Recombinant hvt and uses thereof

By inserting nucleotide sequences of avian influenza virus HA and Newcastle disease virus F proteins into the non-coding region of recombinant turkey herpesvirus (HVT), the competition and stability issues of existing vaccines in multi-antigen expression were resolved, achieving highly effective protection for poultry.

CN114369580BActive Publication Date: 2026-05-01CEVA ANIMAL HEALTH TECHNOLOGY (HANGZHOU) CO LTD +1
View PDF 10 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CEVA ANIMAL HEALTH TECHNOLOGY (HANGZHOU) CO LTD
Filing Date
2020-10-15
Publication Date
2026-05-01

AI Technical Summary

Technical Problem

Existing recombinant avian herpesvirus vaccines suffer from pathogen competition and immunosuppression when encoding multiple antigens, and their stability is insufficient, making it difficult to effectively express multiple genes in poultry to combat various diseases.

Method used

Recombinant turkey herpesvirus (HVT) vectors were designed by inserting nucleotide sequences encoding avian influenza virus HA protein and Newcastle disease virus F protein into the non-coding regions of the viral genome. Different non-coding regions were used as insertion sites, and specific promoters were combined to ensure stable gene expression.

Benefits of technology

It achieves efficient and stable expression of multiple antigens in poultry, induces a strong immune response, provides high protection against Newcastle disease and avian influenza, and significantly reduces viral load.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114369580B_ABST
    Figure CN114369580B_ABST
Patent Text Reader

Abstract

The present invention relates to recombinant HVT and uses thereof. In particular, the present invention relates to recombinant herpesvirus comprising recombinant nucleotide sequences encoding at least two different antigens. The present invention is particularly suitable for the production of vaccines for immunizing avian species against avian pathogens.
Need to check novelty before this filing date? Find Prior Art

Description

Recombinant HVT and its uses Technical Field

[0001] This invention relates to recombinant avian herpesviruses encoding different antigens and their uses. This invention is suitable for the production of vaccines to immunize avian species against avian pathogens. Background Technology

[0002] Poultry meat and eggs are important food sources, and their consumption continues to increase due to population growth and their high quality-price ratio. To ensure poultry health and food safety, poultry vaccine technology has become a global concern.

[0003] Viral vectors expressing pathogen proteins are commonly used in poultry vaccines to combat target pathogens. Vaccines containing such viral vectors induce the expression of foreign pathogen proteins in the infected host, which may lead to protective immunity.

[0004] Many different types of viruses have been investigated as candidate vectors for avian vaccination, such as adenovirus, AAV, fowlpox virus, and herpesvirus.

[0005] Three types of herpesviruses have been identified: MDV1, MDV2, and MDV3 (also known as turkey herpesvirus (HVT)). These viruses share high similarity (see Kingham et al., Journal of General Virology (2001) 82, 1123-1135), and all have been used to prepare recombinant viruses in which foreign genes derived from pathogens are integrated for use as vaccines in poultry, particularly domestic chickens.

[0006] Although such vaccine formulations have provided highly effective results for vaccinating avian species against many diseases, competition between pathogens and immunosuppression may occur when avian birds are injected with two or more recombinant herpesviruses that each encode different antigens.

[0007] In order to overcome this interference and to facilitate vaccination against a variety of diseases, various attempts have been made to produce multivalent herpesviruses that encode several antigens.

[0008] The first studies inserted several genes into a single cloning site in the herpesvirus genome (see, for example, EP1026246). However, such constructs either failed to provide the required level of protective immunity or proved to be unstable, losing all or part of the foreign genes during repeated passages in cultured cells.

[0009] WO2013 / 144355 and WO2020 / 127964 report stable herpesviruses encoding multiple foreign antigens, which are obtained using a combination of cloning sites located in the non-coding region of the viral genome.

[0010] WO2013 / 057236, WO2013 / 082327 and WO2013 / 082317 report an alternative approach to designing multivalent HVTs, which involves cloning at least one gene into the US2 coding sequence of the herpesvirus.

[0011] Given the number of pathogens and species, there is a need in the field for other recombinant multivalent herpesviruses that can stably express multiple genes in vivo and are suitable for vaccination in poultry, particularly domestic poultry. Summary of the Invention

[0012] This invention provides novel antigens and recombinant avian herpesviruses.

[0013] Specifically, this invention provides novel antigens that effectively generate an immune response against avian influenza viruses. This invention also provides nucleic acid molecules encoding said antigens, vectors containing said nucleic acids, and vaccines containing such antigens and / or nucleic acids and / or vectors.

[0014] The present invention also provides a recombinant turkey herpesvirus (HVT) comprising a nucleotide sequence encoding a hemagglutinin (HA) protein having an amino acid sequence selected from any of SEQ ID NO: 1-6, or an immunogenic fragment or variant thereof. Preferably, the nucleotide sequence is inserted into a non-coding region of the viral genome, more preferably selected from the non-coding region between UL45 and UL46 and the non-coding region between SORF3 and US2.

[0015] The present invention also provides a recombinant turkey herpesvirus (HVT) comprising: (i) a nucleotide sequence encoded by inserting into a first insertion site in the viral genome, having an amino acid sequence selected from any of SEQ ID NO: 1-6, of a hemagglutinin (HA) protein or an immunogenic fragment or variant thereof; and (ii) a nucleotide sequence encoded by inserting into a second insertion site in the viral genome, of encoding a nucleotide sequence encoded by inserting into a Newcastle disease virus F protein or an immunogenic fragment or variant thereof, wherein the first and second insertion sites are located in different non-coding regions of the viral genome selected from: a non-coding region between UL45 and UL46, and a non-coding region between SORF3 and US2.

[0016] The present invention also relates to a nucleic acid comprising the genome of recombinant HVT as defined above, and to a vector (e.g., a plasmid) containing such nucleic acid.

[0017] The present invention also relates to a cell containing recombinant HVT or nucleic acid or vector as defined above.

[0018] Another object of the present invention is a composition comprising recombinant HVT as defined above and a suitable excipient or diluent.

[0019] Another object of the present invention is a composition comprising nucleic acids or cells as defined above and suitable excipients or diluents.

[0020] Another object of the present invention is a vaccine comprising an immunologically effective amount of recombinant HVT, nucleic acid and / or cells as defined above.

[0021] Another object of the present invention is the use of recombinant HVT, nucleic acid or cells as defined above for immunizing poultry, such as domestic poultry, against Newcastle disease virus (NDV) and avian influenza virus (AIV) and / or related diseases.

[0022] Another object of the present invention is to use recombinant HVT, nucleic acid or cells as defined above for the protection of poultry, such as domestic poultry, against diseases caused by NDV and AIV.

[0023] Another object of the present invention is a vaccine as defined above, which is used to vaccinate poultry, such as domestic poultry, against NDV and AIV.

[0024] Another object of the present invention is a method for vaccinating poultry, the method comprising administering to the poultry a composition, vaccine or virus as defined above.

[0025] Another object of the present invention is a method for inducing an immune response against an antigen in poultry, the method comprising administering the poultry a composition, vaccine or virus as defined above.

[0026] The present invention also provides a vaccine kit for immunizing poultry, comprising the following components:

[0027] a. An effective amount of the composition or vaccine as defined above, and

[0028] b. An instrument for administering the composition or vaccine to the poultry.

[0029] This invention can be used for vaccination in any poultry to combat NDV and / or AIV and / or related disorders or conditions. It is particularly suitable for vaccinating poultry such as chickens. Attached Figure Description

[0030] Figure 1 shows a schematic diagram of recombinant bivalent HVT constructs (FW206, FW209, FW247, FW248, FW249, FW250, FW251, FW252) with NDV F gene and AIV HA-H9 gene according to the present invention, and recombinant monovalent HVT constructs with NDV F gene (FW168) or AIV HA-H9 gene (FW202).

[0031] Figure 2 shows the results of the immunofluorescence assay, confirming the expression of (A) NDV F protein (green fluorescence), (B) AIV HA-H9 protein (red fluorescence), and (C) the combined (yellow) expression of the rHVT / ND-H9 construct.

[0032] Figure 3 shows the results of Western blot analysis for detecting NDV F protein expression in constructs FW168, FW206, and FW209.

[0033] Figure 4 shows the results of Western blot analysis for detecting AIV HA-H9 protein expression in constructs FW206 and FW209.

[0034] Figure 5 shows the results of Western blot analysis of NDV F protein expression in constructs FW247, FW248, FW249, FW250, FW251, FW252, FW168, and FW206.

[0035] Figure 6 shows the results of Western blot analysis of AIVHA-H9 protein expression in constructs FW247, FW248, FW249, FW250, FW251, FW252 and FW206.

[0036] Figure 7 shows the NDV ELISA titers obtained using a commercial NDV ELISA kit in chickens vaccinated with construct FW206.

[0037] Figure 8 shows the AIV H9 HI titer in chickens vaccinated with construct FW206.

[0038] Figure 9 shows the AIV load in tracheal swabs from chickens vaccinated with construct FW206 after irritation with AIV of the H9 subtype.

[0039] Figure 10 shows the air sac lesion score of chickens vaccinated with construct FW206 after irritation with AIV of the H9 subtype.

[0040] Figure 11 shows the NDV ELISA titers obtained using a commercially available NDV ELISA kit in chickens vaccinated with constructs FW247, FW248, FW249, FW250, FW251, and FW252.

[0041] Figure 12 shows the AIV H9 HI titers obtained using a commercial NDV ELISA kit in chickens vaccinated with constructs FW247, FW248, FW249, FW250, FW251, and FW252.

[0042] This invention provides novel antigens suitable for generating a strong immune response against AIV. The invention also relates to recombinant avian herpesviruses, their manufacture, compositions comprising them, and their uses.

[0043] definition

[0044] This disclosure will be best understood by referring to the definitions below.

[0045] For the purposes of herpesviruses, the term "recombinant" refers to a herpesvirus whose genome has been modified by inserting at least one nucleotide sequence (e.g., DNA, such as a gene) that is not naturally present in the herpesvirus genome, or, although naturally present in the genome, takes a different form or is located at a different position. It should be understood that such recombinant herpesviruses can be manufactured using various different methods, such as the recombinant DNA technology described herein, and can be propagated without further use of the recombinant DNA technology once manufactured.

[0046] In this specification, the terms "nucleic acid," "nucleic acid sequence," and "nucleotide sequence" are used interchangeably and refer to nucleic acid molecules having a defined sequence, which may be deoxyribonucleotides and / or ribonucleotides. The nucleotide sequence may be prepared first by, for example, recombination, enzymatic, and / or chemical techniques, and subsequently replicated in a host cell or in vitro system. The nucleotide sequence preferably contains an open reading frame encoding a molecule (e.g., a peptide or protein). The nucleotide sequence may contain additional sequences such as promoters, transcription terminators, signal peptides, IRES, etc.

[0047] In this specification, the terms “polypeptide,” “peptide,” and “protein” are used interchangeably and refer to any molecule of a polymer containing at least two consecutive amino acids.

[0048] The term "non-coding region" is well known in the art and refers to any region of the viral genome that does not encode a protein. The non-coding region between UL45 (HVT053) and UL46 (HVT054) generally refers to the region that begins directly at the 3' of the stop codon of UL45 and terminates directly at the 5' of the stop codon of UL46 (because the two ORFs take opposite orientations). The non-coding region between SORF3 (HVT087) and US2 (HVT088) generally refers to the region that begins directly at the 3' of the start codon of SORF3 and terminates directly at the 5' of the stop codon of US2.

[0049] An "immunogenic fragment" of an antigen refers to any fragment that can elicit an immune response, preferably any fragment containing an epitope, more preferably an antigen-specific epitope. An immunogenic fragment typically contains 5 to 50, for example 5 to 40, 10 to 40, 10-30, 10-25, or 10-20 consecutive amino acid residues of the antigen. Examples of fragments of the original F protein include any fragment of 10 to 40 consecutive amino acids as in SEQ ID NO: 7.

[0050] When used herein, the term "variant" refers to a modified form of a reference antigen or fragment that retains its immunogenic properties. Generally, a variant is generally similar to the reference antigen or fragment and is consistent in many regions. For example, a variant may exhibit at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% sequence identity compared to the reference antigen or fragment. A variant specifically refers to an antigen having 1, 2, 3, 4, or 5 modified amino acid residues compared to the reference sequence. Modifications include amino acid deletions, substitutions, and / or additions. A variant should retain the immunogenic properties of the reference sequence, such as the ability to induce an immune response against the reference sequence or pathogen. Examples of variants of the original F protein include any protein comprising or consisting of SEQ ID NO: 7 and having 1, 2, or 3 amino acid substitutions. Examples of variants of the fragment include proteins consisting of 10 to 40 consecutive amino acids of SEQ ID NO: 7 and having 1, 2, or 3 amino acid substitutions.

[0051] The term "bird species" is intended to encompass all kinds of birds, such as birds of the class Aves, i.e., feathered, winged, bipedal, warm-blooded, and egg-laying vertebrates. In the context of this invention, birds or bird species more specifically refer to birds of economic and / or agricultural interest, such as poultry (e.g., chickens and turkeys), aquatic poultry (e.g., ducks and geese), and ornamental birds (e.g., swans and parrots).

[0052] When used in this document, the term "vaccine" refers to a drug that can be used to induce, stimulate, or amplify an immune response in an organism.

[0053] AIV HA antigen

[0054] Influenza A viruses are classified into subtypes based on serological reactions to the HA surface protein. The HA serotype is determined by the hemagglutinin inhibition assay. For AIV, sixteen HA subtypes have been identified, namely HA1 to HA16 (David E. Swayne, David L. Suarez, and Leslie D. Simes. (2013). Influenza., in *Diseases of Poultry*, 13th edition (pp. 181-218), edited by David E. Swayne). Any AIV can be readily classified into any of these subtypes using the techniques and general knowledge described above. Subtype H9 further includes a specific subclass known as H9N2. Examples of H9 subtype AIV virus strains include A / turkey / Wisconsin / 1 / 1966 (H9N2), A / Quail / Hong Kong / G1 / 1997 (H9N2), and A / duck / Hong Kong / Y439 / 1997 (H9N2).

[0055] The inventors have designed and synthesized optimized H9 HA antigens with strong immunogenicity and cross-reactivity. These antigens are disclosed as H9-CNn1 (SEQ ID NO: 2), H9-CNn2 (SEQ ID NO: 3), H9-CNn3 (SEQ ID NO: 4), H9-CNn4 (SEQ ID NO: 5), and H9-CNn5 (SEQ ID NO: 6). The optimized antigens exhibit broad cross-immunogenicity and can induce a strong immune response against AIV. Therefore, these antigens represent potent agents for the production of vaccines against AIV infection and related diseases.

[0056] In this regard, the present invention relates to a polypeptide comprising, substantially composed of, or composed of, an amino acid sequence selected from SEQ ID NO: 2-6, or substantially composed of said sequences, and any polypeptide having at least 97%, preferably at least 98%, and even more preferably at least 99% amino acid sequence identity over its entire length with any of SEQ ID NO: 2-6. Amino acid sequence identity can be determined using any known technique or computer program such as BLAST. A variant of the reference sequence preferably refers to an antigen having 1, 2, 3, 4, or 5 modified amino acid residues compared to the reference sequence. Modifications include amino acid deletions, substitutions, and / or additions. The variant should retain the immunogenic properties of the reference sequence, such as the ability to induce an immune response against the reference sequence or a pathogen.

[0057] A specific object of the present invention is a polypeptide comprising the amino acid sequence SEQ ID NO: 2, substantially consisting of or consisting of the sequence.

[0058] Another specific object of the present invention is a polypeptide comprising the amino acid sequence SEQ ID NO: 3, substantially consisting of or consisting of said sequence.

[0059] Another specific object of the present invention is a polypeptide comprising the amino acid sequence SEQ ID NO: 4, substantially consisting of or consisting of said sequence.

[0060] Another specific object of the present invention is a polypeptide comprising the amino acid sequence SEQ ID NO: 5, substantially consisting of said sequence or consisting of said sequence.

[0061] Another specific object of the present invention is a polypeptide comprising the amino acid sequence SEQ ID NO: 6, substantially consisting of or consisting of said sequence.

[0062] The present invention also relates to chimeric molecules comprising the aforementioned polypeptide coupled to a component (which may be a polypeptide).

[0063] The present invention also relates to nucleic acids encoding polypeptides as defined above, and any vectors or cells containing such nucleic acids. Preferred nucleic acid molecules of the present invention comprise, are substantially composed of, or are composed of any of SEQ ID NO: 9-13.

[0064] The nucleic acid may be coupled to a regulatory sequence (e.g., a promoter and / or a terminator) and / or included in any cloning or expression vector (e.g., a plasmid, virus, BAC, etc.). In a preferred embodiment, the vector is a recombinant virus, such as HVT.

[0065] Recombinant HVT

[0066] This invention relates to a recombinant HVT containing a nucleic acid sequence encoding a HA protein as defined above.

[0067] This invention also relates to a recombinant HVT containing multiple foreign genes at a specific location. More specifically, this invention relates to a recombinant HVT (rHVT) comprising:

[0068] (i) A nucleotide sequence encoded by inserting into a first insertion site in the viral genome, having an amino acid sequence selected from any of SEQ ID NO: 1-6, of a hemagglutinin (HA) protein or an immunogenic fragment or variant thereof; and

[0069] (ii) Inserted into a second insertion site in the viral genome, encoding a nucleotide sequence of the F protein of Newcastle disease virus or an immunogenic fragment or variant thereof;

[0070] The first and second insertion sites are located in different non-coding regions of the viral genome selected from the following: the non-coding region between UL45 and UL46, and the non-coding region between SORF3 and US2.

[0071] In a particular embodiment, the present invention relates to an rHVT comprising:

[0072] (i) A nucleotide sequence inserted into the non-coding region between UL45 and UL46 of the viral genome, encoding a hemagglutinin (HA) protein or an immunogenic fragment or variant thereof having an amino acid sequence selected from any of SEQ ID NO: 1-6; and

[0073] (ii) Inserted into the non-coding region between SORF3 and US2 of the viral genome, encoding the F protein of Newcastle disease virus or its immunogenic fragments or variants thereof as a nucleotide sequence.

[0074] In another specific embodiment, the present invention relates to an rHVT comprising:

[0075] (i) A nucleotide sequence inserted into the non-coding region between SORF3 and US2 of the viral genome, encoding a hemagglutinin (HA) protein or an immunogenic fragment or variant thereof having an amino acid sequence selected from any of SEQ ID NO: 1-6; and

[0076] (ii) Inserted into the non-coding region between UL45 and UL46 of the viral genome, encoding the F protein of Newcastle disease virus or its immunogenic fragments or variants thereof.

[0077] As shown in the embodiments, such constructs are genetically stable after at least 10, preferably at least 15, and more preferably at least 20 passages in CEF cells. These constructs also provide stable co-expression of the antigen after at least 10, preferably at least 15, and more preferably at least 20 passages in CEF cells. They can provide strong and long-term sustained expression of the gene in vivo, sufficient to generate high protective immunity.

[0078] More specifically, the inventors have demonstrated that the claimed rHVT correctly expresses both NDV F and AIV HA-H9 antigens (Figures 2-6). The inventors have also demonstrated that the claimed rHVT efficiently induces antibodies against NDV F and AIV HA-H9 at high HI titers (Figures 7, 8, 11, and 12). Data in this application also show that SPF chickens vaccinated with the bivalent construct of this invention received very high protection (e.g., up to 96%) against Newcastle disease (ND) and AIV after irritation, and all vaccinated groups had lower AIV viral loads compared to the control group.

[0079] Therefore, the claimed rHVT provides highly effective clinical protection against irritation from NDV and AIV. Thus, this invention provides a novel and effective construct for protecting poultry against highly relevant pathogens and related disorders.

[0080] The recombinant HVT of the present invention can be prepared from any HVT, preferably non-pathogenic HVT. An example of a suitable non-pathogenic viral strain for use in the present invention (MDV3) is the FC126 strain. The genomic sequence of the FC126 strain is available in the art (Afonso et al., ibid.; Kingham et al., ibid.). Another suitable HVT strain is, for example, the PB1 strain. Any other non-pathogenic viral strain is also suitable.

[0081] The location of the target non-coding region in the viral genome can be readily identified by a person skilled in the art using the teachings of this application, common knowledge, and sequence information available in the literature. For example, Kingham et al., ibid., reported the nucleotide sequence of the FC126 reference virus strain and the location of most ORFs in the genome.

[0082] Referring to the complete FC126 genome (GenBank: AF291866.1), the non-coding region between UL45 and UL46 corresponds to nucleotides 95323-95443 of the HVT genome, and the non-coding region between SORF3 and US2 corresponds to nucleotides 139867-140064 of the HVT genome. Clonings at any location within these regions are suitable for this invention.

[0083] NDV F protein

[0084] The NDV F protein is the F protein of Newcastle disease virus (also known as avian paramyxovirus type 1). It is a type I viral membrane fusion (F) glycoprotein that mediates cell membrane penetration during viral entry into cells. NDV F is a known antigen of NDV. The amino acid sequence of the original NDV F protein is well-known and published under, for example, No. AAU89279, ABA39232, and AAA46643, and any naturally occurring variants (polymorphisms, splice variants, etc.) are also well-known. Exemplary sequences are provided as SEQ ID NO: 7 (protein) and SEQ ID NO: 14 (nucleic acid).

[0085] The protein encoded by the rHVT for which protection is sought can be any original NDV F protein or any immunogenic fragment or variant thereof capable of inducing an anti-NDV immune response.

[0086] Examples of variants of the original F protein include any protein comprising or consisting of SEQ ID NO: 7 and having one, two, or three amino acid substitutions. Examples of variants of the fragment include proteins consisting of 10 to 40 consecutive amino acids of SEQ ID NO: 7 and having one, two, or three amino acid substitutions.

[0087] Other recombinant sequences

[0088] The recombinant HVT according to the present invention may also contain one or more additional sequences that encode, for example, one or more antigens, cytokines, hormones, co-stimulatory factors, adjuvants, etc.

[0089] The recombinant nucleotide sequence inserted into the genome can be in any orientation.

[0090] promoter

[0091] The inserted nucleic acid sequence may contain (or be operatively linked to) regulatory sequences such as promoters and / or terminators. The promoter used may be synthetic or natural, endogenous or heterologous. In principle, any promoter can be used, as long as it functions effectively in the target cell or host. In this regard, the promoter may be a eukaryotic, prokaryotic, viral, or synthetic promoter capable of directing gene transcription in avian cells in the case of a multivalent vector. Furthermore, each inserted nucleic acid sequence may contain a promoter, which may be the same as or different from each other. In a particular embodiment, each inserted nucleic acid sequence contains a different promoter.

[0092] Preferably, the promoter used for each inserted nucleic acid sequence is selected from the Pec promoter, the cytomegalovirus (CMV) immediate early 1 (ie1) promoter, particularly the murine cytomegalovirus (Mcmv) ie1 promoter or the human cytomegalovirus (Hcmv) promoter, the chicken β-actin (Bac) promoter, the simian virus 40 (SV40) promoter and the Raúl's sarcoma virus (RSV) promoter, or any fragment thereof that retains promoter activity.

[0093] Preferably, the NDV F coding sequence and the AIV HA coding sequence are under the control of different promoters.

[0094] In a preferred embodiment, a coding sequence in the rHVT of the present invention is linked to the Pec promoter.

[0095] In another preferred embodiment, a coding sequence in the rHVT of the present invention is linked to a CMV ie1 promoter, particularly a murine cytomegalovirus (Mcmv) ie1 promoter or a human cytomegalovirus (Hcmv) promoter.

[0096] The nucleic acid sequence of the Pec promoter is shown in SEQ ID NO: 15, and the sequence of the Mcmv ie1 promoter is shown in SEQ ID NO: 16. It should be noted that variants of these sequences encoding functional promoters are known and / or can be designed / tested by those skilled in the art for use in this invention.

[0097] In a preferred embodiment, the recombinant nucleotide sequence inserted into the non-coding region between UL45 and UL46 contains the Pec promoter, and the recombinant nucleotide sequence inserted into the non-coding region between SORF3 and US2 contains the CMV IE1 promoter, particularly the Mcmv ie1 promoter. Results obtained by the inventors show that, in the case of the multivalent vector of the present invention, these promoters are particularly efficient when located at the cloning site.

[0098] In another preferred embodiment, the foreign gene inserted into the non-coding region between UL45 and UL46 contains the CMV IE1 promoter, particularly the Mcmv ie1 promoter, and the recombinant nucleotide sequence inserted into the non-coding region between SORF3 and US2 contains the Pec promoter. Results obtained by the inventors show that, in the case of the multivalent vector of the present invention, these promoters are particularly efficient when located at the cloning site.

[0099] Preferably, the recombinant HVT of the present invention comprises: (i) a nucleotide sequence encoding the F protein of Newcastle disease virus or an immunogenic fragment or variant thereof, inserted into the non-coding region between UL45 and UL46 under the control of the Pec promoter; and (ii) a nucleotide sequence encoding a hemagglutinin (HA) protein having an amino acid sequence selected from any of SEQ ID NO: 1-6, inserted into the non-coding region between SORF3 and US2 under the control of the CMV IE1 promoter, preferably the Mcmv ie1 promoter.

[0100] In another preferred embodiment, the recombinant HVT of the present invention comprises: (i) a nucleotide sequence, inserted into the uncoding region between UL45 and UL46, under the control of the CMV IE1 promoter, preferably the Mcmv ie1 promoter, encoding a hemagglutinin (HA) protein having an amino acid sequence selected from any of SEQ ID NO: 1-6; and (ii) a nucleotide sequence, inserted into the uncoding region between SORF3 and US2, under the control of the Pec promoter, encoding the F protein of Newcastle disease virus or an immunogenic fragment or variant thereof.

[0101] In another embodiment, the recombinant HVT according to the present invention comprises: (i) a nucleotide sequence encoding the F protein of Newcastle disease virus or an immunogenic fragment or variant thereof, inserted into the uncoding region between UL45 and UL46 under the control of the Pec promoter; and (ii) a nucleotide sequence encoding a hemagglutinin (HA) protein having an amino acid sequence selected from any of SEQ ID NO: 1-6, inserted into the uncoding region between SORF3 and US2 under the control of the CMV IE1 promoter, preferably the Hcmv promoter.

[0102] Construction method

[0103] The recombinant HVT of the present invention can be prepared using techniques known in the art, such as recombination, homologous recombination, site-specific insertion, mutagenesis, etc.

[0104] Gene cloning and plasmid construction are well known to those skilled in the art and can be performed largely using standard molecular biology techniques (Molecular Cloning: A Laboratory Manual, 4th Edition, Cold Spring Harbor Laboratory Press, Woodbury, NY 2012).

[0105] Herpesviruses can multiply in any suitable host cell and culture medium. Hosts and conditions suitable for herpesvirus reproduction include, for example, chicken-derived cells such as CEF (chicken embryo fibroblasts) and chicken kidney cells. These cells can be cultured in media such as Eagle's MEM or Leibowitz-L-15 / McCoy 5A (1:1 mixture) at approximately 37°C for 3 to 4 days.

[0106] Genomic DNA can be extracted from virus-infected cells using any standard method. Specifically, DNA can be extracted using phenol and ethanol after denaturing and removing proteins in a lysis buffer.

[0107] Typically, recombinant viruses are prepared through homologous recombination between a viral genome and a construct (e.g., a plasmid) containing a recombinant nucleotide sequence or nucleic acid to be inserted, flanked by nucleotides from the insertion site to allow recombination. In simple terms, the sequence containing the target region is first cloned into a plasmid or other suitable vector. Examples of plasmids include pBR322, pBR325, pBR327, pBR328, pUC18, pUC19, pUC7, pUC8, and pUC9; examples of bacteriophages include λ phage and M13 phage; and examples of cloning agents include pHC79. The cloned region should preferably be of sufficient length so that, after insertion of the foreign gene, the sequences flanking the foreign gene have suitable lengths to allow for in vitro homologous recombination with the viral genome. Preferably, each flanking sequence should be at least approximately 50 nucleotides in length.

[0108] To insert one or more recombinant nucleotide sequences into the target region, mutations can be made at specific sites in the region to generate cleavage sites for restriction enzymes. The mutation can be performed using conventional methods, and techniques commonly used by those skilled in the art, such as in vitro mutagenesis and PCR, can be employed. Thus, in a PCR method, mutations can be made in PCR primers, such as deletions, substitutions, or additions of one or two nucleotides, and the primers are then used to generate the mutation. Alternatively, naturally occurring restriction sites can be used. The foreign gene (and promoter) is then inserted into the insertion site of the viral genome in the plasmid.

[0109] The obtained plasmid can be introduced into HVT-infected cells or HVT genome-transfected cells using any suitable technique (e.g., electroporation, calcium phosphate, lipid-based transfection, etc.). When the amount of plasmid to be introduced is in the range of 0.1 to 1000 μg, the efficiency of generating recombinant virus in cells through recombination between the HVT genome and homologous regions of the plasmid increases. This induces recombination events between the plasmid and the viral genome, resulting in the insertion of the recombinant nucleotide sequence into the virus.

[0110] The resulting recombinant viruses can be selected using known selection techniques by genotype or phenotype, such as by hybridization, detection of enzyme activity encoded by genes integrated with the recombinant nucleic acid sequence, or immunological detection of antigenic peptides expressed by the recombinant herpesvirus. The selected recombinant herpesviruses can be cultured on a large scale in cell culture. Once generated, the virus can multiply in suitable cells. Detailed Implementation

[0111] Preferred Implementation

[0112] The recombinant HVTs described below are preferred embodiments of the present invention. As shown in the examples, they allow for the generation of a strong immune response in vivo against the antigen encoded by each recombinant nucleotide sequence.

[0113] The particularly preferred recombinant HVT (rHVT) of the present invention comprises: (i) a nucleotide sequence encoding the F protein of Newcastle disease virus or an immunogenic fragment or variant thereof, inserted into the uncoding region between UL45 and UL46, under the control of the Pec promoter; and (ii) a nucleotide sequence encoding a hemagglutinin (HA) protein having an amino acid sequence selected from any of SEQ ID NO: 1-6, inserted into the uncoding region between SORF3 and US2, under the control of the Mcmvi ie1 promoter. Preferably, as described in the experimental data, this recombinant rHVT is selected from the following divalent constructs:

[0114] ·HVT / 45-46PecF / 87-88Mcmv ie1 H9-CN(FW206),

[0115] ·HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn1(FW247),

[0116] ·HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn2(FW248),

[0117] ·HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn3(FW249),

[0118] ·HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn4(FW250), and

[0119] ·HVT / 45-46PecF / 87-88Mcmvie1 H9-CNn5(FW251).

[0120] In a preferred embodiment, the rHVT according to the present invention contains a nucleic acid encoding an F antigen or a naturally occurring variant thereof, the F antigen comprising the amino acid sequence SEQ ID NO: 7 or consisting substantially of the amino acid sequence SEQ ID NO: 7.

[0121] In a preferred embodiment, the rHVT according to the present invention contains a nucleic acid encoding the F antigen, the nucleic acid comprising or substantially consisting of the nucleic acid sequence SEQ ID NO: 14.

[0122] In another preferred embodiment, the rHVT according to the present invention is HVT / 45-46PecF / 87-88Mcmvie1 H9-CNn3(FW249), which contains the artificially designed hemagglutinin gene (H9-CNn3) of the H9 subtype of avian influenza virus of SEQ ID NO: 11.

[0123] In other preferred embodiments, the rHVT according to the present invention is selected from the following divalent constructs:

[0124] • HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn1(FW247), which contains the artificially designed hemagglutinin gene (H9-CNn1) of the H9 subtype of avian influenza virus, SEQ ID NO: 9.

[0125] • HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn2(FW248), which contains the artificially designed hemagglutinin gene (H9-CNn2) of the H9 subtype of avian influenza virus (SEQ ID NO: 10).

[0126] • HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn4(FW250), which contains the artificially designed hemagglutinin gene (H9-CNn4) of the H9 subtype of avian influenza virus SEQ ID NO: 12, and

[0127] • HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn5(FW251), which contains the artificially designed hemagglutinin gene (H9-CNn5) of the H9 subtype of avian influenza virus SEQ ID NO: 13.

[0128] Another preferred rHVT of the present invention comprises: (i) a nucleotide sequence encoding a hemagglutinin (HA) protein having an amino acid sequence having any of SEQ ID NO: 1-6, inserted into the uncoding region between UL45 and UL46, under the control of the Mcmvie1 promoter; and (ii) a nucleotide sequence encoding the F protein of Newcastle disease virus or an immunogenic fragment or variant thereof, inserted into the uncoding region between SORF3 and US2, under the control of the Pec promoter. Preferably, as described in the experimental data, such rHVT is selected from the following bivalent constructs:

[0129] ·HVT / 45-46Mcmv ie1 H9-CN / 87-88PecF(FW209).

[0130] In another embodiment, the rHVT according to the present invention comprises: (i) a nucleotide sequence encoding the F protein of Newcastle disease virus or an immunogenic fragment or variant thereof, inserted into the non-coding region between UL45 and UL46, under the control of the Pec promoter; and (ii) a nucleotide sequence encoding a hemagglutinin (HA) protein having the amino acid sequence of any one of SEQ ID NO: 1-6, inserted into the non-coding region between SORF3 and US2, under the control of the Hcmv promoter. Preferably, as described in the experimental data, this rHVT is the bivalent construct HVT / 45-46PecF / 87-88Hcmv H9-CNn1(FW252).

[0131] The particularly preferred rHVT of the present invention is prepared using the FC126 or PB1 virus strain.

[0132] The recombinant HVT of the present invention can be propagated in cell cultures. In a preferred embodiment, CEF, embryonic eggs, chicken kidney cells, etc., are used as host cells for propagating recombinant HVT. The multivalent recombinant HVT of the present invention can be cultured in culture media such as Eagle's MEM or Leibowitz-L-15 / McCoy 5A (1:1 mixture) at about 37°C for 3 to 4 days. The infected cells obtained thereby are suspended in a medium containing 10% dimethyl sulfoxide (DMSO) and cryopreserved under liquid nitrogen.

[0133] Advantageously, the recombinant HVTs of the present invention exhibit a high level of stability. They are genetically stable, meaning that they maintain the inserted gene in avian cells, preferably CEF cells, even after 10 or more passages, preferably 15 passages, more preferably 20 passages. They also provide stable expression of the antigen, meaning that they co-express the antigen in avian cells, preferably CEF cells, even after 10 or more passages, preferably 15 passages, even more preferably 20 passages. In the context of the present invention, “passage” or “cell passage” means culturing cells under suitable conditions to allow them to grow and keep them alive until they reach 90% to 100% confluence. The passage step involves transferring a small number of cells from the previous confluence culture to a new culture medium. Aliquots of the previous confluence culture containing a small number of cells can be diluted in a large volume of fresh culture medium.

[0134] The viruses can be collected or purified using conventional techniques. They can be stored in any suitable medium, frozen, and / or freeze-dried.

[0135] Nucleic acids and cells

[0136] Another object of the present invention relates to any nucleic acid contained in a virus as defined above. The nucleic acid may be single-stranded or double-stranded DNA or RNA or a variant thereof. Specific examples of nucleic acids include the entire genome of the HVT of the present invention. Other specific nucleic acids are genes comprising or consisting of SEQ ID NO: 9-13.

[0137] The present invention also relates to vectors (e.g., plasmids, granules, artificial chromosomes, etc.) that contain the nucleic acids of the present invention.

[0138] This invention also relates to cells containing the recombinant HVT, nucleic acid, or vector of this invention. The cells are typically eukaryotic cells, such as avian cells, or prokaryotic cells (if the vector is suitable for replication or maintenance in these cell types).

[0139] vaccine composition

[0140] The present invention also relates to compositions such as vaccines comprising the multivalent recombinant HVT of the present invention, the nucleic acid of the present invention, or the cell of the present invention.

[0141] The vaccines of the present invention typically contain an immunologically effective amount of the recombinant HVT as described above in a pharmaceutically acceptable medium.

[0142] The compositions and vaccines described according to the present invention typically contain suitable solvents or diluents or excipients, such as aqueous buffers or phosphate buffers. The compositions may also contain additives, such as animal-derived proteins or peptides (e.g., hormones, cytokines, co-stimulatory factors), viral-derived and other-derived nucleic acids (e.g., double-stranded RNA, CpG), etc., which are administered together with the vaccine in amounts sufficient to enhance the immune response. Furthermore, any combination of the above substances may provide an immune-enhancing effect and thus can form the immune enhancers of the present invention.

[0143] The vaccine of the present invention can also be formulated with one or more other additives to maintain isotonicity, physiological pH and stability, such as buffers such as physiological saline (0.85%), phosphate-buffered saline (PBS), citrate buffer, tris(hydroxymethyl)aminomethane (TRIS), Tris-buffered saline, etc., or antibiotics such as neomycin or streptomycin, etc.

[0144] The route of administration can be any route, including oral, ocular (e.g., by eye drops), ocular / nasal administration using aerosols, intranasal, cloacal, in feed, in water, or by spray, intraovular, local, or by injection (e.g., intravenous, subcutaneous, intramuscular, intraorbital, intraocular, intradermal, and / or intraperitoneal). Skilled personnel will readily modify the formulation of the vaccine composition to suit each type of route of administration.

[0145] Each dose of vaccine may contain a suitable amount sufficient to elicit a protective immune response in avian species. Optimization of such dosage is well known in the art. The amount of antigen per dose can be determined by known methods, using antigen / antibody reactions, such as ELISA.

[0146] Depending on the vaccination regimen, the vaccine of the present invention can be administered as a single dose or repeated doses.

[0147] Another advantage of the vaccines of this invention is that they provide bird species with up to 100% protection against target avian pathogens 3 weeks after vaccination.

[0148] The present invention also relates to the use of the vaccine as described above for immunizing avian species, such as poultry, against pathogens.

[0149] The present invention also relates to a method for immunizing avian species by administering an effective dose of the vaccine according to the invention. Advantageously, the vaccine can be administered intradermally, subcutaneously, intramuscularly, orally, intraovarianly, via mucous membranes, or via the eyes or nose.

[0150] The present invention also relates to a vaccination kit for immunizing avian species, comprising an effective amount of the multivalent vaccine as described above and a tool for administering the components to the species. For example, such a kit includes an injection device containing the multivalent vaccine according to the invention, and instructions for use for intradermal, subcutaneous, intramuscular, or intraovarian injection. Optionally, the kit includes a spray / aerosol or eye drop device containing the multivalent vaccine according to the invention, and instructions for use for ocular, nasal, oral, or mucosal administration.

[0151] Other aspects and advantages of this application will now be disclosed in the following embodiments, which are used to illustrate the invention. Embodiments

[0152] Recombinant HVTs (rHVTs) were prepared and used in the following examples. They were named according to the following nomenclature:

[0153] -HVT / Insertion site, promoter, inserted antigen (monovalent construct);

[0154] -HVT / First insertion site, first promoter, first inserted antigen / Second insertion site, second promoter, second inserted antigen (bivalent construct).

[0155] List of rHVTs prepared and used in the examples:

[0156] FW168: HVT / 45-46PecF (Unit Price)

[0157] FW202: HVT / 45-46Mcmv ie1 H9-CN (Unit Price)

[0158] FW206: HVT / 45-46PecF / 87-88Mcmv ie1 H9-CN (bivalent)

[0159] FW209: HVT / 45-46Mcmv ie1 H9-CN / 87-88PecF (bivalent)

[0160] FW247: HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn1 (divalent)

[0161] FW248: HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn2 (divalent)

[0162] FW249: HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn3 (divalent)

[0163] FW250: HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn4 (divalent)

[0164] FW251: HVT / 45-46PecF / 87-88Mcmv ie1 H9-CNn5 (divalent)

[0165] FW252: HVT / 45-46PecF / 87-88Hcmv H9-CNn1 (divalent)

[0166] Example 1: Design and synthesis of optimized antigenic proteins of hemagglutinin from avian influenza virus H9 subtype

[0167] Several AIV H9 subtype antigens were designed and synthesized to maximize the protective spectrum in H9N2 AIV isolates. Sequences of several H9 virus strains were collected, including seven Chinese isolates from 2016. Computer protein modeling analysis was performed based on these H9 sequences. More specifically, the optimized antigen was designed based on the HA gene sequence (GenBank accession number JN804297) (SEQ ID NO: 1) from A / chicken / Henan / H24 / 2011, named H9-CN in this paper.

[0168] Five optimized antigens were designed and selected, named H9-CNn1-4 (SEQ ID NO: 2), H9-CNn2 (SEQ ID NO: 3), H9-CNn3 (SEQ ID NO: 4), and H9-CNn4 (SEQ ID NO: 5). H9-CNn5 (SEQ ID NO: 6) was designed by replacing the transmembrane domain (TM) of H9-CNn1 with the TM of the H3 subtype AIV to further improve molecular stability and cross-reactivity.

[0169] The amino acid sequences of H9-CNn1-5 are provided as SEQ ID NO: 2-6, respectively.

[0170] The nucleic acid sequences encoding H9-CNn1-5 are provided as SEQ ID NO: 9-13.

[0171] Example 2: Construction of recombinant HVT

[0172] 2.1. Construction of homologous vectors

[0173] Plasmid construction is generally performed using standard molecular biology techniques (Molecular Cloning: A Laboratory Manual, 4th Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, USA, 2012).

[0174] p45 / 46Mcmv ie1 H9-CN build

[0175] The murine cytomegalovirus (Mcmv) ie1 promoter (SEQ ID NO: 16) was synthesized in a pUC18-based vector to produce pGI Mcmv ie1.

[0176] The polyA signal (SPA: SEQ ID NO: 17) was also synthesized and inserted into pGIMcmvie1 cleaved with SalI and SfiI to generate pGI Mcmvie1 SPA. The Mcmvie1 promoter-SPA box was cleaved from pGI Mcmvie1 SPA by BglI digestion and inserted into the SfiI site of p45 / 46Sfi (WO03 / 064595) to generate p45 / 46Mcmvie1SPA.

[0177] The gene sequence H9-CN (SEQ ID NO: 8) mentioned in Example 1 was synthesized and used. This HA sequence was digested with XbaI and SalI and then inserted into the p45 / 46Mcmvie1 SPA that was cut by XbaI and SalI, producing p45 / 46Mcmvie1 H9-CN SPA.

[0178] Construction of pHVT87-88 Mcmv ie1 H9-CN

[0179] The Mcmv ie1 promoter-SPA box was cleaved from pGI Mcmv ie1SPA by BglI digestion and inserted into the SfiI site of pHVT87-88 (WO2013 / 144355) to produce pHVT87-88 Mcmv ie1 SPA. Then, the H9-CN gene digested with XbaI and SalI was inserted into the pHVT87-88 Mcmv ie1 SPA cleaved by XbaI and SalI to produce pHVT87-88 Mcmv ie1 H9-CN SPA.

[0180] Construction of pHVT87-88 PecF

[0181] The Pec promoter – Newcastle disease virus (NDV) F gene – SV40 polyA box was obtained from p45 / 46PecF (WO03 / 064595) by BglI digestion and cloned into SfiI-digested pHVT87-88 to produce pHVT87-88 PecF. The NDV F gene used contains SEQ ID NO: 14.

[0182] Construction of pHVT87-88 Mcmv ie1 H9-CNn1 to CNn5

[0183] The H9-CNn1 (SEQ ID NO: 9), H9-CNn2 (SEQ ID NO: 10), H9-CNn3 (SEQ ID NO: 11), H9-CNn4 (SEQ ID NO: 12), and H9-CNn5 (SEQ ID NO: 13) genes synthesized in Example 1 were used. These genes were cloned into pHVT87-88 Mcmv ie1 SPA cleaved with XbaI and SalI to generate pHVT87-88 Mcmv ie1H9-CNn1SPA, pHVT87-88 Mcmv ie1 H9-CNn2 SPA, pHVT87-88 Mcmv ie1 H9-CNn3 SPA, pHVT87-88 Mcmv ie1 H9-CNn4 SPA, and pHVT87-88 Mcmv ie1 H9-CNn5 SPA.

[0184] Construction of pHVT87-88 cmv H9-CNn1

[0185] The human cytomegalovirus (Hcmv) promoter was obtained from pGICMVpA (WO2008 / 121329) by digestion with BglI and XbaI, and then inserted into pHVT87-88 Mcmv ie1 H9-CNn1 SPA cleaved by BglI and XbaI to produce pHVT87-88 Hcmv H9-CNn1 SPA.

[0186] 2.2 Construction of Recombinant HVT

[0187] Recombinant HVT (rHVT) was constructed in cultured cells via homologous recombination. HVT DNA was prepared from chicken embryo fibroblasts (CEF) infected with parental HVT, as described by Morgan et al. (Avian Diseases, 34:345-351, 1990). Using Nucleofector II (Lonza, Basel, Switzerland), approximately 2 μg of the described HVT DNA and 1 μg of one of the homologous vectors were transfected into approximately 10 cells via electroporation. 7Transfected cells were added to Leibovitz's L-15 (Life Technologies Corp., catalog 41300-39), McCoy's 5A medium (Life Technologies Corp., catalog 21500-061) (1:1) and 4% fetal bovine serum (LM(+) medium), plated in 96-well tissue culture plates, and incubated at 37°C and 4-5% CO2 for 5-7 days until HVT plaques became visible. Cells were then detached from the plates by trypsin treatment and transferred in equal volumes to two 96-well plates containing CEF, and incubated for 3-5 days until plaques were observed. Screening was performed using a black plaque assay, staining only plaques expressing the antigenic proteins NDV F or AIV HA. In simpler terms, one of the two plates was fixed with a methanol:acetone mixture (1:2) and incubated with rabbit anti-NDV F serum or chicken anti-HA (H9) serum. The plates were then incubated with either biotin-labeled anti-rabbit IgG antibody (Vector Laboratories, catalog BA-1000) or biotin-labeled anti-chicken IgY antibody (Vector Laboratories, catalog BA-9010), and finally incubated with the VECTASTAIN ABC-AP kit (Vector Laboratories, catalog AK-5000). Plaques expressing the antigen were stained with NBT / BCIP solution (Roche Applied Science, catalog 1681451). Wells containing stained recombinant plaques were identified, and cells in the corresponding wells of another 96-well plate were treated with trypsin. The cells were then diluted in fresh secondary CEF cells and transferred to new 96-well plates to complete the first round of purification. The purification procedure was repeated until all plaques were positively stained in the black plaque assay. Multiple clones were isolated for each construct.

[0188] The constructed rHVTs, their parent viruses, and the list of homologous vectors used are provided in Table 1 below. The HVT strain FC126 was used. A diagram illustrating the genomic structure of the rHVTs is provided in Figure 1. For the construction of bivalent rHVTs (rHVT / ND-H9) expressing both the NDV F gene and the AIV HA-H9 gene, the above construction process was repeated using viral DNA extracted from an rHVT containing one antigen gene.

[0189] Table 1: Constructed rHVT, parental virus, and homologous vector

[0190] The construct encodes the parental viral homologous vectors: FW168 (monovalent) HVT FC-126 virus strain p45 / 46, PecFFW202 (monovalent) HVT FC-126 virus strain p45 / 46, Mcmv ie1 H9-CN, SPAFW206 (bivalent) FW168pHVT87-88 Mcmv ie1 H9-CN, SPAFW209 (bivalent) FW202pHVT87-88, PecFFW247 (bivalent) FW168pHVT87-88 Mcmv ie1 H9-CNn1, SPAFW248 (bivalent) FW168pHVT87-88 Mcmv ie1 H9-CNn2, SPAFW249 (bivalent) FW168pHVT87-88 Mcmv ie1 H9-CNn3. SPAFW250 (Divalent) FW168pHVT87-88 Mcmv ie1 H9-CNn4 SPAFW251 (Divalent) FW168pHVT87-88 Mcmv ie1 H9-CNn5 SPAFW252 (Divalent) FW168pHVT87-88 Hcmv H9-CNn1 SPA surface

[0191] Example 3: The inserted antigen was expressed by recombinant HVT.

[0192] The expression of NDV F protein and / or AIV HA-H9 protein in the rHVT constructs prepared in Example 2 was confirmed by immunofluorescence assay (IFA) and Western blot analysis. For IFA, CEF monolayers with rHVT plaques were fixed with a methanol:acetone mixture (1:2) and incubated with a mixture of rabbit anti-NDV F protein serum and chicken anti-HA(H9) serum. The plates were then incubated with a mixture of Alexa Fluor 488 anti-rabbit IgG antibody (Invitrogen, catalog number A-11008) and Alexa Fluor 546 anti-chicken IgY antibody (Invitrogen, catalog number A-11040) and observed under a fluorescence microscope. Specific green (F protein) or red (HA-H9 protein) fluorescence was observed with each rHVT, confirming that these rHVTs expressed the said antigen proteins. Furthermore, it was confirmed that each plaque of the bivalent rHVT / ND-H9 construct expressed both the F and HA-H9 antigens (Figure 2).

[0193] Western blotting was performed using CEF cells infected with the recombinant virus and rabbit anti-NDV F protein serum or chicken anti-HA(H9) serum. In short, CEF cells in 6-well plates were infected with one of the recombinant viruses or a parental HVT virus strain at a multiplicity of infection of approximately 0.1. Three days post-inoculation, cells were harvested with trypsin and centrifuged at 913x g for 5 minutes. The sediment was washed with PBS and resuspended in 100 μl PBS. The cell suspension was boiled for 5 minutes after adding an equal volume of 2x SDS sample buffer (130 mM Tris-Cl (pH 6.8), 6% SDS, 20% glycerol, 10% 2-mercaptoethanol, and 0.01% bromophenol blue). The sample was separated by SDS-PAGE using a 10% polyacrylamide gel and transferred to a PVDF membrane (Immobilon-P, Millipore). The membrane was completely dried and then incubated with rabbit anti-NDV F protein serum or chicken anti-HA(H9) serum. After washing away the antibodies, the membrane was incubated with either biotin-labeled anti-rabbit IgG antibody (Vector Laboratories, catalog number BA-1000) or biotin-labeled anti-chicken IgY antibody (Vector Laboratories, catalog number BA-9010), and then incubated with a VECTASTAIN ABC-AP kit (Vector Laboratories, catalog number AK-5000). The antibody-bound proteins were visualized by adding NBT / BCIP solution. As shown in Figures 3 to 6, a 60 kDa protein band corresponding to NDV F protein or a 70 kDa protein band corresponding to AIV HA-H9 protein was observed only in the channels of cells infected with the recombinant virus, confirming that the rHVT construct prepared in Example 2 expressed the antigen protein of the expected size.

[0194] Example 4: Verification of the genomic structure of recombinant HVT

[0195] The genomic structure of the rHVT constructs prepared in Example 2 was verified by two PCR reactions amplifying the two inserted regions (UL45 / UL46 and SORF3 / US2). The primer pairs used in these PCR reactions were SEQ ID NO: 18 (5'-GGGGAAGTCTTCCGGTTAAGGGAC-3') and SEQ ID NO: 19 (5'-GGTGCAATTCGTAAGACCGATGGG-3') for UL45 / UL46, and SEQ ID NO: 20 (5'-GCGCGACTCCATACATTGA-3') and SEQ ID NO: 21 (5'-AGTCCACATGCACCCCACCTAAAC-3') for SORF3 / US2. The expected size of the PCR products containing the inserted genes was observed with all of the rHVTs, confirming that these recombinant HVTs possess the expected genomic structure.

[0196] Example 5: Genetic stability of recombinant HVT

[0197] The rHVT constructs prepared in Example 2 were passaged 20 times in CEF and their genetic stability was tested. After 20x passages, the genomic structure of all rHVTs was tested by PCR as described in Example 4, and the expression of the antigen protein was tested by IFA and Western blot as described in Example 3. All rHVT constructs showed that the inserted gene was maintained by PCR, and the expression of the antigen protein was shown by IFA and Western blot, confirming that these rHVTs are genetically stable and provide stable antigen expression.

[0198] Example 6: Antibody titers in chickens vaccinated with FW206

[0199] The ability of the construct FW206 to induce antibodies against NDV F and AIV HA-H9 was investigated. Approximately 1,000 plaque-forming units (PFU) of the rHVT construct were subcutaneously administered to 1-day-old specific pathogen-free (SPF) chickens. Serum was collected weekly between 2 and 5 weeks of age, and antigen-specific antibodies were tested. Antibodies against NDV F were tested using the ID Screen Newcastle Disease Indirect ELISA Kit (ID Vet). As shown in Figure 7, FW206 induced antibodies against the NDV F protein. Antibodies against AIV HA-H9 were tested using an inactivated H9 subtype of AIV via a hemagglutinin inhibition (HI) assay, as described in Chapter 3.3.4 (Avian Influenza) of the OIE Terrestrial Manual 2018. FW206 induced HI titers between 2 and 5 weeks of age (Figure 8).

[0200] Example 7: Protection against ND after stress at 17 days of age in chickens vaccinated with FW206

[0201] The efficacy of construct FW206 (HVT / 45-46PecF / 87-88Mcmv ie1 H9-CN) against irritation from virulent NDV strains was investigated. One-day-old SPF chickens were subcutaneously vaccinated with one of the rHVT / ND-H9 constructs at approximately 1,000 PFU. At 17 days of age, the chickens were vaccinated with 10 5 ELD 50 The virulent NDV Herts 33 / 56 strain was irritated by intramuscular injection, and clinical signs of Newcastle disease (ND) were observed for 14 days. FW206 provided nearly 90% protection against the irritation very early.

[0202] Table 2: Protection against ND after stress at 17 days of age in SPF chickens vaccinated with FW206

[0203] Group number | Number of chickens with clinical signs of ND | Protection percentage 1 FW 206 15 287% 2 NICC 10 100% surface

[0204] NICC = Positive control for irritated individuals who have not been immunized

[0205] Example 8: Protection against ND after stress at 21 days of age in chickens vaccinated with FW206

[0206] The efficacy of FW206 against irritation caused by the use of a virulent NDV strain was investigated. One-day-old SPF chickens were subcutaneously vaccinated with approximately 400 PFU of rHVT construct. At 21 days of age, the chickens were vaccinated with 10... 5 ELD 50 The virulent NDV Herts33 / 56 strain was irritated by intramuscular injection, and the clinical signs of Newcastle disease (ND) were observed for 14 days. The results are shown in Table 3 below, confirming that more than 70% of the vaccinated chickens were protected.

[0207] Table 3: Protection against ND after stress at 21 days of age in SPF chickens vaccinated with FW206

[0208] Group number | Number of chickens exhibiting clinical signs of ND | Protection percentage | 1FW20624771% | 62NICC12120% surface

[0209] NICC = Positive control for irritated individuals who have not been immunized

[0210] Example 9: Protection against AI after stress at 25 days of age in chickens vaccinated with FW206

[0211] The efficacy of FW206 against irritation caused by AIV H9 subtype was investigated in commercial broiler chickens. One-day-old commercial broiler chickens were subcutaneously vaccinated with approximately 1,000 PFU of FW206. At 25 days of age, the chickens were vaccinated with 10... 7 EID 50 The AIVA / chicken / Saudi Arabia / D1816 / 1 / 1 / 2011(H9N2) virus strain was irritated via the intratracheal and intranasal routes. Tracheal samples were collected 5 days post-irritation for AIV quantification by qPCR analysis. Eleven days post-irritation, the chickens underwent necropsy to assess lesions in the air sacs. As shown in Figure 9, the vaccinated group had a lower viral load compared to the control group. The AIV load in the FW206 vaccinated group was 0.5 log lower than that in the irritated control (Figure 9). The air sac lesion score in the vaccinated group was also significantly lower than that in the irritated control group (Figure 10). These results confirm that the claimed construct provides protection against irritation using the AIV H9 subtype.

[0212] Example 10: Antibody titers in chickens vaccinated with FW247, FW248, FW249, FW250, FW251, or FW252

[0213] The ability of constructs FW247, FW248, FW249, FW250, FW251, and FW252 to induce antibodies against NDV F and AIV HA-H9 was investigated. Approximately 3,000 PFU of rHVT constructs were subcutaneously administered to 1-day-old SPF chickens. Serum was collected at 2 and 3 weeks of age, and antigen-specific antibodies were tested. Antibodies against NDV F were tested using the ID Screen Newcastle Disease Indirect ELISA Kit (IDVet). Antibodies against AIV HA-H9 were tested using an inactivated H9 subtype of AIV via a HI assay. All constructs tested induced antibodies against both NDV F protein (Fig. 11) and AIV HA-H9 (Fig. 12). Construct FW249 appeared to induce high levels of both F and HA-H9 antibodies.

[0214] Example 11: Protection against ND after stress at 21 days of age in chickens vaccinated with FW249

[0215] The efficacy of construct FW249 against irritation caused by a virulent NDV strain was investigated. One-day-old SPF chickens were subcutaneously vaccinated with one of the rHVT / ND-H9 constructs at approximately 2,500 PFU. At 21 days of age, the chickens were vaccinated with 10...5 ELD 50 The virulent NDV Herts33 / 56 strain was irritated by intramuscular injection, and the clinical signs of Newcastle disease (ND) were observed for 14 days. The results are presented in Table 4.

[0216] Table 4: Protection against ND after stress at 21 days of age in SPF chickens vaccinated with FW249

[0217] Group number | Number of chickens exhibiting clinical signs of ND | Protection percentage | 1FW24913192% | 2NICC13130% surface

[0218] NICC = Positive control from unimmunized, irritated individuals. Sequence listing. <110> Zhejiang Ceva EBVAC Biotechnology Co., Ltd. Beijing Ceva Huadu Biological Co., Ltd. <120> Recombinant HVT and its uses <130> B3389 <160> twenty one <170> PatentIn version 3.5 <210> 1 <211> 560 <212> PRT <213> Artificial sequence <220> <223> H9-CN <400> 1Met Glu Val Val Ser Leu Ile Thr Ile Leu Leu Val Val Thr Val Ser1 5 10 15Asn Ala Asp Lys Ile Cys Ile Gly Tyr Gln Ser Thr Asn Ser Thr Glu20 25 30Thr Val Asp Thr Leu Thr Glu Asn Asn Val Pro Val Thr His Ala Lys35 40 45Glu Leu Leu His Thr Glu His Asn Gly Met Leu Cys Ala Thr Ser Leu50 55 60Gly His Pro Leu Ile Leu Asp Thr Cys Thr Ile Glu Gly Leu Ile Tyr65 70 75 80Gly Asn Pro Ser Cys Asp Leu Leu Leu Gly Gly Arg Glu Trp Ser Tyr85 90 95Ile Val Glu Arg Pro Ser Ala Val Asn Gly Leu Cys Tyr Pro Gly Asn100 105 110Val Glu Asn Leu Glu Glu Leu Arg Ser Leu Phe Ser Ser Ala Arg Ser115 120 125Tyr Gln Arg Ile Gln Ile Phe Pro Asp Thr Ile Trp Asn Val Ser Tyr130 135 140Ser Gly Thr Ser Lys Ala Cys Ser Asp Ser Phe Tyr Arg Ser Met Arg145 150 155 160Trp Leu Thr GlnLys Asn Asn Ala Tyr Pro Ile Gln Asp Ala Gln Tyr165 170 175Thr Asn Asn Gln Glu Lys Asn Ile Leu Phe Met Trp Gly Ile Asn His180 185 190Pro Pro Thr Asp Thr Val Gln Thr Asn Leu Tyr Thr Arg Thr Asp Thr195 200 205Thr Thr Ser Val Ala Thr Glu Glu Ile Asn Arg Thr Phe Lys Pro Leu210 215 220Ile Gly Pro Arg Pro Leu Val Asn Gly Leu Gln Gly Arg Ile Asp Tyr225 230 235 240Tyr Trp Ser Val Leu Lys Pro Gly Gln Thr Leu Arg Ile Arg Ser Asn245 250 255Gly Asn Leu Ile Ala Pro Trp Tyr Gly His Ile Leu Ser Gly Glu Ser260 265 270His Gly Arg Ile Leu Lys Thr Asp Leu Lys Arg Gly Ser Cys Thr Val275 280 285Gln Cys Gln Thr Glu Lys Gly Gly Leu Asn Thr Thr Leu Pro Phe Gln290 295 300Asn Val Ser Lys Tyr Ala Phe Gly Asn Cys Ser Lys Tyr Ile Gly Ile305 310 315 320Lys Ser Leu Lys Leu Ala Val Gly Leu Arg Asn Val Pro Ser Arg Ser325 330 335Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp340 345 350Ser Gly Leu Val Ala Gly Trp Tyr Gly Phe Gln His Ser Asn Asp Gln355 360 365Gly Val Gly Met Ala Ala Asp Arg Asp Ser ThrGln Lys Ala Ile Asp 370 375 380 Lys Ile Thr Ser Lys Val Asn Asn Ile Val Asp Lys Met Asn Lys Gln 385 390 395 400 Tyr Glu Ile Ile Asp His Glu Phe Ser Glu Val Glu Thr Arg Leu Asn 405 410 415 Met Ile Asn Asn Lys Ile Asp Asp Gln Ile Gln Asp Ile Trp Ala Tyr 420 425 430 Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Gln Lys Thr Leu Asp Glu 435 440 445 His Asp Ala Asn Val Asn Asn Leu Tyr Asn Lys Val Lys Arg Ala Leu 450 455 460 Gly Thr Asn Ala Val Glu Asp Gly Lys Gly Cys Phe Glu Leu Tyr His 465 470 475 480 Lys Cys Asp Asp Gln Cys Met Glu Thr Ile Arg Asn Gly Thr Tyr Asn 485 490 495 Arg Arg Lys Tyr Gln Glu Glu Ser Lys Leu Glu Arg Gln Lys Ile Glu 500 505 510 Gly Val Lys Leu Glu Ser Glu Gly Thr Tyr Lys Ile Leu Thr Ile Tyr 515 520 525 Ser Thr Val Ala Ser Ser Leu Val Ile Ala Met Gly Phe Ala Ala Phe 530 535 540 Leu Phe Trp Ala Met Ser Asn Gly Ser Cys Arg Cys Asn Ile Cys Ile 545 550 555 560 <210> 2 <211> 560 <212> PRT <213> Artificial Sequence <220> <223> H9-CNn1 <400> 2 Met Glu Val Val Ser Leu Ile Thr Ile Leu Leu Val Val Thr Val Ser 1 5 10 15 Asn Ala AspLys Ile Cys Ile Gly Tyr Gln Ser Thr Asn Ser Thr Glu20 25 30Thr Val Asp Thr Leu Thr Glu Asn Asn Val Pro Val Thr His Ala Lys35 40 45Glu Leu Leu His Thr Glu His Asn Gly Met Leu Cys Ala Thr Ser Leu50 55 60Gly Gln Pro Leu Ile Leu Asp Thr Cys Thr Ile Glu Gly Leu Ile Tyr65 70 75 80Gly Asn Pro Ser Cys Asp Leu Ser Leu Glu Gly Arg Glu Trp Ser Tyr85 90 95Ile Val Glu Arg Pro Ser Ala Val Asn Gly Leu Cys Tyr Pro Gly Asn100 105 110Val Glu Asn Leu Glu Glu Leu Arg Ser Leu Phe Ser Ser Ala Arg Ser115 120 125Tyr Gln Arg Ile Gln Ile Phe Pro Asp Thr Ile Trp Asn Val Ser Tyr130 135 140Asp Gly Thr Ser Thr Ala Cys Ser Gly Ser Phe Tyr Arg Ser Met Arg145 150 155 160Trp Leu Thr Arg Lys Asn Gly Asp Tyr Pro Ile Gln Asp Ala Gln Tyr165 170 175Thr Asn Asn Gln Gly Lys Asn Ile Leu Phe Met Trp Gly Ile Asn His180 185 190Pro Pro Thr Asp Asp Thr Gln Arg Asn Leu Tyr Thr Arg Thr Asp Thr195 200 205Thr Thr Ser Val Ala Thr Glu Glu Ile Asn Arg Ile Phe Lys Pro Leu210 215 220Ile Gly Pro Arg Pro Leu Val Asn Gly Leu Met Gly Arg IleAsp Tyr225 230 235 240Tyr Trp Ser Val Leu Lys Pro Gly Gln Thr Leu Arg Ile Lys Ser Asp245 250 255Gly Asn Leu Ile Ala Pro Trp Tyr Gly His Ile Leu Ser Gly Glu Ser260 265 270His Gly Arg Ile Leu Lys Thr Asp Leu Lys Arg Gly Ser Cys Thr Val275 280 285Gln Cys Gln Thr Glu Lys Gly Gly Leu Asn Thr Thr Leu Pro Phe Gln290 295 300Asn Val Ser Lys Tyr Ala Phe Gly Asn Cys Ser Lys Tyr Ile Gly Ile305 310 315 320Lys Ser Leu Lys Leu Ala Val Gly Leu Arg Asn Val Pro Ser Arg Ser325 330 335Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp340 345 350Ser Gly Leu Val Ala Gly Trp Tyr Gly Phe Gln His Ser Asn Asp Gln355 360 365Gly Val Gly Met Ala Ala Asp Arg Asp Ser Thr Gln Lys Ala Ile Asp370 375 380Lys Ile Thr Ser Lys Val Asn Asn Ile Val Asp Lys Met Asn Lys Gln385 390 395 400Tyr Glu Ile Ile Asp His Glu Phe Ser Glu Val Glu Thr Arg Leu Asn405 410 415Met Ile Asn Asn Lys Ile Asp Asp Gln Ile Gln Asp Ile Trp Ala Tyr420 425 430Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Gln Lys Thr Leu Asp Glu435 440 445His AspAla Asn Val Asn Asn Leu Tyr Asn Lys Val Lys Arg Ala Leu 450 455 460 Gly Thr Asn Ala Val Glu Asp Gly Lys Gly Cys Phe Glu Leu Tyr His 465 470 475 480 Lys Cys Asp Asp Gln Cys Met Glu Thr Ile Arg Asn Gly Thr Tyr Asn 485 490 495 Arg Arg Lys Tyr Gln Glu Glu Ser Lys Leu Glu Arg Gln Lys Ile Glu 500 505 510 Gly Val Lys Leu Glu Ser Glu Gly Thr Tyr Lys Ile Leu Thr Ile Tyr 515 520 525 Ser Thr Val Ala Ser Ser Leu Val Ile Ala Met Gly Phe Ala Ala Phe 530 535 540 Leu Phe Trp Ala Met Ser Asn Gly Ser Cys Arg Cys Asn Ile Cys Ile 545 550 555 560 <210> 3 <211> 560 <212> PRT <213> Artificial Sequence <220> <223> H9-CNn2 <400> 3 Met Glu Val Val Ser Leu Ile Thr Ile Leu Leu Val Val Thr Val Ser 1 5 10 15 Asn Ala Asp Lys Ile Cys Ile Gly Tyr Gln Ser Thr Asn Ser Thr Glu 20 25 30 Thr Val Asp Thr Leu Thr Glu Asn Asn Val Pro Val Thr His Ala Lys 35 40 45 Glu Leu Leu His Thr Glu His Asn Gly Met Leu Cys Ala Thr Ser Leu 50 55 60 Gly Gln Pro Leu Ile Leu Asp Thr Cys Thr Ile Glu Gly Leu Ile Tyr 65 70 75 80 Gly Asn Pro Ser Cys Asp Leu Ser Leu Glu Gly Arg Glu Trp SerTyr85 90 95Ile Val Glu Arg Pro Ser Ala Val Asn Gly Leu Cys Tyr Pro Gly Asn100 105 110Val Glu Asn Leu Glu Glu Leu Arg Ser Leu Phe Ser Ser Ala Arg Ser115 120 125Tyr Gln Arg Ile Gln Ile Phe Pro Asp Thr Ile Trp Asn Val Ser Tyr130 135 140Asp Gly Thr Ser Thr Ala Cys Ser Gly Ser Phe Tyr Arg Ser Met Arg145 150 155 160Trp Leu Thr Arg Lys Asn Gly Asp Tyr Pro Thr Gln Asp Ala Gln Tyr165 170 175Thr Asn Asn Gln Gly Lys Asn Ile Leu Phe Met Trp Gly Ile Asn His180 185 190Pro Pro Thr Asp Thr Ala Gln Thr Asn Leu Tyr Thr Arg Thr Asp Thr195 200 205Thr Thr Ser Val Ala Thr Glu Glu Ile Asn Arg Ile Phe Lys Pro Leu210 215 220Ile Gly Pro Arg Pro Leu Val Asn Gly Leu Met Gly Arg Ile Asp Tyr225 230 235 240Tyr Trp Ser Val Leu Lys Pro Gly Gln Thr Leu Arg Ile Lys Ser Asp245 250 255Gly Asn Leu Ile Ala Pro Trp Tyr Gly His Ile Leu Ser Gly Glu Ser260 265 270His Gly Arg Ile Leu Lys Thr Asp Leu Lys Arg Gly Ser Cys Thr Val275 280 285Gln Cys Gln Thr Glu Lys Gly Gly Leu Asn Thr Thr Leu Pro Phe Gln290 295 300Asn Val Ser Lys TyrAla Phe Gly Asn Cys Ser Lys Tyr Ile Gly Ile305 310 315 320Lys Ser Leu Lys Leu Ala Val Gly Leu Arg Asn Val Pro Ser Arg Ser325 330 335Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp340 345 350Ser Gly Leu Val Ala Gly Trp Tyr Gly Phe Gln His Ser Asn Asp Gln355 360 365Gly Val Gly Met Ala Ala Asp Arg Asp Ser Thr Gln Lys Ala Ile Asp370 375 380Lys Ile Thr Ser Lys Val Asn Asn Ile Val Asp Lys Met Asn Lys Gln385 390 395 400Tyr Glu Ile Ile Asp His Glu Phe Ser Glu Val Glu Thr Arg Leu Asn405 410 415Met Ile Asn Asn Lys Ile Asp Asp Gln Ile Gln Asp Ile Trp Ala Tyr420 425 430Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Gln Lys Thr Leu Asp Glu435 440 445His Asp Ala Asn Val Asn Asn Leu Tyr Asn Lys Val Lys Arg Ala Leu450 455 460Gly Thr Asn Ala Val Glu Asp Gly Lys Gly Cys Phe Glu Leu Tyr His465 470 475 480Lys Cys Asp Asp Gln Cys Met Glu Thr Ile Arg Asn Gly Thr Tyr Asn485 490 495Arg Arg Lys Tyr Gln Glu Glu Ser Lys Leu Glu Arg Gln Lys Ile Glu500 505 510Gly Val Lys Leu Glu Ser Glu Gly Thr Tyr LysIle Leu Thr Ile Tyr 515 520 525 Ser Thr Val Ala Ser Ser Leu Val Ile Ala Met Gly Phe Ala Ala Phe 530 535 540 Leu Phe Trp Ala Met Ser Asn Gly Ser Cys Arg Cys Asn Ile Cys Ile 545 550 555 560 <210> 4 <211> 560 <212> PRT <213> Artificial Sequence <220> <223> H9-CNn3 <400> 4 Met Glu Val Val Ser Leu Ile Thr Ile Leu Leu Val Val Thr Val Ser 1 5 10 15 Asn Ala Asp Lys Ile Cys Ile Gly Tyr Gln Ser Thr Asn Ser Thr Glu 20 25 30 Thr Val Asp Thr Leu Thr Glu Asn Asn Val Pro Val Thr His Ala Lys 35 40 45 Glu Leu Leu His Thr Glu His Asn Gly Met Leu Cys Ala Thr Ser Leu 50 55 60 Gly Gln Pro Leu Ile Leu Asp Thr Cys Thr Ile Glu Gly Leu Ile Tyr 65 70 75 80 Gly Asn Pro Ser Cys Asp Leu Ser Leu Glu Gly Arg Glu Trp Ser Tyr 85 90 95 Ile Val Glu Arg Pro Ser Ala Val Asn Gly Leu Cys Tyr Pro Gly Asn 100 105 110 Val Glu Asn Leu Glu Glu Leu Arg Ser Leu Phe Ser Ser Ala Arg Ser 115 120 125 Tyr Gln Arg Ile Gln Ile Phe Pro Asp Thr Ile Trp Asn Val Ser Tyr 130 135 140 Asp Gly Thr Ser Thr Ala Cys Ser Gly Ser Phe Tyr Arg Ser Met Arg 145 150 155 160 Trp Leu Thr Gln Lys Asn AsnAla Tyr Pro Ile Gln Asp Ala Gln Tyr165 170 175Thr Asn Asn Gln Gly Lys Asn Ile Leu Phe Met Trp Gly Ile Asn His180 185 190Pro Pro Thr Asp Thr Thr Gln Arg Asn Leu Tyr Thr Arg Thr Asp Thr195 200 205Thr Thr Ser Val Ala Thr Glu Glu Ile Asn Arg Ile Phe Lys Pro Leu210 215 220Ile Gly Pro Arg Pro Leu Val Asn Gly Leu Met Gly Arg Ile Asp Tyr225 230 235 240Tyr Trp Ser Val Leu Lys Pro Gly Gln Thr Leu Arg Ile Lys Ser Asp245 250 255Gly Asn Leu Ile Ala Pro Trp Tyr Gly His Ile Leu Ser Gly Glu Ser260 265 270His Gly Arg Ile Leu Lys Thr Asp Leu Lys Arg Gly Ser Cys Thr Val275 280 285Gln Cys Gln Thr Glu Lys Gly Gly Leu Asn Thr Thr Leu Pro Phe Gln290 295 300Asn Val Ser Lys Tyr Ala Phe Gly Asn Cys Ser Lys Tyr Ile Gly Ile305 310 315 320Lys Ser Leu Lys Leu Ala Val Gly Leu Arg Asn Val Pro Ser Arg Ser325 330 335Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp340 345 350Ser Gly Leu Val Ala Gly Trp Tyr Gly Phe Gln His Ser Asn Asp Gln355 360 365Gly Val Gly Met Ala Ala Asp Arg Asp Ser Thr Gln Lys AlaIle Asp370 375 380Lys Ile Thr Ser Lys Val Asn Asn Ile Val Asp Lys Met Asn Lys Gln385 390 395 400Tyr Glu Ile Ile Asp His Glu Phe Ser Glu Val Glu Thr Arg Leu Asn405 410 415Met Ile Asn Asn Lys Ile Asp Asp Gln Ile Gln Asp Ile Trp Ala Tyr420 425 430Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Gln Lys Thr Leu Asp Glu435 440 445His Asp Ala Asn Val Asn Asn Leu Tyr Asn Lys Val Lys Arg Ala Leu450 455 460Gly Thr Asn Ala Val Glu Asp Gly Lys Gly Cys Phe Glu Leu Tyr His465 470 475 480Lys Cys Asp Asp Gln Cys Met Glu Thr Ile Arg Asn Gly Thr Tyr Asn485 490 495Arg Arg Lys Tyr Gln Glu Glu Ser Lys Leu Glu Arg Gln Lys Ile Glu500 505 510Gly Val Lys Leu Glu Ser Glu Gly Thr Tyr Lys Ile Leu Thr Ile Tyr515 520 525Ser Thr Val Ala Ser Ser Leu Val Ile Ala Met Gly Phe Ala Ala Phe530 535 540Leu Phe Trp Ala Met Ser Asn Gly Ser Cys Arg Cys Asn Ile Cys Ile545 550 555 560<210> 5<211> 560<212> PRT<213> Artificial Sequence<220><Ile Gly Tyr Gln Ser Thr Asn Ser Thr Glu20 25 30Thr Val Asp Thr Leu Thr Glu Asn Asn Val Pro Val Thr His Ala Lys35 40 45Glu Leu Leu His Thr Glu His Asn Gly Met Leu Cys Ala Thr Ser Leu50 55 60Gly Gln Pro Leu Ile Leu Asp Thr Cys Thr Ile Glu Gly Leu Ile Tyr65 70 75 80Gly Asn Pro Ser Cys Asp Leu Leu Leu Gly Gly Arg Glu Trp Ser Tyr85 90 95Ile Val Glu Arg Pro Ser Ala Val Asn Gly Leu Cys Tyr Pro Gly Asn100 105 110Val Glu Asn Leu Glu Glu Leu Arg Ser Leu Phe Ser Ser Ala Arg Ser115 120 125Tyr Gln Arg Ile Gln Ile Phe Pro Asp Thr Ile Trp Asn Val Ser Tyr130 135 140Asp Gly Thr Ser Thr Ala Cys Ser Gly Ser Phe Tyr Arg Ser Met Arg145 150 155 160Trp Leu Thr Arg Lys Asn Gly Asp Tyr Pro Ile Gln Asp Ala Gln Tyr165 170 175Thr Asn Asn Gln Gly Lys Asn Ile Leu Phe Met Trp Gly Ile Asn His180 185 190Pro Pro Thr Asp Asp Thr Gln Arg Asn Leu Tyr Thr Arg Thr Asp Thr195 200 205Thr Thr Ser Val Ala Thr Glu Glu Ile Asn Arg Ile Phe Lys Pro Leu210 215 220Ile Gly Pro Arg Pro Leu Val Asn Gly Leu Met Gly Arg Ile Asp Tyr225 230235 240Tyr Trp Ser Val Leu Lys Pro Gly Gln Thr Leu Arg Ile Lys Ser Asp245 250 255Gly Asn Leu Ile Ala Pro Trp Tyr Gly His Ile Leu Ser Gly Glu Ser260 265 270His Gly Arg Ile Leu Lys Thr Asp Leu Lys Arg Gly Ser Cys Thr Val275 280 285Gln Cys Gln Thr Glu Lys Gly Gly Leu Asn Thr Thr Leu Pro Phe Gln290 295 300Asn Val Ser Lys Tyr Ala Phe Gly Asn Cys Ser Lys Tyr Ile Gly Ile305 310 315 320Lys Ser Leu Lys Leu Ala Val Gly Leu Arg Asn Val Pro Ser Arg Ser325 330 335Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp340 345 350Ser Gly Leu Val Ala Gly Trp Tyr Gly Phe Gln His Ser Asn Asp Gln355 360 365Gly Val Gly Met Ala Ala Asp Arg Asp Ser Thr Gln Lys Ala Ile Asp370 375 380Lys Ile Thr Ser Lys Val Asn Asn Ile Val Asp Lys Met Asn Lys Gln385 390 395 400Tyr Glu Ile Ile Asp His Glu Phe Ser Glu Val Glu Thr Arg Leu Asn405 410 415Met Ile Asn Asn Lys Ile Asp Asp Gln Ile Gln Asp Ile Trp Ala Tyr420 425 430Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Gln Lys Thr Leu Asp Glu435 440 445His Asp Ala Asn Val AsnAsn Leu Tyr Asn Lys Val Lys Arg Ala Leu450 455 460Gly Thr Asn Ala Val Glu Asp Gly Lys Gly Cys Phe Glu Leu Tyr His465 470 475 480Lys Cys Asp Asp Gln Cys Met Glu Thr Ile Arg Asn Gly Thr Tyr Asn485 490 495Arg Arg Lys Tyr Gln Glu Glu Ser Lys Leu Glu Arg Gln Lys Ile Glu500 505 510Gly Val Lys Leu Glu Ser Glu Gly Thr Tyr Lys Ile Leu Thr Ile Tyr515 520 525Ser Thr Val Ala Ser Ser Leu Val Ile Ala Met Gly Phe Ala Ala Phe530 535 540Leu Phe Trp Ala Met Ser Asn Gly Ser Cys Arg Cys Asn Ile Cys Ile545 550 555 560<210> 6<211> 559<212> PRT<213> Artificial Sequence<220><223> H9-CNn5<400> 6Met Glu Val Val Ser Leu Ile Thr Ile Leu Leu Val Val Thr Val Ser1 5 10 15Asn Ala Asp Lys Ile Cys Ile Gly Tyr Gln Ser Thr Asn Ser Thr Glu20 25 30Thr Val Asp Thr Leu Thr Glu Asn Asn Val Pro Val Thr His Ala Lys35 40 45Glu Leu Leu His Thr Glu His Asn Gly Met Leu Cys Ala Thr Ser Leu50 55 60Gly Gln Pro Leu Ile Leu Asp Thr Cys Thr Ile Glu Gly Leu Ile Tyr65 70 75 80Gly Asn Pro Ser Cys Asp Leu Ser Leu Glu Gly Arg Glu Trp Ser Tyr85 90 95Ile ValGlu Arg Pro Ser Ala Val Asn Gly Leu Cys Tyr Pro Gly Asn100 105 110Val Glu Asn Leu Glu Glu Leu Arg Ser Leu Phe Ser Ser Ala Arg Ser115 120 125Tyr Gln Arg Ile Gln Ile Phe Pro Asp Thr Ile Trp Asn Val Ser Tyr130 135 140Asp Gly Thr Ser Thr Ala Cys Ser Gly Ser Phe Tyr Arg Ser Met Arg145 150 155 160Trp Leu Thr Arg Lys Asn Gly Asp Tyr Pro Ile Gln Asp Ala Gln Tyr165 170 175Thr Asn Asn Gln Gly Lys Asn Ile Leu Phe Met Trp Gly Ile Asn His180 185 190Pro Pro Thr Asp Asp Thr Gln Arg Asn Leu Tyr Thr Arg Thr Asp Thr195 200 205Thr Thr Ser Val Ala Thr Glu Glu Ile Asn Arg Ile Phe Lys Pro Leu210 215 220Ile Gly Pro Arg Pro Leu Val Asn Gly Leu Met Gly Arg Ile Asp Tyr225 230 235 240Tyr Trp Ser Val Leu Lys Pro Gly Gln Thr Leu Arg Ile Lys Ser Asp245 250 255Gly Asn Leu Ile Ala Pro Trp Tyr Gly His Ile Leu Ser Gly Glu Ser260 265 270His Gly Arg Ile Leu Lys Thr Asp Leu Lys Arg Gly Ser Cys Thr Val275 280 285Gln Cys Gln Thr Glu Lys Gly Gly Leu Asn Thr Thr Leu Pro Phe Gln290 295 300Asn Val Ser Lys Tyr Ala Phe Gly AsnCys Ser Lys Tyr Ile Gly Ile305 310 315 320Lys Ser Leu Lys Leu Ala Val Gly Leu Arg Asn Val Pro Ser Arg Ser325 330 335Ser Arg Gly Leu Phe Gly Ala Ile Ala Gly Phe Ile Glu Gly Gly Trp340 345 350Ser Gly Leu Val Ala Gly Trp Tyr Gly Phe Gln His Ser Asn Asp Gln355 360 365Gly Val Gly Met Ala Ala Asp Arg Asp Ser Thr Gln Lys Ala Ile Asp370 375 380Lys Ile Thr Ser Lys Val Asn Asn Ile Val Asp Lys Met Asn Lys Gln385 390 395 400Tyr Glu Ile Ile Asp His Glu Phe Ser Glu Val Glu Thr Arg Leu Asn405 410 415Met Ile Asn Asn Lys Ile Asp Asp Gln Ile Gln Asp Ile Trp Ala Tyr420 425 430Asn Ala Glu Leu Leu Val Leu Leu Glu Asn Gln Lys Thr Leu Asp Glu435 440 445His Asp Ala Asn Val Asn Asn Leu Tyr Asn Lys Val Lys Arg Ala Leu450 455 460Gly Thr Asn Ala Val Glu Asp Gly Lys Gly Cys Phe Glu Leu Tyr His465 470 475 480Lys Cys Asp Asp Gln Cys Met Glu Thr Ile Arg Asn Gly Thr Tyr Asn485 490 495Arg Arg Lys Tyr Gln Glu Glu Ser Lys Leu Glu Arg Gln Lys Ile Glu500 505 510Gly Val Lys Leu Glu Ser Glu Gly Thr Tyr Lys Ile Leu Thr IleSer515 520 525Phe Ala Ile Ser Cys Phe Leu Leu Cys Val Val Leu Leu Gly Phe Ile530 535 540Met Trp Ala Cys Gln Asn Gly Ser Cys Arg Cys Asn Ile Cys Ile545 550 555<210> 7<211> 553<212> PRT<213> Artificial Sequence<220><223> F Protein<400> 7Met Gly Ser Arg Ser Ser Thr Arg Ile Pro Val Pro Leu Met Leu Thr1 5 10 15Val Arg Ile Met Leu Ala Leu Ser Cys Val Cys Pro Thr Ser Ser Leu20 25 30Asp Gly Arg Pro Leu Ala Ala Ala Gly Ile Val Val Thr Gly Asp Lys35 40 45Ala Val Asn Ile Tyr Thr Ser Ser Gln Thr Gly Ser Ile Ile Ile Lys50 55 60Leu Leu Pro Asn Met Pro Lys Asp Lys Glu Ala Cys Ala Lys Ala Pro65 70 75 80Leu Glu Ala Tyr Asn Arg Thr Leu Thr Thr Leu Leu Thr Pro Leu Gly85 90 95Asp Ser Ile Arg Arg Ile Gln Glu Ser Val Thr Thr Ser Gly Gly Gly100 105 110Lys Gln Gly Arg Leu Ile Gly Ala Ile Ile Gly Gly Val Ala Leu Gly115 120 125Val Ala Thr Ala Ala Gln Ile Thr Ala Ala Ser Ala Leu Ile Gln Ala130 135 140Asn Gln Asn Ala Ala Asn Ile Leu Arg Leu Lys Glu Ser Ile Ala Ala145 150 155 160Thr Asn Glu Ala Val His Glu Val Thr Asp Gly Leu Ser GlnLeu Ala165 170 175Val Ala Val Gly Lys Met Gln Gln Phe Val Asn Asp Gln Phe Asn Lys180 185 190Thr Ala Gln Glu Leu Asp Cys Ile Lys Ile Thr Gln Gln Val Gly Val195 200 205Glu Leu Asn Leu Tyr Leu Thr Glu Leu Thr Thr Val Phe Gly Pro Gln210 215 220Ile Thr Ser Pro Ala Leu Thr Gln Leu Thr Ile Gln Ala Leu Tyr Asn225 230 235 240Leu Ala Gly Gly Asn Met Asp Tyr Leu Leu Thr Lys Leu Gly Val Gly245 250 255Asn Asn Gln Leu Ser Ser Leu Ile Gly Ser Gly Leu Ile Thr Gly Asn260 265 270Pro Ile Leu Tyr Asp Ser Gln Thr Gln Leu Leu Gly Ile Gln Val Thr275 280 285Leu Pro Ser Val Gly Asn Leu Asn Asn Met Arg Ala Thr Tyr Leu Glu290 295 300Thr Leu Ser Val Ser Thr Thr Lys Gly Phe Ala Ser Ala Leu Val Pro305 310 315 320Lys Val Val Thr Gln Val Gly Ser Val Ile Glu Glu Leu Asp Thr Ser325 330 335Tyr Cys Ile Glu Thr Asp Leu Asp Leu Tyr Cys Thr Arg Ile Val Thr340 345 350Phe Pro Met Ser Pro Gly Ile Tyr Ser Cys Leu Ser Gly Asn Thr Ser355 360 365Ala Cys Met Tyr Ser Lys Thr Glu Gly Ala Leu Thr Thr Pro Tyr Met370 375 380Thr Leu LysGly Ser Val Ile Ala Asn Cys Lys Met Thr Thr Cys Arg385 390 395 400Cys Ala Asp Pro Pro Gly Ile Ile Ser Gln Asn Tyr Gly Glu Ala Val405 410 415Ser Leu Ile Asp Arg Gln Ser Cys Asn Ile Leu Ser Leu Asp Gly Ile420 425 430Thr Leu Arg Leu Ser Gly Glu Phe Asp Ala Thr Tyr Gln Lys Asn Ile435 440 445Ser Ile Gln Asp Ser Gln Val Ile Val Thr Gly Asn Leu Asp Ile Ser450 455 460Thr Glu Leu Gly Asn Val Asn Asn Ser Ile Ser Asn Ala Leu Asp Lys465 470 475 480Leu Glu Glu Ser Asn Ser Lys Leu Asp Lys Val Asn Val Lys Leu Thr485 490 495Ser Thr Ser Ala Leu Ile Thr Tyr Ile Val Leu Thr Val Ile Ser Leu500 505 510Val Cys Gly Ile Leu Ser Leu Val Leu Ala Cys Tyr Leu Met Tyr Lys515 520 525Gln Lys Ala Gln Gln Lys Thr Leu Leu Trp Leu Gly Asn Asn Thr Leu530 535 540Asp Gln Met Arg Ala Thr Thr Lys Met545 550 <210> 8 <211> 1683 <212> DNA <213> artificial sequence <220> <223> H9-CN <400> 8atggaagtag tatcactaat aactatacta ctagtagtaa cattaagcaa tgcagataaa 60atttgcatcg gctatcaatc aacaaactcc acagaaactg tagacacact aacagaaaac 120aatgttcctg tgacacatgccaaagaattg ctccacacag agcataatgg gatgctgtgt 180gcaacaagct tgggacaccc tcttatccta gacacctgta ccattgaagg actaatctat 240ggcaatcctt cttgtgatct attgttggga ggaagagaat ggtcctatat cgtcgagaga 300ccatcagctg ttaacggatt gtgttatccc gggaatgtag aaaacctaga agagctaagg 360tcacttttta gttctgctag gtcttatcaa aggatccaga ttttcccaga caaatctgg 420aatgtgtctt acagtgggac aagcaaagca tgttcagatt cattctaccg aagcatgaga 480tggctgactc aaaagaacaa tgcttaccct attcaagacg cccaatacac aaataatcaa 540gaaaagaaca ttcttttcat gtggggcata aatcaccca ccaccgatac tgtgcagaca 600aatctgtaca caagaaccga cacaacaacg agtgtggcaa cagaagaaat aaataggacc 660ttcaaaccat tgataggacc aaggcctctt gttaatggt tacagggaag aattgattat 720tattggtcag tattgaaacc gggtcaaaca ctgcgaataa gatctaatgg gaatctaata 780gctccatggt atggacacat tctttcagga gagagccacg gagaatcct gagaactgat 840ttaaaaaggg gtagctgcac agtgcaatgt cagacagaaa aaggtggatt aaacacaaca 900ttgccattcc aaaacgtaag taagtatgca tttggaaact gctcgaaata cattggcata 960aagagtctca aacttgcagt tggtctgagg aatgtgcctt ccagatctagtagaggacta 1020ttcggggcca tagcaggatt catagaggga ggttggtcag ggctagttgc tggttggtat 1080ggattccagc attcaaatga ccaaggggtt ggtatggcag cagatagaga ctcaacccaa 1140aaggcaattg ataaaataac atccaaagtg aataacatag tggacaaaat gaacaagcag 1200tatgaaatta ttgatcatga attcagtgag gttgaaacta gacttaacat gatcaataat 1260aagattgatg atcaaattca agatatatgg gcatataatg cagaattgct agttctgctt 1320gagaaccaga aaacactcga tgagcatgat gcaaatgtaa ataatctata taataaagtg 1380aagagggcat tgggtaccaa tgcggtggaa gatgggaaag gatgtttcga gctataccac 1440aaatgtgatg accagtgcat ggagacaatt cggaacggga cctacaacag gaggaagtat 1500caagaagaat caaaattaga aaggcagaaa atagaggggg tcaagctgga atctgaagga 1560acttacaaaa tcctcaccat ttattcgact gtcgcctcat ctcttgtaat tgcaatgggg 1620tttgctgcct tcttgttctg ggccatgtcc aatgggtctt gcagatgcaa catttgtata 1680taa 1683<210> 9<211> 1683<212> DNA<213> Artificial Sequence<220><223> H9-CNn1<400> 9atggaagtag tatcactaat aactatacta ctagtagtaa cagtaagcaa tgcagataaa 60atctgcatcg gctaccaatc aacaaactcc acagaaactg tggacacact aacagaaaac120aatgtccctg tgacacatgc caaagaactg ctccacacag agcataatgg gatgctgtgt 180gcaacaagct tgggacaacc tcttatttta gacacctgca ccattgaagg gctaatctat 240ggcaatcctt cttgtgatct atcgctggaa ggaagagaat ggtcctatat cgtcgagaga 300ccatcagctg ttaacggatt gtgttacccc gggaatgtag aaaacctaga agagctaagg 360tcacttttta gttctgctag gtcttatcaa agaatccaga tttcccaga caaatctgg 420aatgtgtctt acgatggaac aagcacagca tgctcaggtt cattctacag aagcatgaga 480tggttgactc gaagaacgg cgattaccct atccaagacg cccaatacac aaataatcaa 540gggaagaaca ttcttttcat gtggggcata aatcacccac ccaccgatga tacgcagaga 600aatctgtaca cgagaaccga cacaacaacg agtgtggcaa cagaagaaat aaataggatc 660ttcaaaccat tgataggacc aaggcctctt gtcaacggtt tgatgggaag aattgattat 720tattggtctg tattgaaacc gggtcaaaca ctgcgaataa aatctgatgg gaatctaata 780gctccatggt atggacacat tctttcagga gagagccatg gagaatcct gagaactgat 840ttaaaaaggg gtagctgcac agtgcaatgt cagacaga aaggtggctt aaacacaaca 900ctgccattcc aaaatgtaag taagtatgca tttggaaact gctcaaaata cattggcata 960aagagtctca aacttgcagttggtctgagg aatgtgcctt ccagatctag tagaggacta 1020ttcggggcca tagcaggatt catagaggga ggttggtcag ggctagttgc tggttggtat 1080ggattccagc attcaaatga ccaaggggtt ggtatggcag cagatagaga ctcaacccaa 1140aaggcaattg ataaaataac atccaaagtg aataacatag tggacaaaat gaacaagcag 1200tatgaaatta ttgatcatga attcagtgag gttgaaacta gacttaacat gatcaataat 1260aagattgatg atcaaattca agatatatgg gcatataatg cagaattgct agttctgctt 1320gagaaccaga aaacactcga tgagcatgat gcaaatgtaa ataatctata taataaagtg 1380aagagggcat tgggtaccaa tgcggtggaa gatgggaaag gatgtttcga gctataccac 1440aaatgtgatg accagtgcat ggagacaatt cggaacggga cctacaacag gaggaagtat 1500caagaagaat caaaattaga aaggcagaaa atagaggggg tcaagctgga atctgaagga 1560acttacaaaa tcctcaccat ttattcgact gtcgcctcat ctcttgtaat tgcaatgggg 1620tttgctgcct tcttgttctg ggccatgtcc aatgggtctt gcagatgcaa catttgtata 1680taa 1683<210> 10<211> 1683<212> DNA<213> Artificial Sequence<220><223> H9-CNn2<400> 10atggaagtag tatcactaat aactatacta ctagtagtaa cagtaagcaa tgcagataaa 60atctgcatcg gctaccaatc aacaaactcc acagaaactgtggacacact aacagaaaac 120aatgtccctg tgacacatgc caaagaactg ctccacacag agcataatgg gatgctgtgt 180gcaacaagct tgggacaacc tcttatttta gacacctgca ccattgaagg gctaatctat 240ggcaatcctt cttgtgatct atcgctggaa ggaagagaat ggtcctatat cgtcgagaga 300ccatcagctg ttaacggatt gtgttacccc gggaatgtag aaaacctaga agagctaagg 360tcacttttta gttctgctag gtcttatcaa agaatccaga ttttcccaga caaatctgg 420aatgtgtctt aggatggaac aagcacagca tgctcaggtt cattctacag aagcatgaga 480tggttgactc gaagaacgg cgattacct acccaagacg cccaataacac aaataatcaa 540gggaagaaca ttcttttcat gtggggcata aatcacccac ccaccgatac tgcacagaca 600aatctgtaca cgagaaccga cacaacaacg agtgtggcaa cagaagaaat aatataggatc 660ttcaaaccat tgataggacc aaggcctctt gtcaacggtt tgatgggaag aattgattat 720tattggtctg tattgaaacc gggtcaaaca ctgcgaataa aatctgatgg gaatctaata 780gctccatggt atggacacat tctttcagga gagagccatg gagaatcct gagaactgat 840ttaaaaaggg gtagctgcac agtgcaatgt cagacagaga aaggtggctt aaacacaaca 900ctgccattcc aaaatgtaag taagtatgca tttggaaact gctcaaaata cattggcata960aagagtctca aacttgcagt tggtctgagg aatgtgcctt ccagatctag tagaggacta 1020ttcggggcca tagcaggatt catagaggga ggttggtcag ggctagttgc tggttggtat 1080ggattccagc attcaaatga ccaaggggtt ggtatggcag cagatagaga ctcaacccaa 1140aaggcaattg ataaaataac atccaaagtg aataacatag tggacaaaat gaacaagcag 1200tatgaaatta ttgatcatga attcagtgag gttgaaacta gacttaacat gatcaataat 1260aagattgatg atcaaattca agatatatgg gcatataatg cagaattgct agttctgctt 1320gagaaccaga aaacactcga tgagcatgat gcaaatgtaa ataatctata taataaagtg 1380aagagggcat tgggtaccaa tgcggtggaa gatgggaaag gatgtttcga gctataccac 1440aaatgtgatg accagtgcat ggagacaatt cggaacggga cctacaacag gaggaagtat 1500caagaagaat caaaattaga aaggcagaaa atagaggggg tcaagctgga atctgaagga 1560acttacaaaa tcctcaccat ttattcgact gtcgcctcat ctcttgtaat tgcaatgggg 1620tttgctgcct tcttgttctg ggccatgtcc aatgggtctt gcagatgcaa catttgtata 1680taa 1683<210> 11<211> 1683<212> DNA<213> Artificial Sequence<220><223> H9-CNn3<400> 11atggaagtag tatcactaat aactatacta ctagtagtaa cagtaagcaa tgcagataaa 60atctgcatcggctaccaatc aacaaactcc aagaaactg tggacacact aacagaaaac 120aatgtccctg tgacacatgc caaagaactg ctccacacag agcataatgg gatgctgtgt 180gcaacaagct tgggacaacc tcttatttta gacacctgca ccattgaagg gctaatctat 240ggcaatcctt cttgtgatct atcgctggaa ggaagagaat ggtcctatat cgtcgagaga 300ccatcagctg ttaacggatt gtgttacccc gggaatgtag aaaacctaga agagctaagg 360tcacttttta gttctgctag gtcttatcaa agaatccaga tttcccaga caaatctgg 420aatgtgtctt acgatggaac aagcacagca tgctcaggtt cattctacag aagcatgaga 480tggttgactc aaaagaacaa cgcttaccct atccaagacg cccaatacac aataatcaa 540gggaagaaca ttctttcat gtggggcata aatcacccac ccaccgatac tacgcagaga 600aatctgtaca cgagaaccga cacaacaacg agtgtggcaa cagaagaaat aatataggatc 660ttcaaaccat tgataggacc aaggcctctt gtcaacggtt tgatgggaag aattgattat 720tattggtctg tattgaaacc gggtcaaaca ctgcgaataa aatctgatgg gaatctaata 780gctccatggt atggacacat tctttcagga gagagccatg gagaatcct gagaactgat 840ttaaaaaggg gtagctgcac agtgcaatgt cagacagaga aaggtggctt aaacacaaca 900ctgccattcc aaaatgtaag taggatatgca tttggaaactgctcaaaata cattggcata 960aagagtctca aacttgcagt tggtctgagg aatgtgcctt ccagatctag tagaggacta 1020ttcggggcca tagcaggatt catagaggga ggttggtcag ggctagttgc tggttggtat 1080ggattccagc attcaaatga ccaaggggtt ggtatggcag cagatagaga ctcaacccaa 1140aaggcaattg ataaaataac atccaaagtg aataacatag tggacaaaat gaacaagcag 1200tatgaaatta ttgatcatga attcagtgag gttgaaacta gacttaacat gatcaataat 1260aagattgatg atcaaattca agatatatgg gcatataatg cagaattgct agttctgctt 1320gagaaccaga aaacactcga tgagcatgat gcaaatgtaa ataatctata taataaagtg 1380aagagggcat tgggtaccaa tgcggtggaa gatgggaaag gatgtttcga gctataccac 1440aaatgtgatg accagtgcat ggagacaatt cggaacggga cctacaacag gaggaagtat 1500caagaagaat caaaattaga aaggcagaaa atagaggggg tcaagctgga atctgaagga 1560acttacaaaa tcctcaccat ttattcgact gtcgcctcat ctcttgtaat tgcaatgggg 1620tttgctgcct tcttgttctg ggccatgtcc aatgggtctt gcagatgcaa catttgtata 1680taa 1683<210> 12<211> 1683<212> DNA<213> Artificial Sequence<220><223> H9-CNn4<400> 12atggaagtag tatcactaat aactatacta ctagtagtaa cagtaagcaatgcagataaa 60atctgcatcg gctaccaatc aacaaactcc aagaaactg tggacacact aacagaaaac 120aatgtccctg tgacacatgc caaagaactg ctccacacag agcataatgg gatgctgtgt 180gcaacaagct tgggacaacc tcttatttta gacacctgca ccattgaagg gctaatctat 240ggcaatcctt cttgtgatct attgctggga ggaagagaat ggtcctatat cgtcgagaga 300ccatcagctg ttaacggatt gtgttacccc gggaatgtag aaaacctaga agagctaagg 360tcacttttta gttctgctag gtcttatcaa agaatccaga ttttcccaga caaatctgg 420aatgtgtctt acgatggaac aagcacagca tgctcaggt cattctacag aagcatgaga 480tggttgactc gaagaacgg cgattaccct atccaagacg cccaatacac aaataatcaa 540gggaagaaca ttctttcat gtggggcata aatcacccac ccaccgatga tacgcagaga 600aatctgtaca cgagaaccga cacaacaacg agtgtggcaa cagaagaaat aaataggatc 660ttcaaaccat tgataggacc aaggcctctt gtcaacggtt tgatgggaag aattgattat 720tattggtctg tattgaaacc gggtcaaaca ctgcgaataa aatctgatgg gaatctaata 780gctccatggt atggacacat tctttcagga gagagccatg gagaatcct gagaactgat 840ttaaaaaggg gtagctgcac agtgcaatgt cagacagaga aaggtggctt aaacacaaca 900ctgccattcc aaaatgtaagtaagtatgca tttggaaact gctcaaaata cattggcata 960aagagtctca aacttgcagt tggtctgagg aatgtgcctt ccagatctag tagaggacta 1020ttcggggcca tagcaggatt catagaggga ggttggtcag ggctagttgc tggttggtat 1080ggattccagc attcaaatga ccaaggggtt ggtatggcag cagatagaga ctcaacccaa 1140aaggcaattg ataaaataac atccaaagtg aataacatag tggacaaaat gaacaagcag 1200tatgaaatta ttgatcatga attcagtgag gttgaaacta gacttaacat gatcaataat 1260aagattgatg atcaaattca agatatatgg gcatataatg cagaattgct agttctgctt 1320gagaaccaga aaacactcga tgagcatgat gcaaatgtaa ataatctata taataaagtg 1380aagagggcat tgggtaccaa tgcggtggaa gatgggaaag gatgtttcga gctataccac 1440aaatgtgatg accagtgcat ggagacaatt cggaacggga cctacaacag gaggaagtat 1500caagaagaat caaaattaga aaggcagaaa atagaggggg tcaagctgga atctgaagga 1560acttacaaaa tcctcaccat ttattcgact gtcgcctcat ctcttgtaat tgcaatgggg 1620tttgctgcct tcttgttctg ggccatgtcc aatgggtctt gcagatgcaa catttgtata 1680taa 1683<210> 13<211> 1680<212> DNA<213> Artificial Sequence<220><223> H9-CNn5<400> 13atggaagtag tatcactaat aactatacta taagtatgca tttggaaact gctcaaaata cattggcata 960aagagtctca aacttgcagt tggtctgagg aatgtgcctt ccagatctag tagaggacta 1020ttcggggcca tagcaggatt catagaggga ggttggtcag ggctagttgc tggttggtat 1080ggattccagc attcaaatga ccaaggggtt ggtatggcag cagatagaga ctcaacccaa 1140aaggcaattg ataaaataac atccaaagtg aataacatag tggacaaaat gaacaagcag 1200tatgaaatta ttgatcatga attcagtgag gttgaaacta gacttaacat gatcaataat 1260aagattgatg atcaaattca agatatatgg gcatataatg cagaattgct agttctgctt 1320gagaaccaga aaacactcga tgagcatgat gcaaatgtaa ataatctata taataaagtg 1380aagagggcat tgggtaccaa tgcggtggaa gatgggaaag gatgtttcga gctataccac 1440aaatgtgatg accagtgcat ggagacaatt cggaacggga cctacaacag gaggaagtat 1500caagaagaat caaaattaga aaggcagaaa atagaggggg tcaagctgga atctgaagga 1560acttacaaaa tcctcaccat ttattcgact gtcgcctcat ctcttgtaat tgcaatgggg 1620tttgctgcct tcttgttctg ggccatgtcc aatgggtctt gcagatgcaa catttgtata 1680taa 1683<210> 13<211> 1680<212> DNA<213> Artificial Sequence<220><223> H9-CNn5<400> 13atggaagtag tatcactaat aactatactactagtagtaa cagataagcaa tgcagataaa 60atctgcatcg gctaccaatc aacaaactcc acagaaactg tggacacact aacagaaaac 120aatgtccctg tgacacatgc caaagaactg ctccacacacag agcataatgg gatgctgtgt 180gcaacaagct tgggacaacc tcttattta gacacctgca ccattgaagg gcttaatctat 240ggcaatcctt cttgtgatct atcgctggaa ggaagagaat ggtcctatat cgtcgagaga 300ccatcagctg ttaacggatt gtgttacccc gggaatgtag aaaacctaga agagctaagg 360tcacttttta gttctgctag gtcttatcaa agaatccaga tttcccaga cacaatctgg 420aatgtgtctt acgatggaac aagcacagca tgctcaggtt cattctacag aagcatgaga 480tggttgactc gaagaacgg cgattaccct atccaagacg cccaatacac aaataatcaa 540gggaagaaca ttctttcat gtggggcata aatcacccac ccaccgatga tacgcagaga 600aatctgtaca cgagaaccga cacaacaacg agtgtggcaa cagaagaaat aaataggatc 660ttcaaaccat tgataggacc aaggcctctt gtcaacggtt tgatgggaag aattgattat 720tattggtctg tattgaaacc gggtcaaaca ctgcgaataa aatctgatgg gaatctaata 780gctccatggt atggacacat tctttcagga gagagccatg gagaatcct gagaactgat 840ttaaaaaggg gtagctgcac agtgcaatgt cagacagaga aaggtggctt aaacacaaca900ctgccattcc aaaatgtaag taagtatgca tttggaaact gctcaaaata cattggcata 960aagagtctca aacttgcagt tggtctgagg aatgtgcctt ccagatctag tagaggacta 1020ttcggggcca tagcaggatt catagaggga ggttggtcag ggctagttgc tggttggtat 1080ggattccagc attcaaatga ccaaggggtt ggtatggcag cagatagaga ctcaacccaa 1140aaggcaattg ataaaataac atccaaagtg aataacatag tggacaaaat gaacaagcag 1200tatgaaatta ttgatcatga attcagtgag gttgaaacta gacttaacat gatcaataat 1260aagattgatg atcaaattca agatatatgg gcatataatg cagaattgct agttctgctt 1320gagaaccaga aaacactcga tgagcatgat gcaaatgtaa ataatctata taataaagtg 1380aagagggcat tgggtaccaa tgcggtggaa gatgggaaag gatgtttcga gctataccac 1440aaatgtgatg accagtgcat ggagacaatt cggaacggga cctacaacag gaggaagtat 1500caagaagaat caaaattaga aaggcagaaa atagaggggg tcaagctgga atctgaagga 1560acttacaaaa tcctcaccat ttcctttgcc atatcatgct ttttgctttg tgttgttcta 1620ttggggttca ttatgtgggc ctgccagaat gggtcttgca gatgcaacat ttgtatataa 1680<210> 14<211> 1662<212> DNA<213> Artificial Sequence<220><223> F gene<400> 14atgggctcca gatcttctaccaggatccca gtacctctga tgctgaccgt ccgaatcatg 60ttggcactga gttgcgtctg tccgaccagc tcccttgatg gcaggcctct tgcagctgca 120gggattgtgg taacaggaga caaagcagtc aacatataca cctcatctca gacagggtca 180atcataatca agttactccc aaatatgccc aaggataaag aggcgtgtgc aaaagcccca 240ttggaagcat acaacaggac attgactact ttgctcaccc cccttggtga ttctatccgt 300aggatacaag agtctgtgac cacatccgga ggagggaaac agggacgtct tataggcgcc 360attatcggtg gtgtagctct cggggttgca accgctgcac agataacagc agcctcggct 420ctgatacaag ccaatcaaaa tgctgccaac atcctccggc tcaaagagag cattgctgca 480accaatgagg ctgtgcacga ggtcactgac ggattatcac aactagcagt ggcagttggg 540aagatgcagc aatttgttaa tgaccagttt aataaaacag ctcaggaatt ggactgtata 600aaaattacac agcaggttgg tgtagaactc aacctgtacc taactgaatt gactacagta 660ttcgggccac aaatcacttc ccctgcctta actcagctga ctatccaggc gctttacaat 720ctagctggtg ggaatatgga ttacttgttg actaagttag gtgtaggaaa caaccaactc 780agctcattaa ttggtagtgg cctgattacc ggcaacccta tcctgtacga ctcacagact 840caactcttgg gtatacaggt caccctaccc tcagtcggga atctaaataatatgcgtgcc 900acctacctgg aaaccttgtc tgtaagtaca accaaaggat ttgcctcagc acttgtccca 960aaagtagtga cacaggttgg ttccgtgata gaagagcttg acacctcgta ctgtatcgag 1020accgatttgg acctatattg tacaagaata gtgacattcc ctatgtctcc tggtatttat 1080tcctgtttga gtggcaatac atctgcttgc atgtattcaa agactgaagg cgcactcact 1140acgccgtata tgaccctcaa aggctcagtt attgccaact gtaagatgac aacatgtaga 1200tgtgcagacc ccccgggtat catatcgcag aattatggag aagctgtgtc tctaatagat 1260aggcaatcat gcaatatctt atccttagac gggataactt tgaggctcag tggggaattt 1320gatgcaactt atcaaaagaa tatctcaata caagattctc aagtaatagt tacaggcaat 1380cttgacatct cgactgagct tgggaatgtc aacaactcga taagtaatgc tttggataag 1440ttagaggaaa gcaacagcaa actagacaag gtcaatgtta aactgaccag cacatccgct 1500cttattacct atatcgtttt aactgtcata tctcttgtat gtggtatact tagcctggtt 1560ctagcatgct acctgatgta caagcaaaag gcgcaacaga agaccttgtt gtggcttggg 1620aataataccc tagaccagat gagggccact acaaaaatgt ga 1662<210> 15<211> 557<212> DNA<213> Artificial Sequence<220><223> Pec promoter<400> 15tgcagagtta ttaatagtaa tcaattacggggtcattagt tcatagccca tatatggagy 60tccgcgttac ataacttacg gtaaatggcc cgccggctga ccgcccaacg acccccgccc 120attgacgtca ataatgacgt atgytcccat agtaacgcca atagggactt tccattgacg 180tcaatgggtg gagtayttac ggtaaactgc ccattggcag tacatcaagt gtatcatatg 240ccaagtacgc cccctattga cgtcaatgac ggtaaatgga tgcagtattt tgtgcagcga 300tgggggcggg gggggggggc gcgcgccagg cggggcgggg cggggcgagg ggcggggcgg 360ggcgaggcgg agaggtgcgg cggcagccaa tcagagcggc gcgctccgaa agtttccttt 420tatggcgagg cggcggcggc ggcggcccta taaaaagcga agcgcgcggc gggcgggagt 480cgctgcgcgc tgccttcgcc ccgtgccccg ctccgccgcc gcctcgcgcc gcccgccccg 540gctctgactg accgcgt 557<210> 16<211> 572<212> DNA<213> Artificial Sequence<220><223> mcmv-ie1 promoter<400> 16ggccaataag gctgcagtac tgagtcatta gggactttcc aatgggtttt gcccagtaca 60taaggtcaat aggggtgaat caacaggaaa gtcccattgg agccaagtac actgagtcaa 120tagggacttt ccattgggtt ttgcccagta caaaaggtca atagggggtg agtcaatggg 180tttttcccat tattggcacg tacataaggt caataggggt gagtcattgg gtttttccag 240ccaatttaat taaaacgcca tgtactttcc caccattgacgtcaatgggc tattgaaact 300aatgcaacgt gacctttaaa cggtactttc ccatagctga ttaatgggaa agtaccgttc 360tcgagccaat acacgtcaat gggaagtgaa agggcagcca aaacgtaaca ccgccccggt 420tttcccctgg aaattccata ttggcacgca ttctattggc tgagctgcgt tctacgtggg 480tataagaggc gcgaccagcg tcggtaccgt cgcagtcttc ggtctgacca ccgtagaacg 540cagagctcct cgctgcaggc ggccgctcta ga 572 <210> 17 <211> 87 <212> DNA <213> Artificial sequence <220> <223> polyA signal <400> 17ctgcaggcgg ccgctctaga gtcgacaata aaagatcttt attttcatta gatctgtgtg 60ttggtttttt gtgtggccaa taaggcc 87 <210> 18 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primers <400> 18ggggaagtcttccggttaagggac 24 <210> 19 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primers <400> 19ggtgcaattc gtaagaccga tggg 24 <210> 20 <211> 19 <212> DNA <213> Artificial sequence <220> <223> Primers <400> 20gcgcgactcc atacattga 19 <210> twenty one <211> twenty four <212> DNA <213> Artificial sequence <220> <223> Primers <400> 21agtccacatg caccccacct aaac 24

Claims

1. A recombinant turkey herpesvirus (Meleagrid alphaherpesvirus 1) comprising: (i) a nucleotide sequence encoding a hemagglutinin (HA) protein consisting of the amino acid sequence of SEQ ID NO: 4, inserted into a non-coding region between SORF3 and US2 of the viral genome, under the control of a murine or human CMV immediate early promoter; and (ii) a nucleotide sequence encoding a Newcastle disease virus F protein consisting of the amino acid sequence of SEQ ID NO: 7, inserted into a non-coding region between UL45 and UL46 of the viral genome, under the control of a Pec promoter.

2. The recombinant turkey herpesvirus according to claim 1, wherein the sequence encoding the HA protein is SEQ ID NO:

11.

3. The recombinant turkey herpesvirus according to claim 1 or 2, wherein the murine CMV immediate early promoter consists of the sequence of SEQ ID NO:

16.

4. The recombinant turkey herpesvirus according to claim 1 or 2, wherein the Pec promoter consists of the sequence of SEQ ID NO:

15.

5. A vaccine comprising recombinant turkey herpesvirus according to any one of claims 1 to 4.

6. A vaccine kit for immunizing poultry, the kit comprising: a) an effective amount of the vaccine according to claim 5, and b) a tool for administering the vaccine to the poultry.

Citation Information

Patent Citations

  • Avian infectious herpesvirus recombinants and recombinant vaccines prepared with the use of the same

    EP1026246A1

  • Recombinant herpesvirus of turkeys and use thereof

    WO2003064595A2

  • Turkey herpesvirus vectored recombinant containing avian influenza genes

    WO2008121329A2

  • Recombinant non-pathogenic marek's disease virus constructs encoding infectious laryngotracheitis virus and newcastle disease virus antigens

    WO2013057236A1

  • Recombinant gallid herpesvirus 3 (MDV serotype 2) vectors expressing antigens of avian pathogens and uses thereof

    WO2013082317A2