Standard plasmid for detecting copy number of exogenous gene of recombinant CVA10 vaccine and its preparation and application

Abstract

The application provides a standard plasmid for detecting the copy number of exogenous genes of a recombinant CVA10 vaccine, and a preparation method and application thereof. The standard plasmid of the application comprises an endogenous gene MOX fragment SEQ ID No. 1, an exogenous gene P1 fragment SEQ ID No. 2 and an exogenous gene 3CD fragment SEQ ID No. 3 which are connected in series in a cloning vector. The application constructs the standard plasmid, adopts Taqman probe-fluorescence quantitative PCR method, and simply, quickly, absolutely quantitatively and accurately analyzes the copy number of inserted exogenous genes, so that the detection time of the determination of the copy number of exogenous genes of the recombinant CVA10 vaccine is effectively shortened, repeated operation is facilitated, and the determination of the copy number of exogenous genes of the recombinant CVA10 vaccine based on the Hansenula platform and the verification of the genetic stability of the exogenous genes of the recombinant CVA10 vaccine have a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of biopharmaceutical technology, and specifically relates to standard plasmids for detecting the copy number of exogenous genes in recombinant CVA10 vaccines, their preparation methods, and applications. Background Technology

[0002] Coxsackievirus A10 (CVA10) belongs to the genus Enterovirus of the family Picornaviridae and is one of the pathogens that cause hand-foot-and-mouth disease (HFMD). HFMD is classified as a Class C infectious disease in my country. It has complex transmission routes, is highly contagious, and easily causes outbreaks or epidemics. Symptoms often include blisters or ulcers on the hands, feet, and oral mucosa. In rare cases, it can develop into meningitis, pulmonary edema, circulatory disorders, and even death.

[0003] Prior to 2008, the main pathogens of hand-foot-mouth disease (HFMD) were enterovirus 71 (EV71) and Coxsackievirus A16 (CVA16), which alternated or co-circulated. Starting in 2008, CVA10 began to circulate in some areas and, along with CVA6, became the dominant strain causing HFMD outbreaks, thus attracting significant attention from the medical community and vaccine manufacturers.

[0004] A recombinant Coxsackievirus A10 vaccine (Hansenula polymorpha) (referred to as recombinant CVA10 vaccine) is available. This recombinant CVA10 vaccine is based on the Hansenula polymorpha platform. The CVA10 gene fragments P1 and 3CD are randomly integrated into the genome of Hansenula polymorpha using recombination technology to form a recombinant genome. The corresponding Hansenula polymorpha strain is the recombinant Hansenula polymorpha. The CVA10 gene fragments P1 and 3CD are expressed in large quantities in the cell matrix of the recombinant Hansenula polymorpha strain as exogenous genes, including the P1 precursor protein and the 3CD enzyme. The 3CD enzyme can cleave the P1 precursor protein to obtain the structural proteins VP1-VP4, which then self-assemble to obtain Coxsackievirus A10 virus-like particles without nucleic acid. Finally, the virus-like particles are isolated from the recombinant Hansenula polymorpha strain through extraction and purification to prepare the corresponding virus-like particle vaccine. Compared with the traditional CVA10 vaccine, it has better immunogenicity and biocompatibility.

[0005] In the process of preparing recombinant CVA10 vaccine, determining the copy number of exogenous genes P1 and 3CD in the recombinant CVA10 vaccine is of great significance for the genetic stability of cell lines and subsequent production.

[0006] In existing technologies, Southern blot analysis is commonly used to determine gene copy number. However, this method is time-consuming and labor-intensive, requires a large amount of DNA sample, and relies on color intensity to determine copy number. This method is highly subjective, and different operators may produce significantly different results. Furthermore, the probes are radioactively labeled, which is harmful to the human body.

[0007] Another method for determining copy number changes is real-time quantitative PCR (qPCR). This method involves adding a non-specific dye (SYBR Green) or a fluorescently labeled specific probe to the PCR reaction system. It uses the accumulation of fluorescence signals to monitor the entire PCR process in real time, thereby obtaining the number of cycles (Ct value) required for different samples to reach a certain fluorescence signal (fluorescence threshold). When using this method to determine gene copy number, a standard curve is first plotted by comparing the Ct values ​​of known concentrations of standards with the logarithm of their initial concentrations. Then, the Ct value of the sample to be tested is substituted into the curve to calculate the initial concentration of the template. This method is characterized by its rapid reaction, good repeatability, high sensitivity, strong specificity, and clear results. Compared to Western blot hybridization, it can better determine the copy number of exogenous genes. Therefore, standards are a key factor in accurately determining gene copy number.

[0008] However, in practice, the exact number of exogenous genes P1 and 3CD inserted into the *Hansenula polymorpha* genome is uncertain, while the construction of standards requires specifying the exact number of exogenous genes P1 and 3CD inserted into the *Hansenula polymorpha* genome. Therefore, it is difficult to directly use exogenous genes P1 and 3CD to prepare corresponding standards. Thus, there is an urgent need to develop a standard that allows the copy number of the exogenous gene in the recombinant CVA10 vaccine to be determined using real-time quantitative PCR, thereby effectively improving the detection efficiency and accuracy of the exogenous gene copy number in the recombinant CVA10 vaccine. Summary of the Invention

[0009] To address the shortcomings of existing technologies, this invention provides a standard plasmid for detecting the copy number of exogenous genes in recombinant CVA10 vaccines. The standard plasmid consists of an endogenous gene MOX fragment (SEQ ID No. 1), an exogenous gene P1 fragment (SEQ ID No. 2), and an exogenous gene 3CD fragment (SEQ ID No. 3) tandemly in a cloning vector.

[0010] The cloning vector is one of the following: pUC18 vector, pUC19 vector, pET22b vector, pET28b vector, pET30a vector, pET32a vector, and pGEX6P1 vector.

[0011] Preferably, the cloning vector is pGEX6P1.

[0012] This invention provides a method for preparing the above-mentioned standard plasmid, the method comprising the following steps:

[0013] ① Design primer pairs and use Hansenula polymorpha genome as template to perform PCR amplification to prepare endogenous gene MOX fragment (SEQ ID No. 1); use recombinant CVA10 vaccine genome as template to perform PCR amplification to prepare exogenous gene P1 fragment (SEQ ID No. 2) and exogenous gene 3CD fragment (SEQ ID No. 3); then use the amplified endogenous gene MOX fragment, exogenous gene P1 fragment and exogenous gene 3CD fragment as templates to amplify the gene fragment CVA10-MOX-P1-3CD in sequence.

[0014] ② The cloning vector and the gene fragment CVA10-MOX-P1-3CD obtained in step ① were double-digested to obtain the vector fragment and the target fragment, respectively.

[0015] ③ Connect the vector fragment obtained in step ② with the target fragment to obtain the recombinant plasmid;

[0016] ④ Transform the recombinant plasmid obtained in step ③ into competent cells, then spread the competent cells on the corresponding culture medium and culture them in a constant temperature incubator at 37℃ to obtain a single clone containing the recombinant plasmid.

[0017] ⑤ The monoclonal strains obtained in step ③ were identified using PCR / double enzyme digestion and sequencing.

[0018] ⑥ The monoclonal strains that passed the identification in step ④ were amplified, and then the recombinant plasmids in the monoclonal strains were purified using a plasmid extraction kit to obtain standard plasmids.

[0019] Preferably, the primer pair in step ① is as follows:

[0020] Primer pair 1,

[0021] Upstream MOX-F2: CCGGAATTCTTCCTGTTGTGGACGACCT

[0022] Downstream MOX-R4: GTTGATGTGGTCTCTGCTTGTTTCTCATA

[0023] Primer pair 2,

[0024] Upstream CVA10-P1-F1: TATGAGAAAACAAGCAGAGACCACCATCAAC

[0025] Downstream CVA10-P1-R1: CGTCTGGGTTGCAAGGTGGTCACGAAGGTG

[0026] Primer pair 3,

[0027] Upstream CVA10-3CD-F1: CACCTTCGTGACCACCTTGCAACCCAGACG

[0028] Downstream CVA10-3CD-R1: GCGTCGACCAGAGTAACCGATGTCT.

[0029] Preferably, the enzymes used for double digestion in step ② are EcoRI and SalI.

[0030] Preferably, in step ④, the competent cells are Escherichia coli competent cells, and the corresponding culture medium is LB medium.

[0031] This invention provides a method for detecting the copy number of exogenous genes in a recombinant CVA10 vaccine, the method comprising the following steps:

[0032] A. Design primer pairs and probes for the endogenous gene MOX fragment, the exogenous gene P1 fragment, and the exogenous gene 3CD fragment;

[0033] B. Establish the Taqman-quantitative PCR reaction system as shown below:

[0034]

[0035]

[0036] The reaction conditions were: 95℃ for 5 min; 95℃ for 10 s; 58℃ for 15 s, repeated 45 times; 72℃ for 20 s.

[0037] C. Establish a standard curve:

[0038] The standard plasmids used to detect the copy number of the exogenous gene in the recombinant CVA10 vaccine were used as templates and diluted at equal gradients. The CT values ​​of the amplification curves of each standard plasmid were then measured according to the Taqman-fluorescent quantitative PCR reaction system in step ②. A standard curve was established with the copy number of the standard plasmid as the x-axis and the CT value of the standard plasmid as the y-axis.

[0039] D. Detection of the sample to be tested:

[0040] The sample to be tested was detected using the Taqman-fluorescent quantitative PCR reaction system established in step B. The CT value was recorded and substituted into the standard curve established in step C to calculate the copy number of the endogenous gene MOX, exogenous gene P1, and exogenous gene 3CD. The copy number of exogenous gene P1 and exogenous gene 3CD was then compared with the copy number of endogenous gene MOX to obtain the copy number of exogenous gene P1 and exogenous gene 3CD in the genome of the sample to be tested.

[0041] Preferably, in step A, the primer pairs and probe sequences for the endogenous gene MOX fragment, the exogenous gene P1 fragment, and the exogenous gene 3CD fragment are as follows:

[0042] Primer pair 1, pMOX-F: CTTCCTGTTGTGGACGACCT

[0043] pMOX-R:TGCTTGTTTCTCATAGTTGGG

[0044] Primer pair 2, pCVA10-P1-F: GAGACCACCATCAACCACTT

[0045] pCVA10-P1-R:GGTGGTCACGAAGGTGAA

[0046] Primer pair 3, pCVA10-3CD-F: TTGCAACCCAGACGTGTTCT

[0047] pCVA10-3CD-R:CAGAGTAACCGATGTCTCTC

[0048] Probe 1, pMOX: CGTGCGCAGAGTCGGATCTTCTACC

[0049] Probe 2, pCVA10-P1: CGCCACCTGGGACATCGACATCATG

[0050] Probe 3, pCVA10-3CD: CTGCCAATCCTGCTGCCAGGTTCTC.

[0051] Preferably, in step C, the equal gradient multiples are 10. 7 times, 10 6 times, 10 5 times, 10 4 times, 10 3 times, 10 2 Times and 10 times.

[0052] The method for detecting the copy number of exogenous genes in recombinant CVA10 vaccines described in this invention is applicable to the determination of the copy number of exogenous genes in recombinant CVA10 vaccines constructed based on the Hansenula polymorpha platform and the verification of the genetic stability of exogenous genes in recombinant CVA10 vaccines.

[0053] The standard plasmid described in this invention is suitable for use in determining the copy number of exogenous genes in recombinant CVA10 vaccines using quantitative real-time PCR.

[0054] The present invention has the following beneficial effects:

[0055] This invention constructs a standard plasmid containing an endogenous gene MOX fragment, an exogenous gene P1 fragment, and an exogenous gene 3CD fragment. It can determine the specific number of exogenous gene P1 and exogenous gene 3CD inserted into the Hansenula polymorpha genome, making it easy to plot the corresponding standard curve. It can be used to determine the copy number of exogenous genes in recombinant CVA10 vaccines using quantitative photoPCR.

[0056] The standard plasmid constructed in this invention is used as a standard, and then the copy number of the exogenous gene P1 and exogenous gene 3CD inserted into the genome of Hansenula polymorpha is absolutely quantified by using real-time PCR. This effectively saves the detection time for determining the copy number of exogenous genes in recombinant CVA10 vaccines and has the characteristics of simple operation and good reproducibility.

[0057] This invention constructs a standard plasmid and uses the Taqman probe-quantitative real-time PCR method to analyze the copy number of inserted exogenous genes in a simple, rapid, absolute, and accurate manner, thereby effectively shortening the detection time for measuring the copy number of exogenous genes in recombinant CVA10 vaccines and facilitating repeated operations.

[0058] In addition, this copy number detection method can provide strong data support for the study of strain genetic stability and subsequent process research. It has been well applied in the determination of exogenous gene copy number of recombinant CVA10 vaccine constructed based on Hansenula polymorpha platform and in the stable inheritance of exogenous gene in recombinant CVA10 vaccine. Attached Figure Description

[0059] Figure 1 Design concept diagram for gene fragment CVA10-MOX-P1-3CD;

[0060] Figure 2 The amplification curve of MOX in the standard plasmid is shown.

[0061] Figure 3 The standard curve, equation, and correlation coefficient R of MOX in the standard plasmid are provided. 2 ;

[0062] Figure 4 The amplification curve of CVA10-P1 in the standard plasmid is shown.

[0063] Figure 5 The standard curve, equation, and correlation coefficient R of CVA10-P1 in the standard plasmid are shown. 2 ;

[0064] Figure 6 The amplification curve of CVA10-3CD in the standard plasmid is shown.

[0065] Figure 7 The standard curve, equation, and correlation coefficient R of CVA10-3CD in the standard plasmid are shown. 2 . Detailed Implementation

[0066] The following are specific embodiments of the present invention, used to illustrate the technical solutions to the technical problems to be solved in this application, and to help those skilled in the art understand the present invention. However, the implementation of the technical solutions of the present invention is not limited to these embodiments. It should be noted that the experimental methods in the following embodiments, unless otherwise specified, are generally carried out under conventional conditions, such as those described in "Molecular Cloning: A Laboratory Manual" (New York: Cold Spring Harbor Laboratory Press, 1989).

[0067] 1. Example 1

[0068] 1.1 Selection of endogenous gene MOX fragment, exogenous gene P1 fragment, and exogenous gene 3CD fragment; design of PCR primers; and construction of recombinant plasmids.

[0069] The endogenous gene MOX is a fragment in the genome of *Hansenula polymorpha*, specifically the methanol oxidase gene, Genebank sequence number: X02425, with a full length of 4235 bp. Due to its single-copy nature, the endogenous gene MOX is selected as an internal reference for the exogenous genes P1 and CD in this invention. In this embodiment, 137 bp of the endogenous gene MOX (as shown in SEQ ID No. 1) is specifically selected as the insertion fragment for the standard plasmid, thereby ensuring good specificity of the gene fragment while shortening the length of the standard plasmid.

[0070] Exogenous genes P1 and 3CD are fragments from the CVA10 genome. Exogenous gene P1 is 2613 bp in length, and exogenous gene 3CD is 1938 bp in length. Both have undergone codon optimization while maintaining the amino acid sequence. In this embodiment, 189 bp from exogenous gene P1 (as shown in SEQ ID No. 2) and 146 bp from exogenous gene 3CD (as shown in SEQ ID No. 3) were selected as standard plasmid insertion fragments to facilitate the construction of corresponding standard curves for exogenous genes P1 and 3CD.

[0071] To tandemly link three gene fragments—the endogenous MOX fragment, the exogenous P1 fragment, and the exogenous 3CD fragment—using PCR, the following primer pair was designed:

[0072] Primer pair 1,

[0073] MOX-F2: CCGGAATTCTTCCTGTTGTGGACGACCT

[0074] MOX-R4: GTTGATGTGGTCTCTGCTTGTTTCTCATA

[0075] Primer pair 2,

[0076] CVA10-P1-F1:TATGAGAAACAAGCAGAGACCACCATCAAC

[0077] CVA10-P1-R1:CGTCTGGGTTGCAAGGTGGTCACGAAGGTG

[0078] Primer pair 3,

[0079] CVA10-3CD-F1: CACCTTCGTGACCACCTTGCAACCCAGACG

[0080] CVA10-3CD-R1: GCGTCGACCAGAGTAACCGATGTCT.

[0081] Among them, the primers MOX-R3, CVA10-P1-F1, CVA10-P1-R1, and CVA10-3CD-F1 were selected from 15bp gene fragments at the junction of the endogenous gene MOX and the exogenous gene P1, and 15bp gene fragments at the junction of the exogenous gene P1 and the exogenous gene 3CD, respectively, to obtain the tandem gene fragments CVA10-MOX-P1-3CD. The design concept diagram is shown below. Figure 1 As shown.

[0082] In addition, to perform double enzyme digestion and ligation of the gene fragment CVA10-MOX-P1-3CD with the cloning vector, corresponding restriction enzyme sites were added to MOX-F2 and CVA10-3CD-R1, respectively. In this embodiment, the cloning vector used was pGEX6P1, and the enzymes used for double digestion were EcoRI and SalI, thereby constructing the recombinant plasmid.

[0083] 1.2 Preparation of recombinant plasmids

[0084] 1.2.1 PCR to obtain the tandem CVA10-MOX-P1-3CD product

[0085] ① Using Hansenula polymorpha genome as a template, PCR amplification was performed using MOX-F2 and MOX-R3 primers, respectively, to obtain the endogenous gene MOX (SEQ ID No. 1);

[0086] ② Using the recombinant CVA10 vaccine Hansenula polymorpha genome as a template, PCR amplification was performed using CVA10-P1-F1 and CVA10-P1-R1, and CVA10-3CD-F1 and CVA10-3CD-R1 as primers, respectively, to obtain the exogenous gene P1 fragment (SEQ ID No. 2) and the exogenous gene 3CD fragment (SEQ ID No. 3);

[0087] ③ Establish the PCR reaction system shown in Table 1 below. The PCR amplification in steps ① and ② shall be performed according to the PCR reaction system in Table 1.

[0088] Table 1 PCR Reaction System

[0089]

[0090] ④ The PCR amplified endogenous gene MOX, exogenous gene P1 and exogenous gene 3CD were detected by 1% agarose gel electrophoresis. The sizes of the PCR products corresponding to the endogenous gene MOX, exogenous gene P1 and exogenous gene 3CD were 137bp, 180bp and 160bp, respectively.

[0091] ⑤ The endogenous gene MOX, exogenous gene P1 and exogenous gene 3CD that passed the test in step ④ were purified using a PCR product purification kit (purchased from Beijing Golden Spiral Biotechnology Center);

[0092] ⑥ Take 0.5 μL each of the purified endogenous gene MOX, exogenous gene P1 and exogenous gene 3CD from step ⑤ as templates, and perform PCR reaction according to the PCR reaction system in Table 2 using primers MOX-F2 and CVA10-3CD-R1 to obtain the gene fragment CVA10-MOX-P1-3CD (SEQ ID No. 4).

[0093] Table 2 PCR Reaction System

[0094]

[0095] ⑦ The gene fragment CVA10-MOX-P1-3CD obtained in step ⑥ is purified using a DNA fragment purification kit (purchased from Beijing Golden Spiral Biotechnology Center).

[0096] 1.2.2 Double enzyme digestion reaction

[0097] The purified gene fragment CVA10-MOX-P1-3CD and pGEX6P1 vector from step 1.2.1⑦ were subjected to double digestion (EcoRI and SalI) according to the double digestion reaction system in Table 3. After the digestion products were separated by agarose gel electrophoresis, the digested gene fragments were recovered by gel excision and purified using a DNA fragment purification kit (purchased from Beijing Golden Spiral Biotechnology Center) to obtain the pGEX6P1 vector fragment and the gene fragment CVA10-MOX-P1-3CD.

[0098] Table 3. Double Enzyme Digestion Reaction System

[0099]

[0100] 1.2.3. Ligation reaction between the vector fragment and the target fragment

[0101] The pGEX6P1 vector fragment and the gene fragment CVA10-MOX-P1-3CD obtained in step 1.2.2 were ligated using the Solution I ligation kit (purchased from Takara Bio Engineering (Dalian) Co., Ltd.), and then purified using the DNA fragment purification kit (purchased from Beijing Golden Helix Biotechnology Center) to obtain the recombinant plasmid. The ligation reaction system is shown in Table 4 below.

[0102] Table 4. Connection Reaction System

[0103]

[0104] 1.2.4 Transformation of Recombinant Plasmids

[0105] The recombinant plasmid obtained in step 1.2.3 was transformed into 100 μL of Escherichia coli (DH5a) competent cells. The competent cells were then plated in LB+Amp (100 μg / mL) solid medium and cultured overnight at 37°C to obtain a monoclonal strain containing the recombinant plasmid.

[0106] 1.2.5 Identification of recombinant plasmids

[0107] ① Pick the single clonal strains from the LB+Amp (100μg / mL) solid medium in step 1.2.4 and prepare a bacterial suspension in sterile water as a template. Use primers MOX-F2 and CVA10-3CD-R1 to identify the transformed clones by PCR. The PCR reaction system is shown in Table 5 below.

[0108] Table 5 PCR Reaction System

[0109]

[0110] ② Detect the PCR-amplified DNA fragments by 1% agarose gel electrophoresis. The size of the PCR product should be approximately 490 bp.

[0111] ③ Select 3-5 monoclonal strains that have been correctly identified by PCR in step ②, inoculate them into 10 mL of LB+Amp (100 μg / mL) liquid medium, and incubate overnight at 37℃ with a shaker at 200 rpm / min to obtain monoclonal bacterial culture.

[0112] ④. The monoclonal bacterial culture obtained in step ③ is sent for sequencing (using universal primer T7); the monoclonal bacterial culture with correct sequencing results is added with 10-30% glycerol, aliquoted into 1.0 mL / vial, and stored at -60℃ or below. The monoclonal bacterial culture is named pCVA10-MOX-P1-3CD.

[0113] 1.3 Establishment of the Real-Time PCR Method

[0114] 1.3.1 Design and Synthesis of Primer Pairs and Probes

[0115] Using the endogenous gene MOX fragment, exogenous gene P1 fragment, and exogenous gene 3CD fragment obtained in step 1.1 as references, primer pairs and probes for their corresponding real-time PCR were designed. The probes were located between ordinary primers (general primer T7 in this example), with a FAM marker added to the 5' end. The sequences of the primer pairs and probes for the endogenous gene MOX, exogenous gene P1, and exogenous gene 3CD are as follows:

[0116] Primer pair 1, pMOX-F: CTTCCTGTTGTGGACGACCT

[0117] pMOX-R:TGCTTGTTTCTCATAGTTGGG

[0118] Primer pair 2, pCVA10-P1-F: GAGACCACCATCAACCACTT

[0119] pCVA10-P1-R:GGTGGTCACGAAGGTGAA

[0120] Primer pair 3, pCVA10-3CD-F: TTGCAACCCAGACGTGTTCT

[0121] pCVA10-3CD-R:CAGAGTAACCGATGTCTCTC

[0122] Probe 1, pMOX: CGTGCGCAGAGTCGGATCTTCTACC

[0123] Probe 2, pCVA10-P1: CGCCACCTGGGACATCGACATCATG

[0124] Probe 3, pCVA10-3CD: CTGCCAATCCTGCTGCCAGGTTCTC.

[0125] 1.3.2 Establishment of the Standard Curve

[0126] 1.3.2.1 Determination of recombinant plasmid concentration, quality control, and copy number.

[0127] ① The frozen monoclonal strain from step 1.2.5④ was inoculated into LB+Amp (100μg / mL) liquid medium for activation, and then cultured overnight at 150rpm / min in a 37℃ incubator for amplification;

[0128] ② Collect the monoclonal bacterial culture liquid amplified in step ①, purify the plasmid using a plasmid extraction kit (purchased from OMEGA) to obtain the recombinant plasmid, which is the standard plasmid;

[0129] ③ The concentration and quality control of the standard plasmid prepared in step ② were determined using a Thermofisher micro-nucleic acid concentration analyzer. The concentration of the standard plasmid was found to be 121 ng / μL.

[0130] ④ Calculate the copy number of the standard plasmids using the following formula:

[0131] Number of plasmid copies per μL = (mass / molecular weight) × (6.02 × 10⁻⁶) 23 = [plasmid concentration (ng / μL) × 1μL] × 10 -9 / [(plasmid molecular weight + insert fragment molecular weight)×660]×(6.02×10 23 );

[0132] The copy number results are shown in Table 6 below.

[0133] Table 5. Copy numbers of endogenous gene MOX, exogenous gene P1, and exogenous gene 3CD per μL of standard plasmid

[0134] Gene name Copy number exogenous gene P1 <![CDATA[1.90*10 19 ]]> Exogenous 3CD <![CDATA[1.90*10 19 ]]> Endogenous gene MOX <![CDATA[1.90*10 19 ]]>

[0135] 1.3.2.2 Establishment of the Taqman-Quantitative Real-Time PCR Reaction System

[0136] The reagent kit, Premix Ex Taq, was manufactured by Takara Bio Engineering (Dalian). TM(Probe qPCR) Bulk reaction system configuration: using endogenous gene MOX, exogenous gene P1 and exogenous gene 3CD as DNA templates, the DNA template concentration and probe concentration were optimized. The optimized reaction system is shown in Table 7 below.

[0137] Table 7 Taqman-Quantitative PCR Reaction System

[0138]

[0139] 1.3.2.3 Establishment of the Standard Curve

[0140] Using the standard plasmid obtained in step 1.3.2.1② as a template, with 10 7 times, 10 6 times, 10 5 times, 10 4 times, 10 3 times, 10 2 The sample was serially diluted 1-fold and 10-fold, and amplified and detected on an ABI 7500 real-time PCR instrument according to the optimized Taqman-fluorescent quantitative PCR reaction system in step 1.3.2.2. Each template was repeated three times, and a corresponding standard curve was established based on the CT value of the obtained amplification curve.

[0141] The amplification curves of the endogenous gene MOX in the plasmid standard are shown below. Figure 1 As shown, its corresponding standard curve, slope, intercept, and correlation coefficient R 2 like Figure 2 As shown; the amplification curve of the exogenous gene P1 in the plasmid standard is as follows. Figure 3 As shown, its corresponding standard curve, slope, intercept, and correlation coefficient R 2 like Figure 4 As shown; the amplification curve of the exogenous gene 3CD in the plasmid standard is as follows. Figure 5 As shown, its corresponding standard curve, slope, intercept, and correlation coefficient R 2 like Figure 7 As shown.

[0142] 1.4 Determination of the copy number of exogenous gene in recombinant CVA10 vaccine (Hansenula polymorpha) strain

[0143] 1.4.1 Genome Extraction

[0144] ① Take the original seed batch, master seed batch, working seed batch, and 20th generation strain of the original seed batch of the recombinant CVA10 vaccine (Hansenula polymorpha) developed by our company, inoculate each strain into 10 mL of YPD liquid medium, incubate overnight at 37℃ and 200 rpm / min, centrifuge at 6000 rpm / min, and collect the bacterial cells corresponding to the original seed batch, master seed batch, working seed batch, and 20th generation strain of the original seed batch;

[0145] In this invention, the main seed batch, the working seed batch, and the 20th generation of the original seed batch are all obtained based on the original seed batch using conventional technical means.

[0146] ② Extract the genomes of the original seed batch, master seed batch, working seed batch, and the 20th generation of the original seed batch collected in step ① using the glass bead crushing method to obtain the genomes of the corresponding strains to be tested. Use a Thermofisher micro-nucleic acid concentration analyzer to determine the concentration and quality control of the genomes of the test samples of each strain. The nucleic acid concentration is required to be greater than 20 ng / μL, and the 260 / 280 nm ratio is between 1.7 and 1.9. The concentration and quality control of each strain are shown in Table 8 below.

[0147] Table 8. Concentration and quality control of different bacterial strains

[0148]

[0149]

[0150] ③ Take an appropriate amount of the genome of the sample to be tested, which has passed the test in step ②, and dilute it to the same concentration of 20 ng / μL. Store it below -20℃.

[0151] 1.4.2. Quantitative real-time PCR method for determining the copy number of exogenous genes P1 and 3CD

[0152] ① Using the genomes of the original seed batch, master seed batch, working seed batch, and the 20th generation of the original seed batch obtained in step 1.4.1③ as templates, three replicates were set up for each sample DNA. The copy number was determined and the CT value was recorded using the Taqman-fluorescent quantitative PCR reaction system optimized in step 1.3.2.2.

[0153] ② Substitute the CT value obtained in step ① into the standard curve established in step 1.3.2.3 to calculate the copy number of the endogenous gene MOX, the exogenous gene P1, and the exogenous gene 3CD;

[0154] ③ Substitute the copy number obtained in step ② into the following calculation formula to calculate the copy number of exogenous gene P1 and exogenous gene 3CD in the genome of the sample to be tested. The results of the copy number of exogenous gene P1 and exogenous gene 3CD are shown in Table 9 below. The specific calculation formula is as follows:

[0155] The copy number of exogenous gene P1 = the detected copy number of exogenous gene P1 / the detected copy number of endogenous gene MOX;

[0156] The copy number of exogenous gene 3CD = the detected copy number of exogenous gene 3CD / the detected copy number of endogenous gene MOX.

[0157] Table 9. Copy numbers of exogenous genes P1 and 3CD in different bacterial species

[0158] name P1 3CD Original strain 7.03±0.57 5.32±0.49 Main seed batch 7.77±0.37 4.75±0.29 Working Seed Batch 7.87±0.42 5.80±0.66 The original strain was passed down 20 generations. 6.60±0.54 4.88±0.70 average value 7.32 5.19 CV (%) 8.32 9.15

[0159] Referring to Table 9, in the recombinant CVA10 vaccine (Hansenula polymorpha) strain used in this invention, the copy number of the exogenous gene P1 is approximately 7, and the coefficient of variation (CV) between different test samples is 8.32%; the copy number of the exogenous gene 3CD is approximately 5, and the coefficient of variation (CV) between different test samples is 9.15%. This demonstrates, on the one hand, that the recombinant CVA10 vaccine (Hansenula polymorpha) strain in this invention exhibits good genetic stability; and on the other hand, it demonstrates that Taqman probe-quantitative real-time PCR is suitable for determining the copy number of exogenous genes in recombinant CVA10 vaccine (Hansenula polymorpha) and for the stable inheritance of exogenous genes in recombinant CVA10 vaccine.

[0160] Example 2: The difference from Example 1 is that the cloning vector used in this example is the pUC18 vector, and the competent cells are TOP10 competent cells.

[0161] Example 3: The difference from Example 1 is that the cloning vector used in this example is the pUC18 vector, and the competent cells are JM109 competent cells.

[0162] Example 4: The difference from Example 1 is that the cloning vector used in this example is pET22b vector, and the competent cells are Trans10 competent cells.

[0163] Example 5: The difference from Example 1 is that the cloning vector used in this example is pET28b vector, and the competent cells are DH5α competent cells.

[0164] Example 6: The difference from Example 1 is that the cloning vector used in this example is pET30a vector, and the competent cells are DH5α competent cells.

[0165] Example 7: The difference from Example 1 is that the cloning vector used in this example is pET32a vector, and the competent cells are TOP10 competent cells.

[0166] The standard curves corresponding to each standard plasmid in Examples 2-7 are shown in Table 10 below. The copy number of the exogenous gene of the recombinant CVA10 vaccine (Hansenula polymorpha) in Examples 2-7 was determined using the standard plasmids as in Example 1. The detection results of the exogenous gene P1 and exogenous gene 3CD are shown in Table 11 below.

[0167] Table 10 Standard curves of standard plasmids in Examples 2-7

[0168]

[0169]

[0170] Table 11. Mean copy number and coefficient of variation of exogenous genes in Examples 2-7

[0171]

[0172] Referring to Tables 10 and 11, the standard curves of the standard plasmids in Examples 2-7 are similar to those in Example 1, wherein the R0 of the standard curves in Examples 2-7 is... 2 The value is >0.997, therefore it has a good linear relationship, while the R value in Example 1 is >0.997. 2 The coefficient of variation (CV) is >0.999, therefore the standard plasmid of Example 1 has a better linear relationship. In addition, the copy number of exogenous gene P1 in Examples 2-7 is about 7, and the copy number of exogenous gene 3CD is about 5, which is consistent with the results measured in Example 1. However, the coefficient of variation (CV) of exogenous gene P1 and exogenous gene 3CD in Example 1 is smaller than the results measured in Examples 2-7. Therefore, among Examples 1-7, Example 1 is the preferred example.

[0173] In summary, this invention, by constructing a standard plasmid and employing the Taqman probe-quantitative real-time PCR method, provides a simple, rapid, absolute, and accurate analysis of the copy number of inserted exogenous genes. This effectively shortens the detection time for determining the copy number of exogenous genes in recombinant CVA10 vaccines, facilitates repeated operations, and is well-suited for determining the copy number of exogenous genes in recombinant CVA10 vaccines constructed based on the Hansenula polymorpha platform, as well as for the stable inheritance of exogenous genes in recombinant CVA10 vaccines. sequence list <110> Beijing Minhai Biotechnology Co., Ltd. <120> Standard plasmids for detecting the copy number of exogenous genes in recombinant CVA10 vaccines, their preparation methods, and applications. <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 137 <212> DNA <213> Artificial Sequence <400> 1 cttcctgttg tggacgacct ggaggacttc aagacatcgc atggtgcaga gcactggctg 60 aagtggatta acagggacct gggtagaaga tccgactctg cgcacgccta catccaccca 120 actatgagaa acaagca 137 <210> 2 <211> 189 <212> DNA <213> Artificial Sequence <400> 2 gagaccacca tcaaccactt cttctctaga tccggtctgg tgggtgtggt gaacctgacc 60 gacggtggta ccgacaccac cggttacgcc acctgggaca tcgacatcat gggtttcgtg 120 cagctgagaa gaaagtgcga gatgttcacc tacatgagat tcaacgccga gttcaccttc 180 gtgaccacc 189 <210> 3 <211> 146 <212> DNA <213> Artificial Sequence <400> 3 ttgcaaccca gacgtgttct ggtctaagct gccaatcctg ctgccaggtt ctctgttcgc 60 cttcgactac tctggttacg acgcctctct gtctccagtg tggttcagag ccctggagat 120 ggtgctgaga gacatcggtt actctg 146

Claims

1. A method for preparing a standard plasmid for detecting the copy number of a recombinant CVA10 vaccine exogenous gene, characterized by, The preparation method comprises the following steps: ①, design primer pairs, and prepare an endogenous gene MOX fragment as shown in SEQ ID No. 1 by PCR amplification with a Hansenula genome as a template; prepare an exogenous gene P1 fragment as shown in SEQ ID No. 2 and an exogenous gene 3CD fragment as shown in SEQ ID No. 3 by PCR amplification with a recombinant CVA10 vaccine genome as a template; and then prepare a gene fragment CVA10-MOX-P1-3CD in series by amplification with the endogenous gene MOX fragment, the exogenous gene P1 fragment and the exogenous gene 3CD fragment as templates; ②, perform double enzyme digestion on the pGEX6P1 cloning vector and the gene fragment CVA10-MOX-P1-3CD obtained in step ① to obtain a vector fragment and a target fragment, respectively; ③, link the vector fragment and the target fragment obtained in step ② to obtain a recombinant plasmid; ④, transform the recombinant plasmid obtained in step ③ into a competent cell, and then coat the competent cell on a corresponding culture medium and culture it in a 37°C constant temperature incubator to obtain a single clone strain containing the recombinant plasmid; ⑤, identify the single clone strain obtained in step ④ by means of PCR, double enzyme digestion and sequencing; ⑥, amplify the single clone strain identified in step ⑤, and then purify the recombinant plasmid in the single clone strain by using a plasmid extraction kit to obtain a standard plasmid.

2. The method for preparing standard plasmids according to claim 1, characterized in that, The primers in step ① are as follows: Primer pair 1, upstream MOX-F2: CCGGAATTCTTCCTGTTGTGGACGACCT downstream MOX-R4: GTTGATGGTGGTCTCTGCTTGTTTCTCATA Primer pair 2, upstream CVA10-P1-F1: TATGAGAAACAAGCAGAGACCACCATCAAC downstream CVA10-P1-R1: CGTCTGGGTTGCAAGGTGGTCACGAAGGTG Primer pair 3, upstream CVA10-3CD-F1: CACCTTCGTGACCACCTTGCAACCCAGACG downstream CVA10-3CD-R1: GCGTCGACCAGAGTAACCGATGTCT.

3. The method for preparing standard plasmids according to claim 2, characterized in that, In step ④, the competent cell is an E. coli competent cell, and the corresponding culture medium is an LB culture medium.

4. A standard plasmid for detecting the copy number of exogenous genes of a recombinant CVA10 vaccine, characterized by, The standard plasmid is prepared by the method of any one of claims 1-3.

5. A method of detecting the copy number of exogenous genes of a recombinant CVA10 vaccine, characterized by, The detection method comprises the following steps: A, design primer pairs and probes corresponding to the endogenous gene MOX fragment, the exogenous gene P1 fragment and the exogenous gene 3CD fragment, and the sequences are as follows: Primer pair 1, pMOX-F: CTTCCTGTTGTGGACGACCT pMOX-R: TGCTTGTTTCTCATAGTTGGG Primer pair 2, pCVA10-P1-F: GAGACCACCATCAACCACTT pCVA10-P1-R: GGTGGTCACGAAGGTGAA Primer pair 3, pCVA10-3CD-F: TTGCAACCCAGACGTGTTCT pCVA10-3CD-R: CAGAGTAACCGATGTCTCTC Probe 1, pMOX: CGTGCGCAGAGTCGGATCTTCTACC Probe 2, pCVA10-P1: CGCCACCTGGGACATCGACATCATG Probe 3, pCVA10-3CD: CTGCCAATCCTGCTGCCAGGTTCTC B. The Taqman-fluorescent quantitative PCR reaction system is established as shown below: 2x Premix Ex Taq 10 μL 50x ROX Reference Dye 0.2 μL probe 0.1 μL 10 μM of upstream primer and downstream primer, each 0.2 μL RNase-free water 8.8 μL cDNA 0.5 μL The reaction conditions are: 95℃ 5min; 95℃ 10s, 58℃ 15s, cycle 45 times; 72℃ 20s; C. Standard curve is established: The standard plasmid described in claim 4 is used as a template, diluted by equal gradient multiples, and then the CT value of the amplification curve of each standard plasmid is determined according to the Taqman-fluorescent quantitative PCR reaction system in step B. The copy number of the standard plasmid is used as the abscissa, and the CT value of the standard plasmid is used as the ordinate to establish a standard curve; D. Detection of the sample to be tested: The sample to be tested is detected by the Taqman-fluorescent quantitative PCR reaction system established in step B, and the CT value is recorded. The copy number of the endogenous gene MOX, the exogenous gene P1 and the exogenous gene 3CD is calculated by substituting the standard curve established in step C. Then the copy number of the exogenous gene P1 and the exogenous gene 3CD is compared with the copy number of the endogenous gene MOX to obtain the copy number of the exogenous gene P1 and the exogenous gene 3CD in the genome of the sample to be tested.

6. The method for detecting the copy number of exogenous genes in a recombinant CVA10 vaccine according to claim 5, characterized in that, In Step C, the equal gradient multiples are 10 7 times, 10 6 times, 10 5 times, 10 4 times, 10 3 times, 10 2 times, and 10 times, in order.

7. Use of a method according to claim 5 or 6 for detecting the copy number of a foreign gene of a recombinant CVA10 vaccine, characterized in that, The method is applied in the determination of the copy number of the exogenous gene of the recombinant CVA10 vaccine or the verification of the genetic stability of the recombinant CVA10 vaccine based on the Hansenula platform.

8. The application of the standard plasmid in claim 4 in the method for determining the copy number of the exogenous gene of the recombinant CVA10 vaccine by using fluorescent quantitative PCR.

Images