A method for rapidly detecting the titer of lentiviral vector

Abstract

The present invention provides a method for rapidly detecting the titer of a lentiviral vector. Specifically, the present invention provides a method for determining the titer of a lentiviral vector, comprising: (a) providing a sample to be tested, wherein the sample to be tested contains a lentiviral vector and free plasmid DNA; (b) performing RT-PCR and PCR reactions on the sample to be tested, respectively, thereby obtaining the number of copies of the WPRE element in the sample to be tested, wherein the number of copies of the WPRE element includes the number of copies of RNA in the lentiviral vector containing the WPRE element and the number of copies of free plasmid DNA containing the WPRE element; (c) determining the titer of the lentiviral vector based on the number of copies of RNA in the lentiviral vector containing the WPRE element in the sample to be tested. The method of the present invention can obtain specific quantitative results within 2 hours, can be used to rapidly and quantitatively evaluate the titer of intermediate products in each step of the lentiviral vector production process, and can control the titer of the final product.

Description

Technical Field

[0001] The present invention belongs to the field of biological detection, and in particular, the present invention relates to a method for rapidly detecting the titer of a lentiviral vector. Background Art

[0002] Gene therapy refers to the introduction of exogenous therapeutic genes into target cells to correct or compensate for diseases caused by gene defects or abnormalities, or to achieve therapeutic purposes by allowing the products expressed by exogenous genes to act on disease targets.

[0003] Foreign genes can be transduced or delivered through viral vectors or non-viral vectors. Commonly used non-viral vectors include liposomes, dendrimers, non-natural cationic polymers, natural polysaccharides, etc. Non-viral gene delivery vectors are relatively safe and stable, but their transfection efficiency is usually low. Viral vectors are foreign genes packaged into the shell of natural viruses, and the foreign genes are introduced into cells by using the infectivity of the virus to host cells. Common viral vectors include retroviruses (recombinant retrovirus, rRV), recombinant lentiviruses (recombinant lentivirus, rLV), adenoviruses (recombinant adenovirus, rAd), adeno-associated viruses (recombinant adeno-associated virus, rAAV), etc. The transduction efficiency of viral vectors is much higher than that of non-viral vectors, and is particularly suitable for infecting difficult-to-infect target cells, such as lymphocytes.

[0004] Recombinant chronic disease vectors are gene therapy vectors developed based on HIV-1 (human immunodeficiency virus type 1). Different from general retroviral vectors, they have the ability to infect both dividing and non-dividing cells. Recombinant chronic disease vectors have become the preferred transgenic vectors for CART cell and gene therapy due to their advantages such as high titers in vivo and in vitro and low immunogenicity.

[0005] Currently, the detection of recombinant lentiviral vectors mostly uses the p24 Elisa method and the biological titer quantification method. The former requires 1 day to produce results, while the latter requires at least 7 days to produce results and has a high non-specificity.

[0006] Therefore, there is an urgent need in the art to develop a method for rapidly detecting the titer of lentiviral vectors. Summary of the invention

[0007] The purpose of the present invention is to provide a method for rapidly detecting the titer of a lentiviral vector.

[0008] A first aspect of the present invention provides a method for determining the titer of a lentiviral vector, comprising:

[0009] (a) providing a sample to be tested, wherein the sample to be tested contains a lentiviral vector and free plasmid DNA;

[0010] (b) performing RT-PCR and PCR reactions on the sample to be tested, respectively, to obtain the copy number of the WPRE element in the sample to be tested, wherein the copy number of the WPRE element includes the copy number of RNA in the lentiviral vector containing the WPRE element and the copy number of the free plasmid DNA containing the WPRE element;

[0011] (c) determining the titer of the lentiviral vector based on the copy number of RNA in the lentiviral vector containing the WPRE element in the test sample.

[0012] In another preferred embodiment, the copy number of RNA in the lentiviral vector containing the WPRE element in the test sample is calculated using the following formula: the copy number of RNA in the lentiviral vector containing the WPRE element and the total copy number of free plasmid DNA containing the WPRE element - the copy number of free plasmid DNA containing the WPRE element.

[0013] In another preferred embodiment, "based on the copy number of RNA in the lentiviral vector containing the WPRE element in the sample to be tested" includes calculating using formula Q1 to obtain the lentiviral vector titer:

[0014] Q1 = (number of copies of recombinant lentiviral vector RNA in the sample to be tested * biological titer of the positive sample) / number of copies of recombinant lentiviral vector RNA in the positive sample;

[0015] Among them, the positive sample refers to the lentiviral vector suspension with known biological titer; the calculation formula for the biological titer of the positive sample and the copy number of RNA in the positive sample is the same as the calculation formula for the sample to be tested; the copy number of the recombinant lentiviral vector RNA in the sample to be tested is calculated using the following formula: the copy number of RNA in the lentiviral vector containing the WPRE element and the total copy number of free plasmid DNA containing the WPRE element - the copy number of free plasmid DNA containing the WPRE element.

[0016] In another preferred embodiment, the titer is a biological titer.

[0017] In another preferred embodiment, the sample to be tested is derived from the lentiviral vector packaging supernatant, purification intermediate product, or final product during the development and production of the lentiviral vector.

[0018] In another preferred example, the PCR includes q-PCR.

[0019] In another preferred example, in step (b), an RT-PCR reaction is performed on the sample to be tested using upstream primers and downstream primers that specifically amplify the recombinant lentiviral vector containing the WPRE element and using upstream primers and downstream primers that specifically amplify the free plasmid DNA containing the WPRE element to amplify the RNA and free plasmid DNA in the recombinant lentiviral vector, thereby obtaining the Ct value of the RNA and free plasmid DNA in the recombinant lentiviral vector that specifically amplifies the WPRE element.

[0020] In another preferred example, the upstream primer and the downstream primer are used to amplify the WPRE element.

[0021] In another preferred embodiment, the upstream primer and the downstream primer are respectively as follows:

[0022] Primer pair 1:

[0023] Upstream primer: actgtgtttgctgacgcaac (SEQ ID NO.: 1);

[0024] Downstream primer: acaacaccacggaattgtca (SEQ ID NO.: 2); or

[0025] Primer pair 2:

[0026] Upstream primer: actgtgtttgctgacgcaac (SEQ ID NO.: 3);

[0027] Downstream primer: gatgatttccccgacaacac (SEQ ID NO.: 4); or

[0028] Primer pair 3:

[0029] Upstream primer: gtgttgtcggggaaatcatc (SEQ ID NO.: 5);

[0030] Downstream primer: gagatccgactcgtctgagg (SEQ ID NO.: 6).

[0031] In another preferred embodiment, in step (b), a PCR reaction is performed on the sample to be tested using upstream primers and downstream primers that specifically amplify free plasmid DNA containing the WPRE element to amplify the free plasmid DNA, thereby obtaining the Ct value of the free plasmid DNA that specifically amplifies the WPRE element.

[0032] In another preferred embodiment, the upstream primer and the downstream primer are respectively as follows:

[0033] Primer pair 1:

[0034] Upstream primer: actgtgtttgctgacgcaac (SEQ ID NO.: 1);

[0035] Downstream primer: acaacaccacggaattgtca (SEQ ID NO.: 2); or

[0036] Primer pair 2:

[0037] Upstream primer: actgtgtttgctgacgcaac (SEQ ID NO.: 3);

[0038] Downstream primer: gatgatttccccgacaacac (SEQ ID NO.: 4); or

[0039] Primer pair 3:

[0040] Upstream primer: gtgttgtcggggaaatcatc (SEQ ID NO.: 5);

[0041] Downstream primer: gagatccgactcgtctgagg (SEQ ID NO.: 6).

[0042] In another preferred embodiment, in step (b), the content of free plasmid DNA that specifically amplifies the WPRE element is obtained based on the Ct value of the free plasmid DNA that specifically amplifies the WPRE element.

[0043] In another preferred embodiment, in step (b), the total copy number of RNA and free plasmid DNA in the recombinant lentiviral vector is obtained by calculating the Ct value of RNA and free plasmid DNA in the recombinant lentiviral vector based on the specific amplification of the WPRE element using formula Q2:

[0044] Q2 = RNA and / or DNA copy number = (number of nucleic acid copies of the sample in each reaction well × 1000 × dilution factor) / amount of sample added to each reaction well;

[0045] Wherein, the number of nucleic acid copies of the sample in each reaction well = 10^ (aX+b) ,

[0046] Wherein, X: the average CT value obtained by testing the sample;

[0047] a: coefficient obtained by standard curve fitting

[0048] b: The intercept obtained by standard curve fitting.

[0049] In another preferred embodiment, in step (b), based on the total copy number of RNA and free plasmid DNA in the recombinant lentiviral vector, and the copy number of free plasmid DNA, the copy number of RNA in the recombinant lentiviral vector in the sample to be tested is calculated using formula Q3:

[0050] Q3 = the total copy number of RNA and free plasmid DNA in the recombinant lentiviral vector minus the copy number of free plasmid DNA.

[0051] In another preferred embodiment, in step (b), the upstream primer and the downstream primer for specifically amplifying the RNA and free plasmid DNA in the recombinant lentiviral vector containing the WPRE element are both from Lenti-X TM qRT-PCR Titration Kit (Takara) detection kit.

[0052] In another preferred embodiment, the free plasmid DNA is derived from a packaging plasmid.

[0053] In another preferred embodiment, the method further comprises a positive control.

[0054] In another preferred embodiment, the method is a non-diagnostic and non-therapeutic method.

[0055] In another preferred embodiment, the method is an in vitro method.

[0056] In another preferred embodiment, the concentration of the lentiviral vector in the sample to be tested is 5×10 5 -5x10 9 Tu / ml, preferably, 1x10 6 -8x10 8 Tu / ml, preferably, 5x10 6 -5x10 8 Tu / ml.

[0057] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0058] Figure 1 This is the preparation process of the lentivirus control series dilution gradient, in which the lentivirus control concentration provided by the kit itself is 5×10 7 First, draw 2ul 5×10 710 copies / ul lentivirus control to a clean EP tube, add 18ul EASY dilution buffer, mix thoroughly, and take 3ul of the mixture (the concentration of lentivirus control is 5×10 6 18ul EASY dilution buffer) and mix thoroughly. Follow this procedure to make 5 dilution gradients of lentivirus control as shown in the figure. NTC is only EASY dilution buffer. The figure on the right shows the dilution process of the sample to be tested (if necessary, dilute as shown in the figure).

[0059] Figure 2 This is the program running method editing for q-PCR detection. During the detection, you only need to set the temperature and time as shown in the figure.

[0060] Figure 3 The calculation formula is: y = -0.5883x + 10.97, R 2 =0.9999. From the formula, it can be seen that under this detection method, the logarithmic value of the lentivirus content has a good linear correlation with the corresponding CT value, the operation process of the detection of this batch of samples is stable and reliable, and the standard curve can be used to calculate the lentivirus copy number of the sample to be tested.

[0061] Figure 4 This is the melting curve of the product obtained by specifically amplifying the WPRE element and free plasmid DNA with the upstream and downstream primers. The melting curve has only one sharp peak, indicating that the primers have good specificity.

[0062] Figure 5 It is the amplification curve of the real-time quantitative PCR reaction. The amplification curves have the same slope and are parallel, indicating that the efficiency of the primers is consistent and there is no contamination that inhibits PCR in the reaction wells (except the purple curve, which is the well containing NTC).

[0063] Figure 6 Reaction tubes and control tubes are set up, RT-PCR and PCR reactions are carried out simultaneously, and the nucleic acid copy number is calculated in an absolute quantitative manner. The copy number obtained in the reaction tube is recorded as n2 (which is the total nucleic acid copy number), and the copy number obtained in the control tube is recorded as n1 (which is the free DNA copy number), and n2-n1=lentiviral vector RNA copy number. DETAILED DESCRIPTION

[0064] After extensive and in-depth research, the inventors unexpectedly discovered for the first time that the sample to be tested is amplified by RT-PCR (containing reverse transcriptase, amplifying both RNA and plasmid DNA in the lentiviral vector) and PCR (without reverse transcriptase, only amplifying plasmid DNA), and the copy number of RNA in the lentiviral vector containing the WPRE element obtained by RT-PCR and the copy number of free plasmid DNA obtained by PCR are subtracted from the copy number of free plasmid DNA containing the WPRE element obtained by PCR to obtain the copy number of RNA in the lentiviral vector containing the WPRE element in the sample to be tested, and based on the copy number of RNA in the lentiviral vector containing the WPRE element in the sample to be tested, the titer of the lentiviral vector can be determined, and the method of the present invention can remove non-specific interference of plasmids or other nucleic acids, quickly achieve quantification, and obtain specific quantitative results within 2 hours, which can be used to quickly and quantitatively evaluate the physical titer of intermediate products in each step of the lentiviral vector production process, and can control the physical titer (biological titer) of the final product. On this basis, the inventors completed the present invention.

[0065] Terminology

[0066] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0067] As used herein, when used in reference to a specific recited numerical value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0068] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0069] RT-PCR

[0070] RT-PCR (Reverse Transcription-Polymerase Chain Reaction) is a technology that combines reverse transcription (RT) of RNA and polymerase chain amplification (PCR) of cDNA. First, cDNA is synthesized from RNA through the action of reverse transcriptase, and then the target fragment is amplified and synthesized under the action of DNA polymerase using cDNA as a template. RT-PCR technology is sensitive and widely used. It can be used to detect gene expression levels in cells and the content of RNA viruses in cells or culture supernatants. The RT-PCR reaction system contains primers, reverse transcriptase, PCR enzyme, buffer, dNTP and other components.

[0071] In the present invention, the RT-PCR technique is used to simultaneously detect the DNA and RNA contents in the same sample, and reaction tubes and control tubes are set up separately. The reaction tube contains the sample to be tested and all the reaction systems of RT-PCR, and the control tube contains the same sample to be tested as in the reaction tube, and the RT-PCR reaction system without reverse transcriptase. In the reaction tube, RNA and DNA are amplified simultaneously to obtain the Ct value of the specific amplification WPRE element, and the copy number calculated thereby is the lentiviral vector RNA copy number plus the free plasmid DNA copy number. In the control tube, reverse transcriptase is not added, the RNA on the lentiviral vector cannot be amplified, and only the free plasmid DNA is amplified to obtain the Ct value of the specific amplification WPRE element, and the copy number calculated thereby is the free plasmid DNA copy number.

[0072] In a preferred embodiment, the reaction tube and the control tube are set up in the above manner, and RT-PCR and PCR reactions are performed simultaneously. The nucleic acid copy number is calculated in an absolute quantitative manner, and the copy number obtained in the reaction tube is subtracted from the copy number obtained in the control tube to obtain the lentiviral vector RNA copy number, n2-n1=lentiviral vector RNA copy number RNA copy number (such as Figure 6 shown).

[0073] WPRE Components

[0074] The WPRE element comes from the woodchuck hepatitis virus. In 1999, Zufferey et al. inserted the woodchuck postregulatory element (WPRE) of the woodchuck hepatitis virus into the 3′ end of the lentiviral transfer vector. WPRE can promote the nuclear export of transcripts and increase the total amount of intracellular mRNA by upregulating the polyadenylation of primary transcripts, ultimately improving the expression efficiency of lentiviral vector RNA and increasing the yield of lentiviral vectors.

[0075] Positive Control

[0076] In the present invention, the positive control is a lentiviral vector suspension with a known biological titer (eg, LV-CAR001, obtained from Shanghai CyBiotech Biotechnology Co., Ltd.).

[0077] In the present invention, the positive control also contains DNA and RNA, and the copy number and titer of the positive control are calculated in the same manner as the calculation formula of the test sample.

[0078] Method for determining the titer of lentiviral vector

[0079] In the present invention, a method for determining the titer of a lentiviral vector is provided, comprising:

[0080] (a) providing a sample to be tested, wherein the sample to be tested contains a lentiviral vector and free plasmid DNA;

[0081] (b) performing RT-PCR and PCR reactions on the sample to be tested, respectively, to obtain the copy number of the WPRE element in the sample to be tested, wherein the copy number of the WPRE element includes the copy number of RNA in the lentiviral vector containing the WPRE element and the copy number of the free plasmid DNA containing the WPRE element;

[0082] (c) determining the titer of the lentiviral vector based on the copy number of RNA in the lentiviral vector containing the WPRE element in the test sample.

[0083] The main advantages of the present invention include:

[0084] (1) The present invention first discovered that the method of the present invention for rapid detection of physical titer of lentiviral vectors can obtain specific quantitative results within two hours, and can be used to rapidly and quantitatively evaluate the physical titer of intermediate products in each step of the lentiviral vector production process, and can control the loading of the final viral vector product.

[0085] (2) The present invention first discovered that by amplifying the WPRE element through the RT-PCR absolute quantitative method, detecting the number of free plasmid DNA copies and the number of RNA copies of the lentiviral vector in the sample to be tested, and deducting the number of free plasmid DNA copies from the total number of free plasmid DNA copies and the number of RNA copies of the lentiviral vector, the titer of the lentiviral vector can be quickly and specifically determined. In addition, the experimental design of the present invention is simple, the operation is simple, and the content of the recombinant lentiviral vector can be quickly, effectively and specifically determined within two hours.

[0086] (3) The present invention uses the biological titer of the positive sample as a control to calculate the biological titer value of the experimental group, thereby quickly adjusting the content of the recombinant vector.

[0087] (4) The present invention has few operating steps, short detection time, fast feedback of detection results, and high reliability of detection results. It is very suitable for the determination of lentiviral vector content at different stages during the development or production of lentiviral vectors.

[0088] The present invention will be further described below in conjunction with specific implementation. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or under conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0089] Unless otherwise specified, the reagents and materials used in the examples of the present invention are all commercially available products.

[0090] equipment:

[0091] Quantstudio TM DX(ABI)

[0092] Examples and application parameters

[0093] 1. Reagent Preparation

[0094] Prepare sufficient volume of Master Reaction Mix (MRM) on ice.

[0095]

[0096] 2. Sample Dilution

[0097] The sample to be tested was diluted to an appropriate concentration (10 5 -10 9 pfu / ml).

[0098] 3. Sample Lysis

[0099] Add 2 μl of diluted virus and 18 μl of virus lysis buffer, mix well, and incubate at room temperature for 1-5 min.

[0100] 4. Establishing the standard curve Lenti-X RNA Control dilution template

[0101] The standard was diluted in a clean 0.2 ml PCR tube. The RNA control was serially diluted. Each tube must be fully mixed before the next dilution. 7The copies / μl was taken as the highest point of the standard curve, and EASY dilution buffer was used as the negative control (NTC, 0 copies / μl).

[0102] 5. Place the 96-well PCR plate on ice and use a pipette to dispense 18.4 μl of MRM (triplicate) into appropriate wells.

[0103] 6. Use a pipette to transfer 1.6 μl of control dilution, NTCs, and samples (triplicate) to a 96-well PCR plate.

[0104] 7. Centrifuge at 2000 rpm for 2 min at 4°C to remove bubbles.

[0105] 8. Set up the PCR program according to the table below, put in the 96-well plate and start the program

[0106] 9. Data processing

[0107] 1) Standard curve: The average CT value of the Lenti-X RNA Control serial dilution is linearly correlated with the RNA copy number (log scale).

[0108] 2) According to the average CT value of the diluted sample, calculate the RNA copy number of the sample in each reaction well. The average CT value obtained by the serial gradient dilution of the lentivirus standard sample in the kit is used as the horizontal axis, and the logarithm of the corresponding lentivirus control content (copies) (base 10) is used as the vertical axis. The standard curve is fitted to obtain the calculation formula: Y = aX + b

[0109] Y: Logarithmic value of the lentivirus content to be tested (base 10)

[0110] X: The average CT value of the sample under test.

[0111] a: coefficient obtained by standard curve fitting

[0112] b: intercept obtained by standard curve fitting

[0113] A (number of nucleic acid copies in each reaction well) = 10^ (aX+b)

[0114] 3) RNA copies of the original sample (copies / ml) = 5 × 10 7 copies / ul

[0115] result:

[0116] 1. Standard curve

[0117] Use known concentrations of standards to create a standard curve to calculate the amount of unknown samples. Figure 1 Dilutions of Lenti-X RNA control standards and virus samples were performed as shown. Figure 2 PCR amplification was performed according to the procedure shown in the figure. A standard curve was drawn based on the Ct value and the corresponding viral copy number ( Figure 3 ). From the data of the example of the patent method, it can be concluded that by measuring the standard substance, the obtained detection value is fitted, and the fitting data shows a good linear correlation (R 2 ≥0.9999), indicating that the detection method has good stability and accuracy.

[0118] 2. Melting curve

[0119] Melting curve ( Figure 4 ) can verify the specificity of the amplified product. The melting curve can usually show how many peaks there are and where the peaks appear. Because different peaks represent different products, if there are two or more peaks, it means that the primer specificity is not high, that is, the obtained Ct value is not credible. The melting curve obtained by the real-time quantitative PCR reaction has only one sharp peak, indicating that the primer specificity in this reaction system is high, the product amplified by this patented method is stable and correct, and the detection data is credible.

[0120] 3. Amplification curve ( Figure 5 )

[0121] The amplification curve of real-time quantitative PCR can roughly determine the reaction amplification efficiency. Ensuring high amplification efficiency and consistent amplification efficiency is the key to successful detection. If the amplification efficiency is inconsistent, the amplification efficiency curve will not have the same inclination and be parallel, indicating that the efficiency of the primers is different, or there is contamination that inhibits PCR in individual samples or reaction wells. From the figure, it can be seen that the amplification curve obtained by the patented method is basically parallel displacement and the inclination is basically consistent, indicating that the patented method has a high amplification efficiency for detection.

[0122] 4. Calculation of results:

[0123]

[0124] The CT SD value shows that the parallelism of the samples to be tested is good, and the melting temperature of the products after specific amplification is around 75°C, indicating that the amplification efficiency of the primers is relatively good, and there is no non-specific amplification. By comparing with the positive control with known biological titer, the biological titer of the sample to be tested can be quickly and accurately estimated, which is of great significance for relevant R&D and production personnel to grasp the lentivirus content of the sample in a timely manner. This shows that this method has good applicability for the rapid detection of lentivirus titer.

[0125] According to item 8 of the embodiment and application parameters, the q-PCR method program has a total time of 1 hour and 20 minutes from program running to completion, plus the time for preliminary sample preparation operations and data processing after the q-PCR program run is completed, all the time added up can be controlled within 2 hours.

[0126] in conclusion

[0127] The detection method of the present invention can be used to efficiently, quickly and specifically quantify the physical titer of lentiviral vectors, and can be quickly used to detect the physical titer of intermediate samples in each step of the production process, determine the loading amount of intermediate products, and control the concentration of the final product.

[0128] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application. Sequence Listing <110> Shanghai Cybion Biotechnology Co., Ltd. Wuxi Saibiman Biotechnology Co., Ltd. <120> A method for rapidly detecting the titer of lentiviral vector <130> P2020-0547 <160> 6 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <400> 1 actgtgtttg ctgacgcaac 20 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <400> 2 acaacaccac ggaattgtca 20 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <400> 3 actgtgtttg ctgacgcaac 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <400> 4 gatgatttcc ccgacaacac 20 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <400> 5 gtgttgtcgg ggaaatcatc 20 <210> 6 <211> 20 <212> DNA <213> Artificial sequence <400> 6 gagatccgac tcgtctgagg 20

Claims

1. A method for determining the titer of a lentiviral vector, characterized in that: include: (a) providing a sample to be tested, wherein the sample to be tested contains a lentiviral vector and free plasmid DNA; (b) performing RT-PCR and PCR reactions on the sample to be tested, respectively, to obtain the copy number of the WPRE element in the sample to be tested, wherein the copy number of the WPRE element includes the copy number of RNA in the lentiviral vector containing the WPRE element and the copy number of the free plasmid DNA containing the WPRE element; (c) Calculate the copy number of RNA in the lentiviral vector containing the WPRE element in the sample to be tested using the following formula: the copy number of RNA in the lentiviral vector containing the WPRE element and the total copy number of free plasmid DNA containing the WPRE element - the copy number of free plasmid DNA containing the WPRE element, and then calculate the lentiviral vector titer based on the copy number of RNA in the lentiviral vector containing the WPRE element in the sample to be tested using formula Q1: Q1= (number of copies of recombinant lentiviral vector RNA in the sample to be tested * biological titer of the positive sample) / number of copies of recombinant lentiviral vector RNA in the positive sample; Among them, the positive sample refers to a lentiviral vector suspension with a known biological titer; the calculation formula for the biological titer of the positive sample and the copy number of RNA in the positive sample is the same as the calculation formula for the sample to be tested.

2. The method according to claim 1, characterized in that In step (b), an RT-PCR reaction is performed on the sample to be tested using upstream primers and downstream primers that specifically amplify the recombinant lentiviral vector containing the WPRE element, and using upstream primers and downstream primers that specifically amplify the free plasmid DNA containing the WPRE element, and the RNA and free plasmid DNA in the recombinant lentiviral vector are amplified, thereby obtaining the Ct value of the RNA and free plasmid DNA in the recombinant lentiviral vector containing the WPRE element.

3. The method according to claim 1, characterized in that In step (b), a PCR reaction is performed on the sample to be tested using upstream primers and downstream primers that specifically amplify free plasmid DNA containing the WPRE element to amplify the free plasmid DNA, thereby obtaining a Ct value for specifically amplifying the free plasmid DNA containing the WPRE element.

4. The method according to claim 3, characterized in that In step (b), the copy number of the specifically amplified free plasmid DNA containing the WPRE element is obtained based on the Ct value of the specifically amplified free plasmid DNA containing the WPRE element.

5. The method according to any one of claims 2 to 4, characterized in that: In step (b), based on the Ct value of specifically amplifying RNA and free plasmid DNA in the recombinant lentiviral vector containing the WPRE element, and the Ct value of specifically amplifying free plasmid DNA containing the WPRE element, the total copy number of RNA and free plasmid DNA in the recombinant lentiviral vector, and the copy number of free plasmid DNA are calculated using formula Q2, respectively: Q2 = total copy number of RNA and free plasmid DNA or copy number of free plasmid DNA = (number of nucleic acid copies of the sample in each reaction well × 1000 × dilution factor) / amount of sample added to each reaction well; Among them, the number of nucleic acid copies of the sample in each reaction well = 10^ （aX+b） , Wherein, X: the average Ct value obtained by testing the samples; a: coefficient obtained by standard curve fitting; b: The intercept obtained by standard curve fitting.

6. The method according to claim 5, characterized in that In step (b), based on the total copy number of RNA and free plasmid DNA in the recombinant lentiviral vector, and the copy number of free plasmid DNA, the formula Q3 is used to calculate to obtain the copy number of RNA in the recombinant lentiviral vector in the sample to be tested: Q3 = the total copy number of RNA and free plasmid DNA in the recombinant lentiviral vector minus the copy number of free plasmid DNA.

7. The method of any one of claims 2 to 4, wherein the nucleotide sequences of the upstream primer and the downstream primer are: (i) SEQ ID NO: 1 and SEQ ID NO: 2, respectively; (ii) SEQ ID NO: 3 and SEQ ID NO: 4, respectively; or (iii) SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

8. The method of claim 5, wherein the nucleotide sequences of the upstream primer and the downstream primer are: (i) SEQ ID NO: 1 and SEQ ID NO: 2, respectively; (ii) SEQ ID NO: 3 and SEQ ID NO: 4, respectively; or (iii) SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

9. The method of claim 6, wherein the nucleotide sequences of the upstream primer and the downstream primer are: (i) SEQ ID NO: 1 and SEQ ID NO: 2, respectively; (ii) SEQ ID NO: 3 and SEQ ID NO: 4, respectively; or (iii) SEQ ID NO: 5 and SEQ ID NO: 6, respectively.

10. The method according to claim 1, characterized in that Positive controls are also included in the methods.

11. The method according to claim 1, characterized in that The concentration of the lentiviral vector in the sample to be tested is 5x10 5 -5x10 9 Tu / ml.

12. The method according to claim 11, characterized in that The concentration of the lentiviral vector in the test sample is 1×10 6 -8x10 8 Tu / ml.

13. The method according to claim 11, characterized in that The concentration of the lentiviral vector in the sample to be tested is 5x10 6 -5x10 8 Tu / ml.

Images