caused by acute and chronic persistent HBV infection. Chronic viral diseases caused by HBV can lead to various complex symptoms of varying severity. It is well known that chronic hepatitis B virus infection can lead to cirrhosis and / or hepatocellular carcinoma.

[0169] Examples of indications that can be treated with the compounds of the invention are acute and chronic viral infections that can lead to infectious hepatitis, such as hepatitis B virus infection. Chronic hepatitis B infection and acute hepatitis B virus infection are particularly preferred.

[0170] The present invention also relates to the use of the compound and pharmaceutical composition of the present invention for preparing drugs for treating and preventing viral diseases, especially hepatitis B.

[0171] General Synthesis Methods

[0172] Generally, the compounds of the present invention can be prepared by the methods described in the present invention, unless otherwise specified, wherein the substituents are defined as shown in formula (I) or formula (II). The following synthetic schemes and examples are used to further illustrate the content of the present invention.

[0173] Those skilled in the art will recognize that the chemical reactions described herein can be used to appropriately prepare many other compounds of the invention, and other methods for preparing the compounds of the invention are considered to be within the scope of the invention. For example, the synthesis of non-exemplified compounds according to the invention can be successfully accomplished by those skilled in the art through modification methods, such as appropriate protection of interfering groups, by utilizing other known reagents in addition to those described herein, or by making some conventional modifications to the reaction conditions. In addition, the reactions disclosed herein or known reaction conditions are also recognized to be applicable to the preparation of other compounds of the invention.

[0174] In the examples described below, all temperatures are in degrees Celsius (°C) unless otherwise indicated. Reagents were purchased from commercial suppliers such as Aldrich Chemical Company, Arco Chemical Company and Alfa Chemical Company and were used without further purification unless otherwise indicated. Common reagents were purchased from Shantou Xilong Chemical Factory, Guangdong Guanghua Chemical Reagent Factory, Guangzhou Chemical Reagent Factory, Tianjin Haoyuyu Chemical Co., Ltd., Qingdao Tenglong Chemical Reagent Co., Ltd., and Qingdao Ocean Chemical Factory.

[0175] Silica gel column was used as the chromatographic column. Silica gel (200-300 mesh) was purchased from Qingdao Ocean Chemical Plant. NMR spectra were performed with CDC13, DMSO-d6, CD3OD or acetone-d6 as solvents (reported in ppm), and TMS (0 ppm) or chloroform (7.25 ppm) as reference standards. When multiple peaks appeared, the following abbreviations were used: s (singlet), d (doublet), t (triplet), m (multiplet), q (quartets), br (broadened), dd (doublet of doublets), dt (doublet of triplets), br.s (broadened singlet). Coupling constant J is expressed in Hertz (Hz).

[0176] Low-resolution mass spectrometry (MS) data were determined by an Agilent 6320 series LC-MS spectrometer equipped with a G1312A binary pump and a G1316A TCC (column temperature was maintained at 30 °C). A G1329A autosampler and a G1315B DAD detector were used for analysis, and an ESI source was applied to the LC-MS spectrometer.

[0177] Low-resolution mass spectrometry (MS) data were also determined by an Agilent 6120 series LC-MS spectrometer equipped with a G1311A quaternary pump and a G1316A TCC (column temperature was maintained at 30 °C), a G1329A autosampler and a G1315D DAD detector were applied for analysis, and an ESI source was applied to the LC-MS spectrometer.

[0178] Both spectrometers were equipped with an Agilent Zorbax SB-C18 column with a size of 2.1×30 mm, 5 μm. The injection volume was determined by the sample concentration; the flow rate was 0.6 mL / min; the HPLC peak was recorded and read at UV-Vis wavelengths at 210 nm and 254 nm. The mobile phase was 0.1% formic acid acetonitrile solution (phase A) and 0.1% formic acid ultrapure water solution (phase B). The gradient elution conditions are shown in Table 1:

[0179] Table 1: Gradient elution conditions

[0180] Time (min) <![CDATA[A(CH3CN,0.1%HCOOH)]]> <![CDATA[B(H2O,0.1%HCOOH)]]> 0-3 5-100 95-0 3-6 100 0 6-6.1 100-5 0-95 6.1-8 5 95

[0181] The purity of the compounds was evaluated by Agilent 1100 series high performance liquid chromatography (HPLC), with UV detection at 210 nm and 254 nm, a Zorbax SB-C18 column, size 2.1×30 mm, 4 μm, 10 min, a flow rate of 0.6 mL / min, 5-95% (0.1% formic acid in acetonitrile) in (0.1% formic acid in water), and the column temperature was maintained at 40°C.

[0182] The following abbreviations are used throughout this invention:

[0183] MeOH methanol h hours

[0184] MeOH-d4 / CD3OD Deuterated methanol DIPEA N,N-diisopropylethylamine

[0185] DCM,CH2Cl2 Dichloromethane DMF N,N-Dimethylformamide

[0186] CDC13 Deuterated chloroform THF Tetrahydrofuran

[0187] TFA Trifluoroacetic acid DMSO Dimethyl sulfoxide

[0188] PE Petroleum ether DMSO-d4 Deuterated dimethyl sulfoxide

[0189] EtOAc, EA Ethyl acetate 1 / 2 half life

[0190] EtOH AUC Area under the drug-time curve

[0191] Et3N,TEA triethylamine Vss Steady-state apparent volume of distribution

[0192] mL,ml milliliters CL,clearance clearance

[0193] RT, rt room temperature F, absolute bioavailability

[0194] Rt retention time Dose dose

[0195] LDA Lithium Diisopropylamide T max Peak time

[0196] CDI N,N'-Carbonyldiimidazole C max Maximum concentration

[0197] 1atm 101.325kPa hr * ng / mL Blood drug concentration*time

[0198] HATU O-(7-azabenzotriazol-1-yl)-N,N,N′,N′-tetramethyluronium hexafluorophosphate

[0199] Synthesis method

[0200] The following synthesis scheme lists the experimental steps for preparing the compounds disclosed in the present invention. 2 , R 3 and R 4 Has the meaning as described in the present invention.

[0201] Synthesis Scheme 1

[0202]

[0203] The compound represented by formula (a-6) can be prepared by the method described in Synthesis Scheme 1. Compound (a-1) and compound (a-2) react under alkaline conditions (such as lithium bis(trimethylsilyl)amide, etc.) to generate compound (a-3); then, compound (a-3) and compound (a-4) react under appropriate conditions to generate compound (A-5); compound (A-5) undergoes hydrolysis reaction to obtain compound (a-5); finally, compound (a-5) undergoes condensation reaction with RH to obtain compound (a-6). DETAILED DESCRIPTION

[0204] The following examples are used to illustrate the present invention but are not intended to limit the scope of the present invention.

[0205] Preparation Example

[0206] In the following preparation examples, the inventors take some of the compounds of the present invention as examples to describe in detail the preparation process of the compounds of the present invention. Table 1. Example numbers and their corresponding structures

[0207]

[0208]

[0209]

[0210]

[0211] Synthesis of Example 1

[0212] Step 1: Synthesis of N-(3,4-difluorophenyl)-1,3,5-trimethyl-1H-pyrrole-2-carboxamide

[0213]

[0214] 1,3,5-trimethyl-1H-pyrrole-2-carboxylic acid ethyl ester (14.0 g, 77.2 mmol), 3,4-difluoroaniline (19.9 g, 154 mmol) and tetrahydrofuran (200 mL) were added to the reaction bottle. Under nitrogen protection, lithium bis(trimethylsilyl)amide (232 mL, 1 mol / L) was added dropwise at 25 degrees Celsius. After the addition, the reaction mixture was stirred at 25 degrees Celsius for 1 hour, then cooled to 0 degrees Celsius, and water (200 mL) was added to quench the reaction. The obtained mixture was extracted with ethyl acetate (400 mL), the organic phase was adjusted to pH 6 with 1M dilute hydrochloric acid, then washed with saturated brine, dried over anhydrous sodium sulfate, and part of the solvent was concentrated. A large amount of solid precipitated, and then stirred at room temperature for 2 hours, filtered, and the filter cake was rinsed with ethyl acetate (10 mL) to obtain a white solid. The filtrate was concentrated, and the concentrated residue was slurried with ethyl acetate (20 mL) and petroleum ether (300 mL) at room temperature for 2 hours and filtered, and then rinsed with petroleum ether (50 mL) to obtain a light yellow solid. The above solids were combined and dried under vacuum at room temperature for 4 hours to obtain the title compound as a gray solid (18.4 g, 90%). MS (ESI, pos.ion) m / z: 265.1 [M+H] + .

[0215] Step 2: 2-(5-((3,4-difluorophenyl)formamido)-1,2,4-trimethyl-1H-pyrrol-3-yl)-2-oxo Synthesis of Ethyl Acetate

[0216] Add N-(3,4-difluorophenyl)-1,3,5-trimethyl-1H-pyrrole-2-carboxamide (16.0 g, 60.5 mmol) and dichloromethane (400 mL) to the reaction flask, cool to 0 degrees Celsius, then drop ethyl oxalyl chloride (24.8 mL, 182 mmol) in dichloromethane (80 mL) solution, and finally add anhydrous aluminum chloride (24.2 g, 181 mmol) in batches. After the addition, the reaction mixture is heated to 25 degrees Celsius and stirred for 16 hours. Ice water is slowly added to quench the reaction, and the mixture is washed with saturated sodium bicarbonate solution (300 mL) and saturated ammonium chloride solution (300 mL) in turn. The organic phase is concentrated to obtain the title compound as a pink solid (22.1 g, 100%). MS (ESI, pos.ion) m / z: 365.2 [M+H] + .

[0217] Step 3: 2-(5-((3,4-difluorophenyl)formamido)-1,2,4-trimethyl-1H-pyrrol-3-yl)-2-oxo Synthesis of acetic acid

[0218]

[0219] Ethyl 2-(5-((3,4-difluorophenyl)formamido)-1,2,4-trimethyl-1H-pyrrol-3-yl)-2-oxoacetate (22.0 g, 60.4 mmol), ethanol (220 mL) and a solution of sodium hydroxide (12 g, 300 mmol) in water (330 mL) were added to the reaction flask. React at 25 degrees Celsius for 30 minutes, concentrate to remove ethanol, add dichloromethane (100 mL) to dilute, filter, let the filtrate stand for stratification, discard the organic phase, wash the aqueous phase with DCM (100 mL), then cool to 0 degrees Celsius, add concentrated hydrochloric acid to adjust the pH value of the aqueous phase to about 1, precipitate solid, continue stirring for 0.5 hours, filter, and dry the filter cake at 50 degrees Celsius in vacuum to obtain a light pink solid (11.2 g). EA (200 mL × 3) was added to the filtrate for extraction, and the combined organic phase was washed with saturated brine (200 mL), dried over anhydrous sodium sulfate, filtered, and the solvent was concentrated to obtain a pink solid (3.6 g). The solids were combined to obtain the title product as a pink solid (14.8 g, 73%). MS (ESI, pos.ion) m / z: 337.1 [M+H] + .

[0220] Step 4: Synthesis of Example 1

[0221] 2-(5-((3,4-difluorophenyl)formamido)-1,2,4-trimethyl-1H-pyrrol-3-yl)-2-oxoacetic acid (0.35 g, 1.0 mmol), N,N-dimethylformamide (2 mL), dichloromethane (2 mL) and N,N-dicarbonylimidazole (0.28 g, 1.7 mmol) were added to a reaction bottle and reacted at 25 °C for 15 min. Then, (S)-hexahydroimidazo[1,5-a]pyrazin-3(2H)-one trifluoroacetate (0.92 g, 2.8 mmol, obtained by referring to the synthesis method of Example 11 of WO2015132276A1) and N,N-diisopropylethylamine (0.34 g, 2.6 mmol) were added. The reaction mixture was continued to react at 25°C for 12 hours, the reaction was stopped, water (10 mL) and ethyl acetate (20 mL) were added to dilute, the organic phase was washed with 1M dilute hydrochloric acid (20 mL) and saturated brine (20 mL), dried over anhydrous sodium sulfate, the solvent was concentrated, ethyl acetate (5 mL) was added to the residue and slurried for 2 hours, filtered, and the filter cake was dried at room temperature for 4 hours to obtain the title compound as a white solid (0.34 g, 71%). MS (ESI, pos.ion) m / z: 460.1 [M+H] + ; 1 H NMR (400MHz, DMSO-d6) δ (ppm): 10.46 (s, 1H), 7.87 (dd, J = 12.6, 7.1Hz, 1H), 7.49–7.40(m,2H),6.59(d,J=6.3Hz,1H),4.45–4.25(m,1H),3.71–3.64(m,1 H),3.60(s,3H),3.53–3.45(m,1H),3.42(t,J=8.1Hz,1H),3.13–2.97(m,2H ),2.90(dd,J=9.2,4.0Hz,1H),2.79–2.72(m,2H),2.46(s,3H),2.25(s,3H).

[0222] Examples 2-3 can be obtained by referring to the synthesis method of Example 1. The characterization data of Examples 2-3 are as follows:

[0223] Embodiment 2:

[0224] White solid, MS (ESI, pos.ion) m / z: 461.2 [M+H] + ; 11H NMR (400 MHz, CD3OD) δ (ppm): 7.80 (dd, J = 10.5, 7.5 Hz, 1H), 7.36 (d, J = 8.6 Hz, 1H), 7.26 (dd, J = 19.0, 9.0 Hz, 1H), 4.65–4.53 (m, 3H), 4.05–3.95 (m, 1H), 3.92–3.71 (m, 2H), 3.67 (s, 3H), 3.28–3.11 (m, 2H), 2.97–2.81 (m, 1H), 2.52 (s, 3H), 2.34 (s, 3H).

[0225] Embodiment 3:

[0226] Pink solid, MS (ESI, pos. ion) m / z: 459.0 [M+H] + ; 1 1H NMR (400 MHz, CDCl3) δ (ppm): 8.12–8.05 (m, 1H), 7.76–7.71 (m, 1H), 7.24 (d, J = 8.7 Hz, 1H), 7.16 (dd, J = 18.1, 9.0 Hz, 1H), 4.75–4.69 (m, 1H), 4.21–4.10 (m, 1H), 3.93–3.89 (m, 1H), 3.70 (s, 3H), 3.67–3.61 (m, 1H), 3.12–2.87 (m, 1H), 2.84–2.68 (m, 1H), 2.49 (s, 3H), 2.47–2.40 (m, 2H), 2.38 (s, 3H), 2.35–2.16 (m, 1H), 1.79–1.65 (m, 2H).

[0227] Synthesis of Example 4

[0228] Step 1: Preparation of (R)-2-(4-fluorophenyl)-3-oxohexahydroimidazo[1,5-a]pyrazine-7(1H)-carboxylic acid tert-butyl ester synthesis

[0229]

[0230] (R)-3-oxohexahydroimidazo[1,5-a]pyrazine-7(1H)-carboxylic acid tert-butyl ester (5.00 g, 20.72 mmol, obtained by referring to the synthesis method of Example 11 of WO2015132276A1), p-bromofluorobenzene (3.99 g, 22.79 mmol), palladium acetate (0.23 g, 1.0 mmol), 2-di-tert-butylphosphino-2',4',6'-triisopropylbiphenyl (0.89 g, 2.07 mmol) and cesium carbonate (10.10 g, 31.0 mmol) were dissolved in 1,4-dioxane (100 mL). The reaction mixture was stirred at 100 ° C for 12 h under nitrogen protection to stop the reaction. After the reaction solution was cooled to room temperature, it was filtered with diatomaceous earth, the filter cake was washed with 30 mL of dichloromethane, and the filtrate was dried. Add (20 mL) of ethanol to the residue, stir at room temperature for 4 h, filter with suction, and wash the filter cake with (20 mL) of ethanol to obtain the title compound as a white solid product (5.56 g, 80%). MS (ESI, pos.ion) m / z: 358.20 [M+Na] + .

[0231] Step 2: Synthesis of (S)-2-(4-fluorophenyl)hexahydroimidazo[1,5-a]pyrazin-3(2H)-one trifluoroacetate

[0232]

[0233] Dissolve (R)-2-(4-fluorophenyl)-3-oxohexahydroimidazo[1,5-a]pyrazine-7(1H)-carboxylic acid tert-butyl ester (500 mg, 1.49 mmol) in dichloromethane (2 mL), add trifluoroacetic acid (2 mL), and stir for 0.5 h. Stop the reaction, spin dry the reaction solution, and obtain the title compound as an orange oil (0.35 g). Directly put it into the next reaction.

[0234] Step 3: Synthesis of Example 4

[0235] 2-(5-((3,4-difluorophenyl)carbamoyl)-1,2,4-trimethyl-1H-pyrrol-3-yl)-2-oxoacetic acid (400 mg, 1.19 mmol) was dissolved in a mixed solvent of dichloromethane (3 mL) and N,N-dimethylformamide (3 mL), and N,N-carbonyldiimidazole (246 mg, 1.49 mmol) was added thereto. The mixture was stirred at room temperature for 0.5 h.

[0236] The (S)-2-(4-fluorophenyl)hexahydroimidazo[1,5-a]pyrazine-3(2H)-one trifluoroacetate (0.35 g) obtained in the previous step was adjusted to pH 7-8 with DIPEA, and then added to the above reaction system, and stirred at room temperature for 12 h. After the reaction was completed, dichloromethane (30 mL) was added to the reaction mixture, extracted with 1M hydrochloric acid (10 mL×3), and the aqueous phase was discarded. The organic phase was washed with saturated sodium bicarbonate aqueous solution (30 mL×3) and saturated sodium chloride aqueous solution (30 mL) once, then dried with anhydrous sodium sulfate, and spin-dried to obtain a pink solid. 10 mL of ethyl acetate was added and stirred at room temperature for 4 h, filtered, and the filter cake was washed with 10 mL of ethyl acetate to obtain the title compound as a pink solid (167 mg, 25.4%). MS: (ESI, pos.ion) m / z: 554.2 [M+H] + ; 1 H NMR(400MHz, DMSO-d6)δ(ppm):10.48(s,1H),7.87(dd,J=12.7,7.3Hz,1H),7.65–7.50(m,2H),7.50–7.36(m,2H),7.18(dd,J=15.0,8.7Hz,2H),4.60–4 .33(m,1H),4.01–3.72(m,3H),3.60(s,3H),3.56–3.42(m,2H),3.25–3.14( m,1H),3.01–2.89(m,1H),2.84(t,J=11.8Hz,1H),2.47(s,3H),2.26(s,3H).

[0237] Examples 5-8 can be obtained by referring to the synthesis method of Example 4. The characterization data of Examples 5-8 are as follows:

[0238] Embodiment 5:

[0239] White solid, MS (ESI, pos.ion) m / z: 561.2 [M+H] + ; 1 H NMR (400MHz, DMSO-d6) δ (ppm): 10.47 (s, 1H), 7.87 (dd, J = 12.5, 7.3Hz, 1H), 7 .82–7.75(m,3H),7.73(t,J=8.8Hz,1H),7.46–7.39(m,2H),4.49(dd,J=69.6 ,11.0Hz,1H),4.07–3.81(m,3H),3.74–3.64(m,1H),3.61(s,3H),3.58–3.46 (m,1H),3.22(t,J=11.6Hz,1H),3.04–2.82(m,2H),2.47(s,3H),2.26(s,3H).

[0240] Embodiment 6:

[0241] White solid, MS (ESI, pos.ion) m / z: 588.5 [M+H] + ; 1 H NMR (400MHz, DMSO-d6) δ (ppm): 10.47 (s, 1H), 7.87 (dd, J = 12.5, 7.3Hz, 1H), 7.59 –7.53(m,1H),7.52–7.46(m,1H),7.46–7.41(m,2H),7.32–7.25(m,1H),4.46(dd, J=68.6,11.7Hz,1H),3.89–3.78(m,2H),3.78–3.70(m,1H),3.70–3.54(m,4H),3. 53–3.43(m,1H),3.30–3.14(m,1H),3.03–2.78(m,2H),2.48(s,3H),2.27(s,3H).

[0242] Embodiment 7:

[0243] White solid, MS (ESI, pos.ion) m / z: 566.2 [M+H] + ; 1 H NMR (600MHz, DMSO-d6) δ (ppm): 10.48 (s, 1H), 7.87 (dd, J = 11.5, 7.6Hz, 1H), 7.47 (d, J = 8.8Hz ,1H),7.46–7.39(m,3H),6.91(t,J=9.2Hz,2H),4.46(dd,J=100.4,11.1Hz,1H),3.96–3.81( m,2H),3.78(d,J=9.3Hz,1H),3.72(d,J=7.3Hz,3H),3.66–3.56(m,4H),3.53–3.44(m,1H),3 .18(t,J=11.4Hz,1H),2.99–2.90(m,1H),2.83(t,J=11.9Hz,1H),2.48(s,3H),2.27(s,3H).

[0244] Embodiment 8:

[0245] White solid, MS (ESI, pos.ion) m / z: 620.4 [M+H] + ; 1H NMR (400MHz, DMSO-d6) δ (ppm): 10.47 (s, 1H), 7.87 (dd, J = 12.4, 6.9 Hz, 1H), 7.66 (dd, J = 1 7.4,9.1Hz,2H),7.47–7.40(m,2H),7.39–7.30(m,2H),4.47(dd,J=68.4,10.1Hz,1H),4.0 4–3.89(m,1H),3.89–3.76(m,2H),3.68–3.62(m,1H),3.60(s,3H),3.55–3.43(m,1H),3.2 1(d,J=10.5Hz,1H),2.99–2.91(m,1H),2.85(t,J=11.8Hz,1H),2.47(s,3H),2.26(s,3H).

[0246] Synthesis of Example 9

[0247] Step 1: (S)-2-(4-(7-(2-(5-((3,4-difluorophenyl)carbamoyl)-1,2,4-trimethyl-1H-pyrrolidone Synthesis of methyl pyrrol-3-yl)-2-oxoacetyl)-3-oxohexahydroimidazo[1,5-a]pyrazin-2(3H)-yl)phenyl)acetate become

[0248]

[0249] 2-(5-((3,4-difluorophenyl)carbamoyl)-1,2,4-trimethyl-1H-pyrrol-3-yl)-2-oxoacetic acid (200 mg, 0.59 mmol) was dissolved in a mixed solvent of DCM (2 mL) and DMF (2 mL), and CDI (118 mg, 0.71 mmol) was added. The reaction mixture was stirred at room temperature for 30 min, and then (S)-3-(4-(3-oxohexahydroimidazo[1,5-a]pyrazine-2(3H)-yl)phenyl)acetic acid methyl ester (260 mg, 0.90 mmol, obtained by referring to the synthesis method of Example 14 of WO201976310 A1) and DIPEA (235 mg, 1.78 mmol) were added thereto, and stirring was continued for 12 h. The residue was spin-dried and purified by silica gel column chromatography (EA) to obtain the title compound as a white solid (260 mg, 72%). MS(ESI,pos.ion):m / z 608.2[M+H] + .

[0250] Step 2: Synthesis of Example 9

[0251] (S)-2-(4-(7-(2-(5-((3,4-difluorophenyl)carbamoyl)-1,2,4-trimethyl-1H-pyrrol-3-yl)-2-oxoacetyl)-3-oxohexahydroimidazo[1,5-a]pyrazin-2(3H)-yl)phenyl)acetate (200 mg, 0.33 mmol) was dissolved in a mixture of methanol (2 mL) and tetrahydrofuran (6 mL), and a solution of sodium hydroxide (66 mg, 1.66 mmol) in water (2 mL) was added thereto. The mixture was reacted at 50°C for 2 h, and then dried by spin drying. The residue was purified by silica gel column chromatography (DCM / MeOH (V / V) = 15 / 1) to give the title compound as a white solid (180 mg, 92%). MS (ESI, pos.ion) m / z: 594.2 [M+H] + ; 1 HNMR (400MHz, DMSO-d6) δ (ppm): 12.27 (s, 1H), 10.47 (s, 1H), 7.87 (dd, J = 12.3, 7.4Hz, 1H), 7.58–7.38 (m, 4H), 7.21 (t, J = 7.8Hz, 2H), 4.61–4.34 (m, 1 H),4.00–3.75(m,3H),3.67–3.58(m,4H),3.51(d,J=5.1Hz,2H),3.24–3.1 6(m,1H),3.00–2.90(m,1H),2.90–2.78(m,1H),2.48(s,3H),2.27(s,3H).

[0252] Examples 10-11 can be obtained by referring to the synthesis method of Example 9. The characterization data of Examples 10-11 are as follows:

[0253] Embodiment 10:

[0254] White solid, MS (ESI, pos.ion) m / z: 587.1 [M+H] + ; 11H NMR (400 MHz, DMSO-d6) δ (ppm): 12.96 (s, 1H), 10.48 (d, J = 2.1 Hz, 1H), 7.98 (d, J = 9.6 Hz, 1H), 7.89–7.85 (m, 1H), 7.43 (dd, J = 8.4, 5.6 Hz, 2H), 4.54–4.50 (m, 1H), 4.21–4.17 (m, 1H), 3.96–3.89 (m, 1H), 3.86–3.79 (m, 1H), 3.75–3.70 (m, 1H), 3.61 (s, 3H), 3.50 (d, J = 11.8 Hz, 1H), 3.26–3.20 (m, 1H), 3.06–3.02 (m, 1H), 2.93–2.88 (m, 1H), 2.47 (s, 3H), 2.26 (s, 3H).

[0255] Embodiment 11:

[0256] Brown solid, MS (ESI, pos. ion) m / z: 670.2 [M-H] - ; 1 1H NMR (600 MHz, DMSO-d6) δ (ppm): 12.69 (s, 1H), 10.48 (s, 1H), 7.99–7.91 (m, 2H), 7.88 (dd, J = 11.6, 7.6 Hz, 1H), 7.66–7.63 (m, 2H), 7.50–7.39 (m, 2H), 7.14 (t, J = 8.6 Hz, 2H), 6.98 (t, J = 8.2 Hz, 2H), 4.49–4.46 (m, 1H), 4.04–3.79 (m, 3H), 3.69–3.64 (m, 1H), 3.62 (s, 3H), 3.56–3.47 (m, 1H), 3.24–3.18 (m, 1H), 3.02–2.91 (m, 1H), 2.86 (t, J = 11.8 Hz, 1H), 2.49 (s, 3H), 2.28 (s, 3H).

[0257] Synthesis of Example 12

[0258] Step 1: Synthesis of (R)-2-methyl-3-oxohexahydroimidazo[1,5-a]pyrazine-7(1H)-carboxylic acid tert-butyl ester

[0259]

[0260] Dissolve (R)-3-oxohexahydroimidazo[1,5-a]pyrazine-7-(1H)-carboxylic acid tert-butyl ester (1.00 g, 4.14 mmol) and sodium hydride (0.20 g, 5.0 mmol, 60 mass%) in THF (8 mL), then drop iodomethane (0.52 mL, 8.4 mmol) and stir at room temperature for 20 min. Transfer to an ice bath, add water (1 mL) to quench the reaction, dilute with EA (50 mL), wash the organic phase with water (50 mL) and saturated brine (50 mL) in turn, dry over anhydrous sodium sulfate, and evaporate the solvent under reduced pressure to obtain the title compound as a yellow solid (1.06 g, 100%), which is directly used in the next step. MS (ESI, pos.ion) m / z: 278.2 [M+Na] + .

[0261] Step 2: (S)-2-Methylhexahydroimidazo[1,5-a]pyrazin-3-(2H)-one trifluoroacetic acid

[0262]

[0263] Dissolve (R)-2-methyl-3-oxohexahydroimidazo[1,5-a]pyrazine-7-(1H)-carboxylic acid tert-butyl ester (100 mg, 0.39 mmol) in TFA (2 mL) and stir at room temperature for 20 min. Evaporate the solvent under reduced pressure to obtain the title compound as a slightly yellow oil (0.105 g, 99.6%), which is directly used in the next step. MS (ESI, pos.ion) m / z: 156.6 [M+H] + .

[0264] Step 3: Synthesis of Example 12

[0265] (S)-2-Methylhexahydroimidazo[1,5-a]pyrazin-3(2H)-one trifluoroacetic acid (0.096 g, 0.36 mmol), HATU (0.14 g, 0.37 mmol), DIPEA (0.15 mL, 0.91 mmol) and 2-(5-((3,4-difluorophenyl)carbamoyl)-1,2,4-trimethyl-1H-pyrrol-3-yl)-2-oxoacetic acid (0.10 g, 0.30 mmol) were dissolved in THF (3 mL) and stirred at room temperature for 40 min. Water (3 mL) was added to quench the reaction and the mixture was diluted with DCM (50 mL). The organic phase was washed with water (50 mL) and saturated brine (50 mL) in sequence, dried over anhydrous sodium sulfate, and the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (EA to MeOH) to obtain the title compound as a slightly yellow solid (0.11 g, 77%). MS(ESI,pos.ion)m / z:474.2[M+H] + ; 1H NMR (400MHz, CD3OD) δ (ppm): 7.83–7.73 (m, 1H), 7.38–7.30 (m, 1H), 7.24 (dd, J = 19.0, 9.0Hz, 1H), 4.60–4.43 (m, 1H), 3.92–3.71(m,2H),3.66(s,3H),3.59–3.40(m,2H),3.22–2.95(m,3H),2.86–2.74(m,4H),2.50(s,3H),2.33(s,3H).

[0266] Examples 13-14 can be obtained by referring to the synthesis method of Example 12. The characterization data of Examples 13-14 are as follows:

[0267] Embodiment 13:

[0268] Slightly yellow solid, MS (ESI, pos.ion) m / z: 516.2 [M+H] + ; 1 H NMR (400MHz, CD3OD) δ (ppm): 7.78 (dd, J=10.7, 7.4Hz, 1H), 7.37–7.30 (m, 1H) ,7.25(dd,J=18.9,9.1Hz,1H),4.62–4.45(m,1H),3.93–3.65(m,5H),3.61–3 .43(m,1H),3.20–3.11(m,1H),3.06–2.95(m,3H),2.87–2.73(m,1H),2.51(s ,3H),2.33(s,3H),1.95–1.81(m,1H),1.37–1.27(m,2H),0.95–0.86(m,6H).

[0269] Embodiment 14:

[0270] White solid, MS (ESI, pos.ion) m / z: 498.1 [M+H] + ; 1 H NMR(600MHz,CD3OD)δ(ppm):7.81–7.75(m,1H),7.34(d,J=8.6Hz,1H),7.25(dd,J=18.8,9.2Hz,1H),4.65–4.47(m,1H),4.08–3.88(m,2H),3. 83–3.69(m,2H),3.66(s,3H),3.60–3.51(m,1H),3.26–3.00(m,3H),2. 87–2.77(m,3H),2.72–2.65(m,1H),2.51(d,J=1.9Hz,3H),2.33(s,3H).

[0271] Synthesis of Example 15

[0272]

[0273] Step 1: Synthesis of compound 15-1

[0274] Dissolve (R)-3-oxohexahydroimidazo[1,5-a]pyrazine-7(1H)-carboxylic acid tert-butyl ester (300 mg, 1.24 mmol) in DMF (10 mL), add NaH (149 mg, 3.73 mmol, 60 mass%) at 0°C, stir for 1 h, and finally slowly add compound 15-SM1 (411 mg, 1.544 mmol). The reaction mixture was transferred to room temperature and continued to stir for 6 h, then (20 mL) of water was added to quench the reaction, and then DCM (20 mL) and water (20 mL) were added, and the layers were separated by extraction. The aqueous phase was discarded, and the organic phase was washed with water (20 mL×2) and saturated brine (20 mL) in turn, dried over anhydrous sodium sulfate, filtered, concentrated, and the crude product was directly used for the next step. MS (ESI, pos.ion) m / z: 435.4 [M+H] + .

[0275] Step 2: Synthesis of compound 15-2

[0276] 15-1 (540 mg, 1.24 mmol) was dissolved in DCM (6 mL), and then trifluoroacetic acid (2 mL) was added. After stirring at room temperature for 2.5 h, the mixture was concentrated to obtain a brown oil. The crude product was directly used in the next step.

[0277] Step 3: 15 Synthesis

[0278] 2-(5-((3,4-difluorophenyl)formamido)-1,2,4-trimethyl-1H-pyrrol-3-yl)-2-oxoacetic acid (417 mg, 1.240 mmol), DIPEA (0.7 mL, 4 mmol) and HATU (646 mg, 1.614 mmol) were dissolved in DCM (10 mL), stirred for ten minutes, and then compound 15-2 (699 mg, 1.243 mmol) was added. The reaction mixture was stirred at room temperature for 10 hours, then diluted with water (20 mL), separated, and the organic phase was washed with water (20 mL×2) and saturated brine (20 mL×2) in turn, dried over anhydrous sodium sulfate, filtered, and the filtrate was evaporated to remove the solvent under reduced pressure. The residue was separated and purified by silica gel column chromatography (DCM / CH3OH (V / V)=25 / 1) to obtain a white solid (356 mg, 43.89%). MS (ESI, pos.ion) m / z: 653.3 [M+H] + ; 1H NMR(400MHz,DMSO-d6)δ(ppm):10.50(s,1H),8.74–8.58(m,1H),7.97–7.80(m,1H),7.57(d ,J=6.3Hz,1H),7.43(d,J=4.9Hz,2H),4.54(dd,J=60.3,11.0Hz,4H),4.39(d,J=4.2Hz,3H) ,3.88–3.65(m,3H),3.60(s,3H),3.51(s,3H),3.42(d,J=16.5Hz,1H),3.13(dd,J=22.3,7. 2Hz,2H),3.02–2.72(m,3H),2.46(s,3H),2.25(s,3H),2.21(d,J=6.7Hz,3H),2.06(s,2H).

[0279] Examples 16-17 can be obtained by referring to the synthesis method of Example 15. The characterization data of Examples 16-17 are as follows:

[0280] Embodiment 16:

[0281] 2-(Chloromethyl)-3-methyl-4-(2,2,2-trifluoromethoxy)pyridine hydrochloride (411 mg, 1.489 mmol) was used to replace compound 15-SM1 in Example 15, and the rest was carried out according to the synthesis method of Example 15 to obtain a white solid (358 mg, 43.50%). MS (ESI, pos.ion) m / z: 663.2 [M+H] + ; 1 H NMR (400MHz, DMSO-d6) δ (ppm): 10.50 (s, 1H), 8.71 (s, 1H), 7.87 (s, 1H), 7.58 (s, 1H), 7.43 (s, 2H), 5.16 (s, 3H), 4.62 (d, J = 9.3Hz, 2H) ,4.41(dd,J=38.9,10.4Hz,1H),3.96–3.64(m,3H),3.60(s,3H),3.13(d,J=18.0Hz,2H),2.96–2.78(m,3H),2.46(s,2H),2.25(s,6H).

[0282] Embodiment 17:

[0283] 2-(Chloromethoxy)-3,4-dimethoxypyridine hydrochloride (334 mg, 1.491 mmol) was used to replace compound 15-SM1 in Example 15, and the rest was carried out according to the synthetic method of Example 15 to obtain a white solid (384 mg, 50.74%). MS (ESI, pos.ion) m / z: 611.2 [M+H] + ; 1HNMR (400MHz, DMSO-d6) δ (ppm): 10.49 (s, 1H), 8.53 (t, J = 7.2Hz, 1H), 7.87 (dd, J = 11.6, 7.5Hz, 1H),7.56(t,J=5.5Hz,1H),7.49–7.33(m,2H),4.57(d,J=10.6Hz,2H),4.41(dd,J=40.6,11.8Hz ,1H),4.10(d,J=3.6Hz,3H),3.87(d,J=6.9Hz,3H),3.75(dd,J=38.5,12.7Hz,2H),3.60(s,3H), 3.55–3.37(m,2H),3.12(dd,J=38.3,27.9Hz,2H),2.95–2.69(m,2H),2.46(s,3H),2.25(s,3H).

[0284] Biological tests

[0285] Test 1: Anti-HBV EC 50 Test Method

[0286] HBV cell lines and culture conditions

[0287] HepG2.2.15 cells (SELLS, PNAS, 1987 and SELLS, JV, 1988) have a complete HBV genome integrated into their chromosomes and stably express viral RNA and viral proteins. HepG2.2.15 cells are able to secrete mature HBV particles, HBsAg and HBeAg into the culture medium. HepG2.2.15 cells were cultured in DMEM medium containing 10% fetal bovine serum, 100U / mL penicillin, 100U / mL streptomycin, 1% non-essential amino acids, 1mM sodium pyruvate, and 300μg / mL G418.

[0288] The viral particle DNA secreted by HepG2.2.15 cells can be quantified by qPCR, and the effect of the compound on viral replication can be detected thereby.

[0289] In vitro anti-HBV activity assay

[0290] 8,000 HepG 2.2.15 cells were seeded into 96-well cell culture plates and cultured at 37°C, 5% CO2 for 3 days until the cells grew to fullness. On the 0th day of the test, the old culture medium was discarded and 200 μL of fresh test medium (5% FBS) was added.

[0291] Compound preparation and cell treatment in antiviral experiments: Dissolve the compound to 30mM with DMSO, further dilute the compound to 800μM with DMSO, and then perform 8 dilutions of 4-fold dilution, with the highest concentration being 800μM. Add 1μL of the serially diluted compound to each well of the above cell plate, and the highest final concentration of the experiment is 4μM (200-fold dilution). TDF (tenofovir disoproxil fumarate, Selleck, Cat S1400) is used as a positive control compound, with a maximum concentration of 4μM. 1μLDMSO is added to the negative control wells, with a final concentration of 0.5%, and TDF is added to the positive control wells, with a final concentration of 1μM.

[0292] qPCR method to detect viral genomic DNA

[0293] Primers: HBV-For-202, CAGGCGGGGTTTTTCTTGTTGA; HBV-Rev-315, GTGATTGGAGGTTGGGGACTGC. SYBR Premix Ex Taq II–Takara DRR081S kit was used, 1 μL of cell culture supernatant was used as a template, a plasmid containing the HBV genome was used as a standard curve, and the viral copy number was calculated using the standard curve. Graphpad Prism 5 software was used to process the concentration-viral copy number, and the EC value of the compound of the present invention on viral replication was calculated using a four-parameter nonlinear regression model. 50 The experimental results are shown in Table 2.

[0294] Table 2: EC of the compounds of the present invention against HBV replication 50 value

[0295] Example <![CDATA[EC 50 (nM) <!-- 39 -->]]> 1 C 2 C 3 B 4 B 5 A 6 B 7 B 8 C 12 C 13 C 14 C 15 C 16 A 17 B

[0296] Note: A stands for EC 50 <50nM; B means 50nM <EC 50 <150nM; C means 150nM <EC 50 <500nM.

[0297] Conclusion: The experimental data show that the compounds of the present invention have good inhibitory activity on HBV replication and have good application prospects in anti-HBV.

[0298] Test 2: Cytotoxicity

[0299] Experimental methods:

[0300] Add serially diluted compounds to 384-well cytotoxic cell plates, add 50 μL HepG2.2.15 cells (3,000 cells / well) to each well, and the highest final concentration of the experiment is 150 μM (200-fold dilution). After incubation at 37°C in a CO2 incubator for 4 days, use CellTiter Glo reagent to detect the cytotoxic effect of the compound.

[0301] The cytotoxicity of the compound was calculated using the following formula: Cytotoxicity (%) = 100 - (detection value / average value of DMSO control wells × 100). The concentration-cytotoxicity (%) data were processed using Graphpad Prism 5 software, and CC was calculated using a four-parameter nonlinear regression model. 50 .CC 50 A concentration greater than 50 μM indicates relatively low cytotoxicity. The experimental results of the compounds of the present invention are shown in Table 3.

[0302] Table 3: CC of cytotoxicity of compounds of the present invention 50 value

[0303]

[0304]

[0305] Conclusion: The cytotoxicity experimental data show that the compounds of the present invention have low toxicity to cells.

Claims

1. A compound, which is a compound represented by formula (II) or a stereoisomer, a tautomer or a pharmaceutically acceptable salt of a compound represented by formula (II), Each R 6a and R 6b are independently F, Cl, Br or methyl; in, R is the structure shown below: Each R 2 and R 3 are independently methyl; R 4 is methyl; R 1 is hydrogen; R x is phenyl, wherein the phenyl is unsubstituted or substituted with 1 or 2 R y replaced by; R y is F, Cl, Br, CN, methoxy or ethoxy, wherein the ethoxy is unsubstituted or substituted with 1, 2 or 3 R z replaced by; R z For F.

2. The compound according to claim 1, comprising one of the following structures: or a stereoisomer, a tautomer or a pharmaceutically acceptable salt thereof.

3. A pharmaceutical composition comprising the compound according to any one of claims 1 to 2, and a pharmaceutically acceptable excipient thereof.

4. The pharmaceutical composition according to claim 3, further comprising other anti-HBV drugs, wherein the other anti-HBV drugs are lamivudine, telbivudine, tenofovir disoproxil, entecavir, adefovir dipivoxil, Alfaferone, Alloferon, simu-leukin, clavudine, emtricitabine, famciclovir, baoganling CP, intefen, interferon α-1b, interferon α, interferon α-2a, interferon β-1a, interferon α-2, interleukin-2, mivotilide, nitazoxanide, peginterferon α-2a, ribavirin, rointerferon-A, sizoran, Euforavac, ampligen, Phosphazid, Heplisav, interferon α-2b, levamisole or propagermanium.

5. Use of the compound described in any one of claims 1-2 or the pharmaceutical composition described in any one of claims 3-4 in the preparation of a medicament for preventing, treating, curing or alleviating a viral disease in a patient, wherein the viral disease refers to hepatitis B virus infection or a disease caused by hepatitis B virus infection, wherein the disease caused by hepatitis B virus infection refers to cirrhosis or hepatocellular carcinoma.

Images