RPA-LFS Detection Primer-Probe Combinations for Capsular and Non-Capsular Haemophilus influenzae and Their Applications

Through RPA-LFS technology combined with the Omp6 and bexA gene primer probe combination, the problem of difficulty in quickly and accurately detecting capsular and non-capsular Haemophilus influenzae in the prior art is solved, and high specificity and sensitivity detection is achieved, ensuring timely diagnosis and treatment of patients.

CN114574603BActive Publication Date: 2025-06-27LIANYUNGANG SECOND PEOPLES HOSPITAL (LIANYUNGANG CLINICAL TUMOR RES INST)
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202210314226.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-03-28
Publication Date
2025-06-27
Estimated Expiration
2042-03-28

AI Technical Summary

Technical Problem

The prior art is difficult to detect capsular and non-capsular Haemophilus influenzae quickly and accurately, and the traditional culture method is complicated and time-consuming, resulting in delays in diagnosis.

Method used

RPA-LFS technology is used to combine the primer probe combination of Omp6 and bexA genes to design specific primers and probes. By introducing mismatched bases on the probes and primers, false positive signals are reduced, and the capsular and non-capsular Haemophilus influenzae can be quickly identified.

Benefits of technology

It realizes fast, sensitive and portable position-based detection of Haemophilus influenzae, improves the specificity and sensitivity of the detection, reduces the risk of false positives, and ensures timely diagnosis and treatment of patients.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114574603B_ABST
    Figure CN114574603B_ABST
Patent Text Reader

Abstract

The present invention discloses an RPA-LFS detection primer-probe combination for encapsulated and non-encapsulated Haemophilus influenzae and its application; the primer-probe combination of the present invention has good specificity, no cross-amplification for other strains, can detect Haemophilus influenzae at 1 CFU / ul, and the detection sensitivity is not interfered by other pathogenic bacteria. The results of this study are consistent with those of duplex PCR. A total of 203 Haemophilus influenzae and 63 encapsulated Haemophilus influenzae were detected from 209 samples, with detection rates of 97.1% and 63.2% respectively. RPA-LFS has the same practical applicability as duplex PCR. This study successfully established an RPA-LFS detection method for detecting encapsulated and non-encapsulated Haemophilus influenzae based on the Omp6 and BexA genes, providing a solution for the subsequent rapid detection of Haemophilus influenzae and ensuring the timely diagnosis and antibiotic treatment of patients.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an RPA-LFS detection primer-probe combination for capsular and non-capsular Haemophilus influenzae and its application. Background Art

[0002] Haemophilus influenzae is a type of Gram-negative bacteria. Haemophilus influenzae can be divided into capsular and non-capsular types. The capsular Haemophilus influenzae can be divided into 6 types according to the results of serological experiments, namely type a, type b, type c, type d, type e, and type f. It has been found that the serotype distribution varies greatly in different regions. Among them, Haemophilus influenzae type b has the strongest pathogenicity and can cause severe meningitis and sepsis, etc. In some developed countries, conjugate vaccines against Haemophilus influenzae type b have been used for routine immunization, and the incidence of diseases related to Haemophilus influenzae type b has been significantly reduced. However, the incidence is still relatively high in most countries. At present, the traditional bacterial culture method is the gold standard for detecting Haemophilus influenzae. However, Haemophilus influenzae is a fastidious bacterium with high nutritional requirements for culture. In addition to an anaerobic environment, it also requires some special growth factors, and the culture time is relatively long, and the operation process is complicated. Therefore, the isolation rate of Haemophilus influenzae by culture has always been relatively low. This undoubtedly delays the diagnosis and treatment time of patients and accelerates the deterioration of the condition. A method for quickly and accurately detecting Haemophilus influenzae and being able to identify the serotype of Haemophilus influenzae is extremely urgent.

[0003] With the rapid development of molecular diagnostic techniques, the PCR technique has been widely used in various microbial detections. TIAN Guo Zhong established a PCR method for detecting Haemophilus influenzae based on the 16S RNA gene. The sensitivity of this method for detecting Haemophilus influenzae was 97.53%, but this method could not distinguish between capsular and non-capsular Haemophilus influenzae. R.J. VANKETEL et al. established a PCR method for detecting capsular and non-capsular Haemophilus influenzae based on the Omp6 and bexA genes. According to the fact that the bexA gene related to the capsule exists only in capsular Haemophilus influenzae and the Omp6 gene exists in all Haemophilus influenzae, a PCR method that can distinguish different types of Haemophilus influenzae was successfully established. However, this method relies on expensive instrument equipment and professional operating technicians. Qilong Cao et al. established a MCDA-LFB (the multiple cross displacement amplification and nanoparticle-based lateral flow biosensor) method for detecting Haemophilus influenzae based on the Omp6 gene. This method can react at 58–65 °C for 1 h and quickly detect Haemophilus influenzae by combining with the colloidal gold test strip method. Although this method does not rely on expensive instrument equipment, there are risks such as complex primer design, long reaction time, and false positives.

[0004] Recombinase Polymerase Amplication (RPA) technology is a recently emerging isothermal amplification technology. Compared with other technologies, this technology has better specificity, sensitivity, and operational portability. RPA uses recombinase to open the double strand and make the primer bind to the target fragment, and uses the polymerase Bsu with strand displacement activity to recognize the 3' end of the primer for stable amplification. A large amount of amplification products can be obtained by reacting at 30 - 45 °C for 20 min. Therefore, this technology does not rely on sophisticated instrument equipment and professional operators. RPA amplification products can be detected by gel electrophoresis, fluorescence detection method, and colloidal gold test strip method. Different from gel electrophoresis, fluorescence detection method, etc., the colloidal gold test strip technology uses the antigen-antibody binding principle to detect the amplification products. By adding a probe labeled with FITC at the 5' end in the RPA reaction system and labeling the 5' end of the reverse primer with Biotin, amplification products with labels at both ends can be obtained. And the amplification products are detected using a specifically labeled test strip, and the purpose of detecting the amplification products is achieved according to whether the test line shows color. The combination of RPA technology and colloidal gold test strip further increases the on-site detection characteristics of this technology. Currently, RPA-LFS has been applied to various pathogen detections, such as Staphylococcus aureus, Bacillus cereus, Listeria monocytogenes, etc. Summary of the Invention

[0005] The present invention uses the RPA-LFS technology to establish a method for rapidly identifying encapsulated and non-encapsulated Haemophilus influenzae based on the Omp6 gene and the bexA gene, which meets the requirements of rapid, sensitive, and portable on-site detection.

[0006] To distinguish between encapsulated and non-encapsulated Haemophilus influenzae, two pairs of primers were designed in the conserved regions of the Omp6 gene and the bexA gene (Table 1), and each pair of primers was used to detect non-encapsulated Haemophilus influenzae and encapsulated Haemophilus influenzae. Among them, the amplification efficiency of the amplification products of omp6-F1 / R1 and bexA-F2 / R2 was higher. Therefore, subsequent experiments were carried out on omp6-F1 / R1 and bexA-F2 / R2.

[0007] Table 1: Primer design table

[0008]

[0009] To improve specificity and sensitivity, corresponding probes were designed in the target regions of the primer pairs omp6-F1 / R1 and bexA-F2 / R2. Although the introduction of the probe can reduce the generation of primer dimers, false positive signals still cannot be avoided. The false positive signals are mainly due to the formation of dimers with stable amplification ability between the probe and the reverse primer. We used Primer Premier 5 software to analyze the dimers formed between the designed probes and the reverse primers. Each probe and the corresponding reverse primer have certain complementary fragments, some covering the THF site or exposing the 3'-OH end of the reverse primer. These dimers can be stably amplified by polymerase Bsu. Therefore, the false positive signals will be continuously amplified. Research shows that RPA can tolerate certain base mismatches without affecting the amplification efficiency, and this theory has been successfully applied to the establishment of the RPA-LFS method in many studies. Therefore, to avoid false positives, we introduced mismatched bases on the probe and the forward and reverse primers to reduce the generation of dimers between the probe and the reverse primer. The principles for introducing mismatched bases are as follows: 1. The continuous complementary bases between the probe and the reverse primer do not exceed 3; 2. The complementary region between the probe and the primer does not cover the THF site; 3. The 3' end of the reverse primer is complementary to the probe by no more than 3 bases; 4. Preferentially use the interchange of A-G and T-C. By introducing mismatches, we successfully screened out suitable probes and reverse primers.

[0010] To verify that bexA-F3 / R1B / P can only amplify encapsulated Haemophilus influenzae, while omp6-F3 / R1B / P can amplify all non-Haemophilus influenzae. The two primers corresponding to these two genes were used to amplify 10 strains of non-encapsulated Haemophilus influenzae and 10 strains of encapsulated Haemophilus influenzae collected (both have been verified by traditional culture methods). The results are as Figure 2As shown in A and B, omp6-F3 / R1B / P can detect all unencapsulated Haemophilus influenzae, while bexA-F3 / R1B / P can only detect encapsulated Haemophilus influenzae, demonstrating that the bexA-F3 / R1B / P and omp6-F3 / R1B / P primers can correctly identify encapsulated and unencapsulated Haemophilus influenzae. And it was verified that omp6-F3 / R1B / P can only amplify Haemophilus influenzae and has no specificity for other pathogens. We selected 23 pathogens for interspecies specificity verification. The results showed that only Haemophilus influenzae showed red bands in both the test line and the control line, while the other 23 pathogens only showed red bands in the control line.

[0011] The beneficial effects achieved by the present invention are:

[0012] The method of the present invention has higher sensitivity and specificity, and the primer design is simple, without relying on expensive instruments and equipment, etc. In this study, without affecting the amplification efficiency of the primers, by introducing mismatches on the probes and primers, the problem of false positives caused by primer dimers was solved. In order to accurately judge the typing of Haemophilus influenzae for subsequent antibiotic treatment, specific forward and reverse primers and probes were designed on the Omp6 and BexA genes respectively, which can screen out encapsulated and non-encapsulated Haemophilus influenzae respectively. At the same time, the specificity of the primers on the Omp6 gene was verified, and the results showed that the primers had good specificity and no cross-amplification with other strains. In order to verify the sensitivity of the two pairs of primers, standard encapsulated and non-encapsulated Haemophilus influenzae were detected respectively, and at the same time, an equal amount of 10 5 cfu of Streptococcus pneumoniae was added to inactivated Haemophilus influenzae solutions with different concentrations. The results showed that the method can detect Haemophilus influenzae at 1 CFU / ul, and the detection sensitivity is not interfered by other pathogenic bacteria. The clinical sample detection results showed that this study was consistent with the results of duplex PCR. A total of 203 Haemophilus influenzae and 63 encapsulated Haemophilus influenzae were detected from 209 samples, and the detection rates were 97.1% and 63.2% respectively. RPA-LFS has the same practical applicability as duplex PCR. This study successfully established an RPA-LFS detection method for detecting encapsulated and non-encapsulated Haemophilus influenzae based on the Omp6 and BexA genes, providing a solution for the subsequent rapid detection of Haemophilus influenzae and ensuring the timely diagnosis and antibiotic treatment of patients. Brief Description of the Drawings

[0013] The drawings are used to provide a further understanding of the present invention and constitute a part of the specification. They are used together with the embodiments of the present invention to explain the present invention and do not constitute a limitation to the present invention. In the drawings:

[0014] Figure 1 Shows the screening of primers and probes;

[0015] Figure 2 Demonstrated the differential verification of omp6-F3 / R1B / P and bexA-F3 / R1B / P against encapsulated and non-encapsulated influenza viruses;

[0016] Figure 3 Demonstrated the specific detection of OMP6-F3 / R1B / P using RPA-LFS;

[0017] Figure 4 Demonstrated the detection limit of the RPA-LFS system. Detailed implementation manner

[0018] The preferred embodiments of the present invention will be described below with reference to the accompanying drawings. It should be understood that the preferred embodiments described herein are only for the purpose of illustrating and explaining the present invention, and are not intended to limit the present invention.

[0019] Embodiment

[0020] Bacterial strains and genomic template preparation

[0021] Non-encapsulated Haemophilus influenzae (ATCC No. 49247) and encapsulated Haemophilus influenzae (ATCC 9334) were purchased from Shanghai Kewei Chemical Technology Co., Ltd. 10 strains of Haemophilus influenzae (Non-Podoconiosis) and 10 strains of Haemophilus influenzae (Podoconiosis) were isolated from sputum. 23 other common pathogenic bacteria were provided by our laboratory for verifying the specificity of the RPA-LFS method based on the Omp6 gene, including Acinetobacter calcoaceticus, Acinetobacter lwoffii, Acinetobacter haemolyticus, Acinetobacter junii, Acinetobacter johnsonii, Candida albicans, Enterobacter cloacae, Enterococcus faecalis, Escherichia coli O157, Mycobacterium tuberculosis H37Ra strain, Pseudomonas aeruginosa, Staphylococcus aureus, Staphylococcus epidermidis, Staphylococcus haemolyticus, Staphylococcus hominis, Staphylococcus saprophyticus, Staphylococcus warneri, Stenotrophomonas maltophilia, Streptococcus pneumoniae, Streptococcus viridans, Klebsiella pneumoniae, Acinetobacter baumannii. A total of 209 sputum samples from suspected Haemophilus influenzae-infected patients were collected from various hospitals in Lianyungang City such as the First People's Hospital of Lianyungang City, the Second People's Hospital of Lianyungang City, the Third People's Hospital of Lianyungang City, the First People's Hospital of Huai'an City, and the Suqian People's Hospital, and hospitals in surrounding cities. All bacterial strains or samples were incubated at 100 °C for 10 minutes before being used as templates. If not specified, 1 μL of heat-treated culture at 10 5 CFU / mL was used as the template.

[0022] RPA primers

[0023] Two pairs of RPA primers were designed based on the conserved sequences of the Omp6 and BexA genes using Primer Premier 5.0 software (Premier Biosoft International, CA, USA). For the primers, after inputting the sequences of the specific target regions, the parameter settings were as follows: the product size was set to 100 bp - 300 bp. The primer size was set to 30 bp - 35 bp. If there was complementary pairing of more than three consecutive bases at the 3′ end of the obtained primer pair, the primer pair would be discarded. Then, the species specificity of the primer and probe sequences was confirmed using Primer-BLAST on the NCBI website (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast).

[0024] RPA reaction

[0025] According to the manufacturer's instructions, the RPA reaction was carried out using Liquid DNA Amplification Kit (TwistDx Inc., Maidenhead, UK). The 50 μL reaction system contained 25 μL of 2× reaction buffer, 5 μL of 10× Basic e-mix, 2.5 μL of 20× core mix, 2.4 μL of 10 μM forward primer, 2.4 μL of 10 μM reverse primer, and 9.2 μL of distilled water. 2.5 μL of 280 mM magnesium acetate and 1 μL of the template were added to the lid of the reaction tube. After brief centrifugation, the reaction mixture was incubated at 37 °C for 30 minutes. The RPA amplification products were purified using a PCR clean-up kit (Shanghai Meiji Biotechnology Co., Ltd., Shanghai, China) and electrophoresed on a 2% agarose gel.

[0026] RPA-LFS probe design

[0027] Specific probes were designed using Primer Premier 5 software between the forward and reverse primer target sequences of the Omp6 and bexA genes, theoretically avoiding the formation of dimers, hairpin structures, etc. between the probe and the reverse primer as much as possible. The design principles were as follows: (1) the probe size was 46 - 51 bp, the GC content was 20 - 80%, and the Tm was 57 - 80 °C; (2) the maximum hairpin score was 9, and the maximum primer-dimer score was set to 9. The maximum poly-X was set to 5, and other parameters were set to the default values; (3) the 5′ end of the probe was labeled with FITC, the 3′ end was blocked with SpC3, the bases in the middle of the probe were replaced with tetrahydrofuran (THF), there were at least 30 bp of bases before the THF site, and at least 15 bp of bases after that; (4) the 5′ end of the reverse primer was labeled with biotin.

[0028] RPA-LFS reaction

[0029] Use The RPA-LFS reaction was established using the DNA Amplification nfo Kit (TwistDx). The reaction mixture consisted of 29.5 μL of rehydration buffer, 2.1 μL of 10 μM forward primer, 2.1 μL of 10 μM reverse primer, 0.6 μL of 10 μM probe, and 12.2 μL of distilled water. To initiate the reaction, 1 μL of template and 2.5 μL of 280 mM magnesium acetate were added to the mixture. After brief centrifugation, the reaction mixture was incubated at 30 - 45 °C for 30 minutes.

[0030] Since the sensitivity of the colloidal gold test strip is very high, only a small amount of amplification product is required. If the product concentration is too high, it needs to be appropriately diluted. A total of 2 μL of amplification product was used for LFS detection (Ustar Biotechnologies Ltd., Hangzhou, China). The amplification product was added to the sample pad of the LFS. The rod of the LFS was inserted into 100 μL of sample buffer (Ustar Biotech) for 2 minutes, and then the test results were visually inspected.

[0031] Detection limit of RPA-LFS technology

[0032] ddH2O was serially diluted 10-fold to inactivate the standard encapsulated Haemophilus influenzae ATCC9334 (type b) and non-encapsulated Haemophilus influenzae (10 6 ~10 0 CFU) and used as templates for RPA-LFS detection. To determine whether the contamination of other strains would interfere with the detection sensitivity, 10 5 CFU / μL heat-inactivated Streptococcus pneumoniae culture was added to the gradient dilutions of inactivated encapsulated Haemophilus influenzae ATCC9334 (type b) and non-encapsulated Haemophilus influenzae cultures (10 6 –10 0 CFU / μL), and the sensitivity of RPA-LFS was detected separately.

[0033] Duplex PCR

[0034] In this experiment, the dual-PCR method based on the Omp6 gene and bexA gene established by Zhao Ying et al. was used as the control group, and the primers are shown in Table 1. The total volume of the PCR reaction was 50 μl, containing 2.5 mol / L dNTP, 250 nmol / L each of the upstream and downstream primers for the omp6 gene and bexA gene, 2.5 U Ex-Taq DNA polymerase (TaKaRa), 2 μl of template, and 1×PCR buffer (pH = 8.3). PCR parameters: 94°C for 4 min; 35 cycles of 94°C for 30 s, 54°C for 30 s, 72°C for 45 s, and 72°C for 5 min. The amplified products were detected by electrophoresis on a 2% agarose gel pre-stained with 1 μg / ml ethidium bromide.

[0035] Evaluation of the application of RPA-LFS technology in the examination of clinical specimens.

[0036] To verify the practical application ability of RPA-LFS, the practical application effect of RPA-LFS was compared with the dual-PCR method established by Zhao Ying et al. A total of 209 clinical specimens were detected using RPA-LFS and dual-PCR, respectively, and the results were compared with those of the traditional culture method.

[0037] Design and screening of primers for the detection of Haemophilus influenzae

[0038] To distinguish between encapsulated and non-encapsulated Haemophilus influenzae, two pairs of primers were designed in the conserved regions of the Omp6 gene and bexA gene (Table 1), and each pair of primers was used to detect non-encapsulated and encapsulated Haemophilus influenzae. The detection results are as Figure 1 shown in A below. Each pair of primers could amplify the corresponding target strain. From the results of the gel diagram, except for the target bands, there were no any non-specific bands and primer dimers. However, from the results of the gel diagram, the amplified bands of omp6-F1 / R1 and BexA-F2 / R2 were brighter than the other one, indicating that their amplification efficiency was higher. Therefore, subsequent experiments were carried out on omp6-F1 / R1 and BexA-F2 / R2.

[0039] Table 1 Primers and probes

[0040]

[0041] F: forward primer; R: reverse primer; P: probe

[0042] A large number of research results have shown that introducing probes into the RPA system can not only improve the specificity and sensitivity of the reaction, but also reduce the generation of primer dimers. To improve specificity and sensitivity, corresponding probes were designed in the target regions of primer pairs omp6-F1 / R1 and bexA-F2 / R2. Although the introduction of probes can reduce the generation of primer dimers, false positive signals are still inevitable. False positive signals are mainly due to the formation of dimers with stable amplification ability between the probes and the reverse primers. We used Primer Premier 5 software to analyze the dimers formed between the designed probes and the reverse primers, and the results are as Figure 1 shown in Figure B. Each probe and the corresponding reverse primer have certain complementary fragments, some covering the THF site or exposing the 3'-OH end of the reverse primer. These dimers can be stably amplified by polymerase Bsu, so the false positive signals will be continuously amplified. Research has shown that RPA can tolerate certain base mismatches without affecting the amplification efficiency, and this theory has been successfully applied to the establishment of the RPA-LFS method in many studies. Therefore, to avoid false positives, we introduced mismatched bases on the probes and forward and reverse primers to reduce the generation of dimers between the probes and the reverse primers. The principles for introducing mismatched bases are as follows: 1. The continuous complementary bases between the probe and the reverse primer do not exceed 3; 2. The complementary regions of the probe and the primer do not cover the THF site; 3. The 3' end of the reverse primer is complementary to the probe by no more than 3 bases; 4. Preferentially use the interchange of A-G and T-C. By introducing mismatches, we successfully screened out suitable probes and reverse primers (Table 1). The experimental results showed ( Figure 1 at C in the figure) that there was an obvious red band in the test line of the experimental group, and there was no false positive signal in the test line of the NTC group.

[0043] Figure 1 For the screening of primers and probes. Figure 1 At A in the figure is the screening of primers using the RPA reaction. The agarose gel image shows the amplification results of primer pairs for two virulence genes, Omp6 and bexA. The names of the primer pairs are shown at the top of each lane. The NTC lane is the template-free control of the respective RPA reaction adjacent to the leftmost lane. The band sizes of the DNA ladder are shown on the right. These pictures represent the results of three independent experiments. At B is the dimer formed between the probe-reverse primer and the probe-probe designed based on the Omp6 gene. At C is the dimer formed between the probe-reverse primer and the probe designed based on the bexA gene. At D is the testing of the modified primer-probe group on the RPA-LFS. The picture shows the LFS results of RPA amplification. The name of each primer-probe group is marked above the corresponding band. At 10 61 μL of boiled non-encapsulated and encapsulated Haemophilus influenzae cultures at CFU / mL was used as a template. The NTC strips were no-template controls for the respective RPA reactions on the immediately adjacent left strips. The positions of the test line and the control line are marked on the right side of the strip chart. The reaction was carried out at 37 °C for 30 minutes. The image represents the results of three independent experiments.

[0044] Specificity verification of RPA-LFS

[0045] To verify that bexA-F3 / R1B / P can only amplify encapsulated Haemophilus influenzae, while omp6-F3 / R1B / P can amplify all non-Haemophilus influenzae. Two primers corresponding to these two genes were used to amplify 10 strains of non-encapsulated Haemophilus influenzae and 10 strains of encapsulated Haemophilus influenzae (both verified by traditional culture methods) collected respectively. The results are as Figure 2 shown at A and B in the figure. omp6-F3 / R1B / P can detect all non-encapsulated Haemophilus influenzae, while bexA-F3 / R1B / P can only detect encapsulated Haemophilus influenzae, proving that the use of omp6-F3 / R1B / P and omp6-F3 / R1B / P primers can correctly identify encapsulated and non-encapsulated Haemophilus influenzae. In addition, to prove that omp6-F3 / R1B / P can only amplify Haemophilus influenzae and has no specificity for other pathogens, we selected 23 pathogens for interspecies specificity verification (Table 2). The results are shown as Figure 3 shown. Only Haemophilus influenzae showed red bands at both the test line and the control line, while the other 23 pathogens only showed red bands at the control line.

[0046] Table 2. Bacterial strains used in the study

[0047]

[0048]

[0049] Figure 2 For the differential verification of encapsulated and non-encapsulated influenza viruses by omp6-F3 / R1B / P and bexA-F3 / R1B / P. -1 refers to the test result of Omp6-F1 / R1, and -2 refers to the test result of bexA-F2 / R2. Figure 2 At A in the figure, #1-#10 refer to 10 non-encapsulated influenza viruses isolated from sputum. Figure 2 At B in the figure, #1-#10 refer to 10 encapsulated influenza viruses isolated from sputum. The NTC strip was used as a control reaction without a template. The positions of the test line and the control line are marked on the right side of the strip image.

[0050] Figure 3For the specific detection of OMP6-F3 / R1B / P using RPA-LFS, a total of 1 μL of boiled bacterial culture at 106 CFU / mL was used as a template. Other pathogenic bacteria were tested. The reference strain H. influenzae ATCC49247 was used as a positive control. The species names of the bacteria are indicated at the top of each band. The NTC strip is a template-free control. The positions of the test line and the control line are marked on the right side of the bar chart. The reaction was carried out at 37 °C for 30 minutes. The pictures represent the results of three independent experiments.

[0051] Verification of the detection limit of RPA-LFS

[0052] To verify the detection limit of RPA-LFS, inactivated capsular and non-capsular Haemophilus influenzae culture broths were serially diluted 10-fold, ranging from 10 6 to 10 0 CFU / μL (50 μL / reaction volume, 1 μL of the diluted culture was added to each reaction).

[0053] Figure 4 This is the detection limit of the RPA-LFS system. A and B are the LFS results of RPA amplification using different amounts of non-capsular Haemophilus influenzae cultures. The amounts added to the RPA reaction are indicated at the top of each bar (in CFU). At B, in addition to the non-capsular Haemophilus influenzae culture, 10 5 CFU / μL of Streptococcus pneumoniae culture was also added to the reaction. C and D are the LFS results of RPA amplification using different amounts of capsular Haemophilus influenzae cultures. The amounts added to the RPA reaction are indicated at the top of each band. At D, in addition to the encapsulated Haemophilus influenzae culture, 10 5 CFU / μL of Streptococcus pneumoniae culture was also added to the reaction. NTC, template-free control. The reaction was carried out at 37 °C for 30 minutes. The positions of the control line and the test line are marked on the right side of the picture.

[0054] As Figure 4 shown in A and C. The lowest lines of omp6-F3 / R1B / P and bexA-F3 / R1B / P are both 10 0 CFU / reaction. This result indicates that the established RPA-LFS reaction system has the same sensitivity as PCR. By adding Streptococcus pneumoniae to Haemophilus influenzae at different concentrations, it was found that the sensitivity of RPA-LFS for detecting Haemophilus influenzae was not affected by other pathogens, and its lowest detection line was still 10 0 CFU / reaction ( Figure 4 shown in B and D).

[0055] Evaluation of the Application of RPA-LFS Technology in the Examination of Clinical Specimens

[0056] To verify the actual application effect of RPA-LFS, 209 clinical samples were collected for detection. The results are shown in Table 3. 203 samples belonged to Haemophilus influenzae, and the detection rate was 97.1%. This was consistent with the detection results of dual PCR and traditional culture methods. To screen out Haemophilus influenzae type b from the detected Haemophilus influenzae, all Haemophilus influenzae were subjected to RPA-LFS using the primers bexA-F3 / R1B / P, and at the same time, the results were compared with those of the established duplex PCR test. The results showed that both RPA-LFS and Dual-PCR detected 128 strains of Haemophilus influenzae type b, and the detection rate was 63.2%. The experimental results indicate that RPA-LFS has the same accuracy as dual PCR, and these results are consistent with those of the traditional culture method.

[0057] Table 3 209 strains using RPA-LFS and dual PCR

[0058]

[0059] N: number.

[0060] Finally, it should be noted that the above are only the preferred embodiments of the present invention and are not used to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention. Sequence Listing <110> The Second People's Hospital of Lianyungang City (Lianyungang Institute of Clinical Oncology) <120> RPA-LFS Detection Primer Probe Combinations for Encapsulated and Non-encapsulated Haemophilus influenzae and Their Applications <141> 2022-03-28 <160> 18 <170> SIPOSequenceListing 1.0 <210> 1 <211> 31 <212> DNA <213> Artificial Sequence <400> 1 acactgatga acgtggtaca ccagaataca a 31 <210> 2 <211> 31 <212> DNA <213> Artificial Sequence <400> 2 accagctaaa taacctttaa ctgcatctgc a 31 <210> 3 <211> 31 <212> DNA <213> Artificial Sequence <400> 3 caaacttttg gcggttactc tgttgctgat c 31 <210> 4 <211> 31 <212> DNA <213> Artificial Sequence <400> 4 tgcgtctaag atttgaacgt attcaccagt a 31 <210> 5 <211> 32 <212> DNA <213> Artificial Sequence <400> 5 cggttgagtt tgattgttat ttaattgatg ag 32 <210> 6 <211> 31 <212> DNA <213> Artificial Sequence <400> 6 tgtgaaacta aaatgataga acggtctttg c 31 <210> 7 <211> 31 <212> DNA <213> Artificial Sequence <400> 7 tctatcattt tagtttcaca tagcccgagt g 31 <210> 8 <211> 31 <212> DNA <213> Artificial Sequence <400> 8 tgtagtattg atacgctttg tccatgtctt c 31 <210> 9 <211> 46 <212> DNA <213> Artificial Sequence <400> 9 acactgatga acgtgataca ccataataca aatcgtatta ggccaa 46 <210> 10 <211> 31 <212> DNA <213> Artificial Sequence <400> 10 accagctgag taacctttaa ctagatctgc a 31 <210> 11 <211> 35 <212> DNA <213> Artificial Sequence <400> 11 caggaaatgg tgctgctcaa acttttggcg gttac 35 <210> 12 <211> 46 <212> DNA <213> Artificial Sequence <400> 12 cggttgagta tgattgttat gtaattgatg agtgattgta gtaggg 46 <210> 13 <211> 31 <212> DNA <213> Artificial Sequence <400> 13 tgtgaaacga aaatgataga acggtctttg c 31 <210> 14 <211> 35 <212> DNA <213> Artificial Sequence <400> 14 caggaaatgg tgctgctcaa acttttggcg gttac 35 <210> 15 <211> 21 <212> DNA <213> Artificial Sequence <400> 15 atgaacaaat ttgttaaatc a 21 <210> 16 <211> 22 <212> DNA <213> Artificial Sequence <400> 16 tgcgatgttg tattcaggtg ta 22 <210> 17 <211> 21 <212> DNA <213> Artificial Sequence <400> 17 cgtttgtatg atgttgatcc a 21 <210> 18 <211> 19 <212> DNA <213> Artificial Sequence <400> 18 tgtccatgtc ttcaaaatg 19

Claims

1. The primer-probe combination for RPA-LFS detection of capsular and non-capsular Haemophilus influenzae, characterized in that, It includes the omp6-F3 / R1B / P primer-probe combination and the bexA-F3 / R1B / P primer-probe combination; In the omp6-F3 / R1B / P primer-probe combination The sequence of omp6-F3 is: CAGGAAATGGTGCTGCTCAAACTTTTGGCGGTTAC; The sequence of omp6-R1B is Biotin-ACCAGCTGAGTAACCTTTAACTAGATCTGCA; The sequence of omp6-P is: FITC-ACACTGATGAACGTGATACACCATAATACAA[THF]ATCGTATTAGGCCAA-C3 spacer; In the bexA-F3 / R1B / P primer-probe combination In the primer-probe combination The sequence of bexA-F3 is: CAGGAAATGGTGCTGCTCAAACTTTTGGCGGTTAC; The sequence of bexA-R1B is: Biotin-TGTGAAACGAAAATGATAGAACGGTCTTTGC The sequence of bexA-P is: FITC-CGGTTGAGTATGATTGTTATGTAATTGATGAG[THF]TGATTGTAGTAGGG-C3 spacer.

2. Use of the primer-probe combination according to claim 1 in the preparation of a detection kit for capsular and non-capsular Haemophilus influenzae.

3. The application according to claim 2, characterized in that, Non-capsular Haemophilus influenzae is detected using omp6-F3 / R1B / P, and capsular Haemophilus influenzae is detected using bexA-F3 / R1B / P.

Citation Information

Patent Citations

  • Specific forward and reverse primers and probe for vomiting-causing bacillus cereus, detection kit and application of detection kit

    CN111996266A