Bisulfite-free genome-wide methylation profiling

Abstract

The present disclosure provides a method for cost-effective bisulfite-free identification of the position of one or more of 5-methylcytosine, 5-hydroxymethylcytosine, 5-carboxylcytosine, and 5-formylcytosine in DNA, including whole genomic DNA. The method described herein is based on, for example, converting modified cytosine (5mC, 5hmC, 5fC, 5caC) to dihydrouracil (DHU) by TET-assisted pyridine borane treatment, followed by cleavage of the DHU with an endonuclease and identification of the cleavage site, which corresponds to the position of the modified cytosine.

Description

Technical Field

[0001] The present disclosure provides methods for genome-wide identification of the positions of 5-methylcytosine, 5-hydroxymethylcytosine, 5-carboxycytosine and / or 5-formylcytosine. Background Art

[0002] 5-Methylcytosine (5mC) and 5-hydroxymethylcytosine (5hmC) are two major epigenetic marks present in mammalian genomes. 5hmC is generated from 5mC by ten-eleven translocation (TET) family dioxygenases. Tet can further oxidize 5hmC to 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC), which are much less abundant in mammalian genomes compared to 5mC and 5hmC (10 to 100 times less abundant than 5hmC). Together, 5mC and 5hmC play crucial roles in a wide range of biological processes, from gene regulation to normal development. Aberrant DNA methylation and hydroxymethylation are associated with various diseases and are recognized hallmarks of cancer. Therefore, the determination of 5mC and 5hmC in DNA sequences is not only important for basic research but also valuable for clinical applications including diagnosis and treatment.

[0003] 5fC and 5caC are two final oxidation derivatives of 5mC and can be converted to unmodified cytosine by thymine DNA glycosylase (TDG) in the base excision repair pathway. Therefore, 5fC and 5caC are two important key intermediates in the active demethylation process that plays an important role in embryonic development. 5fC and 5caC are found in these cases and can serve as indicators of almost complete demethylation of 5mC. 5fC and 5caC can also play additional functions, such as binding to specific proteins and affecting the rate and specificity of RNA polymerase II.

[0004] The gold standard and most widely used method for DNA methylation and hydroxymethylation analysis is currently bisulfite sequencing (BS), as well as its derivative methods such as Tet-assisted bisulfite sequencing (TAB-Seq) and oxidative bisulfite sequencing (oxBS). Similarly, bisulfite sequencing is the most well-established method for determining genome-wide DNA methylation. All of these methods employ bisulfite treatment to convert unmethylated cytosines to uracil while keeping 5mC and / or 5hmC intact. By performing PCR amplification on bisulfite-treated DNA (which reads uracil as thymine), the modification information of each cytosine can be inferred at single-base resolution (where the transition from C to T provides the position of unmethylated cytosine). However, bisulfite sequencing has at least two major disadvantages. First, bisulfite treatment is a harsh chemical reaction that causes more than 90% of DNA to degrade due to depurination under the required acidic and thermal conditions. This degradation severely limits its application in low-input samples (such as clinical samples including circulating cell-free DNA) and single-cell sequencing. Secondly, bisulfite sequencing relies on the complete conversion of unmodified cytosine to thymine. Unmodified cytosine accounts for about 95% of the total cytosine in the human genome. Converting all these positions to thymine will severely reduce sequence complexity, resulting in poor sequencing quality, low mapping rate, uneven genome coverage and increased sequencing costs. Since unmodified cytosine is not completely converted to thymine, bisulfite sequencing methods are also prone to false detection of 5mC and 5hmC.

[0005] Whole-genome base-resolution methylome sequencing allows the most comprehensive analysis of DNA methylation, however, considerable sequencing costs often limit its application. In order to reduce sequencing costs, reduced representation bisulfite sequencing (RRBS) can be used. However, it only covers a small portion of CpG sites in a specific sequence context and therefore cannot produce a comprehensive methylation picture. Therefore, there is a need for a way to achieve better mCpG coverage at a lower cost. Summary of the invention

[0006] The present disclosure provides a method for genome-wide base resolution methylome analysis. In an embodiment, the method identifies the position of one or more of 5-methylcytosine, 5-hydroxymethylcytosine, 5-carboxylcytosine and / or 5-formylcytosine in a DNA sample. In an embodiment, the DNA sample comprises the entire genome. The method described herein provides a DNA methylation and hydroxymethylation analysis involving a mild reaction of detecting modified cytosine at base resolution without affecting unmodified cytosine. Provided herein is an improved method for identifying 5mC and / or 5hmC by combining TET oxidation with reduction by borane derivatives (e.g., pyridine borane and 2-methylpyridine borane (pic-BH3)), the method being referred to herein as TAPS (TET-assisted pyridine borane sequencing) (Table 1). TAPS directly detects modifications with high sensitivity and specificity without affecting unmodified cytosine, and can be used to detect other cytosine modifications as described herein. It is non-destructive and can preserve up to 10kb of DNA. Compared to bisulfite sequencing, TAPS can have higher mapping rates, more uniform coverage, and lower sequencing costs, resulting in higher quality, more comprehensive, and cheaper methylome analysis. A variation of this method that does not employ an oxidation step was used to identify 5fC and / or 5caC as described herein.

[0007] Compared to whole genome bisulfite sequencing (WGBS), whole genome TAPS (wgTAPS) reduces sequencing costs by half. However, the cost of whole genome sequencing is still high for many projects, especially considering that 5mC and 5hmC only account for about 4% of all cytosine residues in mammalian genomes, so about 65%-80% of the reads generated by short-read whole genome sequencing do not contain any methylated CpG sites (mCpG). In order to reduce sequencing costs, degenerate representational bisulfite sequencing (RRBS) is a widely used method in which CpG-rich regions are enriched by restriction endonucleases before bisulfite treatment. However, it only covers a small portion of CpG sites in a specific sequence context and therefore cannot produce a comprehensive methylation picture. Therefore, there is a need for a way to achieve better mCpG coverage at a lower cost. In one embodiment, the present disclosure provides an improvement to the TAPS method—referred to herein as endonuclease enriched TAPS (eeTAPS)—which provides a new strategy for performing cost-effective whole genome methylation analysis at single CpG resolution. In other embodiments, the present disclosure provides improvements to variations of the TAPS method (eg, TAPSβ and CAPS) that can be used to detect 5mC, 5hmC, 5fC, and / or 5caC.

[0008] Therefore, the present disclosure provides a low-cost method for whole-genome identification of one or more of 5-methylcytosine, 5-hydroxymethylcytosine, 5-carboxylcytosine and / or 5-formylcytosine. The method described herein is based on: for example, converting modified cytosine (5mC, 5hmC, 5fC, 5caC) to dihydrouracil (DHU) by TET-assisted pyridine borane treatment, followed by cleavage of the DHU site with an endonuclease to generate DNA fragments, and then preparing the DNA fragments into a sequencing library. Unfragmented genomic DNA cannot be sequenced directly - only when modified cytosine is converted to DHU will the DNA be cut into DNA fragments, and then the DNA fragments can be sequenced, wherein each end of the fragment indicates the position of the modified cytosine. By sequencing the cut fragments, methylated cytosines in the original DNA sample can be identified with base resolution. In addition, since highly methylated cytosines tend to be cut more frequently than low-methylated sites, this method can be used for semi-quantitative DNA methylation.

[0009] In one aspect, the present disclosure provides a method for identifying 5mC or 5hmC in a DNA sample, comprising the following steps:

[0010] a. providing a DNA sample comprising a target DNA having 5mC and / or 5hmC;

[0011] b. Modifying DNA, comprising the following steps:

[0012] i. converting 5mC and 5hmC in a DNA sample into 5-carboxycytosine (5caC) and / or 5fC; and

[0013] ii. converting 5caC and / or 5fC into DHU to provide a modified DNA sample comprising a modified target DNA; and

[0014] c. cleavage of the modified target DNA;

[0015] d. adding an adaptor DNA molecule to the cleaved modified target DNA; and

[0016] e. detecting the sequence of the modified target DNA;

[0017] The presence of a cleavage site provides the location of 5mC or 5hmC in the target DNA.

[0018] In another aspect, the present disclosure provides a method for identifying 5-methylcytosine (5mC) in a DNA sample, comprising the following steps:

[0019] a. Providing a DNA sample containing a target DNA;

[0020] b. Modifying the DNA sample, comprising the following steps:

[0021] i. Adding blocking groups to 5-hydroxymethylcytosine (5hmC) in DNA samples;

[0022] ii. converting 5mC in the DNA sample into 5-carboxycytosine (5caC) and / or 5-formylcytosine (5fC); and

[0023] iii. converting 5caC and / or 5fC into dihydrouracil (DHU) to provide a modified DNA sample comprising a modified target DNA;

[0024] c. cleavage of the modified target DNA;

[0025] d. adding an adaptor DNA molecule to the cleaved modified target DNA; and

[0026] e. detecting the sequence of the modified target DNA;

[0027] The presence of a cleavage site provides the location of 5mC in the target DNA.

[0028] In another aspect, the present disclosure provides a method for identifying 5mC or 5hmC in a DNA sample, comprising the following steps:

[0029] a. providing a DNA sample comprising a target DNA having 5mC and / or 5hmC;

[0030] b. Modifying DNA, comprising the following steps:

[0031] i. converting 5mC and 5hmC in a DNA sample into 5-carboxycytosine (5caC) and / or 5fC; and

[0032] ii. converting 5caC and / or 5fC into DHU to provide a modified DNA sample comprising a modified target DNA; and

[0033] c. cleavage of the modified target DNA;

[0034] d. adding an adaptor DNA molecule to the cleaved modified target DNA; and

[0035] e. detecting the sequence of the modified target DNA;

[0036] The presence of a cleavage site provides the location of 5mC or 5hmC in the target DNA.

[0037] In another aspect, the present disclosure provides a method for identifying 5mC and identifying 5hmC in a DNA sample, comprising the steps of:

[0038] a. Identifying 5mC in a DNA sample, comprising the following steps:

[0039] i. providing a first DNA sample comprising a target DNA having 5mC and / or 5hmC;

[0040] ii. modifying the DNA in the first sample, comprising the following steps:

[0041] 1. Adding a blocking group to 5-hydroxymethylcytosine (5hmC) in the first DNA sample;

[0042] 2. Converting 5mC in the first DNA sample into 5caC and / or 5fC; and

[0043] 3. converting 5caC and / or 5fC into DHU to provide a modified first DNA sample comprising a modified target DNA;

[0044] iii. cleavage of the modified target DNA;

[0045] iv. adding adapter DNA molecules to the cleaved modified target DNA; and

[0046] v. Detecting the sequence of the modified target DNA; wherein the presence of the cleavage site provides the location of 5mC in the target DNA.

[0047] b. Identifying 5mC or 5hmC in a DNA sample, comprising the following steps:

[0048] i. providing a second DNA sample comprising a target DNA having 5mC and / or 5hmC;

[0049] ii. modifying the DNA in the second sample, comprising the following steps:

[0050] 1. converting 5mC and 5hmC in the second DNA sample into 5caC and / or 5fC; and

[0051] 2. converting 5caC and / or 5fC into DHU to provide a modified second DNA sample comprising a modified target DNA;

[0052] iii. cleavage of the modified target DNA;

[0053] iv. adding adapter DNA molecules to the cleaved modified target DNA; and

[0054] v. detecting the sequence of the modified target DNA from the second sample; wherein the presence of the cleavage site provides the location of 5mC or 5hmC in the target DNA; and

[0055] c. Comparing the results of steps (a) and (b), wherein the cleavage site present in step (b) but not in step (a) provides the location of 5hmC in the target DNA.

[0056] In embodiments, the blocking group added to 5hmC in the DNA sample is a sugar. In embodiments, the sugar is a naturally occurring sugar or a modified sugar, such as glucose or a modified glucose. In embodiments, the blocking group is added to 5hmC by contacting the DNA sample with UDP (e.g., UDP-glucose) linked to a sugar or UDP linked to a modified glucose in the presence of a glucosyltransferase (e.g., T4 bacteriophage β-glucosyltransferase (βGT) and T4 bacteriophage α-glucosyltransferase (αGT) and derivatives and analogs thereof).

[0057] In embodiments, the steps of converting 5mC in a DNA sample to 5caC and / or 5fC and the steps of converting 5mC and 5hmC in a DNA sample to 5caC and / or 5fC each include contacting the DNA sample with a ten-eleven translocation contact (TET) enzyme. In further embodiments, the TET enzyme is human TET1, TET2, and TET3; mouse Tet1, Tet2, and Tet3; Naegleria TET (NgTET); one or more of Coprinopsis cinerea (CcTET) and derivatives or analogs thereof. In embodiments, the TET enzyme is NgTET or a derivative thereof. In embodiments, the TET enzyme is mTet1 (mTet1CD) or a derivative thereof. In other embodiments, the TET enzyme is human TET2 (hTET2) or a derivative thereof.

[0058] In another aspect, the present disclosure provides a method for identifying 5caC or 5fC in a DNA sample, comprising the following steps:

[0059] a. Providing a DNA sample comprising a target DNA having 5caC and / or 5fC;

[0060] b. converting 5caC and 5fC into DHU to provide a modified DNA sample comprising a modified target DNA;

[0061] c. cleavage of the modified target DNA;

[0062] d. adding an adaptor DNA molecule to the cleaved modified target DNA; and

[0063] e. detecting the sequence of the modified target DNA;

[0064] The presence of a cleavage site provides the location of 5caC or 5fC in the target DNA.

[0065] In another aspect, the present disclosure provides a method for identifying 5caC in a DNA sample, comprising the steps of:

[0066] a. providing a DNA sample comprising a target DNA having 5caC;

[0067] b. Adding blocking groups to 5fC in the DNA sample;

[0068] c. converting 5caC into DHU to provide a modified DNA sample comprising a modified target DNA;

[0069] d. cleavage of the modified target DNA;

[0070] e. adding an adapter DNA molecule to the cleaved modified target DNA; and

[0071] f. detecting the sequence of the modified target DNA;

[0072] The presence of the cleavage site provides the location of 5caC in the target DNA.

[0073] In an embodiment, adding a blocking group to 5fC in a DNA sample comprises contacting the DNA with an aldehyde-reactive compound including, for example, hydroxylamine derivatives (such as O-ethylhydroxylamine), hydrazine derivatives, and hydrazide derivatives.

[0074] In another aspect, the present disclosure provides a method for identifying 5fC in a DNA sample, comprising the following steps:

[0075] a. Providing a DNA sample comprising a target DNA having 5fC;

[0076] b. Adding a blocking group to 5caC in the DNA sample;

[0077] c. converting 5fC into DHU to provide a modified DNA sample comprising a modified target DNA;

[0078] d. cleavage of the modified target DNA;

[0079] e. adding an adapter DNA molecule to the cleaved modified target DNA; and

[0080] f. detecting the sequence of the modified target DNA;

[0081] The presence of a cleavage site provides the location of 5fC in the target DNA.

[0082] In an embodiment, the step of adding a blocking group to 5caC in a DNA sample comprises contacting the DNA sample with a carboxylic acid derivatization reagent including, for example, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) and (ii) an amine such as ethylamine, hydrazine or a hydroxylamine compound.

[0083] In another aspect, the present disclosure provides a method for identifying 5hmC in a DNA sample, comprising the following steps:

[0084] a. providing a DNA sample comprising a target DNA having 5hmC;

[0085] b. Modifying the DNA in the sample, comprising the following steps:

[0086] i. Converting 5hmC in DNA samples into 5caC and / or 5fC; and

[0087] ii. converting 5caC and / or 5fC into dihydrouracil (DHU) to provide a modified DNA sample comprising a modified target DNA;

[0088] c. cleavage of the modified target DNA;

[0089] d. adding an adaptor DNA molecule to the cleaved modified target DNA; and

[0090] e. detecting the sequence of the modified target DNA;

[0091] The presence of the cleavage site provides the location of 5hmC in the target DNA.

[0092] In an embodiment, the step of converting 5hmC to 5caC and / or 5fC comprises contacting the DNA sample with an oxidizing agent. In a further embodiment, the oxidizing agent is potassium perruthenate, Cu(II) / TEMPO, potassium ruthenate, or manganese oxide.

[0093] In embodiments, DNA sample comprises genomic DNA. In embodiments, DNA sample comprises picogram amount of DNA. In embodiments, DNA sample comprises about 1pg to about 900pg DNA, about 1pg to about 500pg DNA, about 1pg to about 100pg DNA, about 1pg to about 50pg DNA, about 1pg to about 10pg DNA, about 1pg to about 10pg DNA, less than about 200pg, less than about 100pg DNA, less than about 50pg DNA, less than about 20pg DNA and less than about 5pg DNA. In other embodiments, DNA sample comprises nanogram amount of DNA. In embodiments, DNA sample contains about 1 to about 500ng DNA, about 1 to about 200ng DNA, about 1 to about 100ng DNA, about 1 to about 50ng DNA, about 1ng to about 10ng DNA, about 1ng to about 5ng DNA, less than about 100ng DNA, less than about 50ng DNA, less than about 5ng DNA or less than about 2ng DNA. In embodiments, DNA sample comprises circulating cell-free DNA (cfDNA). In embodiments, DNA sample comprises microgram amount of DNA.

[0094] In an embodiment, the step of converting 5caC and / or 5fC to DHU comprises contacting the DNA sample with a reducing agent including, for example, pyridine borane, 2-methylpyridine borane (pic-BH3), tert-butylamine borane, borane, sodium borohydride, sodium cyanoborohydride, and sodium triacetoxyborohydride. In a preferred embodiment, the reducing agent is pic-BH3 and / or pyridine borane.

[0095] In an embodiment, the step of cutting the modified target DNA comprises specifically cutting the modified target DNA containing DHU by contacting the modified DNA sample containing the modified target DNA with one or more endonucleases, wherein the endonucleases specifically cut the modified target DNA due to the presence of DHU. In an embodiment, the endonuclease is a bifunctional DNA endonuclease having DNA N-glycosylase and AP lyase activity, including, for example, Tma endonuclease III, endonuclease VIII, formamidopyrimidine DNA glycosylase (Fpg) and / or hNEIL1. In an embodiment, a uracil-specific excision reagent (USER) is used to cut the modified target DNA. The USER enzyme comprises a combination of uracil DNA glycosylase (UDG) and endonuclease VIII. Other enzymes that can be used alone or in combination to cleave the modified target DNA are apurinic / apyrimidinic endonuclease 1 (APE 1), UDG, endonuclease III, Tma endonuclease III, Tth endonuclease IV, endonuclease V, endonuclease VIII, Fpg and / or hNEIL1.

[0096] In embodiments, the above method further comprises a step of selecting the size of the modified target DNA to be cut. In embodiments, the above method further comprises a step of amplifying the number of copies of the modified target DNA. In embodiments, the amplification step is performed before the step of detecting the sequence of the modified target DNA. The step of amplifying the number of copies of the modified target DNA can be accomplished by performing polymerase chain reaction (PCR), primer extension and / or cloning.

[0097] In embodiments, the step of determining the sequence of the modified target DNA comprises chain termination sequencing, microarray, high throughput sequencing and restriction enzyme analysis. In embodiments, the step of detecting the sequence of the modified target DNA comprises a next generation sequencing method.

[0098] In one aspect, the present disclosure provides a method for cutting a modified target DNA, the method comprising: contacting a modified target DNA comprising one or more DHUs (i.e., DHU residues) with one or more endonucleases that cut the modified target DNA at or near the one or more DHUs. The one or more endonucleases can be, for example, any type of endonuclease described herein or a combination thereof. In an embodiment, the one or more DHUs in the modified target DNA are derived from 5mC and / or 5hmC, for example, by the methods described herein. In an embodiment, the one or more DHUs in the modified target DNA are derived from 5caC and / or 5fC, for example, by the methods described herein.

[0099] In an embodiment, the method further comprises, prior to the contacting step, modifying the target DNA comprising 5mC and / or 5hmC, the modification comprising the following steps: (i) converting 5mC and 5hmC in the target DNA into 5-carboxycytosine (5caC) and / or 5-formylcytosine (5fC), for example, by the method described herein; and (ii) converting 5caC and / or 5fC into dihydrouracil (DHU), for example, by the method described herein, to provide a modified target DNA.

[0100] In an embodiment, the method further comprises, prior to the contacting step, modifying the target DNA comprising 5mC and 5hmC, the modification comprising the steps of: (i) adding a blocking group to 5hmC in the target DNA, for example, by the methods described herein; (ii) converting 5mC in the target DNA into 5-carboxycytosine (5caC) and / or 5-formylcytosine (5fC), for example, by the methods described herein; and (iii) converting 5caC and / or 5fC into dihydrouracil (DHU), for example, by the methods described herein, to provide a modified target DNA.

[0101] In an embodiment, the method further comprises, prior to the contacting step, modifying the target DNA comprising 5caC and / or 5fC, the modification comprising, for example, a step of converting 5caC and / or 5fC to dihydrouracil (DHU) by the method described herein to provide a modified target DNA.

[0102] In an embodiment, the method further comprises, prior to the contacting step, modifying the target DNA comprising 5caC and / or 5fC, the modification comprising the steps of: (i) adding a blocking group to 5fC in the target DNA, for example, by the method described herein; and (ii) converting 5caC to dihydrouracil (DHU), for example, by the method described herein, to provide a modified target DNA.

[0103] In an embodiment, the method further comprises, prior to the contacting step, modifying the target DNA comprising 5caC and / or 5fC, the modification comprising the steps of: (i) adding a blocking group to 5caC in the target DNA, for example, by the method described herein; and (ii) converting 5fC to dihydrouracil (DHU), for example, by the method described herein, to provide a modified target DNA.

[0104] In an embodiment, the method further comprises, prior to the contacting step, modifying the target DNA comprising 5mC and / or 5hmC, the modification comprising the steps of: (i) converting 5mC in the target DNA into 5-carboxycytosine (5caC) and / or 5-formylcytosine (5fC), for example, by the method described herein; and (ii) converting 5caC and / or 5fC into dihydrouracil (DHU), for example, by the method described herein, to provide a modified target DNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0106] Figure 1 .Screening of borane-containing compounds. Borane-containing compounds were screened for the conversion of 5caC to DHU in 11mer oligonucleotides ("oligos"), where the conversion rate was estimated by MALDI. 2-Methylpyridine borane (pic-borane), borane pyridine and tert-butylamine borane can completely convert 5caC to DHU, while ethylenediamine borane and dimethylamine borane have a conversion rate of about 30%. No detectable product was measured in the case of dicyclohexylamine borane, morpholine borane, 4-methylmorpholine borane and trimethylamine borane (nd). Other reducing agents such as sodium borohydride and sodium tri(acetoxy)borohydride decompose rapidly in acidic media and lead to incomplete conversion. Sodium cyanoborohydride was not used because sodium cyanoborohydride may form hydrogen cyanide under acidic conditions. Pic-borane and pyridine borane were selected because of complete conversion, low toxicity and high stability.

[0107] Figure 2 A to Figure 2 B. Pic-borane reaction on DNA oligonucleotides. (A) MALDI characterization of 11mer model DNA containing 5caC treated with pic-borane. The calculated mass (m / z) is shown above each graph and the observed mass is shown to the left of the peak. (B) The conversion of dC and various cytosine derivatives was quantified by HPLC-MS / MS. Data are shown as mean ± SD of three replicates.

[0108] Figure 3 A to Figure 3 B. Single nucleoside pic-borane reaction. 1 H and 13 The C NMR results are consistent with previous reports on 2′-deoxy-5,6-dihydrouridine (I. Aparici-Espert et al., J. Org. Chem. 81, 4031-4038 (2016)). (A) Mononucleoside pic-borane reaction products 1 H NMR (MeOH-d4, 400MHz) chart. δppm: 6.28 (t, 1H, J = 7Hz), 4.30 (m, 1H), 3.81 (m, 1H), 3.63 (m, 2H), 3.46 (m, 2H), 2.65 (t, 2H, J = 6Hz), 2.20 (m, 1H), 2.03 (m, 1H). (B) Mononucleoside pic-borane reaction products 13 C NMR (MeOH-d4, 400 MHz) chart. δ ppm: 171.56 (CO), 153.54 (CO), 85.97 (CH), 83.86 (CH), 70.99 (CH), 61.92 (CH2), 36.04 (CH2), 35.46 (CH2), 30.49 (CH2).

[0109] Figure 4 A to Figure 4 B. Diagrams showing (A) the proposed mechanism for the borane conversion of 5caC to DHU and the borane reaction of 5caC to DHU; and (B) the proposed mechanism for the borane conversion of 5fC to DHU and the borane reaction of 5fC to DHU.

[0110] Figure 5 A to Figure 5 B. (A) Diagram showing that the TAPS method converts both 5mC and 5hmC to DHU (DHU acts as thymine after replication). (B) Overview of the TAPS, TAPSβ, and CAPS methods.

[0111] Figure 6.MALDI characterization of model DNA oligonucleotides containing 5fC and 5caC treated with pic-borane with or without blocking 5fC and 5caC. 5fC and 5caC are converted to dihydrouracil (DHU) by pic-BH3. 5fC is blocked by hydroxylamine derivatives such as O-ethylhydroxylamine (EtONH2) that can become an oxime and prevent pic-borane conversion. 5caC is blocked by ethylamine by EDC conjugation and converted to an amide, which blocks the conversion caused by pic-borane. The calculated MS (m / z) is shown above each figure, and the observed MS is shown to the left of the peak.

[0112] Figure 7 MALDI characterization of model DNA oligonucleotides containing 5mC and 5hmC treated with KRuO4 and pic-borane with or without blocking 5hmC. 5hmC can be blocked with glucose by βGT and converted to 5gmC. Pic-borane is unable to convert 5mC, 5hmC, and 5gmC. 5hmC can be oxidized to 5fC by KRuO4 and then converted to DHU by pic-borane. The calculated MS (m / z) is shown above each graph, and the observed MS is shown to the left of the peak.

[0113] Figure 8 A to Figure 8 B. Restriction enzyme digestion demonstrates that TAPS can effectively convert 5mC to T. (A) Schematic representation of restriction enzyme digestion assay used to confirm sequence changes caused by TAPS. (B) TaqαI-digestion test used to confirm conversion of C to T caused by TAPS. TAPS was performed on a 222 bp model DNA with a TaqαI restriction site and containing 5 fully methylated CpG sites (5mC) and its unmethylated control (C). The PCR-amplified 222 bp model DNA can be cut with TaqαI into fragments of ~160 bp and ~60 bp, as shown in 5mC, C, and C TAPS. After TAPS of the methylated DNA, the T(mC)GA sequence was converted to TTGA and was no longer cut by TaqαI digestion, as shown in the 5mC-TAPS lane.

[0114] Fig. 9 A to Fig. 9B. TAPS performed on 222 bp model DNA and mESC gDNA. (A) Sanger sequencing results of 222 bp model DNA containing 5 fully methylated CpG sites and its unmethylated control before (5mC, C) and after (5mC TAPS, C TAPS) TAPS. The TAPS method converts only 5mC to T. (B) HPLC-MS / MS quantification of relative modification levels in mESCs gDNA control after NgTET1 oxidation and after pic-borane reduction. Data are shown as mean ± SD of three replicates.

[0115] Fig.10 A to Fig.10 B. TAPS does not cause significant DNA degradation compared to bisulfite. Agarose gel images of 222 bp unmethylated DNA, 222 bp methylated DNA, and mESC gDNA (A) before and (B) after cooling in an ice bath. No detectable DNA degradation was observed after TAPS, and the DNA remained double-stranded and could be visualized without cooling. Bisulfite conversion caused degradation, the DNA became single-stranded, and could only be visualized after cooling on ice. (C) Agarose gel images of mESC gDNA of various fragment lengths treated with TAPS and bisulfite before (left) and after (right) cooling on ice. The DNA after TAPS remained double-stranded and could be visualized directly on the gel. Bisulfite treatment caused more damage and fragmentation to the sample, the DNA became single-stranded, and could only be visualized after cooling on ice. As Fig.15 As shown, TAPS conversion of all gDNA was complete regardless of fragment length. (D) Agarose gel imaging of 222 bp model DNA before and after TAPS (three independent replicates) shows no detectable degradation after the reaction.

[0116] Fig.11 Comparison of amplification and melting curves between model DNA before and after TAPS. qPCR assays showed minor differences in amplification curves with respect to model DNA before and after TAPS. The melting curve of methylated DNA (5mC) shifted to lower temperatures after TAPS, indicating a possible C to T transition with a lowered Tm, while there was no shift for unmethylated DNA (C).

[0117] Fig.12.Complete C to T conversion induced after TAPS, TAPSβ and CAPS as confirmed by Sanger sequencing. Model DNA containing singly methylated and singly hydroxymethylated CpG sites was prepared as described herein. TAPS conversion was performed according to the NgTET1 oxidation and pyridine borane reduction protocol as described herein. TAPSβ conversion was performed according to the 5hmC blocking, NgTET1 oxidation and pyridine borane reduction protocol. CAPS conversion was performed according to the 5hmC oxidation and pyridine borane reduction protocol. After conversion, 1 ng of the converted DNA sample was PCR amplified with Taq DNA polymerase and processed for Sanger sequencing. TAPS converted both 5mC and 5hmC to T. TAPSβ selectively converted 5mC, while CAPS selectively converted 5hmC. None of the three methods caused conversion of unmodified cytosine and other bases.

[0118] Fig.13 A to Fig.13 B. (A) TAPS is compatible with a variety of DNA and RNA polymerases and induces complete C to T conversion as demonstrated by Sanger sequencing. Model DNA and primer sequences containing methylated CpG sites for polymerase testing are described herein. After TAPS treatment, 5mC is converted to DHU. KAPA HiFi uracil plus polymerase, Taq polymerase, and Vent exo-polymerase will read DHU as T, thus inducing complete C to T conversion after PCR. Alternatively, primer extension is performed with biotinylated primers and isothermal polymerases (including Klenow fragment, Bst DNA polymerase, and phi29 DNA polymerase). The newly synthesized DNA strands are separated by Dynabeads MyOne Streptavidin C1, and then PCR amplified by Taq polymerase and processed for Sanger sequencing. T7 RNA polymerase can efficiently bypass DHU and insert adenine opposite the DHU site, as demonstrated by RT-PCR and Sanger sequencing. (B) Certain other commercial polymerases are not efficient in amplifying DNA containing DHU. After TAPS treatment, 5mC is converted to DHU. KAPA HiFi uracil plus polymerase and Taq polymerase will read DHU as T, thus inducing a complete C to T conversion. For certain other commercial polymerases including KAPA HiFi polymerase, Pfu polymerase, Phusion polymerase, and NEBQ5 polymerase (not shown), low or no C to T conversion was observed.

[0119] Fig.14.DHU showed no PCR bias compared to T and C. Model DNA containing one DHU / U / T / C modification was synthesized using the corresponding DNA oligonucleotides as described herein. Based on qPCR reactions performed with 1:10 serial dilutions of model DNA input (from 0.1 pg to 1 ng, each qPCR experiment was run in triplicate), a standard curve for each model DNA with DHU / U / T / C modification was plotted. The regression slope between the logarithmic concentration (ng) value and the average Ct value was calculated by the SLOPE function in Excel. PCR efficiency was calculated using the following formula: Efficiency % = (10^(-1 / Slope)-1)*100%. The amplification coefficient was calculated using the following formula: Amplification coefficient = 10^(-1 / slope). The PCR efficiency of model DNA with DHU or T or C modifications was almost the same, indicating that DHU can be read through as a regular base and does not cause PCR bias.

[0120] Fig.15 A to Fig.15 B. TAPS completely converts 5mC to T regardless of DNA fragment length. (A) Agarose gel images of TaqαI digestion assays confirm that 5mC is completely converted to T in all samples regardless of DNA fragment length. A 194 bp model sequence from the λ genome was PCR amplified after TAPS and digested with TaqαI enzyme. PCR products amplified from untransformed samples can be cleaved, while products amplified from TAPS-treated samples remain intact, indicating loss of restriction sites and therefore complete conversion of 5mC to T. (B) The percentage of conversion of C to T was quantitatively estimated by gel bands and is shown as 100% for all DNA fragment lengths tested.

[0121] Fig.16 .Conversion and false positives for different TAPS conditions. The combination of mTet1 and pyridine borane achieved the highest conversion of methylated C (96.5%, calculated using fully CpG methylated λDNA) and the lowest conversion of unmodified C (0.23%, calculated using 2kb unmodified spike-in) compared to other conditions using NgTET1 or pic-borane. The conversion rates + / - SE for all tested cytosine sites are shown above the bars.

[0122] Fig.17 A to Fig.17 B. Conversion rates for short incorporations. (A) 120mer-1 and (B) 120mer-2 containing 5mC and 5hmC. Nearly complete conversion was achieved at the 5mC and 5hmC sites on both chains. The actual sequence with modification status is shown at the top and bottom.

[0123] Fig.18 A to Fig.18 B. Improvement in sequencing quality of TAPS over whole genome bisulfite sequencing (WGBS). (A) Conversion rates of 5mC and 5hmC in TAPS-treated DNA. Left: Synthetic spike-ins (CpNs) that are methylated or hydroxymethylated at known positions. (B) False positive rate of TAPS from unmodified 2kb spike-ins. (C) Total run time of TAPS and WGBS when processing 1 million simulated reads on one core of an Intel Xeon CPU. (D) The fraction of all sequenced read pairs (readpairs) (after trimming) mapped to the genome. (E) Sequencing quality scores for each base of the first and second reads in all sequenced read pairs as reported by Illumina BaseSpace. Top: TAPS. Bottom: WGBS.

[0124] Fig.19 A to Fig.19 B.TAPS results in more uniform coverage and fewer uncovered positions than WGBS. Comparison of coverage depth between WGBS and TAPS (A) across all bases and (B) CpG sites calculated for both chains. For "TAPS (downsampling)", random reads from all mapped TAPS reads were selected so that the median coverage matched that of WGBS. Positions with coverage exceeding 50× are shown in the last box.

[0125] Fig. 20 Distribution of modification levels across all chromosomes. Average modification levels in 100 kb windows along mouse chromosomes, weighted by CpG coverage and smoothed using a Gaussian weighted moving average filter with a window size of 10.

[0126] Fig.21 A to Fig.21B. Comparison of whole genome methylome measurements by TAPS and WGBS. (A) Average sequencing coverage depth in all mouse CpG islands (binned into 20 windows) and 4kbp flanking regions (binned into 50 windows of equal size). To account for differences in sequencing depth, all mapped TAPS reads were downsampled to match the median of WGBS reads mapped in the entire genome. (B) CpG sites covered by at least three reads generated by TAPS alone, both TAPS and WGBS, or WGBS alone. (C) The number of CpG sites covered by at least three reads and with a modification level>0.1 detected by TAPS alone, TAPS and WGBS, or WGBS alone. (D) Chromosome distribution examples of modification levels (in %) for TAPS and WGBS. The average fraction of modified CpGs per 100kb window along mouse chromosome 4 smoothed using a Gaussian weighted moving average filter with a window size of 10. (E) Heatmap representing the number of CpG sites covered by at least 3 reads in both TAPS and WGBS, broken down by modification level as measured by each method. To improve contrast, the first bin containing CpGs that were not modified in both methods was excluded from the color scale and is indicated with an asterisk.

[0127] Fig. 22 .Modification levels around CpG islands. Average modification levels in CpG islands (binned into 20 windows) and 4 kbp flanking regions (binned into 50 windows of equal size). Bins with coverage below 3 reads were ignored.

[0128] Fig.23 A to Fig.23 B.TAPS shows a smaller coverage modification bias than WGBS. All CpG sites are binned according to their coverage, and the mean (circle) and median (triangle) modification values ​​are shown in each bin for WGBS (A) and TAPS (B). CpG sites covered by more than 100 reads are shown in the last bin. Lines represent linear fits through the data points.

[0129] Fig.24 A to Fig.24C. Low-input gDNA and cell-free DNA TAPS prepared with dsDNA and ssDNA library preparation kits. (A) Sequencing libraries were successfully constructed using as little as 1 ng of mouse embryonic stem cell (mESC) genomic DNA (gDNA) using the dsDNA library kit NEBNext Ultra II or the KAPA HyperPrep kit. The ssDNA library kit Accel-NGS Methyl-Seq kit was used to further reduce the input DNA amount to (B) 0.01 ng mESC gDNA or (C) 1 ng cell-free DNA.

[0130] Fig.25 A to Fig.25 B. Low input gDNA and cell-free DNA TAPS libraries prepared using the dsDNA KAPA HyperPrep library preparation kit. Sequencing libraries were successfully constructed using as little as 1 ng of (A) mESC gDNA and (B) cell-free DNA using the KAPA HyperPrep kit. Due to plasma nuclease digestion, cell-free DNA has a clear length distribution around 160 bp (nucleosome size). After library construction, it becomes ~300 bp, which is a clear band in (B).

[0131] Fig.26 A to Fig.26 D. High-quality cell-free DNA TAPS. (A) Conversion rate of 5mC in TAPS-treated cfDNA. (B) False positive rate in TAPS-treated cfDNA. (C) Fraction of all sequenced read pairs that uniquely map to the genome. (D) Fraction of all sequenced read pairs that uniquely map to the genome and remove PCR duplicate reads. CHG and CHH are non-CpG background.

[0132] Fig. 27 TAPS can detect genetic variation. Methylation (MOD, top row) and C to T SNPs (bottom row) show different base distribution patterns in the original top strand (OT) / original bottom strand (OB) (left column) and in the strands complementary to OT (CTOT) and OB (CTOB) (right column).

[0133] Fig.28 A to Fig.28C. Endonuclease cleavage of TAPS transformation products. (A) Results of digestion of mESC gDNA by different endonucleases before and after TAPS transformation. TAPS transformation introduces DHU to replace methylated cytosine. EndoVIII-Endonuclease VIII, Endo IV-Endonuclease IV, Tma Endo III-Endonuclease III, Tth EndoIV-Endonuclease IV; Nth Endo III-Nth Endonuclease III; Endo V-Endonuclease V. (B) Representative images of TAPS-treated mESC gDNA before USER digestion, after USER digestion, and after size selection. (C) Scatter plot showing methylation levels in all CpGs measured by both BS-seq and eeTAPS.

[0134] Fig.29 A to Fig.29 B. Endonuclease enrichment TAPS (eeTAPS). (A) Schematic diagram of eeTAPS (top) and computational measurement of CG methylation levels (bottom). 5-methylcytosine (mC) is first converted to dihydrouracil (DHU) using TAPS and then enriched by USER digestion. DNA fragments of selected size are then prepared into sequencing libraries and amplified by PCR. After read alignment, CG methylation levels are then calculated as the number of reads cut at each CpG site divided by the total number of reads cut at each CpG site or covering each CpG site. (B) Validation of eeTAPS on 4kb model DNA. The traces from top to bottom represent methylation levels measured in bisulfite sequencing (BS-seq), eeTAPS, and eeTAPS controls. In the eeTAPS control, USER enzyme was used to digest DNA in the absence of TAPS conversion.

[0135] Fig.30 A to Fig.30C. Comparison of wgTAPS, eeTAPS and rrTAPS for mESC DNA. (A) A diagram showing the genome fragmentation methods of wgTAPS, eeTAPS and rrTAPS. In wgTAPS, genomic DNA is randomly fragmented, while for eeTAPS and rrTAPS, fragmentation occurs specifically at methylated CpG (mCG) sites and CCGG sites, respectively. (B) A bar graph showing the percentage of overlap between the covered CpG sites covered by wgTAPS, eeTAPS and rrTAPS and different chromatin features. Chromatin features are defined in previous studies (20). (C) A heat map showing the correlation of methylation levels determined by wgTAPS and eeTAPS at single CpG resolution. For both wgTAPS and eeTAPS, methylation levels are divided into 16 groups. Colors show the number of CpGs within a specific interval. Only sites with wgTAPS coverage>5 are considered. The Pearson correlation coefficient is shown at the top of the figure. (D) Venn diagram showing the overlap of mCpG sites detected in wgTAPS, rrTAPS, and eeTAPS. CpG sites with methylation levels > the first quartile of methylation levels in wgTAPS and eeTAPS were defined as methylated CpGs. In rrTAPS, the same methylation cutoff as in wgTAPS was used. (CpG sites with methylation levels > 0.5 were defined as mCpGs in wgTAPS and rrTAPS, and CpG sites with methylation levels > 0.28 were defined as mCpGs in eeTAPS).

[0136] Fig.31 A to Fig.31 D. (A) Nucleotide frequencies at the ends of sequenced fragments. (B) Bar graph showing the distribution of distances between the cut site and its nearest CpG. (C) Heat map showing the correlation of methylation levels determined by wgTAPS and rrTAPS at single CpG resolution. For both wgTAPS and rrTAPS, methylation levels were divided into 16 groups. The colors show the number of CpGs within a specific interval. Only sites with wgTAPS coverage > 5 and rrTAPS coverage > 5 were considered. The Pearson correlation coefficient was 0.92. (D) Overlap of mCpG sites detected in replicates of eeTAPS, with replicates downsampled to the same depth to detect mCpGs.

[0137] Fig.32 A to Fig.32 F. Methylation profiling in different genomic features using eeTAPS.

[0138] (A) Methylation levels measured by eeTAPS (top line) and wgTAPS (bottom line) in chromosome 1 of mESC. A window of 100 kb was used, and the moving average was calculated using the movAvg2 function in R with bw=10. (B) Density plot showing the correlation of methylation levels between eeTAPS and wgTAPS in chromosome bins. The average methylation level in each bin was calculated using a window of 100 kb. The Pearson correlation coefficient is shown at the top of the figure. (C) Average methylation levels across CpG islands (CGIs) and 4 kb flanking regions for eeTAPS and wgTAPS. (D) Density plot showing the correlation of methylation levels between eeTAPS and wgTAPS in CpG islands. The Pearson correlation coefficient is shown at the top of the figure. (E) Density plot showing the correlation of methylation levels between eeTAPS and wgTAPS in different chromatin features. Chromatin features were previously defined using histone markers (Bogu, GK, Vizan, P., Stanton, LW, Beato, M., Di Croce, L. and Marti-Renom, MA (2015) Chromatin and RNA Maps Reveal Regulatory Long Noncoding RNAs in Mouse. Mol Cell Biol, 36, 809-819) and are also shown in (F). Pearson correlation coefficients are shown at the top of the figure. (F) Box plot showing the distribution of methylation levels across all chromatin features as measured by eeTAPS (bottom bars) and wgTAPS (top bars).

[0139] Fig.33 Average methylation distribution around the transcription start site (TSS) in wgTAPS and eeTAPS. Genes were classified according to their expression levels based on the GSE72855 dataset.

[0140] Fig.34 A to Fig.34F. eeTAPS analysis of low input samples. (A) The number of mCpGs (identified by wgTAPS) detected using eeTAPS using 1ng, 10ng, 50ng, and 200ng mESC gDNA inputs. For 200ng mESC, the reads were downsampled to 2x to match the sequence depth of the low input samples. mCpGs were designated using the following criteria: in eeTAPS, methylation levels>0.28 and cut counts>1 were designated as mCpGs; in wgTAPS, methylation levels>0.5 were designated as mCpGs. The percentages shown above the bars are the percentages of mCpGs detected (mCpGs detected in wgTAPS are defined as true values). (B) A heat map showing the distribution of methylation across the mouse genome measured by eeTAPS when using different input levels. Each chromosome is divided into a window of 100kb, represented by a heat map row. Methylation levels are defined as the number of methylated CpG sites divided by the total number of covered CpG sites in each 100kb window. (C) shows a density plot of the correlation of methylation between low input samples and 200ng input samples. As shown in (B), methylation levels were calculated in a 100kb window across the mouse genome. Each figure shows the Pearson correlation coefficient.

[0141] Fig.35 A to Fig.35 B. eeTAPS sequencing depth analysis. (A) Number of methylated CpGs detected when readings were sampled from 1 to 10x sequencing depth. The percentages shown above are the percentages of mCpGs detected by eeTAPS (mCpGs detected in wgTAPS are defined as true values). (B) Correlation of methylation in a 100kb window across the entire mouse genome (top line) and CpG islands (CGIs) (bottom line) when readings were sampled from 1 to 10x sequencing depth. DETAILED DESCRIPTION

[0142] The present disclosure provides a bisulfite-free base resolution method for identifying cytosine modification in target DNA in DNA samples (including whole genome DNA). The method described herein includes an improvement to the method described in PCT / US2019 / 012627 (which is incorporated herein by reference as a whole), and the PCT / US2019 / 012627 describes a method called TAPS, which includes a bisulfite-free base resolution method for detecting 5mC and 5hmC in a sequence. TAPS is composed of a mild enzymatic and chemical reaction for directly quantitatively detecting 5mC and 5hmC with base resolution without affecting unmodified cytosine. The present disclosure also provides an improved method for detecting 5fC and 5caC with base resolution without affecting unmodified cytosine. Therefore, the method provided herein provides the mapping of 5mC, 5hmC, 5fC and 5caC, and overcomes the shortcomings of previous methods (such as bisulfite sequencing).

[0143] Table 1. Comparison of BS and related methods with TAPS, TAPSβ, and CAPS for 5mC and 5hmC sequencing.

[0144]

[0145] The methods described herein are based on converting modified cytosines (5mC, 5hmC, 5fC, 5caC) to dihydrouracil (DHU), for example, by TET-assisted pyridine borane treatment, followed by cleavage of the DHU sites to generate DNA fragments (e.g., using USER (uracil specific excision reagent)), which are then prepared as sequencing libraries. Unfragmented genomic DNA cannot be sequenced directly. Only when a modified cytosine is converted to DHU will the DNA be cleaved into DNA fragments, which can then be sequenced, with each end of the fragment indicating the position of the modified cytosine. Thus, for example, eeTAPS reduces the cost of whole genome TAPS (WGTAPS) by sequencing only the cleaved fragments resulting from the conversion of 5mC / 5hmC to DHU. By sequencing the cleaved fragments, methylated cytosines in the original DNA sample can be identified with base resolution.

[0146] Method for identifying 5mC or 5hmC (together identification)

[0147] In another aspect, the present disclosure provides a method for identifying 5mC or 5hmC in a DNA sample, comprising the following steps:

[0148] a. Providing a DNA sample containing a target DNA;

[0149] b. Modifying DNA, comprising the following steps:

[0150] i. converting 5mC and 5hmC in a DNA sample into 5-carboxycytosine (5caC) and / or 5fC; and

[0151] ii. converting 5caC and / or 5fC into DHU to provide a modified DNA sample comprising a modified target DNA;

[0152] c. cleavage of the modified target DNA;

[0153] d. adding an adaptor DNA molecule to the cleaved modified target DNA; and

[0154] e. detecting the sequence of the modified target DNA;

[0155] The presence of a cleavage site provides the location of 5mC or 5hmC in the target DNA.

[0156] In an embodiment of the method for identifying 5mC or 5hmC in a target DNA, the method provides a semi-quantitative measurement of the frequency of 5mC or 5hmC modification at each position where a 5mC or 5hmC modification is identified in the target DNA. This method for identifying 5mC or 5hmC provides the position of 5mC or 5hmC, but cannot distinguish between the two cytosine modifications. Instead, both 5mC and 5hmC are converted to DHU.

[0157] Methods used to identify 5mC

[0158] In one aspect, the present disclosure provides a method for identifying 5-methylcytosine (5mC) in a DNA sample, comprising the steps of:

[0159] a. Providing a DNA sample containing a target DNA;

[0160] b. Modifying DNA, comprising the following steps:

[0161] i. Adding blocking groups to 5-hydroxymethylcytosine (5hmC) in DNA samples;

[0162] ii. converting 5mC in the DNA sample into 5-carboxycytosine (5caC) and / or 5-formylcytosine (5fC); and

[0163] iii. converting 5caC and / or 5fC into DHU to provide a modified DNA sample comprising a modified target DNA;

[0164] c. cleavage of the modified target DNA;

[0165] d. adding an adaptor DNA molecule to the cleaved modified target DNA; and

[0166] e. Detecting the sequence of the modified target DNA; wherein the presence of the cleavage site provides the location of 5mC in the target DNA.

[0167] In an embodiment of the method for identifying 5mC in a target DNA, the method provides a semi-quantitative measurement of the frequency of 5mC modifications at each position in the target DNA where the 5mC modification is identified.

[0168] In order to identify 5mC in target DNA that does not contain 5hmC, 5hmC in the sample is blocked so that it will not be converted into 5caC and / or 5fC. In the method disclosed herein, 5hmC in the sample DNA is made unreactive to subsequent steps by adding a blocking group to 5hmC. In one embodiment, the blocking group is a sugar, including a modified sugar, such as glucose or 6-azido-glucose (6-azido-6-deoxy-D-glucose). The sugar blocking group is added to the hydroxymethyl of 5hmC by contacting the DNA sample with uridine diphosphate (UDP)-sugar in the presence of one or more glucosyltransferases.

[0169] In embodiments, the glucosyltransferase is T4 bacteriophage β-glucosyltransferase (βGT), T4 bacteriophage α-glucosyltransferase (αGT), and derivatives and analogs thereof. βGT is an enzyme that catalyzes a chemical reaction in which a β-D-glucosyl (glucose) residue is transferred from UDP-glucose to a 5-hydroxymethylcytosine residue in DNA.

[0170] It is stated that the blocking group is, for example, glucose, which means that a glucose moiety (e.g., a β-D-glucosyl residue) is added to 5hmC to produce a glucosyl 5-hydroxymethylcytosine. The sugar blocking group can be any sugar or modified sugar that is a substrate for a glucosyltransferase and blocks the subsequent conversion of 5hmC to 5caC and / or 5fC. The step of converting 5mC in the DNA sample to 5caC and / or 5fC is then completed by the methods provided herein, such as by oxidation using a TET enzyme. And the conversion of 5caC and / or 5fC to DHU is completed by the methods provided herein, such as by borane oxidation.

[0171] Methods for the identification of 5mC and characterization of 5hmC

[0172] The present disclosure provides a method for identifying 5mC and identifying 5hmC in a target DNA, which is achieved by the following steps: (i) performing a method for identifying 5mC on a first DNA sample described herein, and (ii) performing a method for identifying 5mC or 5hmC on a second DNA sample described herein. The position of 5mC is provided by (i). By comparing the results of (i) and (ii), the cleavage site present in (i) but not present in (ii) provides the position of 5hmC in the target DNA. In an embodiment, the first and second DNA samples are derived from the same DNA sample. For example, the first sample and the second sample can be separate aliquots obtained from a sample containing the DNA to be analyzed.

[0173] Because 5mC and 5hmC (unblocked) are converted to 5fC and 5caC prior to conversion to DHU, any existing 5fC and 5caC in the DNA sample will be detected as 5mC and / or 5hmC. However, given the extremely low levels of 5fC and 5caC in genomic DNA under normal conditions, this will often be acceptable when analyzing methylation and hydroxymethylation in DNA samples. Protecting 5fC and 5caC from conversion to DHU, such as by hydroxylamine conjugation and EDC coupling, respectively, can eliminate 5fC and 5caC signals.

[0174] The above method identifies the position of 5hmC in the target DNA by comparing the position of 5mC with the position of 5mC or 5hmC (together). Alternatively, the position of 5hmC modification in the target DNA can be directly measured. Therefore, in one aspect, the present disclosure provides a method for identifying 5hmC in a DNA sample, comprising the following steps:

[0175] a. Providing a DNA sample containing a target DNA;

[0176] b. Modifying DNA, comprising the following steps:

[0177] i. Converting 5hmC in DNA samples into 5caC and / or 5fC; and

[0178] ii. converting 5caC and / or 5fC into DHU to provide a modified DNA sample comprising a modified target DNA;

[0179] c. cleavage of the modified target DNA;

[0180] d. adding an adaptor DNA molecule to the cleaved modified target DNA; and

[0181] e. detecting the sequence of the modified target DNA;

[0182] The presence of the cleavage site provides the location of 5hmC in the target DNA.

[0183] In an embodiment, the step of converting 5hmC to 5fC comprises oxidizing 5hmC to 5fC by contacting the DNA with, for example, potassium perruthenate (KRuO4) (as described in Science. 2012, 33, 934-937 and WO2013017853, which are incorporated herein by reference) or Cu(II) / TEMPO (copper (II) perchlorate and 2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO)) (as described in Chem. Commun., 2017, 53, 5756-5759 and WO2017039002, which are incorporated herein by reference). Other oxidants that can be used are potassium ruthenate and / or manganese oxide. 5fC in the DNA sample is then converted to DHU by the methods disclosed herein, for example, by a borane reaction.

[0184] Methods for Identifying 5caC or 5fC

[0185] In one aspect, the present disclosure provides a method for identifying 5caC or 5fC in a DNA sample, comprising the following steps:

[0186] a. Providing a DNA sample containing a target DNA;

[0187] b. converting 5caC and / or 5fC into DHU to provide a modified DNA sample comprising a modified target DNA;

[0188] f. cleavage of the modified target DNA;

[0189] g. adding an adapter DNA molecule to the cleaved modified target DNA; and

[0190] h. detecting the sequence of the modified target DNA;

[0191] The presence of a cleavage site provides the location of 5caC or 5fC in the target DNA.

[0192] This method for identifying 5fC or 5caC provides the position of 5fC or 5caC, but cannot distinguish between the two cytosine modifications. Instead, both 5fC and 5caC are converted to DHU, which can be detected by the methods described herein.

[0193] Methods used to identify 5caC

[0194] In another aspect, the present disclosure provides a method for identifying 5caC in a DNA sample, comprising the steps of:

[0195] a. Providing a DNA sample containing a target DNA;

[0196] b. Adding blocking groups to 5fC in the DNA sample;

[0197] c. converting 5caC into DHU to provide a modified DNA sample comprising a modified target DNA;

[0198] g. cleavage of the modified target DNA;

[0199] h. adding an adapter DNA molecule to the cleaved modified target DNA; and

[0200] i. detecting the sequence of the modified target DNA;

[0201] The presence of a cleavage site provides the location of 5caC in the target DNA.

[0202] In an embodiment of the method for identifying 5caC in a target DNA, the method provides a semi-quantitative measurement of the frequency of 5caC modifications at each position in the target DNA where a 5caC modification is identified.

[0203] In this method, 5fC is blocked (and 5mC and 5hmC are not converted to DHU), thereby allowing the identification of 5caC in the target DNA. In an embodiment, adding a blocking group to 5fC in a DNA sample includes contacting the DNA with an aldehyde-reactive compound, which includes, for example, hydroxylamine derivatives, hydrazine derivatives, and hydrazide derivatives. Hydroxylamine derivatives include hydroxylamine; hydroxylamine hydrochloride; hydroxylammonium sulfate; hydroxylamine phosphate; O-methylhydroxylamine; O-hexylhydroxylamine; O-pentylhydroxylamine; O-benzylhydroxylamine; especially O-ethylhydroxylamine (EtONH2), O-alkylated or O-arylated hydroxylamine, its acid or salt. Hydrazine derivatives include N-alkylhydrazine, N-arylhydrazine, N-benzylhydrazine, N,N-dialkylhydrazine, N,N-diarylhydrazine, N,N-dibenzylhydrazine, N,N-alkylbenzylhydrazine, N,N-arylbenzylhydrazine and N,N-alkylarylhydrazine. Hydrazide derivatives include N-toluenesulfonylhydrazide, N-hydrazide, N,N-alkylhydrazide, N,N-benzylhydrazide, N,N-arylhydrazide, N-sulfonylhydrazide, N,N-alkylsulfonylhydrazide, N,N-benzylsulfonylhydrazide and N,N-arylsulfonylhydrazide.

[0204] Methods used to identify 5fC

[0205] In another aspect, the present disclosure provides a method for identifying 5fC in a DNA sample, comprising the steps of:

[0206] a. Providing a DNA sample containing a target DNA;

[0207] b. Adding a blocking group to 5caC in the DNA sample;

[0208] c. converting 5fC into DHU to provide a modified DNA sample comprising a modified target DNA;

[0209] d. cleavage of the modified target DNA;

[0210] e. adding an adapter DNA molecule to the cleaved modified target DNA; and

[0211] f. detecting the sequence of the modified target DNA;

[0212] The presence of a cleavage site provides the location of 5fC in the target DNA.

[0213] In an embodiment of the method for identifying 5fC in a target DNA, the method provides a semi-quantitative measurement of the frequency of 5fC modifications at each position in the target DNA where a 5fC modification is identified.

[0214] Adding a blocking group to 5caC in a DNA sample can be achieved by (i) contacting the DNA sample with a coupling agent, e.g., a carboxylic acid derivatizing agent such as a carbodiimide derivative, such as 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) or N,N'-dicyclohexylcarbodiimide (DCC), and (ii) contacting the DNA sample with an amine, hydrazine, or hydroxylamine compound. Thus, for example, 5caC can be blocked by treating the DNA sample with EDC and then with benzylamine, ethylamine, or other amine to form an amide that blocks 5caC from being converted to DHU by, e.g., pic-BH3. Methods for EDC-catalyzed 5caC coupling are described in WO2014165770, which is incorporated herein by reference.

[0215] DNA sample / target DNA

[0216] The methods disclosed herein utilize mild enzymatic and chemical reactions that avoid the extensive degradation associated with methods such as bisulfite sequencing. Therefore, the methods can be used to analyze low input samples such as circulating cell-free DNA and can be used for single cell analysis.

[0217] In embodiments, DNA sample comprises the DNA of picogram amount.In embodiments, DNA sample comprises about 1pg to about 900pg DNA, about 1pg to about 500pg DNA, about 1pg to about 100pg DNA, about 1pg to about 50pg DNA, about 1pg to about 10pg DNA, about 1pg to about 10pg DNA, less than about 200pg, less than about 100pg DNA, less than about 50pg DNA, less than about 20pg DNA and less than about 5pg DNA.In other embodiments, DNA sample comprises the DNA of nanogram amount.Sample DNA used in method disclosed herein can be any amount, including DNA from single cell or batch DNA sample.In embodiments, described method can comprise about 1 to about 500ng DNA, about 1 to about 200ng DNA, about 1 to about 100ng DNA, about 1 to about 50ng DNA, about 1 to about 10ng DNA, about 2 to about 5ng DNA, less than about 100ng DNA, less than about 50ng DNA, less than about 5 and less than about 2ng DNA DNA sample on the DNA sample to carry out.In embodiments, DNA sample comprises the DNA of microgram amount.

[0218] As used herein, providing a DNA sample refers to obtaining a DNA sample directly or indirectly from any source. The DNA sample used in the method described herein may be from any source, including, for example, body fluids, tissue samples, organs, organelles, or individual cells. In an embodiment, the DNA sample is circulating cell-free DNA (cell-free DNA or cfDNA), which is DNA found in blood and not present in cells. cfDNA can be separated from blood or plasma using methods known in the art. Commercial kits (including, for example, circulating DNA kits (Qiagen)) can be used to separate cfDNA. The DNA sample can be obtained from an enrichment step, which includes, but is not limited to, antibody immunoprecipitation, chromatin immunoprecipitation, enrichment based on restriction enzyme digestion, enrichment based on hybridization, or enrichment based on chemical markers.

[0219] The target DNA can be any DNA with cytosine modification (i.e., 5mC, 5hmC, 5fC and / or 5caC), including but not limited to DNA fragments or genomic DNA purified from tissues, organs, cells and organelles. The target DNA can be a single DNA molecule in a sample, or can be a whole population of DNA molecules in a sample (or a subset thereof) with cytosine modification. The target DNA can be natural DNA from a source, or can be pre-converted into a high-throughput sequencing-ready form, for example, by fragmentation, repair and connection with an adapter for sequencing. Therefore, the target DNA can include multiple DNA sequences, so that the methods described herein can be used to generate a library of target DNA sequences that can be analyzed individually (e.g., by determining the sequence of a single target) or in groups (e.g., by high-throughput or next-generation sequencing methods).

[0220] The DNA sample comprising the target DNA can be obtained from organisms from the prokaryotes (Monera) (bacteria), protista, fungi, plant kingdom and animal kingdom. The DNA sample can be obtained from a patient or subject, from an environmental sample, or from a target organism. In embodiments, the DNA sample is extracted, purified or derived from a cell or cell collection, a body fluid, a tissue sample, an organ and / or a cell organelle. In a preferred embodiment, the sample DNA is whole genome DNA.

[0221] Converts 5mC and 5hmC to 5caC and / or 5fC

[0222] Embodiments of the methods provided herein, such as the eeTAPS methods described herein, include a step of converting 5mC and 5hmC (or only 5mC if 5hmC is blocked) to 5caC and / or 5fC. In embodiments, the step includes contacting the DNA sample with a ten-eleven translocation (TET) enzyme. TET enzymes are a family of enzymes that catalyze the transfer of an oxygen molecule to the N5 methyl group on 5mC, thereby forming 5-hydroxymethylcytosine (5hmC). TET further catalyzes the oxidation of 5hmC to 5fC and catalyzes the oxidation of 5fC to form 5caC (see Figure 5A). TET enzymes that can be used in the methods described herein include one or more of human TET1, TET2, and TET3; mouse Tet1, Tet2, and Tet3; Nassaurus TET (NgTET); Coprinus cinereus (CcTET), and derivatives or analogs thereof. In embodiments, the TET enzyme is NgTET or a derivative thereof. In other embodiments, the TET enzyme is human TET1 (hTET1) or a derivative thereof. In embodiments, the TET enzyme is mouse Tet1 or a derivative thereof (mTet1CD). In other embodiments, the TET enzyme is human TET2 (hTET2) or a derivative thereof.

[0223] Convert 5caC and / or 5fC to DHU

[0224] The methods described herein include the step of converting 5caC and / or 5fC in a DNA sample into DHU. In embodiments, this step includes contacting the DNA sample with a reducing agent, including, for example, a borane reducing agent, such as pyridine borane, 2-methylpyridine borane (pic-BH3), borane, sodium borohydride, sodium cyanoborohydride, and sodium triacetoxyborohydride. In preferred embodiments, the reducing agent is pyridine borane and / or pic-BH3.

[0225] Cleavage of modified target DNA

[0226] The methods described herein include a step of cleaving a modified target DNA containing DHU at the position where the modified cytosine (5mC, 5hmC, 5fC and / or 5caC) is located in the DNA sample before one or more conversion steps (i.e., before one or more steps of converting the modified cytosine to DHU). The cleavage step described herein specifically cleaves the modified target DNA containing DHU while leaving DNA that does not contain DHU uncleaved or substantially uncleaved.

[0227] The step of cutting the modified target DNA containing DHU can be carried out by contacting the modified target DNA containing DHU with one or more DNA endonucleases that specifically cut the modified target DNA. In an embodiment, one or more of the DNA endonucleases are bifunctional DNA endonucleases with DNA N-glycosylase and AP lyase activity, including, for example, Tma endonuclease III, endonuclease VIII, formamidopyrimidine DNA glycosylase (Fpg) and / or hNEIL1. In an embodiment, the modified target DNA containing DHU is cut with a uracil specific excision reagent (USER). The USER enzyme comprises a combination of uracil DNA glycosylase (UDG) and DNA glycosylase-lyase endonuclease VIII. Other enzymes that can be used to cleave the modified target DNA are one or more of apurinic / apyrimidinic endonuclease 1 (APE 1), endonuclease III (Endo III), Tma endonuclease III, Tth endonuclease IV, endonuclease V, endonuclease VIII, Fpg and / or hNEIL1.

[0228] In an embodiment, the step of cleaving the modified target DNA containing DHU comprises exposing the modified target DNA to acidic pH and / or heat conditions, as described in House CH, Miller SL. Hydrolysis of dihydrouridine and related compounds. Biochemistry. 1996; 35(1): 315-320. In an embodiment, the cleavage step comprises exposing the modified target DNA to a temperature of at least 70°C, 75°C, 80°C, 85°C, 90°C, 95°C, 100°C, 105°C, or 110°C and / or a pH of 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, or 13.

[0229] Adding adapter DNA molecules to the cleaved, modified target DNA

[0230] In embodiments, the methods described herein include adding an adapter DNA molecule to a modified target DNA that has been, for example, cut by a USER enzyme. Adapter DNA or DNA adapters are short chemically synthesized single-stranded or double-stranded oligonucleotides that can be connected to one end or both ends of other DNA molecules. Double-stranded adapters can be synthesized so that each end of the adapter has a flat end or 5' or 3' overhang (i.e., sticky ends). DNA adapters are connected to the cut modified target DNA to provide sequences for PCR amplification using complementary primers and / or for cloning and / or library creation (e.g., next generation sequencing libraries).

[0231] Prior to ligating the adaptor to the cleaved target DNA, the ends of the cleaved DNA can be prepared for ligation by, for example, end repair to create blunt ends with 5' phosphate groups. The blunt ends can be used to ligate to the adaptor or overhangs can be created prior to ligation by, for example, a tailing reaction. Tailing is an enzymatic method for adding non-templated nucleotides to the 3' end of a flat double-stranded DNA molecule. A-tailing of the 3' end (i.e., adding dA at the 3' end) can be used to facilitate ligation to an adaptor with a complementary dT overhang.

[0232] In embodiments, the cleaved target DNA is size selected before or after the step of adding the DNA adaptor molecules to the cleaved modified target DNA. In embodiments, the size selection is performed after the DNA adaptors are added to the cleaved target DNA. The size selection can be performed by methods known in the art, including but not limited to solid phase reversible immobilization (SPRI) paramagnetic beads (e.g., using AMPure XP beads).

[0233] Amplify the copy number of modified target DNA

[0234] Methods described herein may optionally include a step of amplifying (increasing) the copy number of modified target DNA by methods known in the art. When modified target DNA is DNA, copy number can be increased by, for example, PCR, cloning and primer extension. Primers specific to a particular target DNA sequence can be used to amplify the copy number of a single target DNA by PCR. Alternatively, multiple different modified target DNA sequences can be amplified by cloning into a DNA vector by standard techniques. In an embodiment, the copy number of multiple different modified target DNA sequences is increased by PCR to produce a library for next generation sequencing, wherein, for example, double-stranded adapter DNA has been previously connected to sample DNA (or connected to modified sample DNA), and PCR is performed using primers complementary to adapter DNA.

[0235] Creating Next-Generation Sequencing Libraries

[0236] Once the adapter DNA molecules are added to the cleaved modified target DNA, the number of copies of the modified target DNA can be amplified (e.g., by PCR amplification) to generate a library DNA sequence for next generation sequencing. The primers used for PCR have sequences corresponding to the adapter DNA that has been previously connected to the cleaved target DNA (complementary sequences). The methods provided herein (including reagents, steps, and their order) enable the generation of a DNA sequence library that can be sequenced using a high-throughput next generation sequencing method.

[0237] Detection of cleavage sites of modified target DNA

[0238] In an embodiment of the method described herein, the method includes a step of detecting a modified target DNA sequence that is cut. The modified target DNA contains DHU at the position where one or more of 5mC, 5hmC, 5fC and 5caC are located in the unmodified target DNA. The modified target DNA containing DHU is cut by the method described herein (including DHU-sensitive endonuclease digestion). The cut fragments can then be converted into a sequencing library, wherein the starting point and end point of each fragment correspond to the site of a modified cytosine (5mC, 5hmC, 5fC or 5caC). This allows methylated CpG sites to be enriched genome-wide, while the vast majority of unmethylated genomes are depleted. Therefore, cytosine modifications can be detected by any method for identifying cleavage sites known in the art. Such methods include sequencing methods, such as Sanger sequencing, microarrays, and next-generation sequencing methods.

[0239] Reagent test kit

[0240] The present disclosure further provides a kit for identifying 5mC and 5hmC in target DNA. Such a kit includes reagents for identifying 5mC and 5hmC by the methods described herein. The kit may also contain reagents for identifying 5caC and identifying 5fC by the methods described herein. In an embodiment, the kit includes a TET enzyme, a borane reducing agent, and instructions for performing the method. In another embodiment, the TET enzyme is TET1 or TET2 (or a derivative thereof) and the borane reducing agent is selected from one or more of the following groups: pyridine borane, 2-methylpyridine borane (pic-BH3), borane, sodium borohydride, sodium cyanoborohydride, and sodium triacetoxyborohydride. In another embodiment, the TET1 enzyme is NgTet1, human TET1, or mouse Tet1 and the borane reducing agent is pyridine borane and / or pic-BH3. In other embodiments, the TET enzyme is mTET2 or a derivative thereof.

[0241] In an embodiment, the kit further comprises a 5hmC blocking group and a glucosyltransferase. In a further embodiment, the 5hmC blocking group is a uridine diphosphate (UDP)-sugar, wherein the sugar is glucose or a glucose derivative, and the glucosyltransferase is T4 bacteriophage β-glucosyltransferase (βGT), T4 bacteriophage α-glucosyltransferase (αGT) and derivatives and analogs thereof.

[0242] In an embodiment, the kit further comprises an oxidizing agent selected from one or more of potassium perruthenate (KRuO4), Cu(II) / TEMPO (copper(II) perchlorate and 2,2,6,6-tetramethylpiperidine-1-oxyl (TEMPO)), potassium ruthenate and manganese oxide.

[0243] In embodiments, the kit includes a reagent for blocking 5fC in a DNA sample. In embodiments, the kit includes an aldehyde-reactive compound, including, for example, hydroxylamine derivatives, hydrazine derivatives, and hydrazide derivatives as described herein. In embodiments, the kit includes a reagent for blocking 5caC as described herein.

[0244] In embodiments, the kit includes reagents for isolating DNA. In embodiments, the kit includes reagents for isolating low input DNA from a sample, such as cfDNA from blood, plasma, or serum. In embodiments, the kit includes reagents for isolating genomic DNA.

[0245] In embodiments, the kit includes one or more enzymes as described herein for cleaving a modified target DNA containing DHU. In embodiments, the kit includes an adapter DNA molecule as described herein. In addition, the kit may include an enzyme for ligating the adapter DNA molecule to the cleaved modified target DNA.

[0246] Example

[0247] Example 1: TAPS and WGTAPS

[0248] method

[0249] Preparation of model DNA.

[0250] DNA oligonucleotides for MALDI and HPLC-MS / MS assays. DNA oligonucleotides with C, 5mC, and 5hmC (“oligonucleotides”) were purchased from Integrated DNA Technologies (IDT). All sequences and modifications can be found at Figure 6 and Figure 7DNA oligonucleotides with 5fC were synthesized by the C-tailing method: DNA oligonucleotides 5′-GTCGACCGGATC-3′ were annealed with 5′-TTGGATCCGGTCGACTT-3′, and then incubated with 5-formyl-2′-dCTP (Trilink Biotech) and Klenow fragment 3′→5′exo- (New England Biolabs) in NEB buffer 2 at 37°C for 2 hours. The product was purified using a Bio-Spin P-6 gel column (Bio-Rad).

[0251] DNA oligonucleotides with 5caC were synthesized using the Expedite 8900 DNA synthesis system using standard phosphoramidites (Sigma) 5-carboxyl-dC-CE phosphoramidites (Glen Research). Deprotection and purification were subsequently performed using Glen-Pak Cartridges (Glen Research) according to the manufacturer's instructions. Purified oligonucleotides were characterized by a Voyager-DE MALDI-TOF (matrix-assisted laser desorption ionization time of flight) biopsy spectrophotometry workstation.

[0252] 222bp model DNA for transformation test. In order to generate a 222bp model DNA containing five CpG sites, phage λ DNA (Thermo Fisher) was PCR amplified using Taq DNA polymerase (New England Biolabs) and purified by AMPure XP beads (Beckman Coulter). The primer sequences are as follows: FW-5′-CCTGATGAAACAAGCATGTC-3′, RV-5′-CAUTACTCACUTCCCCACUT-3′. The uracil bases in the reverse strand of the PCR product were removed by USER enzyme (New England Biolabs). Then 100ng of the purified PCR product was methylated at 37°C in a 20μl solution containing 1x NEB buffer 2, 0.64mM S-adenosylmethionine and 20U M.SssI CpG methyltransferase (New England Biolabs) for 2 hours, and then heated inactivated at 65°C for 20 minutes. The methylated 222bp model DNA was purified by AMPure XP beads.

[0253] TAPS, TAPSβ and CAPS validation of model DNA was performed using Sanger sequencing. A 34 bp DNA oligo containing a single 5mC and a single 5hmC site was annealed with other DNA oligos in an annealing buffer containing 5 mM Tris-Cl (pH 7.5), 5 mM MgCl2 and 50 mM NaCl, then ligated in a reaction containing 400 U T4 ligase (NEB) at 25°C for 1 hour and purified by 1.8X AMPure XP beads.

[0254]

[0255] The uracil linker is removed by USER enzyme after the ligation reaction, resulting in the final product sequence (5' to 3'): AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTCCCGA m CGCATGATCTGTACTTGATCGAC hm CGTGCAACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG. The PCR primers used to amplify the model DNA were: P5: 5′-AATGATACGGCGACCACCGAG-3′ and P7: 5′-CAAGCAGAAGACGGCATACGAG-3′.

[0256] Model DNA for polymerase testing and Sanger sequencing. Model DNA for polymerase testing and Sanger sequencing was prepared using the same ligation method as above, except that different DNA oligos were used:

[0257]

[0258]

[0259] The final product sequence (5' to 3') is: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGTGCGCTAAGTTCTAGATCGCCAACTGGTTGTGGCCTTAGCAGTCT m CGATCAGCTG m CTACTGTA mCGTAGCATCTATAGCCGGCTTGCTCTCTCTGCCTCTAGCAGCTGCTCCCTATAGTGAGTCGTATTAACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG. The PCR primers used to amplify the model DNA were the P5 and P7 primers provided above. The biotin-labeled primer sequence used for primer extension was biotin attached to the 5′ end of the P7 primer. The PCR primers used for RT-PCR after T7 RNA polymerase transcription were the P5 primer and RT: 5′-TGCTAGAGGCAGAGAGAGCAAG-3′.

[0260] Model DNA for PCR bias testing. Model DNA for PCR bias testing was prepared using the same ligation method as above, except that different DNA oligonucleotides were used:

[0261]

[0262] The sequence of the final product (5' to 3'): AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTAGGTGCGCTAAGTTCTAGATCGCCAACTGGTTGTGGCCTTAGCAGTCTXGATCAGCTGCTACTGTACGTAGCATCTATAGCCGGCTTGCTCTCTCTGCCTCTAGCAGCTGCTCCCTATAGTGAGTCGTATTAACGATCGGAAGAGCACACGTCTGAACTCCAGTCACGCCAATATCTCGTATGCCGTCTTCTGCTTG, wherein X = DHU or U or T or C. The PCR primers used to amplify the model DNA were the P5 and P7 primers provided above.

[0263] Preparation of methylated bacteriophage λ genomic DNA

[0264] 1 μg of unmethylated bacteriophage λ DNA (Promega) was methylated for 2 h at 37°C in a 50 μL reaction containing 0.64 mM SAM and 0.8 U / μl of Mg-free 2+M.SssI enzyme in a buffer (10mM Tris-Cl pH 8.0, 50mM NaCl and 10mM EDTA). Then, 0.5μL M.SssI enzyme and 1μL SAM were added, and the reaction was incubated for another 2 hours at 37°C. The methylated DNA was subsequently purified on 1X Ampure XP beads. To ensure complete methylation, the entire procedure was repeated in NEB buffer 2. DNA methylation was then verified using an HpaII digestion assay. 50ng of methylated and unmethylated DNA was digested for 1h at 37°C in a 10μL reaction containing 2U of HpaII enzyme (NEB) in CutSmart buffer (NEB). The digestion products were run on a 1% agarose gel along with an undigested λDNA control. Unmethylated λDNA was digested after the assay, while methylated λDNA remained intact, confirming complete and successful CpG methylation. The sequence of lambda DNA can be found in GenBank-EMBL accession number: J02459.

[0265] Preparation of 2 kb unmodified spike-in control

[0266] 2 kb spike-in controls (2 kb-1, 2, 3) were PCR amplified from pNIC28-Bsa4 plasmid (Addgene, catalog number 26103) in reactions containing 1 ng DNA template, 0.5 μM primers, 1 U Phusion High Fidelity DNA Polymerase (Thermo Fisher). PCR primer sequences are listed in Table 2.

[0267] Table 2. PCR primer sequences used for spike-ins.

[0268]

[0269]

[0270] Preparation of 120mer spike-in controls

[0271] A 120mer spike-in control was generated by primer extension. Oligonucleotide sequences and primers are listed in Table 3.

[0272] Table 3. Sequences of DNA oligonucleotides and primers used to prepare 120mer control spike-ins.

[0273]

[0274] Briefly, for 120mer-1 incorporation, 3 μM oligonucleotide was annealed with 10 μM primer in an annealing buffer containing 5 mM Tris-Cl (pH 7.5), 5 mM MgCl2, and 50 mM NaCl. For 120mer-2 incorporation, 5 μM oligonucleotide was annealed with 7.5 μM primer. Primer extension was performed at 37°C in NEB buffer 2 for 1 hour, containing 0.4 μM dNTPs (120mer-1: dATP / dGTP / dTTP / dhmCTP, 120mer-2: dATP / dGTP / dTTP / dCTP) and 5 U of Klenow polymerase (New England Biolabs). Incorporation controls were purified on Zymo-Spin columns (Zymo Research) after the reaction. The 120mer spike control was then methylated for 2 hours at 37°C in a 50 μL reaction containing 0.64 mM SAM and 0.8 U / μl M.SssI enzyme in NEB buffer 2 and purified using a Zymo-Spin column. All spike sequences used can be downloaded from https: / / figshare.com / s / 80c3ab713c261262494b.

[0275] Synthetic spike-ins were generated using N5mCNN and N5hmCNN.

[0276] Synthetic oligonucleotides with N5mCNN and N5hmCNN sequences were generated by annealing and extension method. The oligonucleotide sequences are listed in Table 4 below.

[0277] Table 4.

[0278]

[0279] Briefly, 10 μM of N5mCNN and N5hmCNN oligonucleotides (IDT) were annealed together in an annealing buffer containing 5 mM Tris-Cl (pH 7.5), 5 mM MgCl2, and 50 mM NaCl. Extension was performed in NEB buffer 2 containing 0.4 μM dNTPs (dATP / dGTP / dTTP / dCTP) and 5 U of Klenow polymerase (NEB) at 37°C for 1 hour. After the reaction, the spike-in control was purified on a Zymo-Spin column (Zymo Research). Synthetic incorporation with N5mCNN and N5hmCNN (5' to 3'): GAAGATGCAGAAGACAGGAAGGATGAAACACTCAGGCGCACGCTGGCATNmCNNGACAAACCACAAGAACAGGCTAGTGAGAATGAAGGGATATGTTTGTAAGATGGTCNNGNATCTTGGGTTGTGTGGTGGATGTTGGCGTTGGTGGGTTTCAGAGTTGG. Complementary strand (5' to 3'): CCAACTCTGAAACCCACCAACGCCAACATCCACCACACAACCCAAGATNhmCNN GACCATCTTACAAACATATCCCTTCATTCTCACTAGCCTGTTCTTGTGGTTTGTCNNGNATGCCAGCGTGCGCCTGAGTGTTTCATCCTTCCTGTCTTCTGCATCTTC.

[0280] DNA digestion and HPLC-MS / MS analysis

[0281] DNA samples were digested with 2U of nuclease P1 (Sigma-Aldrich) and 10nM of deaminase inhibitor erythromycin-9-amino-β-hexyl-α-methyl-9H-purine-9-ethanol hydrochloride (Sigma-Aldrich). After incubation at 37°C overnight, samples were further treated with 6U of alkaline phosphatase (Sigma-Aldrich) and 0.5U of phosphodiesterase I (Sigma-Aldrich) at 37°C for 3 hours. The digested DNA solution was filtered with Amicon Ultra-0.5mL 10K centrifugal filter (MerckMillipore) to remove protein and analyzed by HPLC-MS / MS.

[0282] HPLC-MS / MS analysis was performed using a 1290 Infinity LC system (Agilent) coupled to a 6495B triple quadrupole mass spectrometer (Agilent). A ZORBAX EclipsePlus C18 chromatographic column (2.1 x 150 mm, 1.8-Micron, Agilent) was used. The column temperature was maintained at 40°C, the solvent system was water (pH 6.0, solvent A) and water-acetonitrile (60 / 40, v / v, solvent B) containing 10 mM ammonium acetate, and the flow rate was 0.4 mL / min. The gradient was: 0-5 min; 0 solvent B; 5-8 min; 0-5.63% solvent B; 8-9 min; 5.63% solvent B; 9-16 min; 5.63-13.66% solvent B; 16-17 min; 13.66-100% solvent B; 17-21 min; 100% solvent B; 21-24.3 min; 100-0% solvent B; 24.3-25 min; 0% solvent B. Quantification was performed using the dynamic multiple reaction monitoring (dMRM) mode of MS. The source-related parameters were as follows: gas temperature 230°C, gas flow rate 14 L / min, nebulizer 40 psi, sheath gas temperature 400°C, sheath gas flow rate 11 L / min, capillary voltage 1500 V (in positive ion mode), nozzle voltage 0 V, high RF 110 V and low RF 80 V (both in positive ion mode). The fragmentation voltage for all compounds was 380 V, and other compound-related parameters are summarized in Table 5.

[0283] Table 5. Compound-dependent HPLC-MS / MS parameters for nucleoside quantification. RT: retention time, CE: collision energy; CAE: cell accelerator voltage. All nucleosides were analyzed in positive ion mode.

[0284]

[0285] Expression and purification of NgTET1

[0286] The pRSET-A plasmid encoding the His-tagged NgTET1 protein (GG739552.1) was designed and purchased from Invitrogen. The protein was expressed in E. coli BL21 (De3) bacteria and purified as previously described (J. E. Pais et al., Biochemical characterization of a Naegleria TET-like oxygenase and its application in single molecule sequencing of 5-methylcytosine. Proc. Natl. Acad. Sci. USA 112, 4316-4321 (2015), incorporated herein by reference) with some modifications. Briefly, for protein expression, bacteria from overnight small-scale cultures were grown in LB medium at 37°C and 200 rpm until OD600 was between 0.7 and 0.8. The culture was then cooled to room temperature and 0.2 mM isopropyl-β-d-1-thiogalactopyranoside (IPTG) was used to induce target protein expression. The cells were kept at 18 ° C and 180 rpm for another 18 hours. Subsequently, the cells were harvested and resuspended in a buffer containing 20 mM HEPES (pH 7.5), 500 mM NaCl, 1 mM DTT, 20 mM imidazole, 1 μg / mL leupeptin, 1 μg / mL pepstatin A and 1 mM PMSF. The cells were broken with an EmulsiFlex-C5 high pressure homogenizer and the lysate was clarified by centrifugation at 30,000 x g and 4 ° C for 1 hour. The collected supernatant was loaded onto Ni-NTA resin and the NgTET1 protein was eluted with a buffer containing 20 mM HEPES (pH 7.5), 500 mM imidazole, 2 M NaCl, 1 mM DTT. The collected fractions were then purified on HiLoad 16 / 60Sdx 75 (20mM HEPES pH 7.5, 2M NaCl, 1mM DTT). The fractions containing NgTET1 were then collected, the buffer was exchanged to a buffer containing 20mM HEPES (pH 7.0), 10mM NaCl, 1mM DTT, and loaded onto a HiTrap HP SP column. The pure protein was eluted with a salt gradient, the protein was collected and the buffer was exchanged to a final buffer containing 20mM Tris-Cl (pH 8.0), 150mM NaCl and 1mM DTT. The protein was then concentrated to 130μM, mixed with glycerol (30% v / v), and aliquots were stored at -80°C.

[0287] Expression and purification of mTET1CD

[0288] The catalytic domain of mTET1CD (NM_001253857.2, 4371-6392) with an N-terminal Flag-tag was cloned between the kpnI and BamH1 restriction sites of pcDNA3-Flag. For protein expression, 1 mg of plasmid was cultured at 1 × 10 6 Cells were transfected into 1L Expi293F (Gibco) cell culture at a density of 1 cell / mL and grown for 48h at 37°C, 170rpm and 5% CO2. Subsequently, cells were harvested by centrifugation, resuspended in a lysis buffer containing 50mM Tris-Cl pH=7.5, 500mM NaCl, 1X cOmplete protease inhibitor cocktail (Sigma), 1mM PMSF, 1% Triton X-100, and incubated on ice for 20 minutes. The cell lysate was then clarified by centrifugation at 30000×g and 4°C for 30min. The collected supernatant was purified on ANTI-FLAG M2 affinity gel (Sigma) and pure protein was eluted with a buffer containing 20mM HEPES pH=8.0, 150mM NaCl, 0.1mg / mL 3X Flag peptide (Sigma), 1X cOmplete protease inhibitor cocktail (Sigma), 1mM PMSF. The collected fractions were concentrated and the buffer was exchanged for a final buffer containing 20 mM HEPES pH = 8.0, 150 mM NaCl and 1 mM DTT. The concentrated protein was mixed with glycerol (30% v / v), frozen in liquid nitrogen, and aliquots were stored at -80 ° C. The activity and quality of the recombinant mTET1CD were checked by MALDI mass spectrometry. Based on this assay, the recombinant mTET1CD has full activity and is able to catalyze the oxidation of 5mC to 5caC. Any significant digestion of the tested model oligonucleotides was detected by MALDI, thereby confirming that the protein does not contain nucleases.

[0289] TET oxidation

[0290] NgTET1 oxidation. For Tet oxidation of the 222 bp model DNA oligonucleotide, 100 ng of 222 bp DNA was incubated at 37°C in 20 μl of a solution containing 50 mM MOP buffer (pH 6.9), 100 mM ammonium iron (II) sulfate, 1 mM α-ketoglutarate, 2 mM ascorbic acid, 1 mM dithiothreitol (DTT), 50 mM sodium chloride, and 5 μM NgTET for 1 hour. Afterwards, 0.4 U proteinase K (New England Biolabs) was added to the reaction mixture and incubated at 37°C for 30 minutes. The product was purified by Zymo-Spin column (Zymo Research) according to the manufacturer's instructions.

[0291] For NgTET1 oxidation of genomic DNA, 500 ng of genomic DNA was incubated at 37°C for 1 hour in 50 μl of a solution containing 50 mM MOPS buffer (pH 6.9), 100 mM ammonium iron (II) sulfate, 1 mM α-ketoglutarate, 2 mM ascorbic acid, 1 mM dithiothreitol, 50 mM NaCl, and 5 μM NgTET1. Afterwards, 4 U of proteinase K (New England Biolabs) was added to the reaction mixture and incubated at 37°C for 30 minutes. The product was purified on 1.8X Ampure beads according to the manufacturer's instructions.

[0292] Oxidation of mTET1. 100 ng of genomic DNA was incubated at 37°C in 50 μl of a reaction containing 50 mM HEPES buffer (pH 8.0), 100 μM ammonium iron (II) sulfate, 1 mM α-ketoglutarate, 2 mM ascorbic acid, 1 mM dithiothreitol, 100 mM NaCl, 1.2 mM ATP, and 4 μM mTET1CD for 80 min. Afterwards, 0.8 U of proteinase K (New England Biolabs) was added to the reaction mixture and incubated at 50°C for 1 hour. The product was purified on a Bio-Spin P-30 gel column (Bio-Rad) and 1.8X Ampure XP beads according to the manufacturer's instructions.

[0293] Borane reduction

[0294] Pic-BH3 reduction 25 μL of 5 M α-picoline-borane in MeOH (pic-BH3, Sigma-Aldrich) and 5 μL of 3 M sodium acetate solution (pH 5.2, Thermo Fisher) were added to 20 μL DNA sample and incubated for 1 h at 60° C. The product was purified by Zymo-Spin column (Zymo Research) according to the manufacturer's instructions for 222 bp or by Micro Bio-Spin 6 column (Bio-Rad) according to the manufacturer's instructions for oligonucleotides.

[0295] Alternatively, 100 mg of 2-methylpyridine-borane (pic-borane, Sigma-Aldrich) was dissolved in 187 μL DMSO to obtain a solution of about 3.26 M. For each reaction, 25 μL of pic-borane solution and 5 μL of 3M sodium acetate solution (pH 5.2, Thermo Fisher) were added to 20 μL of DNA sample and incubated at 70° C. for 3 hours. The products were purified by Zymo-Spin columns (for genomic DNA) or by Micro Bio-Spin 6 columns (Bio-Rad) (for DNA oligonucleotides) according to the manufacturer's instructions.

[0296] Pyridine borane reduction. 50-100 ng of oxidized DNA in 35 μL of water was reduced in a 50 μL reaction containing 600 mM sodium acetate solution (pH=4.3) and 1 M pyridine borane in an Eppendorf ThermoMixer at 37°C and 850 rpm for 16 hours. The product was purified by Zymo-Spin column.

[0297] Single nucleoside pic-borane reaction. 500 μL of 3.26M 2-methylpyridine-borane (pic-borane, Sigma-Aldrich) in MeOH and 500 μL of 3M sodium acetate solution (pH 5.2, Thermo Fisher) were added to 10 mg of 2'-deoxycytidine-5-carboxylic acid sodium salt (Berry & Associates). The mixture was stirred at 60 ° C for 1 hour. The product was purified by HPLC to obtain a pure compound in the form of a white foam. C9H 14 High-resolution MS (Q-TOF) m / z [M+Na] + calculated value for N2O5Na: 253.0800; found value: 253.0789.

[0298] 5hmC blocking

[0299] 5hmC blocking was performed in 20 μl of a solution containing 50 mM HEPES buffer (pH 8), 25 mM MgCl2, 200 μM uridine diphosphate glucose (UDP-Glc, New England Biolabs), 10 U βGT (Thermo Fisher) and 10 μM 5hmC DNA oligonucleotides at 37° C. for 1 hr. The product was purified by Micro Bio-Spin6 column (Bio-Rad) according to the manufacturer's instructions.

[0300] 5fC blocking

[0301] 5fC blocking was performed in 100 mM MES buffer (pH 5.0), 10 mM O-ethylhydroxylamine (Sigma-Aldrich) and 10 μM 5fC DNA oligonucleotide for 2 hours at 37° C. The product was purified by Micro Bio-Spin 6 columns (Bio-Rad) according to the manufacturer's instructions.

[0302] 5caC blocking

[0303] 5caC blocking was performed in 75 mM MES buffer (pH 5.0), 20 mM N-hydroxysuccinimide (NHS, Sigma-Aldrich), 20 mM 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC, Fluorochem), and 10 μM 5caC DNA oligonucleotide at 37°C for 0.5 h. The buffer was then exchanged to 100 mM sodium phosphate (pH 7.5), 150 mM NaCl using a Micro Bio-Spin 6 column (Bio-Rad) according to the manufacturer's instructions. 10 mM ethylamine (Sigma-Aldrich) was added to the oligonucleotide and incubated at 37°C for 1 hour. The product was purified by a MicroBio-Spin 6 column (Bio-Rad) according to the manufacturer's instructions.

[0304] 5hmC oxidation

[0305] 46 μL of 5hmC DNA oligonucleotides were denatured with 2.5 μL of 1 M NaOH in a shaking incubator at 37°C for 30 min, and then oxidized with 1.5 μL of a solution containing 50 mM NaOH and 15 mM potassium perruthenate (KRuO4, Sigma-Aldrich) on ice for 1 hour. The product was purified by Micro Bio-Spin 6 column according to the manufacturer's instructions.

[0306] Verification of TAPS transformation using TaqαI assay

[0307] 5mC conversion after TAPS is tested by PCR amplification of the target region containing a TaqαI restriction site (TCGA) followed by TaqαI digestion. For example, 5mC conversion in our TAPS library can be tested based on a 194 bp amplicon amplified from a CpG methylated λ DNA spike-in control, which contains a single TaqαI restriction site. The PCR product amplified from the 194 bp amplicon is digested with TaqαI restriction enzyme and the digestion products are examined on a 2% agarose gel. The PCR product amplified on the unconverted control DNA is digested by TaqαI and shows two bands on the gel. In the TAPS-converted samples, the restriction site is lost due to the conversion of C to T, so the 194 bp amplicon will remain intact. The overall conversion level can be quantitatively assessed based on the digested and undigested gel bands and should be above 95% for a successful TAPS sample.

[0308] Briefly, the transformed DNA samples were PCR amplified using the corresponding primers by Taq DNA polymerase (New England Biolabs). The PCR products were incubated with 4 units of TaqαI restriction endonuclease (New England Biolabs) in 1X CutSmart buffer (New England Biolabs) at 65°C for 30 min and checked by 2% agarose gel electrophoresis.

[0309] Quantitative polymerase chain reaction (qPCR)

[0310] In order to compare the amplification curves and melting curves of the model DNA before and after TAPS ( Fig.11 ), 1 ng DNA sample was added to 19 μL of PCR premix containing 1× LightCycler 480 high-resolution melting premix (Roche Diagnostics Corporation), 250 nM primers FW-CCTGATGAAACAAGCATGTC and RV-CATTACTCACTTCCCCACTT, and 3 mM MgSO4. For PCR amplification, an initial denaturation step was performed at 95°C for 10 min, followed by 40 cycles of denaturation at 95°C for 5 seconds, annealing at a custom annealing temperature for 5 seconds, and extension at 72°C for 5 seconds. The last step included 1 min at 95°C, 1 min at 70°C, and a melting curve from 65°C to 95°C (0.02°C step increment, 5 seconds before each acquisition).

[0311] For other assays, qPCR was performed by adding the required amount of DNA sample to 19 μL of PCR premix containing 1× Fast SYBR Green premix (Thermo Fisher), 200 nM forward and reverse primers. For PCR amplification, an initial denaturation step was performed at 95°C for 20 seconds, followed by 40 cycles of denaturation at 95°C for 3 seconds, annealing and extension at 60°C for 20 seconds.

[0312] Validation of C in mESC gDNA using HpaII-qPCR assay m CGG methylation level.

[0313] 1 μg of mESC gDNA was incubated with 50 units of HpaII (NEB, 50 units / μL) and 1X CutSmart buffer at 37°C in a 50 μL reaction for 16 hours. No HpaII was added to the control reaction. 1 μL of proteinase K was added to the reaction and incubated at 40°C for 30 minutes, then proteinase K was inactivated at 95°C for 10 minutes. The Ct values ​​of HpaII-digested samples or control samples were measured by the qPCR assay as above using the corresponding primer sets for specific CCGG positions (listed in Table 9).

[0314] Sanger sequencing:

[0315] PCR products were purified by exonuclease I and shrimp alkaline phosphatase (New England Biolabs) or Zymo-Spin columns and processed for Sanger sequencing.

[0316] Fragments of different lengths were tested for DNA damage.

[0317] 0.5% CpG methylated λDNA was spiked into the mESC genomic DNA and the mESC genomic DNA was kept unfragmented or sonicated using a Covaris M220 instrument and size selected to 500-1kb or 1kb-3kb on Ampure XP beads. 200ng DNA was mono-oxidized with mTET1CD and reduced with a pyridine borane complex as described above, or converted with an EpiTect Bisulfite kit (Qiagen) according to the manufacturer's protocol. 10ng DNA before and after TAPS and bisulfite conversion was run on a 1% agarose gel. To visualize the bisulfite-converted gel, the samples were cooled in an ice bath for 10 min. 5mC conversion in the TAPS sample was tested by the TaqαI digestion assay as described above.

[0318] mESC culture and isolation of genomic DNA.

[0319] Mouse ESC (mESC) E14 was cultured on gelatin-coated plates in Dulbecco's modified Eagle's medium (DMEM) (Invitrogen), supplemented with 15% FBS (Gibco), 2mM L-glutamine (Gibco), 1% non-essential amino acids (Gibco), 1% penicillin / streptavidin (Gibco), 0.1mM β-mercaptoethanol (Sigma), 1000 units / mL LIF (Millipore), 1μM PD0325901 (Stemgent) and 3μM CHIR99021 (Stemgent). The culture was maintained at 37°C and 5% CO2 and passaged every 2 days.

[0320] To isolate genomic DNA, cells were harvested by centrifugation at 1000 x g and room temperature for 5 minutes. DNA was extracted using the Quick-DNA Plus kit (Zymo Research) according to the manufacturer's protocol.

[0321] Preparation of mESC gDNA for TAPS and WGBS.

[0322] For whole genome bisulfite sequencing (WGBS), mESC gDNA was spiked with 0.5% unmethylated λDNA. For whole genome TAPS, mESC gDNA was spiked with 0.5% methylated λDNA and 0.025% unmodified 2kb spike-in control. DNA samples were fragmented with a Covaris M220 instrument and size selected to 200-400bp on Ampure XP beads. After size selection using Ampure XP beads, DNA for TAPS was additionally spiked with 0.25% N5mCNN and N5hmCNN control oligonucleotides.

[0323] Whole-genome bisulfite sequencing

[0324] For whole genome bisulfite sequencing (WGBS), 200ng of fragmented mESC gDNA spiked with 0.5% unmethylated bacteriophage λDNA was used. End repair and A-tailing reactions and ligation of methylated adapters (NextFlex) were performed using the KAPA HyperPrep kit (KapaBiosystems) according to the manufacturer's protocol. Subsequently, the DNA was bisulfite converted using the EpiTect Bisulfite kit (Qiagen) according to the Illumina protocol. The final library was amplified for 6 cycles with KAPA Hifi Uracil Plus polymerase (Kapa Biosystems) and cleaned up on 1X Ampure beads. The WGBS sequencing library was sequenced with paired end 80bp using the NextSeq High Output Kit on a NextSeq 500 sequencer (Illumina) using 15% PhiX control library spike-in.

[0325] Genome-wide TAPS

[0326] For whole-genome TAPS, 100 ng of fragmented mESC gDNA spiked with 0.5% methylated λDNA and 0.025% unmodified 2 kb spike-in control was used. End repair and A-tailing reactions and ligation of Illumina Multiplexing adapters were performed using the KAPA HyperPrep kit according to the manufacturer's protocol. The ligated DNA was oxidized twice with mTET1CD and then reduced with pyridine borane according to the above protocol. The final sequencing library was amplified for 5 cycles with KAPA Hifi UracilPlus polymerase (Kapa Biosystems) and cleaned up on 1X Ampure beads. Paired-end 80 bp sequencing of the whole-genome TAPS sequencing library was performed using a NextSeq high output kit on a NextSeq 500 sequencer (Illumina) using 1% PhiX control library spike-in.

[0327] Low-Input Whole-Genome TAPS Using dsDNA Library Preparation Kit

[0328] mESC gDNA prepared as described above for whole genome TAPS was used for low input whole genome TAPS. Briefly, samples containing 100ng, 10ng and 1ng of mESC gDNA were oxidized once with NgTET1 according to the above protocol. End repair and A-tailing reactions and ligation were performed using NEBNext Ultra II (New England Biolabs) or KAPA HyperPrep kits according to the manufacturer's protocol. The DNA was then subjected to the pic-borane reaction as described above. The transformed library was amplified with KAPA Hifi Uracil Plus polymerase and cleaned up on 1X Ampure beads.

[0329] Low-input whole-genome TAPS using ssDNA library preparation kit

[0330] mESC gDNA prepared as described above for whole genome TAPS was used for low input whole genome TAPS. In brief, samples containing 100ng, 10ng, 1ng, 100pg and 10pg of mESC gDNA were oxidized once with NgTET1 and then reduced with pic-borane as described above. Sequencing libraries were prepared using Accel-NGS Methyl-SeqDNA library kit (Swift Biosciences) according to the manufacturer's protocol. The final library was amplified with KAPA Hifi Uracil Plus polymerase for 6 cycles (100ng), 9 cycles (10ng), 13 cycles (1ng), 16 cycles (100pg) and 21 cycles (10pg) and purified on 0.85X Ampure beads.

[0331] In other experiments, mESC gDNA prepared as described above for whole genome TAPS was used for low input whole genome TAPS. In brief, samples containing 100ng, 10ng and 1ng mESC gDNA were used for end repair and A-tailing reaction and connected to Illumina Multiplexing adapters using KAPA HyperPrep kit according to the manufacturer's protocol. Then, according to the above protocol, the connected sample was oxidized once with mTET1CD and then reduced with pyridine borane. The converted library was amplified with KAPA Hifi Uracil Plus polymerase for 5 cycles (100ng), 8 cycles (10ng) and 13 cycles (1ng) and purified on 1X Ampure XP beads.

[0332] Cell-free DNA TAPS

[0333] Cell-free DNA TAPS samples were prepared from 10 ng and 1 ng of cell-free DNA samples. Briefly, samples were oxidized once with NgTET1 and then reduced with pic-borane as described above. Sequencing libraries were prepared using the Accel-NGSMethyl-Seq DNA Library Kit (Swift Biosciences) according to the manufacturer's protocol. The final libraries were amplified with KAPA HifiUracil Plus polymerase for 9 cycles (10 ng) and 13 cycles (1 ng) and cleaned up on 0.85X Ampure beads.

[0334] In other experiments, cell-free DNA TAPS samples were prepared from 10 ng and 1 ng cell-free DNA samples as described above for whole genome TAPS. In brief, cell-free DNA samples were used for end repair and A-tailing reactions and connected to Illumina Multiplexing adapters using the KAPA HyperPrep kit according to the manufacturer's protocol. The connected samples were then oxidized once with mTET1CD and then reduced with pyridine borane according to the above protocol. The converted libraries were amplified for 7 cycles (10 ng) and 13 cycles (1 ng) with KAPA Hifi Uracil Plus polymerase and purified on 1X Ampure XP beads.

[0335] WGBS data processing

[0336] Paired end reads were downloaded from Illumina BaseSpace as FASTQ and subsequently quality trimmed using TrimGalore! V0.4.4 (https: / / www.bioinformatics.babraham.ac.uk / projects / trim_galore / ). Read pairs where at least one read was shorter than 35 bp after trimming were removed. Trimmed reads were mapped to a genome combining the mm9 version of the mouse genome, lambda phage, and PhiX (sequences from Illumina iGENOMES) using Bismark v0.19 with the --no_overlap option (F. Krueger, SR Andrews, Bismark: a flexible aligner and methylationcaller for Bisulfite-Seq applications. Bioinformatics 27, 1571-1572 (2011), incorporated herein by reference). '3-C' filters were used to remove reads that were not too highly converted. PCR duplicates were called using Picard v1.119 (http: / / broadinstitute.github.io / picard / ) MarkDuplicates. Regions known to be prone to mapping artifacts were downloaded (https: / / sites.google.com / site / anshulkundaje / projects / blacklists) and excluded from further analysis (EPConsortium, An integrated encyclopedia of DNA elements in the human genome. Nature 489, 57-74 (2012), incorporated herein by reference).

[0337] TAPS data preprocessing

[0338] Paired end reads were downloaded from Illumina BaseSpace and subsequently quality trimmed using Trim Galore! V0.4.4. Read pairs in which at least one read was shorter than 35 bp after trimming were removed. Using BWA memv.0.7.15 (H. Li, R. Durbin, Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1760 (2009), incorporated herein by reference), the trimmed reads were mapped to the genome of the mm9 version of the combined incorporation sequence, lambda phage, and mouse genome. Regions known to be prone to mapping artifacts (https: / / sites.google.com / site / anshulkundaje / projects / blacklists) were downloaded and excluded from further analysis (EPConsortium, Nature 489, 57-74 (2012)).

[0339] Detection of converted bases in TAPS

[0340] The aligned reads were separated into original top (OT) and original bottom (OB) strands using a custom python3 script (MF-filter.py). PCR duplicates were then removed using Picard MarkDuplicates on OT and OB, respectively. Overlapping segments in read pairs were removed using BamUtilclipOverlap (https: / / github.com / statgen / bamUtil) on the deduplicated mapped OT and OB reads, respectively. Modified bases were then detected using samtools mpileup and a custom python3 script (MF-caller_MOD.py).

[0341] Sequencing quality analysis of TAPS and WGBS

[0342] A python3 script (MF-phredder.py) was used to extract quality score statistics for each nucleotide type from raw FASTQ files as downloaded from Illumina BaseSpace.

[0343] Coverage analysis of TAPS and WGBS

[0344] Each base genome coverage file was generated using Bedtools v2.25 genomecov (ARQuinlan, IMHall, BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841-842 (2010), incorporated herein by reference). In order to compare the relative coverage distribution between TAPS and WGBS, the TAPS reads were subsampled for the corresponding median coverage in WGBS using the –s option of samtools view. In the analysis of the coverage in the comparison of WGBS and subsampled TAPS, clipOverlap was used for TAPS and WGBSbam files.

[0345] Analysis of cytosine modifications measured by TAPS and WGBS

[0346] The scores of the modified reads of each base are calculated from the output of Bismark and MF-caller_MOD.py respectively. Intersection operation (Intersection) is performed using Bedtools intersect, and statistical analysis and graphics are generated in R and Matlab. Genomic regions are visualized using IGVv2.4.6 (JT Robinson et al., Integrative genomics viewer. Nat. Biotechnol. 29, 24-26 (2011), incorporated herein by reference). In order to draw the coverage and modification level around CGI, all CGI coordinates of mm9 are downloaded from the UCSC genome browser, which are binned into 20 windows, and up to 50 windows of size 80bp are extended on both sides (as long as they do not reach half the distance from the next CGI). The average modification level (in CpG) and coverage (in all bases, two chains) in each box are calculated using Bedtools map. The value of each box is averaged again and then plotted in Matlab.

[0347] Data processing time simulation

[0348] Paired-end sequencing reads were simulated synthetically using ART42 based on the lambda phage genome (using parameters -p-ss NS50 --errfree --minQ 15-k 0-nf 0-l 75-c 1000000-m240-s 0-ir 0-ir2 0-dr 0-dr2 0-sam-rs 10). Subsequently, 50% of all CpG positions were annotated as modified using a custom python3 script, and two libraries were generated as TAPS (transformed modified bases) or WGBS (transformed unmodified bases). The reads were then processed according to the pipeline used for each method in the paper. The processing time was measured using Linux command time. All analysis steps were performed in single-threaded mode on an Intel Xeon CPU with 250GB of memory.

[0349] Results and discussion

[0350] We found that pic-BH3 can readily convert 5fC and 5caC to DHU ( Figure 4 ). Using MALDI, the reaction was shown to be quantitative for both single nucleosides and oligonucleotides ( Figures 2 to 3 and Figure 6 to Figure 7 ).

[0351] An 11mer DNA oligonucleotide containing 5caC was used as a model to screen for chemicals that react with 5caC as monitored by matrix-assisted laser desorption / ionization mass spectrometry (MALDI). It was found that certain borane-containing compounds reacted efficiently with the 5caC oligonucleotide, resulting in a molecular weight reduction of 41 Da ( Figure 1 and Figure 2 Pyridine borane and its derivative 2-methylpyridine borane (pic-borane) were selected for further study because they are commercially available and environmentally friendly reducing agents.

[0352] The reaction was repeated on a single 5caC nucleoside and confirmed that pyridine borane and pic-borane convert 5caC to dihydrouracil (DHU). Figure 3 , Figure 4 B). Interestingly, pyridine borane and pic-borane were also found to convert 5fC to DHU via an apparent reductive decarboxylation / deamination mechanism ( Figure 4 C and Figure 6 ). The detailed mechanisms of these two reactions remain to be determined. Quantitative analysis of the borane reaction on DNA oligonucleotides by HPLC-MS / MS confirmed that pic-borane converts 5caC and 5fC to DHU with an efficiency of approximately 98% and has no activity on unmethylated cytosine, 5mC, or 5hmC ( Figure 2 B).

[0353] As a uracil derivative, DHU can be recognized as thymine by DNA and RNA polymerases. Therefore, borane reduction can be used to induce the conversion of 5caC to T and 5fC to T, and can be used for base-resolution sequencing of 5fC and 5caC, which we call pyridine borane sequencing ("PS") (Table 6). Borane reduction of 5fC and 5caC to T can be blocked by hydroxylamine conjugation (CX Song et al., Genome-wide profiling of 5-formylcytosine reveals its roles in epigenetic priming. Cell 153, 678-691 (2013), incorporated herein by reference) and EDC coupling (X. Lu et al., Chemical modification-assisted bisulfite sequencing (CAB-Seq) for 5-carboxylcytosine detection in DNA. J. Am. Chem. Soc. 135, 9315-9317 (2013), incorporated herein by reference), respectively. Figure 6 ). This blocking allows the use of PS to sequence exclusively 5fC or 5caC (Table 6).

[0354] Table 6. Comparison of BS and related methods with PS for 5fC and 5caC sequencing.

[0355]

[0356] Additionally, TET enzymes can be used to oxidize 5mC and 5hmC to 5caC, which is then sequenced in a process referred to herein as TET-assisted pyridine borane sequencing (“TAPS”). Figure 5 A to Figure 5 B, Table 1) 5caC was subjected to borane reduction. TAPS can induce C to T conversion of 5mC and 5hmC and can therefore be used for base-resolution detection of 5mC and 5hmC.

[0357] In addition, β-glucosyltransferase (βGT) can label 5hmC with glucose, thereby protecting it from TET oxidation (M. Yu et al., Base-resolution analysis of 5-hydroxymethylcytosine in the mammalian genome. Cell 149, 1368-1380 (2012)) and borane reduction ( Figure 7 ), enabling a process referred to herein as TAPSβ ( Figure 5B, Table 1) for selective sequencing of only 5mC. The 5hmC sites can then be deduced by subtracting TAPSβ from the TAPS measurements. Alternatively, potassium perruthenate (KRuO4), a reagent previously used for oxidative bisulfite sequencing (oxBS) (MJ Booth et al., Quantitative Sequencing of 5-Methylcytosine and 5-Hydroxymethylcytosine at Single-Base Resolution. Science 336, 934-937 (2012)) can be used to replace TET as a chemical oxidant for specifically oxidizing 5hmC to 5fC ( Figure 7 This approach is referred to herein as chemically assisted pyridine borane sequencing ("CAPS") and can be used specifically to sequence 5hmC ( Figure 5 B, Table 1). Thus, TAPS and related methods can, in principle, provide a comprehensive suite of programs to characterize all four cytosine epigenetic modifications ( Figure 5 B, Table 1, Table 6) were sequenced.

[0358] TAPS itself will also detect existing 5fC and 5caC in the genome. However, this will be acceptable given the extremely low levels of 5fC and 5caC in genomic DNA under normal conditions. If under certain conditions, one wants to completely eliminate the 5fC and 5caC signals, this can also be easily achieved by protecting 5fC and 5caC through hydroxylamine conjugation and EDC coupling, respectively, thereby preventing conversion to DHU.

[0359] The performance of TAPS was evaluated by comparing it to bisulfite sequencing, which is currently the standard and most widely used method for base-resolution mapping of 5mC and 5hmC. Naegleria TET-like oxygenase (NgTET1) and mouse Tet1 (mTet1) were used because both can efficiently oxidize 5mC to 5caC in vitro. To confirm the conversion of 5mC to T, TAPS was applied to model DNA containing fully methylated CpG sites and the results showed that it can efficiently convert 5mC to T, as shown by restriction endonuclease digestion ( Figure 8 A to Figure 8 B) and Sanger sequencing ( Fig. 9 A) was confirmed. TAPSβ and CAPS ( Fig.12 ).

[0360] TAPS was also applied to genomic DNA (gDNA) from mouse embryonic stem cells (mESCs). HPLC-MS / MS quantification showed that, as expected, 5mC accounted for 98.5% of cytosine modifications in mESC gDNA; the remainder consisted of 5hmC (1.5%) as well as trace amounts of 5fC and 5caC, and there was no DHU ( Fig. 9 B). After TET oxidation, approximately 96% of cytosine modifications are oxidized to 5caC and 3% are oxidized to 5fC ( Fig. 9 B). After borane reduction, more than 99% of cytosine modifications were converted to DHU ( Fig. 9 B) These results indicate that both TET oxidation and borane reduction are very effective for genomic DNA.

[0361] Both TET oxidation and borane reduction are mild reactions with no significant DNA degradation compared to bisulfite ( Fig.10 A to Fig.10 D), thus providing high DNA recovery. Another clear advantage over bisulfite sequencing is that TAPS is non-destructive and can preserve DNA up to 10 kb ( Fig.10 C). In addition, after TAPS, the DNA remains double-stranded ( Fig.10 A to Fig.10 C), and conversion is independent of DNA length ( Fig.15 A to Fig.15 B).

[0362] In addition, due to its close proximity to natural bases, DHU is compatible with various DNA polymerases and isothermal DNA or RNA polymerases ( Fig.13 A to Fig.13 B) and showed no bias compared to T / C during PCR ( Fig.14 ).

[0363] Whole genome sequencing was performed on two mESC gDNA samples, one converted using TAPS and the other converted using standard whole genome bisulfite sequencing (WGBS) for comparison.

[0364] To assess the accuracy of TAPS, spikes of varying lengths were added that were either completely unmodified or methylated in vitro using either a CpG methyltransferase (M.SssI) or a GpC methyltransferase (M.CviPI) (using the methods above). For short spikes containing 5mC and 5hmC (120mer-1 and 120mer-2), near-complete conversion was observed for both modifications on both strands in both CpG and non-CpG contexts ( Fig.17 A to Fig.17 B).

[0365] TAPS used 100 ng of gDNA, while WGBS used 200 ng of gDNA. To evaluate the accuracy of TAPS, we added three different types of spike controls. λ DNA in which all CpGs were fully methylated was used to estimate the false negative rate (non-conversion rate of 5mC); a 2kb unmodified amplicon was used to estimate the false positive rate (conversion rate of unmodified C); and synthetic oligonucleotide spikes containing methylated and hydroxymethylated C surrounded by any other bases (N5mCNN and N5hmCNN, respectively) were used to compare the conversion rates of 5mC and 5hmC in different sequence backgrounds. The combination of mTet1 and pyridine borane achieved the highest 5mC conversion rate (96.5% and 97.3% in λ and synthetic spikes, respectively) and the lowest conversion rate of unmodified C (0.23%) ( Fig.18 A to Fig.18 B and Fig.16 ). The false negative rate is between 2.7% and 3.5%, and the false positive rate is only 0.23%, which is comparable to bisulfite sequencing: a recent study showed that the average false negative and false positive rates of 9 commercial bisulfite kits were 1.7% and 0.6%, respectively (Holmes, EE et al. Performance evaluation of kits for bisulfite-conversion of DNA from tissues, cell lines, FFPE tissues, aspirates, lavages, effusions, plasma, serum, and urine. PLoS One 9, e93933 (2014)). Synthetic spike-ins showed that TAPS performed well on both 5mC and 5hmC, while TAPS performed only slightly worse in non-CpG backgrounds. The conversion rate of 5hmC was 8.2% lower than that of 5mC, and the conversion rate of non-CpG background was 11.4% lower than that of CpG background ( Fig.18 A).

[0366] WGBS data require special software to perform the alignment and modification calling steps. In contrast, our processing pipeline uses a standard genome aligner (bwa) followed by a custom modification calling tool we call “asTair”. When processing simulated WGBS and TAPS reads (derived from the same hemimethylated source sequence), TAPS / asTair is more than 3 times faster than WGBS / Bismark ( Fig.18 C).

[0367] Since almost all cytosines are converted to thymines, WGBS libraries are characterized by extremely skewed nucleotide compositions, which negatively impacts Illumina sequencing. As a result, WGBS reads show significantly lower sequencing quality scores at cytosine / guanine base pairs compared to TAPS ( Fig.18 E). To compensate for nucleotide composition bias, at least 10% to 20% PhiX DNA (base-balanced control library) is usually added to the WGBS library (see, e.g., Illumina's Whole-Genome Bisulfite Sequencing on the HiSeq 3000 / HiSeq4000 Systems). Therefore, we supplemented the WGBS library with 15% PhiX. This, combined with the reduced information content of the BS-converted reads and the DNA degradation caused by bisulfite treatment, resulted in a significant reduction in the mapping rate of WGBS compared to TAPS ( Fig.18 D and Table 7).

[0368] Table 7. Mapping and sequencing quality statistics for WGBS and TAPS.

[0369]

[0370] Thus, for the same sequencing cost (one NextSeq High Output run), the average depth of TAPS exceeded that of WGBS (21× and 13.1×, respectively; Table 8). Furthermore, TAPS resulted in fewer uncovered regions and showed a more uniform coverage distribution overall, even after downsampling to the same sequencing depth as WGBS (interquartile range: 9 and 11, respectively; Table 8). Fig.19 A and Table 8).

[0371] Table 8. Coverage statistics for TAPS, WGBS, and TAPS downsampled to have approximately the same average coverage as WGBS. Here, coverage is calculated for both strands at all positions in the genome.

[0372]

[0373] For example, CpG islands (CGIs) in particular were generally better covered by TAPS, even when controlling for differences in sequencing depth between WGBS and TAPS ( Fig.21 A), while both showed equivalent demethylation within the CGI ( Fig. 22 ). In addition, WGBS showed a slight bias towards reduced modification levels in highly covered CpG sites ( Fig.23 A), while our results suggest that TAPS exhibits little modification coverage bias ( Fig.23 B) These results demonstrate that TAPS significantly improves sequencing quality compared to WGBS while effectively halving sequencing costs.

[0374] The higher and more uniform genome coverage of TAPS resulted in a greater number of CpG sites being covered by at least three reads. For TAPS, 88.3% of all 43,205,316 CpG sites in the mouse genome were covered at this level, compared to only 77.5% for WGBS ( Fig.21 B and Fig.19 B). TAPS and WGBS produce highly correlated methylation measurements across chromosomal regions ( Fig.21 D and Fig. 20 On a per-nucleotide basis, 32,755,271 CpG positions were covered by at least three reads in both methods ( Fig.21 B). Among these sites, we defined "modified CpGs" as all CpG positions with a modification level of at least 10% (L. Wen et al., Whole-genome analysis of 5-hydroxymethylcytosine and 5-methylcytosine at base resolution in the human brain. Genome Biology 15, R49 (2014)). Using this threshold, 95.8% of CpGs showed matching modification status between TAPS and WGBS. 98.5% of all CpGs covered by at least three reads in WGBS and found to be modified were recalled by TAPS, indicating good consistency between WGBS and TAPS ( Fig.21 C) When comparing the modification levels of each CpG covered by at least three reads in WGBS and TAPS, a good correlation was observed between TAPS and WGBS (Pearson r = 0.63, p < 2e-16, Fig.21 E). Notably, TAPS identified a subset of highly modified CpG positions that were missed by WGBS ( Fig.21 E, lower right). We further validated 7 of these CpGs using orthogonal restriction digestion and real-time PCR assays and confirmed that all of these CpGs were fully methylated and / or hydroxymethylated (Table 9).

[0375] Table 9. Comparison of CmCGG methylation levels in mESCgDNA quantified by TAPS, WGBS and HpaII-qPCR assays. Coverage and methylation levels calculated for each strand by TAPS and WGBS ( mC%) HpaII-digested samples in HpaII-qPCR assay (Ct HpaII ) or control sample (Ct 对照 ) is the average of three replicates. mC% was calculated using the following formula: m C%=2^(Ct 对照 -Ct HpaII )*100%.

[0376]

[0377]

[0378]

[0379]

[0380] Together, these results suggest that TAPS can be a direct alternative to WGBS and in fact provides a more comprehensive view of the methylome than WGBS.

[0381] Finally, TAPS was tested with low input DNA and was shown to be effective with as little as 1 ng of gDNA and, in some cases, as little as 10 pgg of DNA, close to the single-cell level. TAPS was also effective with as little as 1 ng of circulating cell-free DNA. These results demonstrate the potential of TAPS for low input DNA and clinical applications ( Fig.24 A to Fig.24 C, Fig.25 A to Fig.25 B).

[0382] TAPS was tested on three circulating cell-free DNA samples (cfDNA) from one healthy sample, one Barrett's sample, and one pancreatic cancer sample obtained from 1-2 ml of plasma. Each sample was sequenced to approximately 10x coverage following the standard TAPS protocol. Analysis of the cfDNA TAPS results showed that TAPS provided the same high-quality methylome sequencing from low input cfDNA as that provided from bulk genomic DNA, including high 5mC conversion rates ( Fig.26 A), low false positive rate (conversion of unmodified cytosine, Fig. 26B), high mapping rate ( Fig.26 C) and low PCR repetition rate ( Fig.26 D) These results demonstrate the ability of TAPS to diagnose disease from cfDNA.

[0383] TAPS can also distinguish methylation from C to T genetic variation or single nucleotide polymorphism (SNP), thus enabling the detection of genetic variation. Methylation and C to T SNPs lead to different patterns in TAPS: methylation leads to T / G reads in the original top strand (OT) / original bottom strand (OB) and A / C reads in the strands complementary to OT (CTOT) and OB (CTOB), while C to T SNPs lead to T / A reads in OT / OB and (CTOB / CTOT) Fig. 27 ). This further increases the utility of TAPS in providing methylation information and genetic variation, and therefore mutations, in one experiment and sequencing run. This capability of the TAPS method disclosed herein provides integration of genomic and epigenetic analysis and greatly reduces sequencing costs by eliminating the need to perform standard whole genome sequencing (WGS).

[0384] In summary, we developed a series of PS-derived bisulfite-free base-resolution sequencing methods for cytosine epigenetic modifications and demonstrated the utility of TAPS for global methylome sequencing. By using mild enzymatic and chemical reactions to directly detect 5mC and 5hmC at base resolution with high sensitivity and specificity without affecting unmodified cytosines, TAPS is superior to bisulfite sequencing as it provides high-quality and more complete methylomes at half the sequencing cost. Therefore, TAPS may replace bisulfite sequencing and become the new standard for DNA methylcytosine and hydroxymethylcytosine analysis. Unlike the recently reported bisulfite-free 5fC sequencing method, which modifies cytosine extensively (B. Xia et al., Bisulfite-free, base-resolution analysis of 5-formylcytosine at the genome scale. Nat. Methods 12, 1047-1050 (2015); C. Zhu et al., Single-Cell 5-Formylcytosine Landscapes of Mammalian Early Embryos and ESCs at Single-Base Resolution. Cell Stem Cell 20, 720-731 (2017)), TAPS converts modified cytosine to DHU, which is a nearly natural base that can be "read" as T by common polymerases and is potentially compatible with PCR-free DNA sequencing. TAPS is compatible with a variety of downstream analyses, including but not limited to pyrophosphate sequencing, methylation-sensitive PCR, restriction digestion, MALDI mass spectrometry, microarrays, and whole genome sequencing. Because TAPS can retain long DNA, it will be very valuable for studying certain difficult-to-map areas when combined with long-read sequencing technologies such as SMRT sequencing and nanopore sequencing. Pull-down methods can also be combined with TAPS to further reduce sequencing costs and add base resolution information to low-resolution affinity-based maps. In this article, it is demonstrated that TAPS can directly replace WGBS in daily use while reducing the cost, complexity, and time required for analysis. This may lead to epigenetic analysis being more widely used in academic research and clinical diagnosis.

[0385] Example 2: Endonuclease-enriched TAPS (eeTAPS)

[0386] method

[0387] Preparation of spike-in controls.

[0388] The 4 kb spike-in control was prepared by PCR amplification of pNIC28-Bsa4 plasmid (Addgene, catalog number 26103) in a reaction containing 1 ng DNA template, 0.5 μM primers and 1X Phusion high-fidelity PCR premix (Thermo Scientific) containing HF buffer. Primer sequences are listed in Table 10. The PCR product was purified by Zymo-IC column (Zymo Research) and methylated with HpaII methyltransferase (New England Biolabs) at 37°C for 2 hours in 50 μL reaction. The methylated product was purified with 1X Ampure XP beads (Beckman Coulter) according to the manufacturer's protocol. Fully CpG methylated λ-DNA was prepared by methylating unmethylated λ-DNA (Promega) with M.SssI enzyme (New England Biolabs) as previously described (Wu, H., Wu, XJ, and Zhang, Y. (2016) Base-resolution profiling of active DNA demethylation using MAB-seq and caMAB-seq. Nat Protoc, 11: 1081-1100).

[0389] Preparation of vector DNA.

[0390] Vector DNA was prepared by PCR amplification of pNIC28-Bsa4 plasmid (Addgene, catalog number 26103) in a reaction containing 1 ng DNA template, 0.5 μM primers and 1X Phusion High Fidelity PCR Premix (Thermo Scientific) with HF buffer. Primer sequences are listed in Table 10. PCR products were purified by Zymo-IC columns (Zymo Research), fragmented by Covaris M220 and purified on 0.9×Ampure XP beads to select fragments of 200-500 bp.

[0391] Table 10. Primer sequences used to amplify 4 kb spike-in model DNA and vector DNA

[0392]

[0393] mESC culture and isolation of genomic DNA.

[0394] E14 mESCs were cultured on gelatin-coated plates in DMEM (Invitrogen) supplemented with 15% FBS (Gibco), 2 mM L-glutamine (Gibco), 1% non-essential amino acids (Gibco), 1% penicillin / streptavidin (Gibco), 0.1 mM β-mercaptoethanol (Sigma), 1,000 units of sml-1 leukemia inhibitory factor (Millipore), 1 μM PD0325901 (Stemgent), and 3 μM CHIR99021 (Stemgent). Cultures were maintained at 37°C and 5% CO2 and passaged every 2 days. To isolate genomic DNA, cells were harvested by centrifugation at 1,000 g and room temperature for 5 minutes. DNA was extracted using the Quick-DNA Plus kit (Zymo Research) according to the manufacturer's protocol.

[0395] Expression and purification of mTet1CD

[0396] Expression and purification of the mTet1 catalytic domain (mTet1CD) were performed as described above.

[0397] mTet1CD oxidation.

[0398] 200 ng of mESC gDNA spiked with 0.5% methylated λ-DNA and 0.025% unmodified 2 kb DNA control was oxidized in 50 μl of a reaction containing 50 mM HEPES buffer (pH 8.0), 100 μM ammonium iron (II) sulfate, 1 mM α-ketoglutarate, 2 mM ascorbic acid, 1 mM dithiothreitol, 100 mM NaCl, 1.2 mM ATP, and 4 μM mTet1CD at 37°C for 80 min. Afterwards, 0.8 U proteinase K (New England Biolabs) was added to the reaction mixture and incubated at 50°C for 1 h. The product was cleaned up on a Bio-Spin P-30 gel column (Bio-Rad) and 1.8X Ampure XP beads according to the manufacturer's instructions.

[0399] Screening for DHU digestion endonucleases

[0400] 1 μg of mESC gDNA was enzymatically oxidized using mTet1CD as described above. Subsequently, the oxidized DNA in 35 μl of water was reduced in 50 μl of a reaction containing 600 mM sodium acetate solution (pH 4.3) and 1 M pyridine borane in an Eppendorf ThermoMixer at 37°C and 850 rpm for 16 h. The product was purified using a Zymo-Spin column. Then, 40 ng of TAPS transformed or untransformed DNA was digested using the following enzymes (all from New England Biolabs) according to the manufacturer's protocol: USER (Catalog No. M5505S), Endonuclease IV (Catalog No. M0304S), Tma Endonuclease III (Catalog No. M0291S), Endonuclease V (Catalog No. M0305S), UDG (Catalog No. M0280S), Tth Endonuclease IV (Catalog No. M0294S), Fpg (Catalog No. M0240S), Endonuclease III (Nth) (Catalog No. M0268S), Endonuclease VIII (Catalog No. M0299S), APE1 (Catalog No. M0282S). The digestion products were purified on 1.8× Ampure XP beads according to the manufacturer's instructions and 10 ng of each product was run on a 2% agarose gel.

[0401] eeTAPS

[0402] 0.05% of 4kb control methylated in CCGG sequence background was added to mESC genomic DNA (200ng, 50ng, 10ng or 1ng), and the mESC genomic DNA was oxidized with mTet1CD as described above. Subsequently, the oxidized DNA in 35 μL of water was reduced in 50 μL of a reaction containing 600mM sodium acetate solution (pH=4.3) and 1M pyridine borane in an Eppendorf ThermoMixer at 37°C and 850 rpm for 16 hours. The product was purified by a Zymo-Spin column. The converted sample was digested for 1 hour at 37°C in a reaction containing 2U of USER enzyme (New England Biolabs) in CutSmart buffer and size selected on 0.35×-1×Ampure XP beads. According to the manufacturer's protocol, the KAPA HyperPrep kit was used for end repair and A-tailing reaction and connection of Illumina Multiplexing adapters. To prepare the control library, 200 ng of unconverted mESC gDNA containing spike-in controls was digested with USER enzyme, size selected and used for library construction as described above. The final sequencing library was amplified with KAPA HiFi HotStart ReadyMix for 6 cycles (for 200 ng input), 8 cycles (50 ng input), 10 cycles (10 ng input) or 14 cycles (1 ng input) and size selected on 0.35×-1×Ampure XP beads. The final library was sequenced with paired end 80 bp on a NextSeq 500 sequencer (Illumina) along with other sequencing libraries.

[0403] rrTAPS

[0404] 1 μg of mESC gDNA was spiked with 1% CpG methylated lλ and digested with fast digestion Msp1 enzyme (Thermo Scientific) in 50 μL reaction at 37°C for 30 min. The digested DNA was purified by phenol / chloroform precipitation. Ultra TM II DNA Library Preparation Kit was used for end repair and A-tailing reactions and ligation of Illumina Multiplexing adapters. The ligated library was then purified on 1.6× Ampure XP beads and run on a 1% agarose gel. DNA fragments of 100–400 bp were excised and purified using the manufacturer’s protocol. DNA gel extraction kit was used to purify it. 100ng of carrier DNA was incorporated into the sample connected to the adapter and double oxidized with mTet1CD as described above. The oxidized DNA in 35 μL of water was reduced in 50 μL of a reaction containing 600mM sodium acetate solution (pH=4.3) and 1M pyridine borane in an Eppendorf ThermoMixer at 37°C and 850 rpm for 16 hours. The product was purified by Zymo-Spin column. The final sequencing library was amplified for 6 cycles with KAPA HiFi Uracil (+) premix and cleaned up on 1X Ampure XP beads. The final library was sequenced with paired ends 80bp together with other sequencing libraries on a NextSeq 500 sequencer (Illumina).

[0405] Data analysis of eeTAPS

[0406] Raw sequencing reads were processed using TrimGalore (https: / / www.bioinformatics.babraham.ac.uk / projects / trim_galore / ) to perform adapter and quality trimming using the following parameters: -- paired – length 35. Cleaned reads were aligned using bwa mem 0.7.17-r1188 (Li, H. and Durbin, R. (2009) Fastand accurate short read alignment with Burrows-Wheeler transform. Bioinformatics, 25, 1754-1760) with default parameters. For the 4 kb model DNA, pNIC28-Bsa4 sequences from 2,627 to 6,911 were used as references. For mESC gDNA, the mm9 genome was used as a reference. Only correctly mapped read pairs (read 1 with an identifier designated as 83 or 99) were extracted to calculate coverage for the endpoints and read-throughs of the entire fragment using bedtools v2.27.1 (Quinlan, AR and Hall, IM (2010) BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics, 26, 841-842), and uncut sites were also considered when calculating the cleavage score. The detailed computational workflow for analyzing eeTAPS can be found here (https: / / gitlab.com / jfeicheng / userenrich). Two technical replicates were sequenced for eeTAPS. When analyzing the effect of sequence depth on eeTAPS, the alignment files from the two replicates were merged and then subsampled according to a fraction from 0.1 to 1 using samtools view (Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R. Genome Project Data Processing, S. (2009) The Sequence Alignment / Map format and SAMtools. Bioinformatics, 25, 2078-2079).

[0407] Data analysis of rrTAPS

[0408] The raw sequencing reads were processed using seqtk (https: / / github.com / lh3 / seqtk) trimfq-b 2 to trim 2 bp from the left side of each read. rrTAPS (8) was processed using Astair 3.2.7. The cleaned reads were aligned using the mm9 genome as a reference using Astair. Methylated CpGs were extracted using Astair calls.

[0409] Comparison of wgTAPS, eeTAPS, and rrTAPS in mESCs

[0410] wgTAPS data were downloaded from GSE112520 (Liu, YB, Siejka-Zielinska, P., Velikova, G., Bi, Y., Yuan, F., Tomkova, M., Bai, CS, Chen, L., Schuster-Bockler, B. and Song, CX (2019) Bisulfite-free direct detection of 5-methylcytosine and 5-hydroxymethylcytosine at base resolution. Nat Biotechnol, 37, 424-429). Only CpG sites covered by at least 4 reads were considered covered CpG sites. The number of methylated CpG sites was defined according to the following criteria: CpG methylation level > the first quartile of all CpG methylation levels (0.5 for wgTAPS and 0.28 for eeTAPS). The genome was divided into non-overlapping 100 kb windows using bedtools. CpG island traces were downloaded from http: / / hgdownload.soe.ucsc.edu / goldenPath / mm9 / database / cpgIslandExt.txt.gz. Gene annotation files were downloaded from http: / / hgdownload.soe.ucsc.edu / goldenPath / mm9 / database / refGene.txt.gz. For wgTAPS, the average methylation was used to assign methylation in each window. For eeTAPS, CpG sites with a cleavage score above 0.28 were assigned as methylated, while sites below this cutoff were assigned as unmethylated, so the methylation level for each bin was measured as the number of methylated CpGs / (number of methylated CpGs + number of unmethylated CpGs). Expression data of the e14 mESC cell line were taken from GEO entry GSE72855 (Neri, F., Rapelli, S., Krepelova, A., Incarnato, D., Parlato, C., Basile, G., Maldotti, M., Anselmi, F., and Oliviero, S. (2017) Intragenic DNA methylation prevents spurious transcription initiation. Nature, 543, 72-77) and were used to classify the genes into four groups according to their expression levels.

[0411] result

[0412] Development of eeTAPS

[0413] To enrich for methylated CpG sites for sequencing after the TAPS reaction, endonucleases that specifically cleave TAPS products containing DHU were identified. Ten commercially available endonucleases with known ability to digest DHU or structurally similar nucleotides (uracil, 5-hydroxymethyluracil, dihydrothymine) were tested. Nucleases including USER, endonuclease VIII, endonuclease III, and Fpg cleaved TAPS-converted DNA, while other nucleases such as APE 1 and UDG did not cleave TAPS-converted DNA substantially ( Fig.28 A). USER was chosen because it showed the highest cleavage efficiency for TAPS-transformed DNA, while having the least effect on untransformed DNA ( Fig.28 A).

[0414] TAPS conversion was then combined with USER digestion to enrich for methylated sequences. First, unfragmented genomic DNA (gDNA) from mouse embryonic stem cells (mESCs) was TAPS converted and USER digested. The cleavage produced DNA fragments ranging from 100 bp to 10 kb ( Fig.28 B). It is speculated that shorter fragments correspond to densely methylated regions, while longer fragments correspond to sparsely methylated parts of the genome. The fragmented DNA was size-selected to retain fragments of 200 bp-1 kb to represent the medium methylation state, and an Illumina sequencing library was prepared ( Fig.29 A. Fig.28 B). To identify and quantify methylated CpG sites, a computational pipeline was developed. Methylation levels were calculated as the number of reads cleaved at each CpG site divided by the total number of reads cleaved or covering each CpG site ( Fig.29 A).

[0415] To evaluate the performance of eeTAPS, a 4 kb spike-in model DNA was prepared with all CpGs in CCGG sites methylated by HpaII methyltransferase, which also produced some low-level CpG methylation in off-target non-CCGG sites. Excellent agreement (Pearson correlation coefficient (r) = 0.98) was obtained between eeTAPS methylation and bisulfite methylation in the model DNA ( Fig.28 C), which supports the ability of eeTAPS to quantify DNA methylation levels ( Fig.29 B). On the other hand, in the control sample in which USER enzyme was used to digest the non-TAPS-converted 4 kb model DNA, no CpG with significant methylation was detected ( Fig.29 B), indicating that eeTAPS is highly specific in detecting methylation. Taken together, these results indicate that eeTAPS can accurately inform on the DNA methylation status in a 4 kb model DNA.

[0416] eeTAPS on mESCs

[0417] After demonstrating the capability of eeTAPS on model DNA, eeTAPS was used to analyze the CpG methylation profile in mESC gDNA (Table 11). eeTAPS is considered a cost-effective approach because it will enrich for methylated CpGs. In fact, we found that 84.6% of the fragments in eeTAPS ended with C / G ( Fig.31 A). Further analysis of the distance between the cleavage site and the nearest CpG showed that 72.7% of the cleavage events occurred at CpG ( Fig.31 B).

[0418] To further illustrate this point, eeTAPS was compared with wgTAPS and rrTAPS ( Fig.30 A, Table 11). First, the number of covered CpG sites in all three methods was compared (CpGs with coverage > 3 were considered covered CpGs). wgTAPS and eeTAPS covered most CpG sites (19.3M and 15.2M sites, respectively; 92.1% and 74.2% of total CpGs, respectively), while rrTAPS covered only about 1.5M sites (7.2% of total CpGs) ( Fig.30 B). To further compare the genomic regions covered by these assays, the covered sites were mapped to different genomic regions (Bogu, GK, Vizan, P., Stanton, LW, Beato, M., Di Croce, L. and Marti-Renom, MA (2015) Chromatin and RNA Maps Reveal Regulatory Long Noncoding RNAs in Mouse. Mol Cell Biol, 36, 809-819). Intergenic methylation (such as those in distal regulatory elements) is also known to be important for gene regulation. We found that wgTAPS and eeTAPS shared similar broad signature distributions, with the majority of covered CpG sites located in heterochromatin (65.6% and 71%, respectively), whereas rrTAPS was biased toward promoter regions (46% of covered CpGs) ( Fig.30 B). At single CpG resolution, eeTAPS and wgTAPS showed good correlation (r = 0.56, Fig.30C), while rrTAPS and wgTAPS showed excellent correlation (r = 0.92, Fig.31 C) eeTAPS overestimates methylation, likely because DNA fragments with unmethylated CpGs are longer and amplify less effectively.

[0419] Table 11. Mapping statistics of eeTAPS, wgTAPS, and rrTAPS

[0420]

[0421] Next, we compared the methylated CpG sites covered in the different assays. eeTAPS and wgTAPS showed high agreement in the sites defined as methylated CpG (mCpG) sites (82.4% of the mCpG sites detected by wgTAPS were also detected by eeTAPS, Fig.30 D), while rrTAPS detected only about 20.0% of mCpG ( Fig.30 D). In addition, eeTAPS showed high reproducibility, with 81% of mCpGs observed in replicates ( Fig.31 D). Taken together, these analyses support that eeTAPS can accurately and robustly detect mCpG sites genome-wide and can be a powerful semi-quantitative tool to measure methylation at single CpG resolution.

[0422] Comparison of eeTAPS and wgTAPS in genomic features

[0423] Methylation patterns across different genomic features were compared between eeTAPS and wgTAPS. To quantify methylation levels in a region, average methylation was used in wgTAPS and the fraction of methylated CpGs compared to the total number of detected CpG sites was used in eeTAPS. eeTAPS and wgTAPS showed highly correlated chromosome-wide methylation patterns, but eeTAPS overestimated methylation levels ( Fig.32 A. Fig.32 B). CpG islands (CGIs) are known to lack DNA methylation, and this is reflected in both eeTAPS and wgTAPS ( Fig.32 C). The correlation between the methylation levels at CGIs measured using eeTAPS and wgTAPS was 0.81, further demonstrating that eeTAPS can accurately capture the CpG methylation status in various features ( Fig.32 D).

[0424] Previous studies have shown that DNA methylation in promoter regions is generally inversely correlated with gene expression. We divided genes into four groups based on their expression levels and plotted the average methylation from 4 kb upstream to 4 kb downstream of the transcription start site (TSS). Using both eeTAPS and wgTAPS, we found that highly expressed genes tended to have lower methylation levels, while genes with lower expression levels had higher methylation levels ( Fig.33 We also compared the methylation distribution in different chromatin features as defined previously (Bogu, GK, Vizan, P., Stanton, LW, Beato, M., Di Croce, L. and Marti-Renom, MA (2015) Chromatin and RNA Maps Reveal Regulatory LongNoncoding RNAs in Mouse. Mol Cell Biol, 36, 809-819) ( Fig.32 E. Fig.32 F). Consistent with previous studies, heterochromatin regions are highly methylated, whereas promoter regions in euchromatin generally lack CG methylation ( Fig.32 F).

[0425] Application of eeTAPS on low input samples

[0426] To evaluate the performance of eeTAPS for low input samples, we applied eeTAPS to 1 ng, 10 ng, and 50 ng mESC gDNA. For the 200 ng mESC DNA sample, sequencing reads were downsampled to 2x to match the sequencing depth of the low input sample. We found that 27% of the mCpG sites identified by wgTAPS could also be recovered using 1 ng DNA in eeTAPS. When 50 ng mESC DNA was used, the percentage increased to 47% ( Fig.34 A). To further compare the genome-wide methylation profiles with these low-input samples, we binned the genome into 100 kb windows and calculated the mean methylation level within each bin ( Fig.34 B). Highly consistent methylation profiles were observed between these low input samples (r = 0.88, 0.92, and 0.95 for 1 ng, 20 ng, and 50 ng, respectively, compared to 2 x 200 ng eeTAPS). Fig.34 C), further demonstrating the feasibility of eeTAPS for low-input DNA samples.

[0427] Effect of sequencing depth on eeTAPS

[0428] To evaluate the effect of sequencing depth on the total number of detectable mCpG sites, we downsampled eeTAPS and evaluated the performance. The total number of detected mCpG sites increased with increasing sequencing depth ( Fig.35 A). Nevertheless, at 4x (70M reads) sequencing depth, 74% of mCpG sites could be successfully detected (of the 14.9M mCpG sites detected in wgTAPS, 10.9M sites were also defined as mCpG in 4x eeTAPS). Similar trends were observed in terms of methylation correlations across chromosomes and CGIs ( Fig.35 B), and the Pearson correlation coefficient in CGI reaches 0.83 for 4x coverage ( Fig.35 B) Thus, we demonstrated that eeTAPS can accurately provide global methylation profiles at a lower sequencing cost compared to WGBS.

[0429] discuss

[0430] wgTAPS can provide the most comprehensive quantitative and base-resolution whole-genome methylation. However, the high cost of whole-genome sequencing and the large amount of data generated still limit its widespread application in many projects. Methylated CpG sites only account for a small proportion of the mammalian genome, so whole-genome sequencing is not the most data-efficient way to understand the methylation status. A cost-effective approach is to specifically select only regions containing methylated CpGs for further analysis by sequencing. Reduced-representation sequencing based on restriction endonuclease digestion enrichment of CpG-rich regions and subsequent bisulfite sequencing is an effective methylation analysis approach; however, this method only covers a small portion of CpG sites in the genome (Meissner, A., Gnirke, A., Bell, GW, Ramsahoye, B., Lander, ES and Jaenisch, R. (2005) Reduced representation bisulfite sequencing for comparative high-resolution DNA methylation analysis. Nucleic Acids Res, 33, 5868-5877). TAPS is compatible with the reduced-representation approach, and we have demonstrated that rrTAPS can accurately quantify methylation in subsets of the genome, especially at CGIs. In addition to the recognized biological significance of CpG methylation in gene promoters, extensive research has also focused on intergenic DNA methylation because of its possible involvement in cell fate commitment and tumorigenesis. To expand the enrichment approach to genome-wide CpG sites, we further exploited the advantage of TAPS in directly converting 5mC to DHU, which allows DHU-sensitive endonuclease-induced cleavage at these specific modified bases. By combining selective enrichment of these fragments with sequencing, we demonstrated that eeTAPS is able to detect CpG methylation on a genome-wide scale. This strategy is possible because TAPS can directly detect methylated cytosines. Unlike traditional antibody-based enrichment methods, eeTAPS offers the possibility of directly detecting methylation at single CpG resolution.

[0431] We demonstrated that eeTAPS can be used to capture genome-wide methylation signatures at single-CpG resolution in a cost-effective manner, filling the gap between rrTAPS and wgTAPS. The eeTAPS methylation profiles across multiple different genomic features correlated well with those obtained using wgTAPS. Furthermore, with only 70M reads, eeTAPS detected 74% of the methylated CpGs detected by wgTAPS. A potential limitation of eeTAPS caused by the variable spacing of methylated CpG sites may be the semi-quantitative measurement of methylation levels at single CpG sites. In this study, we selected fragments ranging from 200bp to 1kb as a proof of concept. Despite this, the correlation coefficient between wgTAPS and eeTAPS remained as high as 0.56. Based on the mild nature of the TAPS reaction, we further demonstrated that eeTAPS is also a promising cost-effective approach for methylation detection in low-input DNA samples.

Claims

1. A method for cleaving a modified target DNA, the method comprising: converting 5caC and / or 5fC in the target DNA to dihydrouracil (DHU) to provide a modified target DNA comprising one or more DHUs; as well as contacting the modified target DNA comprising one or more DHUs with one or more endonucleases that cleave the modified target DNA at or near the one or more DHUs, Wherein, the endonuclease is a DHU-sensitive endonuclease.

2. The method of claim 1, wherein the method further comprises, before the conversion step, modifying the target DNA containing 5mC and / or 5hmC, wherein the modification comprises the step of converting the 5mC and / or 5hmC in the target DNA into 5-carboxycytosine (5caC) and / or 5-formylcytosine (5fC).

3. The method of claim 2, wherein the method further comprises, before the step of converting the 5mC and / or 5hmC, modifying the target DNA comprising 5mC and 5hmC, the modification comprising the step of adding a blocking group to the 5hmC in the target DNA.

4. The method of claim 3, wherein the blocking group added to the 5hmC is a sugar.

5. The method of claim 2, wherein the step of converting the 5mC and / or 5hmC in the target DNA into 5caC and / or 5fC comprises contacting the target DNA with a ten-eleven translocation TET enzyme.

6. The method of claim 5, wherein the TET enzyme is selected from the group consisting of: human TET1, TET2 and TET3; mouse TET1, TET2 and TET3; Naegleria TET (NgTET); Coprinus cinereus TET (CcTET) and derivatives or analogs thereof.

7. The method of claim 6, wherein the TET enzyme is NgTET, mouse TET2, human TET1 or a derivative thereof.

8. The method of claim 2, wherein the step of converting the 5hmC to 5caC and / or 5fC comprises contacting the target DNA with an oxidizing agent.

9. The method of claim 8, wherein the oxidizing agent is potassium perruthenate, Cu(II) / TEMPO, potassium ruthenate or manganese oxide.

10. The method of claim 1, wherein the step of converting the 5caC and / or 5fC to DHU comprises contacting the target DNA with a reducing agent.

11. The method of claim 10, wherein the reducing agent is selected from the group consisting of pyridine borane, 2-picoline borane (pic-BH3), borane, sodium borohydride, sodium cyanoborohydride and sodium triacetoxyborohydride.

12. The method of claim 1, wherein the one or more endonucleases are selected from one or more of the group consisting of: endonuclease III, Tma endonuclease III, formamidopyrimidine DNA glycosylase (Fpg), and hNEIL1.

13. The method of claim 12, wherein the endonuclease comprises a uracil-specific excision reagent (USER).

14. The method of claim 1, further comprising the step of adding an adaptor DNA molecule to the cleaved modified target DNA.

15. The method of claim 1, further comprising detecting a cleaved modified target DNA sequence, wherein the presence of a cleavage site provides the location of a 5caC or 5fC in the target DNA.

Images