Antigen recognition receptor targeting CD371 and its use

Abstract

The subject of the present disclosure provides antigen recognition receptors specifically targeting CD371 and cells comprising such antigen recognition receptors targeting CD371. The subject of the present disclosure also provides the use of antigen recognition receptors targeting CD371 for treatment. The subject of the present disclosure provides methods and compositions for immunotherapy. It relates to antigen recognition receptors (e.g., chimeric antigen receptors (CAR) or T cell receptors (TCR)) specifically targeting CD371, cells comprising such receptors, and methods for treating using such cells.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Application No. 62 / 900,141, filed September 13, 2019, and U.S. Provisional Application No. 62 / 936,951, filed November 18, 2019, the contents of each of which are incorporated herein by reference in their entirety, and claim priority to each of which.

[0003] Sequence Listing

[0004] This application contains a sequence listing, which has been submitted in ASCII format via EFS-Web and is incorporated herein by reference in its entirety. The ASCII copy was created on September 11, 2020, is named 0727341147_ST25, and is 211,921 bytes in size. Technical Field

[0005] The subject matter of the present disclosure provides methods and compositions for immunotherapy.It relates to antigen recognition receptors (e.g., chimeric antigen receptors (CAR) or T cell receptors (TCR)) that specifically target CD371, cells comprising such receptors, and methods for treating using such cells. Background Art

[0006] Cell-based immunotherapy is a therapy with therapeutic potential for cancer treatment. T cells and other immune cells are modified to target tumor antigens by introducing genetic material encoding artificial or synthetic receptors for antigens, which are called chimeric antigen receptors (CARs), which are specific for the selected antigens. Targeted T cell therapy using CARs has recently been shown to achieve clinical success in the treatment of hematological malignancies.

[0007] Acute myeloid leukemia (AML) is the most common type of acute leukemia in adults. It is characterized by the accumulation of immature myeloid cells in the bone marrow, leading to hematopoietic dysfunction. Chemotherapy and hematopoietic stem cell transplantation (HSCT) are standard treatments for AML. However, most patients eventually relapse and die from the disease.

[0008] AML is the most common acute leukemia in adults. Standard induction chemotherapy regimens have not changed substantially over the past 40 years, and overall survival remains poor. Frequently occurring abnormalities in genes encoding epigenetic modifiers have been identified. The development of CAR therapies for AML has been hampered by the lack of suitable targets. Therefore, new therapeutic strategies are needed to design CARs that target antigens that are highly expressed in AML cells and have limited expression in normal tissues for the treatment of AML, and strategies that can induce potent cancer eradication with minimal toxicity and immunogenicity are needed. Summary of the Invention

[0009] The presently disclosed subject matter provides an antigen recognition receptor that specifically targets CD371 and a cell comprising such an antigen recognition receptor that targets CD371. The presently disclosed subject matter also provides the use of an antigen recognition receptor that targets CD371 for treatment.

[0010] The subject matter of the present disclosure provides an antigen recognition receptor comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain, wherein the extracellular antigen binding domain specifically binds to CD371. In certain embodiments, the extracellular antigen binding domain is a single-chain variable fragment (scFv). In certain embodiments, the extracellular antigen binding domain is a human scFv. In certain embodiments, the extracellular antigen binding domain is a Fab, which is optionally cross-linked. In certain embodiments, the extracellular antigen binding domain is a F(ab)2. In certain embodiments, one or more of scFv, Fab and F(ab)2 are contained in a fusion protein with a heterologous sequence to form an extracellular antigen binding domain.

[0011] In certain embodiments, the extracellular antigen binding domain comprises:

[0012] (a) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 28 or a conservative modification thereof; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 29 or a conservative modification thereof; and a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 30 or a conservative modification thereof;

[0013] (b) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 34 or a conservative modification thereof; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 35 or a conservative modification thereof; and a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 36 or a conservative modification thereof;

[0014] (c) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 40 or a conservative modification thereof; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 42 or a conservative modification thereof; and a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 43 or a conservative modification thereof;

[0015] (d) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 462 or a conservative modification thereof; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 47 or a conservative modification thereof; and a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 48 or a conservative modification thereof;

[0016] (e) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 52 or a conservative modification thereof; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 53 or a conservative modification thereof; and a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 54 or a conservative modification thereof; or

[0017] (f) a heavy chain variable region CDR1 comprising the amino acid sequence shown in SEQ ID NO: 58 or a conservative modification thereof; a heavy chain variable region CDR2 comprising the amino acid sequence shown in SEQ ID NO: 59 or a conservative modification thereof; and a heavy chain variable region CDR3 comprising the amino acid sequence shown in SEQ ID NO: 60 or a conservative modification thereof.

[0018] In certain embodiments, the extracellular antigen-binding domain comprises: a heavy chain variable region CDR1 comprising the amino acid sequence shown in SEQ ID NO: 28; a heavy chain variable region CDR2 comprising the amino acid sequence shown in SEQ ID NO: 29; and a heavy chain variable region CDR3 comprising the amino acid sequence shown in SEQ ID NO: 30.

[0019] In certain embodiments, the extracellular antigen binding domain comprises:

[0020] (a) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 31 or a conservative modification thereof; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 32 or a conservative modification thereof; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 33 or a conservative modification thereof;

[0021] (b) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 37 or a conservative modification thereof; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 38 or a conservative modification thereof; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 39 or a conservative modification thereof;

[0022] (c) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 43 or a conservative modification thereof; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 44 or a conservative modification thereof; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 45 or a conservative modification thereof;

[0023] (d) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 49 or a conservative modification thereof; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 50 or a conservative modification thereof; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 51 or a conservative modification thereof;

[0024] (e) a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 55 or a conservative modification thereof; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 56 or a conservative modification thereof; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 57 or a conservative modification thereof; or

[0025] (f) a light chain variable region CDR1 comprising the amino acid sequence shown in SEQ ID NO: 61 or a conservative modification thereof; a light chain variable region CDR2 comprising the amino acid sequence shown in SEQ ID NO: 62 or a conservative modification thereof; and a light chain variable region CDR3 comprising the amino acid sequence shown in SEQ ID NO: 63 or a conservative modification thereof.

[0026] In certain embodiments, the extracellular antigen-binding domain comprises: a heavy chain variable region CDR1 comprising the amino acid sequence shown in SEQ ID NO: 28; a heavy chain variable region CDR2 comprising the amino acid sequence shown in SEQ ID NO: 29; and a heavy chain variable region CDR3 comprising the amino acid sequence shown in SEQ ID NO: 30.

[0027] In certain embodiments, the extracellular antigen binding domain comprises:

[0028] (a) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 28; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 29; a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 30; a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 31; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 32; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 33;

[0029] (b) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 34; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 35; a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 36; a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 37; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 38; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 39;

[0030] (c) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 40; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 41; a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 42; a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 43; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 44; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 45;

[0031] (d) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 46; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 47; a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 48; a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 49; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 50; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 51;

[0032] (e) a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 52; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 53; a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 54; a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 55; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 56; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 57; or

[0033] (f) a heavy chain variable region CDR1 comprising the amino acid sequence shown in SEQ ID NO: 58; a heavy chain variable region CDR2 comprising the amino acid sequence shown in SEQ ID NO: 59; a heavy chain variable region CDR3 comprising the amino acid sequence shown in SEQ ID NO: 60; a light chain variable region CDR1 comprising the amino acid sequence shown in SEQ ID NO: 61; a light chain variable region CDR2 comprising the amino acid sequence shown in SEQ ID NO: 62; and a light chain variable region CDR3 comprising the amino acid sequence shown in SEQ ID NO: 63.

[0034] In certain embodiments, the extracellular antigen-binding domain comprises: a heavy chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 28; a heavy chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 29; a heavy chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 30; a light chain variable region CDR1 comprising the amino acid sequence set forth in SEQ ID NO: 31; a light chain variable region CDR2 comprising the amino acid sequence set forth in SEQ ID NO: 32; and a light chain variable region CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 33.

[0035] In certain embodiments, the extracellular antigen binding domain comprises a heavy chain variable region comprising an amino acid sequence that is at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homologous or identical to the amino acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11. In certain embodiments, the extracellular antigen binding domain comprises a heavy chain variable region comprising the amino acid sequence set forth in SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11. In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO:1.

[0036] In certain embodiments, the extracellular antigen binding domain comprises a light chain variable region comprising an amino acid sequence that is at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homologous or identical to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12. In certain embodiments, the extracellular antigen binding domain comprises a light chain variable region comprising an amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12. In certain embodiments, the extracellular antigen-binding domain comprises a light chain variable region comprising the amino acid sequence shown in SEQ ID NO:2.

[0037] In certain embodiments, the extracellular antigen binding domain comprises: (a) a heavy chain variable region comprising an amino acid sequence that is at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homologous or identical to the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11; and (b) a light chain variable region comprising an amino acid sequence that is at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homologous or identical to the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 11. NO: 12 has at least about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homology or identity to the amino acid sequence of NO: 12. In certain embodiments, the extracellular antigen-binding domain comprises: (a) a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, or SEQ ID NO: 11; and (b) a light chain variable region comprising the amino acid sequence of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, or SEQ ID NO: 12.

[0038] In certain embodiments, the extracellular antigen binding domain comprises:

[0039] (a) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 1, and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 2;

[0040] (b) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 3, and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 4;

[0041] (c) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 5, and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 6;

[0042] (d) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 7, and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 8;

[0043] (e) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 9, and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 10; or

[0044] (f) a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 11, and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 12.

[0045] In certain embodiments, the extracellular antigen-binding domain comprises a heavy chain variable region comprising the amino acid sequence shown in SEQ ID NO: 1; and a light chain variable region comprising the amino acid sequence shown in SEQ ID NO: 2.

[0046] In certain embodiments, the extracellular antigen-binding domain comprises a linker between the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain. In certain embodiments, the linker has an amino acid sequence as set forth in SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 91, SEQ ID NO: 92, SEQ ID NO: 93, or SEQ ID NO: 94. In certain embodiments, the linker has an amino acid sequence as set forth in SEQ ID NO: 13 or SEQ ID NO: 14.

[0047] In certain embodiments, the extracellular antigen binding domain comprises a signal peptide covalently linked to the 5' end of the extracellular antigen binding domain. In certain embodiments, the extracellular antigen binding domain comprises a heavy chain variable region and a light chain variable region, and the positions of the heavy chain variable region and the light chain variable region from N-terminus to C-terminus are: V H -V L .

[0048] In certain embodiments, the extracellular antigen binding domain binds to CD371 with low binding affinity. In certain embodiments, the extracellular antigen binding domain binds to CD371 with a binding affinity of 1×10 -8 M or higher dissociation constant (K d ) binds to CD371.

[0049] In certain embodiments, the transmembrane domain comprises a CD28 polypeptide. In certain embodiments, the intracellular signaling domain comprises a CD3ζ polypeptide. In certain embodiments, the intracellular signaling domain further comprises at least one costimulatory signaling region. In certain embodiments, at least one costimulatory signaling region comprises a CD28 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a DAP-10 polypeptide, or a combination thereof. In certain embodiments, at least one costimulatory signaling region comprises a CD28 polypeptide or a 4-1BB polypeptide.

[0050] In certain embodiments, the antigen recognition receptor is a chimeric antigen receptor (CAR), a T cell receptor (TCR), or a T cell-like fusion protein. In certain embodiments, the antigen recognition receptor is a CAR.

[0051] In certain embodiments, the antigen recognition receptor is recombinantly expressed. In certain embodiments, the antigen recognition receptor is expressed by a vector. In certain embodiments, the vector is a gamma-retroviral vector.

[0052] The subject matter of the present disclosure provides cells comprising the antigen recognition receptors of the present disclosure. In certain embodiments, the cells are transduced with the antigen recognition receptors. In certain embodiments, the antigen recognition receptors are constitutively expressed on the cell surface.

[0053] In certain embodiments, the cells are engineered to express a cytokine or a fragment thereof. In certain embodiments, the cells further comprise an exogenous polypeptide of a cytokine or a fragment thereof. In certain embodiments, the cells further comprise a nucleic acid molecule encoding a cytokine or a fragment thereof. In certain embodiments, the cytokine is selected from IL-18, IL-33, IL-36, and combinations thereof. In certain embodiments, the cytokine is IL-18.

[0054] In certain embodiments, the cell is an immune response cell. In certain embodiments, the cell is a cell of the lymphoid lineage or a cell of the myeloid lineage. In certain embodiments, the cell is selected from T cells, natural killer (NK) cells and stem cells that can differentiate into lymphoid cells.

[0055] In certain embodiments, the cell is a T cell. In certain embodiments, the T cell is a cytotoxic T lymphocyte (CTL) or a regulatory T cell. In certain embodiments, the stem cell is a pluripotent stem cell. In certain embodiments, the pluripotent stem cell is an embryonic stem cell or an induced pluripotent stem cell.

[0056] The presently disclosed subject matter also provides nucleic acid molecules encoding the antigen recognition receptors of the present disclosure.

[0057] In certain embodiments, the nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, or SEQ ID NO:27. In certain embodiments, the nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO:22. The presently disclosed subject matter also provides vectors comprising the nucleic acid molecules of the present disclosure. In certain embodiments, the vector is a viral vector. In certain embodiments, the vector is a gamma-retroviral vector.

[0058] Furthermore, the presently disclosed subject matter provides host cells that express the nucleic acid molecules disclosed herein.

[0059] In certain embodiments, the host cell is a T cell.

[0060] The presently disclosed subject matter also provides compositions comprising the cells disclosed herein. In certain embodiments, the composition is a pharmaceutical composition further comprising a pharmaceutically acceptable carrier.

[0061] The presently disclosed subject matter also provides methods of reducing tumor burden in a subject. In certain embodiments, the method comprises administering to the subject an effective amount of a cell or composition of the present disclosure.

[0062] In certain embodiments, the method reduces the number of tumor cells in the subject, reduces the size of the tumor in the subject, and / or eradicates the tumor in the subject. The subject of the present disclosure also provides a method for increasing or extending the survival of a subject suffering from a tumor or neoplasia. In certain embodiments, the method comprises administering an effective amount of cells or compositions of the present disclosure to the subject. The subject of the present disclosure also provides a method for treating and / or preventing a tumor or neoplasia in a subject. In certain embodiments, the method comprises administering an effective amount of cells or compositions of the present disclosure to the subject. In certain embodiments, the tumor or neoplasia is selected from acute myeloid leukemia (AML), multiple myeloma, non-Hodgkin's lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia (CLL), glioblastoma, myelodysplastic syndrome (MDS) and chronic myeloid leukemia (CML). In certain embodiments, the tumor or neoplasia is acute myeloid leukemia (AML).

[0063] The presently disclosed subject matter also provides methods for producing cells of the present disclosure comprising an antigen recognition receptor that targets CD371. In certain embodiments, the method comprises introducing a nucleic acid molecule encoding the antigen recognition receptor into the cell.

[0064] In addition, the presently disclosed subject matter provides kits for reducing tumor burden in a subject, treating and / or preventing a tumor or neoplasia in a subject, and / or increasing or prolonging the survival of a subject suffering from a tumor or neoplasia. In certain embodiments, the kit comprises cells described herein. In certain embodiments, the kit further comprises written instructions for using the cells to reduce tumor burden in a subject, treat and / or prevent a tumor or neoplasia in a subject, and / or increasing or prolonging the survival of a subject suffering from a tumor or neoplasia. BRIEF DESCRIPTION OF THE DRAWINGS

[0065] The following detailed description is given by way of example and is not intended to limit the invention to the specific embodiments described, and should be understood in conjunction with the accompanying drawings.

[0066] Figure 1 The structure of an antigen recognition receptor according to the presently disclosed subject matter is described.

[0067] Figure 2 Description CAR targeting CD371 was detected on the surface of transduced human T cells. Antibodies against EGFRt (CETUXIMAB-APC) and Myc-tag (9B11-PE) detected the surface expression of EGFRt and human anti-human CAR in B10-based CAR constructs. Controls included non-transduced human T cells that do not express EGFRt or MYC-tags, and CAR constructs containing non-MYC-tags Etah19h28z (anti-human CD19 CAR T cells) and EtC1HVh28z (anti-CD371 CAR T cells derived from mouse anti-human CD371 antibody 107537).

[0068] Figure 3 To characterize the tumor cell lytic activity of CAR T cells targeting CD371. After 4 days of rest (4dR), CAR T cells targeting human CD371 were co-transfected with CD33 expressing GFP and firefly luciferase (U937gL). + / CD371 + U937 cells were co-cultured at varying effector:tumor (E:T) ratios. Bioluminescence was measured 24 hours later and plotted as the percentage of signal detected in co-cultures of non-functional CAR T cells (based on B10L4H but without the CD28 or CD3ζ signaling domains) and U937gL. Et.C1HVh28z represents a CD371-targeting CAR derived from the mouse anti-human CD371 antibody 1075.7, and EtM195MTh28z represents a CD33-targeting CAR T cell derived from the murine anti-CD33 antibody M195 (see Zhao et al., Haematologica (2010): 95:71–78 (2010)).

[0069] Figure 4 The tumor cell lytic activity of CAR T cells targeting CD371 in a 24-hour killing assay was described. CAR T cells targeting CD371 from a healthy donor (referred to as "donor C") were compared with CD33 expressing GFP and firefly luciferase (U937gL). + / CD371 + U937 cells were co-cultured at different effector:tumor (E:T) ratios. Bioluminescence was measured after 24 hours and plotted as the percentage of the signal detected in co-cultures of non-functional CAR T cells (based on B10L4H but without the CD28 or CD3ζ signaling domains) and U937gL. Et.C1HVh28z represents a CD371-targeted CAR derived from the mouse anti-human CD371 antibody 1075.7, and EtM195Mth28z represents a CD33-targeted CAR T cell derived from the murine anti-human CD33 antibody M195.

[0070] Figure 5 The tumor cell lytic activity of CAR T cells targeting CD371 in a 24-hour killing assay was described. CAR T cells targeting CD371 from a healthy donor (referred to as "donor D") were compared with CD33 expressing GFP and firefly luciferase (U937gL). + / CD371 + U937 cells were co-cultured with different effector: tumor (E:T ratios). Bioluminescence was measured after 24 hours and plotted as the percentage of the signal detected in co-cultures of non-functional CAR T cells (based on B10L4H but without the CD28 or CD3ζ signaling domains) and U937gL. Et.C1HVh28z represents a CD371-targeted CAR derived from the mouse anti-human CD371 antibody 1075.7, and EtM195Mth28z represents a CD33-targeted CAR T cell derived from the mouse anti-human CD33 antibody M195.

[0071] Figure 6 To characterize the activity of CAR T cells targeting CD371 in a recurrent stimulation assay. CAR T cells targeting CD371 from a healthy donor (referred to as "donor C") were compared with CD33 + / CD371 +U937gL cells were co-cultured at an E:T ratio of 1:12.5 and a concentration of 30,000 CAR positives / mL. CAR T cells were counted approximately every 4-5 days and characterized by flow cytometry, and then the initial number of tumor cells were added back to the culture (as indicated by the arrows). Et.B10LHdel represents a non-functional CART cell (lacking a signaling domain); Et.C1HVh28z represents a CD371-targeted CAR derived from mouse anti-human CD371 antibody 1075.7, and EtM195Mth28z represents a CD33-targeted CAR T cell derived from mouse anti-human CD33 antibody M195.

[0072] Figure 7 To characterize the activity of CAR T cells targeting CD371 in a recurrent stimulation assay. CAR T cells targeting CD371 from a healthy donor (referred to as “donor D”) were compared with CD33 + / CD371 + U937gL cells were co-cultured with an E:T ratio of 1:12.5 and a concentration of 30,000 CAR positives / ml. CAR T cells were counted approximately every 4-5 days and characterized by flow cytometry, and then the initial number of tumor cells were added back to the culture (as indicated by the arrows). Et.B10LHdel represents a non-functional CART cell (lacking a signaling domain); Et.C1HVh28z represents a CAR targeting CD371 derived from mouse anti-human CD371 antibody 1075.7, and EtM195Mth28z represents a CAR T cell targeting CD33 derived from mouse anti-human CD33 antibody M195.

[0073] Figure 8A and 8B The present study describes the in vitro antitumor activity of CD371-targeted CAR T cells (second-generation B10HL-based CAR T cells and B10LH-based CAR T cells) in a 24-hour killing assay against U937gL cells. CAR T cells targeting CD371 from healthy human donors (referred to as "donor A" and "donor B") were co-cultured with CD371-positive U937 cells (U937gL) expressing GFP and firefly luciferase at varying effector:tumor ratios. Bioluminescence was measured after 24 hours and plotted as a percentage of the signal detected in co-cultures of non-functional CD371-targeted CAR T cells (based on B10L4H but without the CD28 or CD3ζ signaling domains) and U937gL cells. Figure 8A Results for donor A are shown. Figure 8B Results for donor B are shown.

[0074] Figure 9A and9B The present study describes the in vitro antitumor activity of CD371-targeted CAR T cells (second-generation B10HL-based CAR T cells and B10LH-based CAR T cells) in a 24-hour killing assay in HL60gL cells. CD371-targeted CAR T cells from healthy human donors (referred to as "Donor A" and "Donor B") were co-cultured with CD371-positive HL60 cells (HL60gL) expressing GFP and firefly luciferase at varying effector:tumor ratios. Bioluminescence was measured after 24 hours and plotted as a percentage of the signal detected in co-cultures of non-functional CD371-targeted CAR T cells (based on B10L4H but without the CD28 or CD3ζ signaling domains) and HL60gL cells. Figure 9A Results for donor A are shown. Figure 9B Results for donor B are shown.

[0075] Figure 10A and 10B The generation of a human CD371 (hCD371) CRISPR knockout cell line was described. Figure 10A ) and U937gL( Figure 10B ) were knocked out in the culture medium. Knockout was confirmed by flow cytometry using an anti-human CD371 APC-conjugated antibody. Figure 10A Knockout of HL60gL is shown. Figure 10B Knockout of U937gL is shown.

[0076] Figure 11A and 11B The present invention describes the cytotoxic activity of CD371-targeted CAR T cells (second-generation B10-based CAR T cells, i.e., B10-HL and B10LH-based CAR T cells) from different healthy donors against antigen-negative U937gL in a 24-hour killing assay. CAR T cells targeting CD371 from healthy human donors (referred to as "donor A" and "donor B") were co-cultured with CD371-negative U937 cells expressing RFP and cytochrome luciferase (U937RFPcyp.371KO) at different effector:tumor ratios. Bioluminescence was measured after 24 hours and plotted as a percentage of the signal detected in the co-culture of non-functional CD371-targeted CAR T cells (based on B10L4H, but without CD28 or CD3ζ signaling domains) and U937RFPcyp.371KO. Figure 11A Results for donor A are shown. Figure 11B Results for donor B are shown.

[0077] Figure 12A and 12BThe present study describes the cytotoxic activity of CD371-targeted CAR T cells (second-generation B10-based CAR T cells, i.e., B10-HL and B10LH-based CAR T cells) from different healthy donors against antigen-negative HL60gL in a 24-hour killing assay. CD371-targeted CAR T cells from healthy human donors (referred to as "donor A" and "donor B") were co-cultured with CD371-negative HL60 cells expressing GFP and firefly luciferase (HL60L.371KO) at different effector:tumor ratios. Bioluminescence was measured after 24 hours and plotted as a percentage of the signal detected in co-cultures of non-functional CD371-targeted CAR T cells (based on B10L4H but without the CD28 or CD3ζ signaling domains) and HL60gL.371KO. Figure 12A Results for donor A are shown. Figure 12B Results for donor B are shown.

[0078] Figure 13A and 13B The interferon gamma (IFN-γ) secretion of CAR T cells targeting CD371 (second-generation B10-based CAR T cells, i.e., B10-HL and B10LH-based CAR T cells) was described. CAR T cells targeting human CD371 were co-administered with CD371-negative U937 cells alone or with CD371+ U937 cells at a 1:1 effector:tumor ratio (E:T) (4.0 × 10 in 200 μl). 4 :4.0×10 4 After 24 hours, supernatants were collected and IFN-γ was measured using a bead-based multiplex assay. Figure 13A Results for donor A are shown. Figure 13B Results for donor B are shown.

[0079] Figure 14A and 14B The interleukin-2 (IL-2) secretion of CD371-targeted CAR T cells (second-generation B10-based CAR T cells, i.e., B10-HL and B10LH-based CAR T cells) was described. Human CD371-targeted CAR T cells were co-administered with CD371-negative U937 cells alone or with CD371+ U937 cells at a 1:1 effector:tumor ratio (E:T) (4.0 × 10 in 200 μl). 4 :4.0×10 4 After 24 hours, the supernatants were collected and IL-2 was measured using a bead-based multiplex assay. Figure 14A Results for donor A are shown. Figure 14B Results for donor B are shown.

[0080] Figure 15A and 15B The tumor necrosis factor alpha (TNF-α) secretion of CD371-targeted CAR T cells (second-generation B10-based CAR T cells, i.e., B10-HL and B10LH-based CAR T cells) was described. Human CD371-targeted CAR T cells were co-administered with CD371-negative U937 cells alone or with CD371+ U937 cells at a 1:1 effector:tumor ratio (E:T) (4.0 × 10 in 200 μl). 4 :4.0×10 4 After 24 hours, the supernatants were collected and TNF-α was measured using a bead-based multiplex assay. Figure 15A Results for donor A are shown. Figure 15B Results for donor B are shown.

[0081] Figure 16A and 16B Figure 3 depicts cell proliferation of B10-based CAR T cells in a recursive stimulation assay. CAR T cells targeting CD371 were generated from two healthy donors (donor A and donor B). CAR T cells were co-cultured with CD371+U937gL at an E:T ratio of 1:5 and a concentration of 50,000 CAR positives / ml. Approximately every 5 days, CAR T cells were counted and characterized by flow cytometry. The initial number of tumor cells was added back to the culture (indicated by the arrow). Figure 16A Results for donor A are shown. Figure 16B Results for donor B are shown.

[0082] Figure 17 A murine xenograft model of AML is shown. NCG mice were inoculated via the tail vein with 5×10 4 Three days later, mice were administered CAR T cells targeting CD371. Tumor dynamics were noninvasively measured approximately every five days using bioluminescence imaging, and survival was monitored.

[0083] Figure 18 Figure 3. Survival of mice xenografted with AML cell lines (donor 1) treated with CAR T cells targeting human CD371. NCG mice were inoculated with 5×10 4 U937gL tumor cells were used three days later with approximately 1.25×10 6 The mice were treated with CAR T cells targeting human CD371. The survival of the mice was monitored.

[0084] Figure 19Figure 2 shows the survival of mice xenografted with AML cell lines (donor 2) treated with CAR T cells targeting human CD371. NCG mice were inoculated with U937gL tumor cells and three days later treated with approximately 1.25×10 6 The mice were treated with CAR T cells targeting human CD371. The survival of the mice was monitored.

[0085] Figure 20 Characterize the in vivo activity of B10-based CAR T cells. NCG mice were inoculated with 5×10 4 U937gL tumor cells were then treated with different doses of CD371-targeting CAR T cells (1.25×10 5 , 2.5×10 5 , 5.0×10 5 and 1.0×10 6 ) treatment. In 55 days ( Figure 20 A) and 60 days ( Figure 20 B) The survival rate of mice was monitored. Figure 21 Binding of scFv to HEK293 cells expressing human CD371 is depicted.

[0086] Figure 22 The in vitro cytotoxicity of second-generation B10HL-based CAR T cells against CD371-positive targets is described. B10HL-based CAR T cells have different lengths of G4S linkers. CAR T cells targeting CD371 from healthy human donors (including donors A and B) were co-cultured with antigen-positive U937 cells (U937gL) expressing GFP and firefly luciferase at different effector:tumor ratios. Bioluminescence was measured after 24 hours and plotted as the percentage of the signal detected in co-cultures of non-functional CD371-targeting CAR T cells (based on B10L4H, but without CD28 or CD3ζ signaling domains) and U937gL.

[0087] Figure 23 Characterize the in vivo activity of B10-based CAR T cells. NCG mice were inoculated with 5×10 4 U937gL tumor cells were used, and 5×10 5 CAR T cell therapy. Survival of mice was monitored. CAR T cells targeting human CD371, including B10H3L, B10H5L, and the IL33-secreting B10H4L, outperformed B10H4L-based CAR T cells in vivo.

[0088] Figure 24 Characterize the in vivo activity of B10-based CAR T cells. NCG mice were inoculated with 5×10 4 U937gL tumor cells were used and 2.5×105 CAR T cell therapy. Survival of mice was monitored. CAR T cells targeting human CD371, which secrete IL18 and IL33, outperformed B10H4L-based CAR T cells in vivo.

[0089] Figure 25 Characterize the in vivo activity of B10-based CAR T cells. NCG mice were inoculated with 5×10 4 U937gL tumor cells were used and 1.0×10 5 CAR T cell therapy. Monitoring the survival rate of mice. 5 At low doses, IL18-secreting B10H4L CAR T cells targeting human CD371 outperformed all other constructs in vivo. DETAILED DESCRIPTION

[0090] The subject matter of the present disclosure provides antigen recognition receptors (e.g., chimeric antigen receptors (CAR) or T cell receptors (TCR)) that specifically target CD371. The subject matter of the present disclosure also provides cells comprising such receptors. The cell can be an immune response cell, e.g., a genetically modified immune response cell (e.g., T cell or NK cell). The subject matter of the present disclosure also provides methods for treating using such cells, e.g., for treating and / or preventing tumors or neoplasia (e.g., AML).

[0091] Non-limiting embodiments of the present disclosure are described by way of the specification and examples.

[0092] For purposes of clarity of the present disclosure, and not by way of limitation, the detailed description is divided into the following subsections:

[0093] 5.1. Definitions;

[0094] 5.2.CD371;

[0095] 5.3. Antigen recognition receptors;

[0096] 5.4. Cells;

[0097] 5.5. Compositions and carriers;

[0098] 5.6. Peptides;

[0099] 5.7. Dosage Form and Administration;

[0100] 5.8. Treatment methods; and

[0101] 5.9. Test kit.

[0102] 5.1. Definitions

[0103] Unless otherwise defined, all technical and scientific terms used herein have the meanings commonly understood by those skilled in the art to which the invention belongs. The following references provide general definitions of many of the terms used in the present invention for those skilled in the art: Singleton et al., Dictionary of Microbiology and Molecular Biology (Second Edition, 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, Fifth Edition, R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). Unless otherwise indicated, the following terms used herein have the meanings given below.

[0104] As used herein, the terms "about" or "approximately" mean within an acceptable error range for a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, according to common practice in the art, "about" can mean within 3 or more standard deviations. Alternatively, "about" can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and even more preferably up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold of a value.

[0105] "Immune response cell" refers to a cell or its progenitor cell or its progeny that plays a role in an immune response. In certain embodiments, the immune response cell is a cell of the lymphoid lineage. Non-limiting examples of lymphoid lineage cells include T cells, natural killer (NK) cells, B cells, and stem cells that can differentiate into lymphoid cells. In certain embodiments, the immune response cell is a cell of the bone marrow lineage.

[0106] "Activation of immune response cells" refers to the induction of signal transduction or changes in protein expression in cells, resulting in the initiation of an immune response. For example, when the CD3 chain responds to ligand binding and immunoreceptor tyrosine-based inhibitory motif (ITAM) aggregation, a signal transduction cascade reaction is generated. In certain embodiments, when endogenous TCR or exogenous CAR is bound to an antigen, the formation of an immune synapse occurs, which includes the aggregation of many molecules near the binding receptor (e.g., CD4 or CD8, CD3γ / δ / ε / ζ, etc.). This aggregation of membrane-bound signaling molecules phosphorylates the ITAM motif contained in the CD3 chain. This phosphorylation, in turn, activates the T cell activation pathway, ultimately activating transcription factors such as NF-κB and AP-1. These transcription factors induce the overall gene expression of T cells, thereby increasing the production of IL-2, promoting the proliferation and expression of master regulatory T cell proteins, and then initiating a T cell-mediated immune response.

[0107] "Stimulating immune response cells" refers to signals that cause a strong and sustained immune response. In various embodiments, this occurs after immune cells (e.g., T cells) are activated or mediated simultaneously by receptors including but not limited to CD28, CD137 (4-1BB), OX40, CD40, and ICOS. Receiving a variety of stimulating signals may be important for establishing a strong and long-term T cell-mediated immune response. T cells can be rapidly suppressed and have no response to antigens. Although the effects of these co-stimulatory signals may be different, they generally result in increased gene expression, resulting in long-lived, proliferative, and anti-apoptotic T cells, which respond strongly to antigens and can be thoroughly and continuously eradicated.

[0108] As used herein, the term "antigen recognition receptor" refers to a receptor that can recognize a target antigen (e.g., CD371). In certain embodiments, the antigen recognition receptor can activate immune or immune response cells (e.g., T cells) after binding to the target antigen.

[0109] The term "antibody" as used herein refers not only to complete antibody molecules, but also to antibody molecule fragments that retain immunogen binding ability. Such fragments are also well known in the art and are routinely used in vitro and in vivo. Therefore, the term "antibody" used herein refers not only to complete immunoglobulin molecules, but also to the well-known active fragments F(ab')2 and Fab. F(ab')2 and Fab fragments that lack the Fc fragment of a complete antibody are cleared from the circulation faster and may have less non-specific tissue binding of the complete antibody (Wahl et al., Nucl Med (1983); 24: 316-325). As used herein, it includes complete natural antibodies, bispecific antibodies; chimeric antibodies; Fab, Fab', single-chain V region fragments (scFv), fusion polypeptides and unconventional antibodies. In certain embodiments, an antibody is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds. Each heavy chain consists of a heavy chain variable region (referred to herein as V H ) and heavy chain constant (C H The heavy chain constant region is composed of three domains: CH1, CH2 and CH3. Each light chain is composed of a light chain variable region (abbreviated herein as V L ) and light chain constant C L The light chain constant region consists of a domain C L Composition. H Area and V L The V region can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDRs), interspersed with regions that are more conserved, termed framework regions (FRs). H and V L It is composed of three CDRs and four FRs, which are arranged in the following order from amino terminus to carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4. The variable regions of the heavy and light chains contain binding domains that interact with antigens. The constant region of an antibody can mediate the binding of immunoglobulins to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (C1q) of the classical complement system.

[0110] As used herein, "CDR" is defined as the complementary determining region amino acid sequence of an antibody, which is a hypervariable region of an immunoglobulin heavy chain and light chain. See, for example, Kabat et al., Sequences of Proteins of Immunological Interest, 4th edition, National Institutes of Health, Department of Health and Human Services (1987) or the IMGT numbering system (Lefranc, The Immunologist (1999); 7: 132-136; Lefranc et al., Dev. Comp. Immunol. (2003); 27: 55-77). Typically, an antibody comprises three heavy chain and three light chain CDRs or CDR regions in the variable region. CDRs provide most of the contact residues to bind the antibody to the antigen or epitope. In some embodiments, the CDR regions are outlined using the IMGT numbering system. In some embodiments, the CDR regions are outlined using the IMGT numbering system accessible at http: / / www.imgt.org / IMGT_vquest / input.

[0111] As used herein, the term "single-chain variable fragment" or "scFv" is a fragment of a heavy chain (V H ) and light chain (V L ) of the variable region, which is covalently linked to form V H ::VL heterodimer. Heavy chain (V H ) and light chain (V L ) directly or through a peptide-encoded linker (e.g., 10, 15, 20, 25 amino acids) that connects V H The N-terminus of V L The C-terminus of the H The C-terminus of V L The N-terminus of the polypeptide is connected. The linker is generally rich in glycine for flexibility and serine or threonine for solubility. The linker can connect the heavy chain variable region and the light chain variable region of the extracellular antigen binding domain. Non-limiting examples of linkers are disclosed in Shen et al., Anal. Chem. 80(6): 1910-1917 (2008) and WO2014 / 087010, the contents of which are incorporated herein by reference in their entirety. In certain embodiments, the linker is a G4S linker.

[0112] In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 13, which is provided below:

[0113] GGGGSGGGGSGGGSGGGGS[SEQ ID NO: 13]

[0114] In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO: 14, which is provided below:

[0115] GGGGSGGGGSGGGGS[SEQ ID NO: 14]

[0116] In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO:91, which is provided below:

[0117] GGGGSGGGGSGGGGSGGGSGGGGS [SEQ ID NO: 91]

[0118] In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO:92, which is provided below:

[0119] GGGGSGGGGSGGGGSGGGGSGGGSGGGGS [SEQ ID NO: 92]

[0120] In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO:93, which is provided below:

[0121] GGGGS [SEQ ID NO: 93]

[0122] In certain embodiments, the linker comprises the amino acid sequence set forth in SEQ ID NO:94, which is provided below:

[0123] GGGGSGGGGS [SEQ ID NO: 94]

[0124] Despite the removal of the constant region and the introduction of a linker, the scFv protein retains the specificity of the original immunoglobulin. Single-chain Fv polypeptide antibodies can be prepared by methods such as Huston et al. Proc. Nat. Acad. Sci. USA, (1988); 85: 5879-5883; U.S. Patent Nos. 5,091,513, 5,132,405 and 4,956,778 and U.S. Patent Publication Nos. 20050196754 and 20050196754, including V H and V LExpression of nucleic acid encoding sequences. Antagonistic scFvs with inhibitory activity have been described (see, e.g., Zhao et al., Hyrbidoma (Larchmt) (2008); 27(6):455-51; Peter et al., J Cachexia Sarcopenia Muscle (2012); Aug 12; Shieh et al., J Imunol (2009); 183(4):2277-85; Giomarelli et al., Thromb Haemost (2007); 97(6):955-63; Fife et al., J Clin Invst (2006); 116(8):2252-61; Brocks et al., Immunotechnology 1997 3(3):173-84; Moosmayer et al., Ther Immunol 1995 2(10:31-40)). Agonistic scFvs with stimulatory activity have been described (see, e.g., Peter et al., J Biol Chern 2003 25278(38):36740-7; Xie et al., Nat Biotech 1997 15(8):768-71; Ledbetter et al., Crit Rev Immunol 1997 17(5-6):427-55; Ho et al., BioChim Biophys Acta 2003 1638(3):257-66).

[0125] As used herein, the term "chimeric antigen receptor" or "CAR" refers to a molecule comprising an extracellular antigen binding domain and a transmembrane domain fused to an intracellular signaling domain that can activate or stimulate an immune response cell. In certain embodiments, the extracellular antigen binding domain of CAR comprises scFv. scFv can be derived from the variable heavy and light regions of a fusion antibody. Alternatively or in addition, scFv can be derived from Fab's (rather than antibodies, e.g., obtained from a Fab library). In certain embodiments, scFv is fused to a transmembrane domain and then fused to an intracellular signaling domain. "Substantial identity" or "substantial homology" refers to a polypeptide or nucleic acid molecule that exhibits at least about 50% homology or identity to a reference amino acid sequence (e.g., any amino acid sequence described herein) or a reference nucleic acid sequence (e.g., any nucleic acid sequence described herein). In certain embodiments, such sequences are at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or at least about 100% homologous or identical to the amino acid or nucleic acid sequence used for comparison.

[0126] Sequence identity can be measured using sequence analysis software (e.g., Sequence Analysis Software Package, University of Wisconsin Biotechnology Center Genetics Computer Group, 1710 University Avenue, Madison, WI 53705, BLAST, BESTFIT, GAP, or PILEUP / PRETTYBOX programs). Such software matches identical or similar sequences by assigning degrees of homology to various substitutions, deletions, and / or other modifications. Conservative substitutions generally include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine lysine, arginine; and phenylalanine, tyrosine. In an exemplary method for determining the degree of identity, the BLAST program can be used, where probability scores between e-3 and e-100 indicate closely related sequences.

[0127] An "effective amount" is an amount sufficient to affect a beneficial or desired clinical outcome during treatment. An effective amount can be administered to a subject in one or more doses. In certain embodiments, an effective amount can be an amount sufficient to alleviate, improve, stabilize, reverse, or slow the progression of a disease or otherwise reduce the pathological consequences of a disease. An effective amount can be determined by a physician on a case-by-case basis and is within the skill of those skilled in the art. When determining an appropriate dosage to achieve an effective amount, several factors are generally considered. These factors include the age, sex, and weight of the subject, the disease being treated, the severity of the disease, and the form and effective concentration of the cells being administered.

[0128] As used herein, the term "endogenous" refers to a nucleic acid molecule or polypeptide that is normally expressed in a cell or tissue.

[0129] As used herein, the term "exogenous" refers to a nucleic acid molecule or polypeptide that is not endogenous and exists in a cell. Therefore, the term "exogenous" will encompass any recombinant nucleic acid molecule or polypeptide expressed in a cell, such as exogenous, heterologous and overexpressed nucleic acid molecules and polypeptides. "Exogenous" nucleic acid refers to a nucleic acid that does not exist in a natural wild-type cell. For example, an exogenous nucleic acid can be different from an endogenous counterpart by sequence, position / location or both. For clarity, an exogenous nucleic acid can have the same or different sequence relative to its natural endogenous counterpart. It can be introduced into the cell itself or its progenitor cell by genetic engineering and can optionally be connected to an alternative control sequence, such as a non-natural promoter or secretory sequence.

[0130] "Heterologous nucleic acid molecule or polypeptide" refers to a nucleic acid molecule (e.g., a cDNA, DNA, or RNA molecule) or polypeptide that is not normally present in a cell or a sample obtained from a cell. The nucleic acid can be from another organism or can be, for example, an mRNA molecule that is not normally expressed in the cell or sample.

[0131] "Modulate" refers to a positive or negative change. Exemplary modulations include changes of about 1%, about 2%, about 5%, about 10%, about 25%, about 50%, about 75%, or about 100%.

[0132] "Increase" refers to a positive change of at least about 5%. The change can be about 5%, about 10%, about 25%, about 30%, about 50%, about 75%, about 100% or more.

[0133] "Decrease" refers to a negative change of at least about 5%. The change can be about 5%, about 10%, about 25%, about 30%, about 50%, about 75% or even about 100%.

[0134] The terms "isolated," "purified," or "biologically pure" refer to a substance that is free, to varying degrees, from components that normally accompany it in its native state. "Isolated" refers to a degree of separation from the original source or environment. "Purified" refers to a degree of separation greater than separation. A "purified" or "biologically pure" protein is sufficiently free of other substances so that any impurities do not materially affect the biological properties of the protein or cause other adverse consequences. In other words, a nucleic acid or peptide is purified if it is produced by recombinant DNA technology and is substantially free of cellular material, viral material, or culture medium, or if it is chemically synthesized and is substantially free of chemical precursors or other chemicals. Purity and homogeneity are typically determined using analytical chemistry techniques, such as polyacrylamide gel electrophoresis or high performance liquid chromatography. The term "purified" can mean that a nucleic acid or protein produces essentially a single band in an electrophoretic gel. For proteins that can be modified (e.g., phosphorylated or glycosylated), different modifications can produce different isolated proteins, which can be purified separately.

[0135] An "isolated cell" refers to a cell that is separated from the molecules and / or cellular components that naturally accompany the cell.

[0136] As used herein, the term "antigen binding domain" refers to a domain that is capable of specifically binding to a particular antigenic determinant or group of antigenic determinants present on a cell.

[0137] "Neoplasia" refers to a disease characterized by the pathological proliferation of cells or tissues and their subsequent migration or invasion to other tissues or organs. The growth of neoplasia is usually uncontrolled and progressive, and occurs under the conditions that do not cause normal cell proliferation or cause normal cell proliferation to stop. Neoplasia can affect a variety of cell types, tissues or organs, including but not limited to organs selected from: bladder, bone, brain, breast, cartilage, glial, esophagus, fallopian tube, gall bladder, heart, intestine, kidney, liver, lung, lymph node, nervous tissue, ovary, pancreas, prostate, skeletal muscle, skin, spinal cord, spleen, stomach, testicle, thymus, thyroid, trachea, genitourinary tract, ureter, urethra, uterus and vagina or its tissue or cell type. Neoplasia includes cancer, such as sarcoma, tumor or plasmacytoma (malignant tumor of plasma cells). Neoplasia can be a primary tumor or primary cancer. In addition, neoplasia may be in a metastatic state.

[0138] "Receptor" refers to a polypeptide or a portion thereof present on a cell membrane that selectively binds one or more ligands.

[0139] "Recognition" refers to selectively binding to a target. T cells that recognize tumors can express receptors (such as TCRs or CARs) that bind to tumor antigens.

[0140] A "reference" or "control" refers to a standard of comparison. For example, the scFv-antigen binding levels of cells expressing a CAR and an scFv can be compared to the scFv-antigen binding levels of corresponding cells expressing only the CAR.

[0141] "Secreted" refers to the release of a polypeptide from a cell through the secretory pathway through the endoplasmic reticulum, the Golgi apparatus, and as vesicles that transiently fuse at the plasma membrane, releasing the protein outside the cell.

[0142] "Signal sequence" or "leader sequence" refers to a peptide sequence (eg, 5, 10, 15, 20, 25, or 30 amino acids) present at the N-terminus of newly synthesized proteins that directs them into the secretory pathway.

[0143] "Specifically binds" or "specifically binds to..." or "specifically targets" refers to a polypeptide or fragment thereof that recognizes and / or binds to a target biological molecule (e.g., a polypeptide, such as a CD371 polypeptide) but does not substantially recognize and / or bind to other molecules in a sample, such as a biological sample, which naturally includes a polypeptide of the present disclosure (e.g., a CD371 polypeptide).

[0144] The terms "comprising," "including," and "include" are intended to have the broadest meanings given them in U.S. patent law, and may mean "containing," "including," and the like.

[0145] As used herein, "treatment" refers to a clinical intervention that attempts to alter the course of a disease in the individual or cell being treated, and can be used prophylactically or performed during clinical pathology. The therapeutic effects of treatment include, but are not limited to, preventing the onset or recurrence of a disease, alleviating symptoms, reducing any direct or indirect pathological consequences of a disease, preventing metastasis, reducing the rate of disease progression, ameliorating or alleviating the disease state, and alleviating or improving prognosis. By preventing the progression of a disease or condition, treatment can not only prevent deterioration due to the condition in an affected or diagnosed subject or a subject suspected of having the condition, but treatment can also prevent the onset of the condition or symptoms of the condition in a subject at risk of having the condition or suspected of having the condition.

[0146] As used herein, an "individual" or "subject" is a vertebrate, such as a human or a non-human animal, such as a mammal. Mammals include, but are not limited to, humans, primates, farm animals, sports animals, rodents, and pets. Non-limiting examples of non-human animal subjects include rodents, such as mice, rats, hamsters, and guinea pigs; rabbits; dogs; cats; sheep; pigs; goats; cattle; horses; and non-human primates, such as apes and monkeys. As used herein, the term "immunocompromised" refers to a subject that has an immune deficiency. The subject is highly susceptible to opportunistic infections caused by organisms that do not normally cause disease in people with healthy immune systems, but can affect people with poorly functioning or suppressed immune systems.

[0147] Other aspects of the presently disclosed subject matter are described in the following disclosure and are within the scope of the presently disclosed subject matter.

[0148] 5.2.CD371

[0149] CD371 (CEC12A), also known as DCAL-2, MICL, or CLL-1, is a 30kD C-type lectin transmembrane glycoprotein. It is expressed on monocytes, granulocytes, natural killer (NK) cells, and basophils. CD371 is an immunosuppressive receptor that recruits the Src homologous phosphatases SHP-1 and SHP-2 to its phosphorylated cytoplasmic immunoreceptor tyrosine-based inhibitory motif (ITIM) (Sancho et al., Annu Rev. Immunol (2012); 30:491-529; Yan et al., Front Immunol (2015); 6:408; Lahoud et al., J Immunol (2011); 187:842). CD371 is considered a negative regulator of uric acid crystals (monosodium urate, MSU) receptors that control autoimmune and inflammatory diseases (Neumann et al., Immunity (2014); 40:389-99). CD371 is a negative regulator of granulocyte and monocyte function (Marshall et al., J Biol Chem (2004); 279(15): 14792-802; Pyz et al., Eur J Immunol (2008); 38(4): 1157-63).

[0150] In certain embodiments, CD371 is human CD371 comprising or consisting of the amino acid sequence having NCBI Reference Number: NP_612210.4 (SEQ ID NO: 15) or a fragment thereof.

[0151] SEQ ID NO: 15 is provided below:

[0152]

[0153] In certain embodiments, CD371 comprises, or consists of, an amino acid sequence that is at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%, or at least about 100% identical to the amino acid sequence shown in SEQ ID NO:15, or a fragment thereof.

[0154] 5.3. Antigen Recognition Receptors

[0155] The antigen recognition receptors of the present disclosure specifically target or bind CD371. In certain embodiments, the antigen recognition receptor is a chimeric antigen receptor (CAR). In certain embodiments, the antigen recognition receptor is a T cell receptor (TCR). In certain embodiments, the antigen recognition receptor is a TCR-like fusion molecule.

[0156] The presently disclosed subject matter also provides nucleic acid molecules encoding the antigen recognition receptors of the present disclosure. In certain embodiments, the nucleic acid molecule comprises a nucleotide sequence encoding a polypeptide of the antigen recognition receptor targeting CD371 disclosed herein.

[0157] 5.3.1. T cell receptor (TCR)

[0158] In certain embodiments, the antigen recognition receptor is a TCR. TCR is a disulfide-linked heterodimeric protein composed of two variable chains that are expressed as part of a complex with an invariant CD3 chain molecule. TCR is found on the surface of T cells and is responsible for recognizing antigens as peptides bound to major histocompatibility complex (MHC) molecules. In certain embodiments, TCR comprises an α chain and a β chain (encoded by TRA and TRB, respectively). In certain embodiments, TCR comprises a γ chain and a δ chain (encoded by TRG and TRD, respectively).

[0159] Each TCR chain consists of two extracellular domains: a variable (V) region and a constant (C) region. The constant region is located close to the cell membrane, followed by a transmembrane region and a short cytoplasmic tail. The variable region binds the peptide / MHC complex. The variable domains of both chains have three complementarity determining regions (CDRs).

[0160] In certain embodiments, the TCR can form a receptor complex with three dimeric signaling modules: CD3δ / ε, CD3γ / ε, and CD247ζ / ζ or ζ / η. When the TCR complex binds to its antigen and MHC (peptide / MHC), the T cell expressing the TCR complex is activated.

[0161] In certain embodiments, the TCR is an endogenous TCR. In certain embodiments, the antigen recognition receptor is a naturally occurring TCR.

[0162] In certain embodiments, the antigen recognition receptor is an exogenous TCR. In certain embodiments, the antigen recognition receptor is a recombinant TCR. In certain embodiments, the antigen recognition receptor is a non-naturally occurring TCR. In certain embodiments, the non-naturally occurring TCR differs from any naturally occurring TCR in at least one amino acid residue. In certain embodiments, the non-naturally occurring TCR differs from any naturally occurring TCR in at least about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100 or more amino acid residues. In certain embodiments, the non-naturally occurring TCR is obtained by modifying a naturally occurring TCR by at least one amino acid residue. In certain embodiments, the non-naturally occurring TCR is derived from a naturally occurring TCR by modifying at least about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 20, about 25, about 30, about 40, about 50, about 60, about 70, about 80, about 90, about 100 or more amino acid residues.

[0163] 5.3.2. Chimeric Antigen Receptor (CAR)

[0164] In certain embodiments, the antigen recognition receptor is a CAR. CARs are engineered receptors that transfer or confer target specificity to immune effector cells. CARs can be used to transfer the specificity of monoclonal antibodies to T cells; transfer of their coding sequences is facilitated by retroviral vectors.

[0165] There are three generations of CARs. “First generation” CARs typically consist of an extracellular antigen binding domain (e.g., scFv) fused to a transmembrane domain fused to a cytoplasmic / intracellular signaling domain. “First generation” CARs can provide de novo antigen recognition and activate CD4 through the CD3ζ chain signaling domain in a single fusion molecule. + and CD8 +In some embodiments, antigen recognition receptor is a first generation CAR. In some embodiments, antigen recognition receptor is a CAR that does not include the intracellular signaling domain of a costimulatory molecule or its fragment. In some embodiments, antigen recognition receptor is a second generation CAR. ...

[0166] In certain embodiments, the CAR comprises an extracellular antigen binding domain that specifically binds to CD371, a transmembrane domain, and an intracellular signaling domain.

[0167] 5.3.2.1. Extracellular Antigen Binding Domain of CAR

[0168] In certain embodiments, the extracellular antigen binding domain is an scFv. In certain embodiments, the scFv is a human scFv. In certain embodiments, the scFv is a humanized scFv. In certain embodiments, the scFv is a murine scFv. In certain embodiments, the scFv is identified by screening an scFv phage library with an antigen-Fc fusion protein.

[0169] In certain embodiments, the extracellular antigen binding domain is a Fab. In certain embodiments, the Fab is cross-linked. In certain embodiments, the extracellular antigen binding domain is a F(ab)2.

[0170] Any of the aforementioned molecules can be included in a fusion protein with a heterologous sequence to form an extracellular antigen binding domain. In certain non-limiting embodiments, the extracellular antigen binding domain of the CAR (embodied as, for example, scFv or its analogs) is approximately 1×10 -6 M or smaller, for example, about 1×10 -7 M or smaller, approximately 1×10 -8 M or smaller, approximately 1×10 -9 M or smaller, approximately 1×10 -10 M or smaller, or about 1×10 -11 The dissociation constant (K d ) binds to CD371 (e.g., human CD371). In certain embodiments, the extracellular antigen binding domain of the CAR is at about 1×10 -7 M or smaller K dBinds to CD371 (e.g., human CD371). In certain embodiments, the extracellular antigen binding domain of the CAR is at about 1×10 -8 M or smaller K d Binds to CD371 (e.g., human CD371). In certain embodiments, the extracellular antigen binding domain of the CAR is at about 1.5×10 -8 M or about 1×10 -8 M's K d Binds to CD371 (e.g., human CD371). In certain embodiments, the extracellular antigen binding domain of the CAR is at about 1×10 -8 M and about 1×10 -7 K between M d Binds to CD371 (eg, human CD371).

[0171] In certain embodiments, the extracellular antigen binding domain of the CAR binds to CD371 (e.g., human CD371) with low binding affinity. In certain embodiments, the extracellular antigen binding domain of the CAR binds to CD371 (e.g., human CD371) with low binding affinity. -8 M or larger, approximately 1×10 -8 M or larger, approximately 1×10 -7 M or larger, or about 1×10 -6 M or larger K d Binds to CD371 (eg, human CD371).

[0172] The combination of the extracellular antigen binding domain of CAR can be measured by, for example, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), FACS analysis, bioassay (e.g., growth inhibition), or Western Blot assay. Each of these assays is typically detected by using a labeling agent (e.g., antibody or scFv) specific for the target complex to detect the presence of a specific target protein-antibody complex. For example, scFv can be radiolabeled and used for radioimmunoassay (RIA) (see, e.g., Weintraub, B., Principles of Radioimmunoassay, Seventh Training Course on Radioligand Assay Technology, Endocrine Society, March 1986, incorporated herein by reference). Radioisotopes can be detected by methods such as using a gamma counter or scintillation counter or by autoradiography. In some embodiments, the extracellular antigen binding domains of targeting CD371 are labeled with a fluorescent marker. Non-limiting examples of fluorescent markers include green fluorescent protein (GFP), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, and mKalamal), cyan fluorescent proteins (e.g., ECFP, Cerulean, and CyPet), and yellow fluorescent proteins (e.g., YFP, Citrine, Venus, and YPet). In one embodiment, the human scFv targeting CD371 is labeled with GFP.

[0173] In certain embodiments, CDRs are identified according to the IMGT numbering system.

[0174] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises an amino acid sequence having at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homology or identity with the amino acid sequence shown in SEQ ID NO: 1. For example, the extracellular antigen binding domain of CAR (e.g., scFv) comprises V H , which comprises an amino acid sequence having about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity to SEQ ID NO: 1. In certain embodiments, the extracellular antigen binding domain comprises V H , which comprises the amino acid sequence shown in SEQ ID NO: 1. SEQ ID NO: 1 is provided in Table 1 below.

[0175] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a VL , which comprises an amino acid sequence having at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homology or identity with the amino acid sequence shown in SEQ ID NO: 2. For example, the extracellular antigen binding domain of a CAR (e.g., scFv) comprises a V L , which comprises an amino acid sequence having about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity to SEQ ID NO: 2. In certain embodiments, the extracellular antigen binding domain comprises V L , which comprises the amino acid sequence shown in SEQ ID NO: 2. SEQ ID NO: 2 is provided in Table 1 below.

[0176] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28 or a conservative modification thereof; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29 or a conservative modification thereof; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 30 or a conservative modification thereof. SEQ ID NOs: 28-30 are provided in Table 1.

[0177] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31 or a conservative modification thereof; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32 or a conservative modification thereof; and V L CDR3 comprising the amino acid sequence shown in SEQ ID NO: 33 or a conservative modification thereof. SEQ ID NOs: 31-33 are provided in Table 1.

[0178] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28 or a conservative modification thereof; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29 or a conservative modification thereof; V HCDR3, which comprises the amino acid sequence shown in SEQ ID NO: 30 or a conservative modification thereof; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31 or a conservative modification thereof; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32 or a conservative modification; and V L CDR3 comprises the amino acid sequence shown in SEQ ID NO: 33 or a conservative modification thereof.

[0179] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29; V H CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 30; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32; and V L CDR3 comprises the amino acid sequence shown in SEQ ID NO:33.

[0180] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises the amino acid sequence shown in SEQ ID NO: 1; and V L , which comprises the amino acid sequence shown in SEQ ID NO: 2. In certain embodiments, V H and V L In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 13.

[0181] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one after another so that at the N-terminus of the extracellular antigen binding domain, a heavy chain variable region (V H In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V H -V L In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 107, which is provided in Table 1. In certain embodiments, the scFv is designated "B10H4L."

[0182] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one by one so that at the N-terminus of the extracellular antigen binding domain, a light chain variable region (V L In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V L -V H In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 16. In certain embodiments, the scFv is designated "B10L4H." An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 16 is set forth in SEQ ID NO: 22. SEQ ID NO: 16 and SEQ ID NO: 22 are provided in Table 1 below.

[0183] Table 1

[0184]

[0185] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises an amino acid sequence having at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homology or identity with the amino acid sequence shown in SEQ ID NO: 3. For example, the extracellular antigen binding domain of CAR (e.g., scFv) comprises V H , which comprises an amino acid sequence having about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity to the amino acid sequence of SEQ ID NO: 3. In certain embodiments, the extracellular antigen binding domain comprises V H , which comprises the amino acid sequence shown in SEQ ID NO: 3. SEQ ID NO: 3 is provided in Table 2 below.

[0186] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V L , which comprises an amino acid sequence having at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homology or identity with the amino acid sequence shown in SEQ ID NO: 4. For example, the extracellular antigen binding domain of CAR (e.g., scFv) comprises V L, which comprises an amino acid sequence having about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity to the amino acid sequence of SEQ ID NO: 4. In certain embodiments, the extracellular antigen binding domain comprises V L , which comprises the amino acid sequence shown in SEQ ID NO: 4. SEQ ID NO: 4 is provided in Table 2 below.

[0187] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises the amino acid sequence shown in SEQ ID NO: 3, as shown in Table 2. In certain embodiments, the anti-CD371 scFv comprises V L , which comprises the amino acid sequence shown in SEQ ID NO: 4. In certain embodiments, the anti-CD371 scFv comprises V H , which comprises the amino acid sequence shown in SEQ ID NO: 3; and V L , which comprises the amino acid sequence shown in SEQ ID NO:4.

[0188] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 34 or a conservative modification thereof; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 35 or a conservative modification thereof; and V H CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 36 or a conservative modification thereof. SEQ ID NOs: 34-36 are provided in Table 2.

[0189] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 37 or a conservative modification thereof; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 38 or a conservative modification thereof; and V L CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 39 or a conservative modification thereof. SEQ ID NOs: 37-39 are provided in Table 2.

[0190] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 34 or a conservative modification thereof; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 35 or a conservative modification thereof; V H CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 36 or a conservative modification thereof; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 37 or a conservative modification thereof; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 38 or a conservative modification thereof; and V L CDR3 comprises the amino acid sequence shown in SEQ ID NO: 39 or a conservative modification thereof.

[0191] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 34; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 35; V H CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 36; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 37; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 38; and V L CDR3 comprises the amino acid sequence shown in SEQ ID NO:39.

[0192] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises the amino acid sequence shown in SEQ ID NO: 3; and V L , which comprises the amino acid sequence shown in SEQ ID NO: 4. In certain embodiments, V H and V L In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 13.

[0193] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one after another so that at the N-terminus of the extracellular antigen binding domain, a heavy chain variable region (V HIn certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V H -V L In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 108, which is provided in Table 2. In certain embodiments, the scFv is designated "C3H4L."

[0194] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one by one so that at the N-terminus of the extracellular antigen binding domain, a light chain variable region (V L In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V L -V H In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 17. In certain embodiments, the scFv is designated "C3L4H." An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 17 is set forth in SEQ ID NO: 23. SEQ ID NO: 17 and SEQ ID NO: 23 are provided in Table 2 below.

[0195] Table 2

[0196]

[0197] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises an amino acid sequence having at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homology or identity with the amino acid sequence shown in SEQ ID NO: 5. For example, the extracellular antigen binding domain of CAR (e.g., scFv) comprises V H , which comprises an amino acid sequence having about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity to the amino acid sequence of SEQ ID NO: 5. In certain embodiments, the extracellular antigen binding domain comprises V H , which comprises the amino acid sequence shown in SEQ ID NO: 5. SEQ ID NO: 5 is provided in Table 3 below.

[0198] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a VL , which comprises an amino acid sequence having at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homology or identity with the amino acid sequence shown in SEQ ID NO: 6. For example, the extracellular antigen binding domain of a CAR (e.g., scFv) comprises a V L , which comprises an amino acid sequence having about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity to the amino acid sequence of SEQ ID NO: 6. In certain embodiments, the extracellular antigen binding domain comprises V L , which comprises the amino acid sequence shown in SEQ ID NO: 6. SEQ ID NO: 6 is provided in Table 3 below.

[0199] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 40 or a conservative modification thereof; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 41 or a conservative modification thereof; and V H CDR3 comprising the amino acid sequence of SEQ ID NO: 42 or a conservative modification thereof. SEQ ID NOs: 40-42 are provided in Table 3.

[0200] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 43 or a conservative modification thereof; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 44 or a conservative modification thereof; and V L CDR3 comprising the amino acid sequence of SEQ ID NO: 45 or a conservative modification thereof. SEQ ID NOs: 43-45 are provided in Table 3.

[0201] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 40 or a conservative modification thereof; V H CDR2 comprises the amino acid sequence shown in SEQ ID NO: 41 or a conservative modification thereof; V HCDR3, which comprises the amino acid sequence shown in SEQ ID NO: 42 or a conservative modification thereof; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 43 or a conservative modification thereof; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 44 or a conservative modification thereof; and V L CDR3 comprises the amino acid sequence shown in SEQ ID NO: 45 or a conservative modification thereof.

[0202] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO:40; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO:41; V H CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 42; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 43; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 44; and V L CDR3 comprises the amino acid sequence shown in SEQ ID NO:45.

[0203] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises the amino acid sequence shown in SEQ ID NO: 5; and V L , which comprises the amino acid sequence shown in SEQ ID NO: 6. In certain embodiments, V H and V L In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 13.

[0204] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one after another so that at the N-terminus of the extracellular antigen binding domain, a heavy chain variable region (V H In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V H -V L In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 109, which is provided in Table 3. In certain embodiments, the scFv is designated "D6H4L."

[0205] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one by one so that at the N-terminus of the extracellular antigen binding domain, a light chain variable region (V L In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V L -V H In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 18. In certain embodiments, the scFv is designated "D6L4H." An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 18 is set forth in SEQ ID NO: 24. SEQ ID NO: 18 and SEQ ID NO: 24 are provided in Table 3 below.

[0206] Table 3

[0207]

[0208]

[0209] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises an amino acid sequence having at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homology or identity with the amino acid sequence shown in SEQ ID NO: 7. For example, the extracellular antigen binding domain of a CAR (e.g., scFv) comprises a V H , which comprises an amino acid sequence having about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity to the amino acid sequence of SEQ ID NO: 7. In certain embodiments, the extracellular antigen binding domain comprises V H , which comprises the amino acid sequence shown in SEQ ID NO: 7. SEQ ID NO: 7 is provided in Table 4 below.

[0210] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V L , which comprises an amino acid sequence having at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homology or identity with the amino acid sequence shown in SEQ ID NO: 8. For example, the extracellular antigen binding domain of a CAR (e.g., scFv) comprises a V L, which comprises an amino acid sequence having about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity to the amino acid sequence of SEQ ID NO: 8. In certain embodiments, the extracellular antigen binding domain comprises V L , which comprises the amino acid sequence shown in SEQ ID NO: 8. SEQ ID NO: 8 is provided in Table 4 below.

[0211] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 46 or a conservative modification thereof; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 47 or a conservative modification thereof; and V H CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 48 or a conservative modification thereof. SEQ ID NOs: 46-48 are provided in Table 4.

[0212] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 49 or a conservative modification thereof; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 50 or a conservative modification thereof; and V L CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 51 or a conservative modification thereof. SEQ ID NOs: 49-51 are provided in Table 4.

[0213] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 46 or a conservative modification thereof; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 47 or a conservative modification thereof; V H CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 48 or a conservative modification thereof; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 49 or a conservative modification thereof; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 50 or a conservative modification thereof; and VL CDR3 comprises the amino acid sequence shown in SEQ ID NO: 51 or a conservative modification thereof.

[0214] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 46; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 47; V H CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 48; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 49; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 50; and V L CDR3 comprises the amino acid sequence shown in SEQ ID NO:51.

[0215] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises the amino acid sequence shown in SEQ ID NO: 7; and V L , which comprises the amino acid sequence shown in SEQ ID NO: 8. In certain embodiments, V H and V L In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 13.

[0216] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one after another so that at the N-terminus of the extracellular antigen binding domain, a heavy chain variable region (V H In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V H -V L In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 110, which is provided in Table 4. In certain embodiments, the scFv is designated "A11H4L."

[0217] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one by one so that at the N-terminus of the extracellular antigen binding domain, a light chain variable region (V L In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: VL -V H In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 19. In certain embodiments, the scFv is designated "A11L4H." An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 19 is set forth in SEQ ID NO: 25. SEQ ID NO: 19 and SEQ ID NO: 25 are provided in Table 4 below.

[0218] Table 4

[0219]

[0220] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises an amino acid sequence having at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homology or identity with the amino acid sequence shown in SEQ ID NO: 9. For example, the extracellular antigen binding domain of a CAR (e.g., scFv) comprises a V H , which comprises an amino acid sequence having about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity to the amino acid sequence of SEQ ID NO: 9. In certain embodiments, the extracellular antigen binding domain comprises V H , which comprises the amino acid sequence shown in SEQ ID NO: 9. SEQ ID NO: 9 is provided in Table 5 below.

[0221] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V L , which comprises an amino acid sequence having at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homology or identity with the amino acid sequence shown in SEQ ID NO: 10. For example, the extracellular antigen binding domain of CAR (e.g., scFv) comprises V L , which comprises an amino acid sequence having about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity to the amino acid sequence of SEQ ID NO: 10. In certain embodiments, the extracellular antigen binding domain comprises V L, which comprises the amino acid sequence shown in SEQ ID NO: 10. SEQ ID NO: 10 is provided in Table 5 below.

[0222] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 52 or a conservative modification thereof; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 53 or a conservative modification thereof; and V H CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 54 or a conservative modification thereof. SEQ ID NOs: 52-54 are provided in Table 5.

[0223] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 55 or a conservative modification thereof; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 56 or a conservative modification thereof; and V L CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 57 or a conservative modification thereof. SEQ ID NOs: 55-57 are provided in Table 5.

[0224] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 52 or a conservative modification thereof; V H CDR2 comprises the amino acid sequence shown in SEQ ID NO: 53 or a conservative modification thereof; V H CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 54 or a conservative modification thereof; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 55 or a conservative modification thereof; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 56 or a conservative modification thereof; and V L CDR3 comprises the amino acid sequence shown in SEQ ID NO: 57 or a conservative modification thereof.

[0225] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 52; V HCDR2, which comprises the amino acid sequence shown in SEQ ID NO: 53; V H CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 54; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 55; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 56; and V L CDR3 comprises the amino acid sequence shown in SEQ ID NO:57.

[0226] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises the amino acid sequence shown in SEQ ID NO: 9; and V L , which comprises the amino acid sequence shown in SEQ ID NO: 10. In certain embodiments, V H and V L In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 13.

[0227] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one after another so that at the N-terminus of the extracellular antigen binding domain, a heavy chain variable region (V H In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V H -V L In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 111, which is provided in Table 5. In certain embodiments, the scFv is designated "E4H4L."

[0228] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one by one so that at the N-terminus of the extracellular antigen binding domain, a light chain variable region (V L In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V L -V H In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 20. In certain embodiments, the scFv is designated "E4L4H." An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 20 is set forth in SEQ ID NO: 26. SEQ ID NO: 20 and SEQ ID NO: 26 are provided in Table 5 below.

[0229] Table 5

[0230]

[0231]

[0232] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises an amino acid sequence having at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homology or identity with the amino acid sequence shown in SEQ ID NO: 11. For example, the extracellular antigen binding domain of CAR (e.g., scFv) comprises V H , which comprises an amino acid sequence having about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity to the amino acid sequence of SEQ ID NO: 11. In certain embodiments, the extracellular antigen binding domain comprises V H , which comprises the amino acid sequence shown in SEQ ID NO: 11. SEQ ID NO: 11 is provided in Table 6 below.

[0233] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V L , which comprises an amino acid sequence having at least about 80% (e.g., at least about 85%, at least about 90%, or at least about 95%) homology or identity with the amino acid sequence shown in SEQ ID NO: 12. For example, the extracellular antigen binding domain of CAR (e.g., scFv) comprises V L , which comprises an amino acid sequence having about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity to the amino acid sequence of SEQ ID NO: 12. In certain embodiments, the extracellular antigen binding domain comprises V L , which comprises the amino acid sequence set forth in SEQ ID NO: 12. SEQ ID NO: 12 is provided in Table 6 below.

[0234] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V HCDR1, which comprises the amino acid sequence shown in SEQ ID NO: 58 or a conservative modification thereof; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 59 or a conservative modification thereof; and V H CDR3 comprising the amino acid sequence of SEQ ID NO: 60 or a conservative modification thereof. SEQ ID NOs: 58-60 are provided in Table 6.

[0235] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 61 or a conservative modification thereof; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 62 or a conservative modification thereof; and V L CDR3 comprising the amino acid sequence set forth in SEQ ID NO: 63 or a conservative modification thereof. SEQ ID NOs: 61-63 are provided in Table 6.

[0236] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 58 or a conservative modification thereof; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 59 or a conservative modification thereof; V H CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 60 or a conservative modification thereof; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 61 or a conservative modification thereof; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 62 or a conservative modification thereof; and V L CDR3 comprises the amino acid sequence shown in SEQ ID NO: 63 or a conservative modification thereof.

[0237] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 58; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 59; V H CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 60; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 61; V LCDR2, which comprises the amino acid sequence shown in SEQ ID NO: 62; and V L CDR3 comprises the amino acid sequence shown in SEQ ID NO:63.

[0238] In certain embodiments, the extracellular antigen binding domain of the CAR (e.g., scFv) comprises a V H , which comprises the amino acid sequence shown in SEQ ID NO: 11; and V L , which comprises the amino acid sequence shown in SEQ ID NO: 12. In certain embodiments, V H and V L In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 13.

[0239] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one after another so that at the N-terminus of the extracellular antigen binding domain, a heavy chain variable region (V H In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V H -V L In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 112, which is provided in Table 6. In certain embodiments, the scFv is designated "E8H4L."

[0240] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one by one so that at the N-terminus of the extracellular antigen binding domain, a light chain variable region (V L In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V L -V H In certain embodiments, the scFv comprises the amino acid sequence set forth in SEQ ID NO: 21. In certain embodiments, the scFv is designated "E8L4H." An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 21 is set forth in SEQ ID NO: 27. SEQ ID NO: 21 and SEQ ID NO: 27 are provided in Table 6 below.

[0241] Table 6

[0242]

[0243]

[0244] As used herein, the term "conservative sequence modification" refers to amino acid modifications that do not significantly affect or change the binding characteristics of the mesothelin-targeting CAR (e.g., the extracellular antigen binding domain of CAR) comprising an amino acid sequence of the present disclosure. Conservative modifications may include amino acid substitutions, additions, and deletions. Modifications may be introduced into the extracellular antigen binding domain of the CAR of the present disclosure by standard techniques known in the art (e.g., site-directed mutagenesis and PCR-mediated mutagenesis). Amino acids can be divided into several groups according to their physicochemical properties (e.g., charge and polarity). Conservative amino acid substitutions are amino acid substitutions in which amino acid residues are replaced by amino acids in the same group. For example, amino acids can be classified by charge: positively charged amino acids include lysine, arginine, histidine, negatively charged amino acids include aspartic acid, glutamic acid, neutrally charged amino acids include alanine, asparagine, cysteine, glutamine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. In addition, amino acids can be classified by polarity: polar amino acids include arginine (basic polarity), asparagine, aspartic acid (acidic polarity), glutamic acid (acidic polarity), glutamine, histidine (basic polarity), lysine (basic polarity), serine, threonine and tyrosine; non-polar amino acids include alanine, cysteine, glycine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan and valine. Thus, one or more amino acid residues within a CDR region can be replaced with other amino acid residues from the same group, and the retained function of the altered antibody (i.e., the functions listed in (c) to (l) above) can be tested using the functional assays described herein. In certain embodiments, no more than one, no more than two, no more than three, no more than four, no more than five residues are changed within a given sequence or CDR region.

[0245] Relative to a specified sequence, a V sequence containing a V sequence that is at least about 80%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% (e.g., about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% homologous or identical to a specified sequence (e.g., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12) H and / or V LThe amino acid sequence may comprise substitutions (e.g., conservative substitutions), insertions, or deletions, but retains the ability to bind to a target antigen (e.g., mesothelin). In certain embodiments, a total of 1 to 10 amino acids are substituted, inserted, and / or deleted in a specified sequence (e.g., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12). In certain embodiments, the substitutions, insertions, or deletions occur in regions outside the CDRs of the extracellular antigen-binding domain (e.g., in the FRs). In certain embodiments, the extracellular antigen binding domain comprises a V selected from SEQ ID NO: 1-12 (including post-translational modifications of the sequences (SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, or SEQ ID NO: 12)). H and / or V L sequence.

[0246] As used herein, the percent homology between two amino acid sequences is equivalent to the percent identity between the two sequences. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % homology = number of identical positions # / total number of positions # × 100), taking into account the number of gaps and the length of each gap, which need to be introduced to achieve optimal alignment of the two sequences. Comparison of sequences and determination of the percent identity between two sequences can be accomplished using a mathematical algorithm.

[0247] The percent homology between two amino acid sequences can be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl. Biosci., 4: 11-17 (1988)), which has been incorporated into the ALIGN program (version 2.0), using the PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. In addition, the percent homology between two amino acid sequences can be determined using the Needleman and Wunsch (J. Mol. Biol. 48: 444-453 (1970)) algorithm, which has been incorporated into the GAP program in the GCG software package (available from www.gcg.com), using either the Blossum 62 matrix or the PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.

[0248] Additionally or alternatively, the amino acid sequences of the subject matter of the present disclosure can be further used as "query sequences" to search public databases, for example, to identify related sequences. Such searches can be performed using the XBLAST program (version 2.0) of Altschul et al. ((1990) J. Mol. Biol. 215: 403-10). BLAST protein searches can be performed using the XBLAST program with a score of 50 and a word length of 3 to obtain amino acid sequences homologous to the specified sequences disclosed herein (e.g., the heavy and light chain variable region sequences of scFv m903, m904, m905, m906, and m900). To obtain gapped alignments for comparison purposes, Gapped BLAST can be used as described in Altschul et al. (1997) Nucleic Acids Res. 25(17): 3389-3402. When using BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.

[0249] In certain embodiments, the extracellular antigen binding domain of the CAR of the present disclosure cross-competes for binding to CD371 (e.g., human CD371) with a reference antibody or antigen-binding fragment thereof comprising, for example, V of any one of the scFvs of the present disclosure (e.g., V10, C3, D6, A11, E4, and D8). H CDR1, CDR2 and CDR3 sequences and V LCDR1, CDR2 and CDR3 sequences. In certain embodiments, the extracellular antigen binding domain of the CAR of the present disclosure cross-competes with a reference antibody or its antigen binding portion for binding to CD371 (e.g., human CD371), the reference antibody or its antigen binding portion comprising, for example, V sequences of any one of the scFvs of the present disclosure (e.g., V10, C3, D6, A11, E4 and D8). H and V L sequence.

[0250] In certain embodiments, the extracellular antigen binding domain of the CAR of the present disclosure cross-competes for binding to CD371 (e.g., human CD371) with a reference antibody, or antigen binding portion thereof, comprising the V domain of scFv B10. H CDR1, CDR2 and CDR3 sequences and V L CDR1, CDR2 and CDR3 sequences. For example, the extracellular antigen binding domain of the CAR of the present disclosure cross-competes with a reference antibody or antigen binding portion thereof for binding to CD371 (e.g., human CD371), the reference antibody or antigen binding portion thereof comprising V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29; V H CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 30; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32; and V L CDR3 comprises the amino acid sequence shown in SEQ ID NO: 33. In certain embodiments, the extracellular antigen binding domain of the CAR of the present disclosure cross-competes with a reference antibody or its antigen binding portion for binding to CD371 (e.g., human CD371), the reference antibody or its antigen binding portion comprising the V domain of scFv B10. H and V L For example, the extracellular antigen binding domain of the CAR of the present disclosure cross-competes for binding to CD371 (e.g., human CD371) with a reference antibody or antigen binding portion thereof comprising V H , which comprises the amino acid sequence shown in SEQ ID NO: 1; and V L , which comprises the amino acid sequence shown in SEQ ID NO:2.

[0251] In certain embodiments, the extracellular antigen binding domain binds to the same epitope on CD371 (e.g., human CD371) as a reference antibody or its antigen binding portion. For example, the extracellular antigen binding domain of the CAR of the present disclosure binds to the same epitope on CD371 (e.g., human CD371) as a reference antibody or its antigen binding portion, the reference antibody or its antigen binding fragment comprising, for example, a V domain of any one of the scFvs of the present disclosure (e.g., B10, C3, D6, A11, E4, and E8). H CDR1, CDR2 and CDR3 sequences and V L CDR1, CDR2 and CDR3 sequences. In certain embodiments, the extracellular antigen binding domain of the CAR of the present disclosure binds to the same epitope on EMR2 (e.g., human EMR2) as a reference antibody or its antigen binding portion, the reference antibody or its antigen binding portion comprising, for example, the V domain of any one of the scFvs of the present disclosure (e.g., B10, C3, D6, A11, E4 and E8). H and V L sequence.

[0252] In certain embodiments, the extracellular antigen binding domain of the CAR of the present disclosure binds to the same epitope on CD371 (e.g., human CD371) as a reference antibody or antigen-binding fragment thereof comprising the V domain of scFvB10. H CDR1, CDR2 and CDR3 sequences and V L CDR1, CDR2 and CDR3 sequences. For example, the extracellular antigen binding domain of the CAR of the present disclosure binds to the same epitope on CD371 (e.g., human CD371) as a reference antibody or antigen binding fragment thereof, the reference antibody or antigen binding fragment thereof comprising V H CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28; V H CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29; V H CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 30; V L CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31; V L CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32; and V L CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 33. In certain embodiments, the extracellular antigen binding domain of the CAR of the present disclosure binds to the same or substantially the same epitope on CD371 (e.g., human CD371) as a reference antibody or its antigen-binding fragment, wherein the reference antibody or its antigen-binding fragment comprises the V domain of scFv B10. Hand V L For example, the extracellular antigen binding domain of the CAR of the present disclosure binds to the same epitope on CD371 (e.g., human CD371) as a reference antibody or antigen-binding fragment thereof, the reference antibody or antigen-binding fragment thereof comprising V H , which comprises the amino acid sequence shown in SEQ ID NO: 1; and V L , which comprises the amino acid sequence shown in SEQ ID NO:2.

[0253] Extracellular antigen binding domains that cross-compete or compete for binding to CD371 (e.g., human CD371) with a reference antibody or antigen-binding portion thereof can be identified using conventional methods known in the art, including, but not limited to, ELISA, radioimmunoassay (RIA), Biacore, flow cytometry, Western blot, and any other suitable quantitative or qualitative antibody binding assay. Competition ELISA is described in Morris, "Epitope Mapping of Protein Antigens by Competition ELISA", The Protein Protocols Handbook (1996), pp 595-600, J. Walker, which is incorporated by reference in its entirety. In certain embodiments, the antibody binding assay comprises measuring initial binding of a reference antibody to a CD371 polypeptide, mixing the reference antibody with the test extracellular antigen binding domain, and measuring a second binding of the reference antibody to the CD371 polypeptide. The presence of the test extracellular antigen binding domain is tested, and the initial binding of the reference antibody is compared to the second binding, wherein a reduction in the second binding of the reference antibody to the CD371 polypeptide compared to the initial binding indicates that the test extracellular antigen binding domain cross-competes with the reference antibody for binding to CD371, e.g., the antibodies recognize the same or substantially the same epitope, overlapping epitopes, or adjacent epitopes. In certain embodiments, the reference antibody is labeled, for example, with a fluorescent dye, biotin, or peroxidase. In certain embodiments, the CD371 polypeptide is expressed in cells, e.g., in a flow cytometry assay. In certain embodiments, the CD371 polypeptide is immobilized on a surface, including on a Biacore ship (e.g., in a Biacore assay), or on other media suitable for surface plasmon resonance analysis. Binding of the reference antibody in the presence of a completely unrelated antibody (that does not bind to CD371) can serve as a control high value. A control low value can be obtained by incubating a labeled reference antibody with an unlabeled reference antibody, where competition and reduced binding of the labeled reference antibody will occur. In certain embodiments, a test extracellular antigen-binding domain that reduces binding of a reference antibody to a CD371 polypeptide by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% is considered to cross-compete with the reference antibody for binding to CD371. In certain embodiments, the assay is performed at room temperature.

[0254] In certain embodiments, the antibody binding assay comprises measuring the initial binding of the test extracellular antigen-binding domain to the CD371 polypeptide, mixing the test extracellular antigen-binding domain with a reference antibody, measuring the second binding of the test extracellular antigen-binding domain to the CD371 polypeptide in the presence of the reference antibody, and comparing the initial binding of the test extracellular antigen-binding domain to the second binding, wherein a decrease in the second binding of the test extracellular antigen-binding domain to the CD371 polypeptide compared to the initial binding indicates that the test extracellular antigen-binding domain cross-competes with the reference antibody for binding to CD371, such as where the reference antibody recognizes the same or substantially the same epitope, overlapping epitope, or adjacent epitope. In certain embodiments, the test extracellular antigen-binding domain is labeled, for example, with a fluorescent dye, biotin, or peroxidase. In certain embodiments, the CD371 polypeptide is expressed in a cell, such as in a flow cytometry assay. In certain embodiments, the CD371 polypeptide is immobilized on a surface, including on a Biacore ship (e.g., in a Biacore assay), or on other media suitable for surface plasmon resonance analysis. In the presence of a completely unrelated antibody (not bound to CD371), the binding of the test extracellular antigen-binding domain can be used as a control high value. A control low value can be obtained by incubating a labeled test extracellular antigen-binding domain with an unlabeled test extracellular antigen-binding domain, where competition and binding reduction of the labeled test extracellular antigen-binding domain will occur. In certain embodiments, in the presence of a reference antibody, the binding of the test extracellular antigen-binding domain to the CD371 polypeptide is reduced by at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or at least about 95% and is considered to be cross-competing with the reference antibody for binding to the extracellular antigen-binding domain of CD371. In certain embodiments, the assay is performed at room temperature.

[0255] In certain non-limiting embodiments, the extracellular antigen-binding domain of the CAR of the present disclosure comprises a linker connecting the heavy chain variable region and the light chain variable region of the extracellular antigen-binding domain. In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 13. In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 14. In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 91. In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 92. In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 93. In certain embodiments, the linker comprises the amino acid sequence shown in SEQ ID NO: 94.

[0256] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one after another so that at the N-terminus of the extracellular antigen binding domain, a heavy chain variable region (V H In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V H -V L .

[0257] In certain embodiments, the variable regions within the extracellular antigen binding domain of the CAR must be linked one by one so that at the N-terminus of the extracellular antigen binding domain, a light chain variable region (V L In certain embodiments, if the extracellular antigen binding domain of the CAR is a scFv, the variable region positions from N-terminus to C-terminus are: V L -V H .

[0258] In addition, the extracellular antigen-binding domain may include a leader peptide or signal peptide that guides the nascent protein into the endoplasmic reticulum. If CAR is to be glycosylated and anchored in the cell membrane, a signal peptide or leader peptide may be essential. The signal sequence or leader sequence can be a peptide sequence (about 5, about 10, about 15, about 20, about 25 or about 30 amino acids long) present in the N-terminus of the newly synthesized protein, guiding them to enter the secretory pathway. In certain embodiments, the signal peptide is covalently linked to the 5' end of the extracellular antigen-binding domain. In certain embodiments, the signal peptide includes a CD8 polypeptide, for example, CAR includes a truncated CD8 signal peptide.

[0259] 5.3.2.2. CAR transmembrane domain

[0260] In certain non-limiting embodiments, the transmembrane domain of CAR comprises a hydrophobic alpha helix that spans at least a portion of the membrane. Different transmembrane domains result in different receptor stabilities. After antigen recognition, the receptors aggregate and transmit signals to cells. According to the subject matter of the present disclosure, the transmembrane domain of CAR may comprise a natural or modified transmembrane domain of CD8 or a fragment thereof, a natural or modified transmembrane domain of CD28 or a fragment thereof, a natural or modified transmembrane domain of CD3ζ or a fragment thereof, a natural or modified transmembrane domain of CD4 or a fragment thereof, a natural or modified transmembrane domain of 4-1BB or a fragment thereof, a natural or modified transmembrane domain of OX40 or a fragment thereof, a natural or modified transmembrane domain of ICOS or a fragment thereof, a natural or modified transmembrane domain of CD84 or a fragment thereof. or a fragment thereof, a native or modified transmembrane domain of CD166 or a fragment thereof, a native or modified transmembrane domain of CD8a or a fragment thereof, a native or modified transmembrane domain of CD8b or a fragment thereof, a native or modified transmembrane domain of ICAM-1 or a fragment thereof, a native or modified transmembrane domain of CTLA-4 or a fragment thereof, a native or modified transmembrane domain of CD27 or a fragment thereof, a native or modified transmembrane domain of CD40 or a fragment thereof, NKGD2 or a fragment thereof, or a combination thereof.

[0261] In certain embodiments, the transmembrane domain of the CAR comprises a CD8 polypeptide (e.g., a transmembrane domain of CD8 or a fragment thereof).

[0262] In certain embodiments, the transmembrane domain of CAR comprises a CD8 polypeptide (e.g., a transmembrane domain of CD8 or a fragment thereof). In certain embodiments, the transmembrane domain of CAR comprises a CD8 polypeptide (e.g., a transmembrane domain of human CD8 or a fragment thereof). In certain embodiments, the CD8 polypeptide comprises an amino acid sequence or fragment thereof having at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity with an amino acid sequence having NCBI reference number: NP_001139345.1 (SEQ ID NO: 64), or consists of, and / or may optionally comprise at most one or at most two or at most three conservative amino acid substitutions. In certain embodiments, the CD8 polypeptide comprises or consists of an amino acid sequence that is a continuous portion of SEQ ID NO: 64, which is at least 20, or at least 30, or at least 40, or at least 50 and at most 235 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, the CD8 polypeptide comprises or consists of an amino acid sequence of amino acids 1 to 235, 1 to 50, 50 to 100, 100 to 150, 150 to 200, 137 to 209, or 200 to 235 of SEQ ID NO: 64. In certain embodiments, the transmembrane domain of the CAR comprises a CD8 polypeptide comprising or consisting of amino acids 137 to 209 of SEQ ID NO: 64. SEQ ID NO: 64 is provided below.

[0263]

[0264] In certain embodiments, the transmembrane domain of CAR includes a CD8 polypeptide (e.g., a transmembrane domain of mouse CD8 or a fragment thereof). In certain embodiments, the CD8 polypeptide includes an amino acid sequence with NCBI reference number: AAA92533.1 (SEQ ID NO: 65) having at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity, or a fragment thereof, or consisting of it, and / or can optionally include at most one or at most two or at most three conservative amino acid substitutions. In certain embodiments, the CD8 polypeptide includes or consists of an amino acid sequence that is a continuous portion of SEQ ID NO: 65, which is at least 20, or at least 30, or at least 40, or at least 50, or at least 60, or at least 70, or at least 100, or at least 200 and at most 247 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, the CD8 polypeptide comprises or consists of an amino acid sequence of amino acids 1 to 247, 1 to 50, 50 to 100, 100 to 150, 150 to 200, 151 to 219, or 200 to 247 of SEQ ID NO: 65. In certain embodiments, the transmembrane domain of the CAR comprises a CD8 polypeptide comprising or consisting of amino acids 151 to 219 of SEQ ID NO: 65. SEQ ID NO: 65 is provided below.

[0265]

[0266] In certain embodiments, the transmembrane structure of the CAR of the present disclosure comprises a CD28 polypeptide (e.g., a transmembrane domain of CD28 or a fragment thereof).

[0267] In certain embodiments, the transmembrane domain of CAR includes a CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a fragment thereof). In certain embodiments, the CD28 polypeptide includes an amino acid sequence with NCBI reference number: NP_006130 (SEQ ID NO: 66) having at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity, or a fragment thereof, or consisting thereof, and / or can optionally include at most one or at most two or at most three conservative amino acid substitutions. In certain embodiments, the CD28 polypeptide includes or consists of an amino acid sequence that is a continuous portion of SEQ ID NO: 66, which is at least 20, or at least 30, or at least 40, or at least 50 and at most 220 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence of amino acids 1 to 220, 1 to 50, 50 to 100, 100 to 150, 150 to 200, 153 to 179, or 200 to 220 of SEQ ID NO: 66. In certain embodiments, the transmembrane domain of the CAR comprises a CD28 polypeptide comprising or consisting of amino acids 153 to 179 of SEQ ID NO: 66. SEQ ID NO: 66 is provided below:

[0268]

[0269] An exemplary nucleotide sequence encoding amino acids 153 to 179 of SEQ ID NO:66 is set forth in SEQ ID NO:67, which is provided below.

[0270]

[0271] In certain embodiments, the transmembrane domain of CAR includes a CD28 polypeptide (e.g., a transmembrane domain of mouse CD28 or a fragment thereof). In certain embodiments, the CD28 polypeptide includes an amino acid sequence with NCBI reference number: NP_031668.3 (SEQ ID NO: 68) having at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99% or about 100% homology or identity, or a fragment thereof, or consisting of it, and / or can optionally include at most one or at most two or at most three conservative amino acid substitutions. In certain embodiments, the CD28 polypeptide includes or consists of an amino acid sequence that is a continuous portion of SEQ ID NO: 66, which is at least 20, or at least 30, or at least 40, or at least 50 and at most 218 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence of amino acids 1 to 220, 1 to 50, 50 to 100, 100 to 150, 150 to 200, 151 to 177, or 200 to 218 of SEQ ID NO: 68. In certain embodiments, the transmembrane domain of the CAR comprises a CD28 polypeptide comprising or consisting of amino acids 151 to 177 of SEQ ID NO: 68. SEQ ID NO: 68 is provided below:

[0272]

[0273] In certain non-limiting embodiments, CAR may further include a spacer connecting the extracellular antigen binding domain to the transmembrane domain. The spacer may be flexible enough to allow the antigen binding domain to be oriented in different directions to facilitate antigen recognition while retaining the activation activity of CAR.

[0274] In certain embodiments, the hinge / spacer region of the CAR comprises a native or modified hinge region or a fragment thereof of CD8, a native or modified hinge region or a fragment thereof of CD28, a native or modified hinge region or a fragment thereof of CD3ζ, a native or modified hinge region or a fragment thereof of CD40, a native or modified hinge region or a fragment thereof of 4-1BB, a native or modified hinge region or a fragment thereof of OX40, a native or modified hinge region or a fragment thereof of CD84, a native or modified hinge region or a fragment thereof of CD166, a native or modified hinge region or a fragment thereof of CD8a. a natural or modified hinge region or fragment thereof, a natural or modified hinge region or fragment thereof of α-AKTA ... The hinge / spacer can be a hinge region from IgG1, or a portion of the CH2CH3 region of an immunoglobulin and CD3, a portion of a CD28 polypeptide (e.g., a portion of SEQ ID NO: 66 or SEQ ID NO: 68), a portion of a CD8 polypeptide (e.g., a portion of SEQ ID NO: 64 or SEQ ID NO: 65), a variant of any of the foregoing having at least about 80%, at least about 85%, at least about 90%, at least about 95% or at least about 100% homology or identity thereto, or a synthetic spacer sequence.

[0275] 5.3.2.3. Intracellular Signaling Domain of CAR

[0276] In certain embodiments, CAR includes an intracellular signaling domain. In certain non-limiting embodiments, the intracellular signaling domain of CAR includes a CD3 ζ polypeptide, and CD3 ζ can activate or stimulate cells (e.g., cells of lymphoid lineage, such as T cells). Wild-type ("natural") CD3 ζ includes three functional immunoreceptor tyrosine-based activation motifs (ITAMs), three functional basic-rich stretch (BRS) regions (BRS1, BRS2, ​​and BRS3). CD3 ζ transmits activation signals to cells (e.g., cells of lymphoid lineage, such as T cells) after antigen binding. The intracellular signaling domain of the CD3 ζ-chain is the main transmitter of signals from endogenous TCR.

[0277] In certain embodiments, the intracellular signaling domain of the CAR comprises native CD3 zeta. In certain embodiments, the CD3 zeta polypeptide comprises or consists of an amino acid sequence having at least about 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, or about 100% homology or identity to the amino acid sequence of NCBI Reference No.: NP_932170 (SEQ ID NO: 69), or a fragment thereof, and / or may optionally comprise at most one, at most two, or at most three conservative amino acid substitutions. In certain non-limiting embodiments, the CD3 zeta polypeptide comprises or consists of an amino acid sequence that is a contiguous portion of SEQ ID NO: 69, which is at least 20, or at least 30, or at least 40, or at least 50 and at most 164 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, the CD3 zeta polypeptide comprises or consists of an amino acid sequence of amino acids 1 to 164, 1 to 50, 50 to 100, 52 to 164, 100 to 150, or 150 to 164 of SEQ ID NO: 69. In certain embodiments, the intracellular signaling domain of the CAR comprises a CD3 zeta polypeptide comprising or consisting of amino acids 52 to 164 of SEQ ID NO: 69. SEQ ID NO: 69 is provided below:

[0278]

[0279] In certain embodiments, the intracellular signaling domain of the CAR comprises a CD3 polypeptide comprising or consisting of the amino acid sequence set forth in SEQ ID NO: 89. SEQ ID NO: 89 is provided below.

[0280]

[0281] An exemplary nucleotide sequence encoding the amino acid sequence of SEQ ID NO:89 is set forth in SEQ ID NO:90, which is provided below.

[0282]

[0283] In certain non-limiting embodiments, the intracellular signaling domain of the CAR further comprises at least one costimulatory signaling region. In certain embodiments, the costimulatory signaling region comprises at least one costimulatory molecule or a fragment thereof. In certain embodiments, the costimulatory signaling region comprises an intracellular domain of at least one costimulatory molecule or a fragment thereof.

[0284] As used herein, " co-stimulatory molecules " refer to cell surface molecules other than antigen receptors or their ligands, which can provide lymphocytes to effectively respond to antigens. In certain embodiments, co-stimulatory molecules can provide optimal lymphocyte activation. The limiting examples of co-stimulatory molecules include CD28, 4-1BB, OX40, ICOS, DAP-10, CD27, CD40, NKGD2, CD2, FN14, HVEM, LTBR, ​​CD28H, TNFR1, TNFR2, BAFF-R, BCMA, TACI, TROY, RANK, CD40, CD27, CD30, EDAR, XEDAR, GITR, DR6 and NGFR, and combinations thereof. Co-stimulatory molecules can be combined with co-stimulatory ligands, which are proteins expressed on the cell surface, which produce co-stimulatory responses after being bound to their receptors, i.e., when antigen recognition receptors (such as chimeric antigen receptors (CAR)) are combined with their target antigens, affecting the intracellular response of the stimulation provided. As an example, a 4-1BB ligand (i.e., 4-1BBL) can bind to 4-1BB to provide an intracellular signal that, in combination with the CAR signal, induces CAR + Effector cell functions of T cells.

[0285] In certain embodiments, the intracellular signaling domain of the CAR comprises a co-stimulatory signaling region comprising a CD28 polypeptide, such as an intracellular domain of CD28, or a fragment thereof. The CD28 polypeptide may comprise or have an amino acid sequence or fragment thereof having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homology or identity with the amino acid sequence shown in SEQ ID NO: 66, and / or may optionally comprise at most one, at most two, or at most three conservative amino acid substitutions. In certain non-limiting embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence that is a continuous portion of SEQ ID NO: 66, which is at least 20, or at least 30, or at least 40, or at least 50 and at most 220 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence of amino acids 1 to 220, 1 to 50, 50 to 100, 100 to 150, 114 to 220, 150 to 200, 180 to 220, or 200 to 220 of SEQ ID NO: 66. In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region comprising a CD28 polypeptide comprising or consisting of an amino acid sequence of amino acids 180 to 220 of SEQ ID NO: 66.

[0286] An exemplary nucleic acid sequence encoding amino acids 180 to 220 of SEQ ID NO:66 is set forth in SEQ ID NO:70, which is provided below.

[0287]

[0288] In certain embodiments, the CD28 polypeptide may comprise or consist of an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or at least about 100% homology or identity to the amino acid sequence set forth in SEQ ID NO: 68, or a fragment thereof, and / or may optionally comprise up to one, up to two, or up to three conservative amino acid substitutions. In certain non-limiting embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence that is a contiguous portion of SEQ ID NO: 68 that is at least about 20, or at least about 30, or at least about 40, or at least about 50 and up to 218 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, the CD28 polypeptide comprises or consists of an amino acid sequence of amino acids 1 to 218, 1 to 50, 50 to 100, 100 to 150, 150 to 218, 178 to 218, or 200 to 218 of SEQ ID NO: 68. In certain embodiments, the costimulatory signaling region of the CAR of the present disclosure comprises a CD28 polypeptide comprising or consisting of an amino acid sequence of amino acids 178 to 218 of SEQ ID NO: 68.

[0289] In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region comprising a 4-1BB polypeptide, such as an intracellular domain of 4-1BB, or a fragment thereof. The 4-1BB polypeptide may comprise an amino acid sequence having at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100% homology or identity to the amino acid sequence shown in NCBI Reference No.: NP_001552 (SEQ ID NO: 71), or a fragment thereof, or consist thereof, and / or may optionally comprise at most one, at most two, or at most three conservative amino acid substitutions. In certain non-limiting embodiments, the 4-1BB polypeptide comprises or consists of an amino acid sequence that is a continuous portion of SEQ ID NO: 71 and is at least 20, or at least 30, or at least 40, or at least 50, or at least 100, or at least 150, or at least 150 and at most 255 amino acids in length. Alternatively or additionally, in various non-limiting embodiments, the 4-1BB polypeptide comprises or consists of an amino acid sequence of amino acids 1 to 255, 1 to 50, 50 to 100, 100 to 150, 150 to 200, or 200 to 255 of SEQ ID NO: 71. In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region comprising a 4-1BB polypeptide comprising or consisting of an amino acid sequence of amino acids 214 to 255 of SEQ ID NO: 71. SEQ ID NO: 71 is provided below.

[0290]

[0291] An exemplary nucleic acid sequence encoding amino acids 214 to 255 of SEQ ID NO:71 is set forth in SEQ ID NO:72, which is provided below.

[0292]

[0293] In certain embodiments, the intracellular signaling domain of the CAR comprises a costimulatory signaling region comprising the intracellular domains or portions thereof of two or more costimulatory molecules, such as the intracellular domain of CD28 or a fragment thereof and the intracellular domain of 4-1BB or a fragment thereof, or the intracellular domain of CD28 or a fragment thereof and the intracellular domain of OX40 or a fragment thereof.

[0294] 5.3.2.4. Exemplary CAR

[0295] In certain embodiments, the CAR is a CAR targeting CD371. In certain embodiments, the CAR comprises (a) an extracellular antigen binding domain comprising (i) a VH , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 30, and (ii) V L , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32; and V L CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 33; (b) a transmembrane domain, which comprises a CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a fragment thereof), and (c) an intracellular signaling domain, which comprises (i) a CD3 zeta polypeptide, and (ii) a costimulatory signaling region, which comprises a CD28 polypeptide (e.g., an intracellular domain of human CD28 or a fragment thereof). In certain embodiments, V H and V L Connected via a linker comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 14. H and V L The positions from N-terminus to C-terminus are: V L -V H In certain embodiments, the CAR is designated as "Et.B10L3H_MT_h28Z." In certain embodiments, the CAR comprises the nucleotide sequence shown in SEQ ID NO: 73, which is provided below.

[0296]

[0297] An exemplary nucleic acid sequence of the amino acid sequence of SEQ ID NO:73 is set forth in SEQ ID NO:74, which is provided below.

[0298]

[0299]

[0300] In certain embodiments, the CAR is a CAR targeting CD371. In certain embodiments, the CAR comprises (a) an extracellular antigen binding domain comprising (i) a V H , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 30, and (ii) VL , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32; and V L CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 33; (b) a transmembrane domain, which comprises a CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a portion thereof), and (c) an intracellular signaling domain, which comprises (i) a CD3ζ polypeptide, and (ii) a costimulatory signaling region, which comprises a 4-1BB polypeptide (e.g., an intracellular domain of human 4-1BB or a portion thereof). In certain embodiments, V H and V L Connected via a linker comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 13. H and V L The positions from N-terminus to C-terminus are: V L -V H In certain embodiments, the CAR is designated as "Et.B10L4H_MT_hBBZ." In certain embodiments, the CAR comprises the nucleotide sequence shown in SEQ ID NO: 75, which is provided below.

[0301]

[0302] An exemplary nucleic acid sequence of the amino acid sequence of SEQ ID NO:75 is shown as SEQ ID NO:76, which is provided below.

[0303]

[0304]

[0305] In certain embodiments, the CAR is a CAR targeting CD371. In certain embodiments, the CAR comprises (a) an extracellular antigen binding domain comprising (i) a V H , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 30, and (ii) V L , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32; and V LCDR3, which comprises the amino acid sequence shown in SEQ ID NO: 33; (b) a transmembrane domain, which comprises a CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a portion thereof), and (c) an intracellular signaling domain, which comprises (i) a CD3 zeta polypeptide, and (ii) a costimulatory signaling region, which comprises a CD28 polypeptide (e.g., an intracellular domain of human CD28 or a portion thereof). In certain embodiments, V H and V L Connected via a linker comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 13. H and V L The positions from N-terminus to C-terminus are: V L -V H In certain embodiments, the CAR is designated as "Et.B10L4H_MT_h28Z." In certain embodiments, the CAR comprises the nucleotide sequence shown in SEQ ID NO: 77, which is provided below.

[0306]

[0307]

[0308] An exemplary nucleic acid sequence of the amino acid sequence of SEQ ID NO:77 is shown as SEQ ID NO:78, which is provided below.

[0309]

[0310]

[0311] In certain embodiments, the CAR is a CAR targeting CD371. In certain embodiments, the CAR comprises (a) an extracellular antigen binding domain comprising (i) a V H , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 30, and (ii) V L , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32; and V LCDR3, which comprises the amino acid sequence shown in SEQ ID NO: 33; (b) a transmembrane domain, which comprises a CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a portion thereof), and (c) an intracellular signaling domain, which comprises (i) a CD3 zeta polypeptide, and (ii) a costimulatory signaling region, which comprises a CD28 polypeptide (e.g., an intracellular domain of human CD28 or a portion thereof). In certain embodiments, V H and V L Connected via a linker comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 14. H and V L The positions from N-terminus to C-terminus are: V H -V L In certain embodiments, the CAR is designated as "Et.B10H3L_MT_h28Z." In certain embodiments, the CAR comprises the nucleotide sequence shown in SEQ ID NO: 79, which is provided below.

[0312]

[0313]

[0314] An exemplary nucleic acid sequence of the amino acid sequence of SEQ ID NO:79 is shown as SEQ ID NO:80, which is provided below.

[0315]

[0316] In certain embodiments, the CAR is a CAR targeting CD371. In certain embodiments, the CAR comprises (a) an extracellular antigen binding domain comprising (i) a V H , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 30, and (ii) V L , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32; and V LCDR3, which comprises the amino acid sequence shown in SEQ ID NO: 33; (b) a transmembrane domain, which comprises a CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a portion thereof), and (c) an intracellular signaling domain, which comprises (i) a CD3 zeta polypeptide, and (ii) a costimulatory signaling region, which comprises a CD28 polypeptide (e.g., an intracellular domain of human CD28 or a portion thereof). In certain embodiments, V H and V L Connected via a linker comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 13. H and V L The positions from N-terminus to C-terminus are: V H -V L In certain embodiments, the CAR is designated as "Et.B10H4L_MT_h28Z." In certain embodiments, the CAR comprises the nucleotide sequence shown in SEQ ID NO: 81, which is provided below.

[0317]

[0318] An exemplary nucleic acid sequence of the amino acid sequence of SEQ ID NO:81 is shown as SEQ ID NO:82, which is provided below.

[0319]

[0320]

[0321] In certain embodiments, the CAR is a CAR targeting CD371. In certain embodiments, the CAR comprises (a) an extracellular antigen binding domain comprising (i) a V H , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 34, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 35; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 36, and (ii) V L , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 37, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 38; and V LCDR3, which comprises the amino acid sequence set forth in SEQ ID NO: 39; (b) a transmembrane domain, which comprises a CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a portion thereof), and (c) an intracellular signaling domain, which comprises (i) a CD3 zeta polypeptide, and (ii) a costimulatory signaling region, which comprises a CD28 polypeptide (e.g., an intracellular domain of human CD28 or a portion thereof). In certain embodiments, V H and V L Connected via a linker comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 14. H and V L The positions from N-terminus to C-terminus are: V H -V L In certain embodiments, the CAR is designated as "Et.C3H3L_MT_h28Z." In certain embodiments, the CAR comprises the nucleotide sequence shown in SEQ ID NO: 83, which is provided below.

[0322]

[0323] An exemplary nucleic acid sequence of the amino acid sequence of SEQ ID NO:83 is set forth as SEQ ID NO:84, which is provided below.

[0324]

[0325]

[0326] In certain embodiments, the CAR is a CAR targeting CD371. In certain embodiments, the CAR comprises (a) an extracellular antigen binding domain comprising (i) a V H , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 34, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 35; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 36, and (ii) V L , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 37, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 38; and V L CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 39; (b) a transmembrane domain, which comprises CD28In certain embodiments, V H and V L Connected via a linker comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 14. H and V L The positions from N-terminus to C-terminus are: V L -V H In certain embodiments, the CAR is designated as "Et.C3L3H_MT_h28Z." In certain embodiments, the CAR comprises the nucleotide sequence shown in SEQ ID NO: 85, which is provided below.

[0327]

[0328] An exemplary nucleic acid sequence of the amino acid sequence of SEQ ID NO:85 is shown as SEQ ID NO:86, which is provided below.

[0329]

[0330]

[0331] In certain embodiments, the CAR is a CAR targeting CD371. In certain embodiments, the CAR comprises (a) an extracellular antigen binding domain comprising (i) a V H , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO:40, CDR2, which comprises the amino acid sequence shown in SEQ ID NO:41; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 42, and (ii) V L , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO:43, CDR2, which comprises the amino acid sequence shown in SEQ ID NO:44; and V L CDR3, which comprises the amino acid sequence set forth in SEQ ID NO: 45; (b) a transmembrane domain, which comprises a CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a portion thereof), and (c) an intracellular signaling domain, which comprises (i) a CD3 zeta polypeptide, and (ii) a costimulatory signaling region, which comprises a CD28 polypeptide (e.g., an intracellular domain of human CD28 or a portion thereof). In certain embodiments, V H and V LConnected via a linker comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 14. H and V L The positions from N-terminus to C-terminus are: V L -V H In certain embodiments, the CAQR is designated as "Et.D6L3H_MT_h28Z." In certain embodiments, the CAR comprises the nucleotide sequence shown in SEQ ID NO: 87, which is provided below.

[0332]

[0333] An exemplary nucleic acid sequence of the amino acid sequence of SEQ ID NO:87 is shown as SEQ ID NO:88, which is provided below.

[0334]

[0335]

[0336] In certain embodiments, the CAR is a CAR targeting CD371. In certain embodiments, the CAR comprises (a) an extracellular antigen binding domain comprising (i) a V H , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 30, and (ii) V L , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32; and V L CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 33; (b) a transmembrane domain, which comprises a CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a fragment thereof), and (c) an intracellular signaling domain, which comprises (i) a CD3 zeta polypeptide, and (ii) a costimulatory signaling region, which comprises a CD28 polypeptide (e.g., an intracellular domain of human CD28 or a fragment thereof). In certain embodiments, V H and V L Connected via a joint comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 93. H and V L The positions from N-terminus to C-terminus are: V H -V LIn certain embodiments, the CAR is designated as "Et.B10H1L_MT_h28Z." In certain embodiments, the CAR comprises the nucleotide sequence shown in SEQ ID NO: 95, which is provided below.

[0337]

[0338]

[0339] An exemplary nucleic acid sequence of the amino acid sequence of SEQ ID NO:95 is shown as SEQ ID NO:96, which is provided below.

[0340]

[0341]

[0342] In certain embodiments, the CAR is a CAR targeting CD371. In certain embodiments, the CAR comprises (a) an extracellular antigen binding domain comprising (i) a V H , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 30, and (ii) V L , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32; and V L CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 33; (b) a transmembrane domain, which comprises a CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a fragment thereof), and (c) an intracellular signaling domain, which comprises (i) a CD3 zeta polypeptide, and (ii) a costimulatory signaling region, which comprises a CD28 polypeptide (e.g., an intracellular domain of human CD28 or a fragment thereof). In certain embodiments, V H and V L Connected via a linker comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 94. H and V L The positions from N-terminus to C-terminus are: V H -V L In certain embodiments, the CAR is designated as "Et.B10H2L_MT_h28Z." In certain embodiments, the CAR comprises the nucleotide sequence shown in SEQ ID NO: 97, which is provided below.

[0343]

[0344] An exemplary nucleic acid sequence of the amino acid sequence of SEQ ID NO:97 is shown as SEQ ID NO:98, which is provided below.

[0345]

[0346] In certain embodiments, the CAR is a CAR targeting CD371. In certain embodiments, the CAR comprises (a) an extracellular antigen binding domain comprising (i) a V H , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 30, and (ii) V L , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32; and V L CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 33; (b) a transmembrane domain, which comprises a CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a fragment thereof), and (c) an intracellular signaling domain, which comprises (i) a CD3 zeta polypeptide, and (ii) a costimulatory signaling region, which comprises a CD28 polypeptide (e.g., an intracellular domain of human CD28 or a fragment thereof). In certain embodiments, V H and V L Connected via a linker comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 91. H and V L The positions from N-terminus to C-terminus are: V H -V L In certain embodiments, the CAR is designated as "Et.B10H5L_MT_h28Z." In certain embodiments, the CAR comprises the nucleotide sequence shown in SEQ ID NO: 99, which is provided below.

[0347]

[0348] An exemplary nucleic acid sequence of the amino acid sequence of SEQ ID NO: 99 is shown as SEQ ID NO: 100, which is provided below.

[0349]

[0350]

[0351] In certain embodiments, the CAR is a CAR targeting CD371. In certain embodiments, the CAR comprises (a) an extracellular antigen binding domain comprising (i) a V H , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 28, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 29; and V H CDR3 comprising the amino acid sequence shown in SEQ ID NO: 30, and (ii) V L , which comprises CDR1, which comprises the amino acid sequence shown in SEQ ID NO: 31, CDR2, which comprises the amino acid sequence shown in SEQ ID NO: 32; and V L CDR3, which comprises the amino acid sequence shown in SEQ ID NO: 33; (b) a transmembrane domain, which comprises a CD28 polypeptide (e.g., a transmembrane domain of human CD28 or a fragment thereof), and (c) an intracellular signaling domain, which comprises (i) a CD3 zeta polypeptide, and (ii) a costimulatory signaling region, which comprises a CD28 polypeptide (e.g., an intracellular domain of human CD28 or a fragment thereof). In certain embodiments, V H and V L Connected via a linker comprising or consisting of the nucleotide sequence shown in SEQ ID NO: 92. H and V L The positions from N-terminus to C-terminus are: V H -V L In certain embodiments, the CAR is designated as "Et.B10H6L_MT_h28Z." In certain embodiments, the CAR comprises the nucleotide sequence shown in SEQ ID NO: 101, which is provided below.

[0352]

[0353] An exemplary nucleic acid sequence of the amino acid sequence of SEQ ID NO: 101 is shown as SEQ ID NO: 102, which is provided below.

[0354]

[0355]

[0356] In certain embodiments, the CAR of the present disclosure further comprises an inducible promoter for expressing the nucleic acid sequence in human cells. The promoter for expressing the CAR gene can be a constitutive promoter, such as ubiquitin C (UbiC) promoter.

[0357] 5.3.3. TCR-like fusion molecules

[0358] In certain embodiments, antigen recognition receptor is a TCR-like fusion molecule. Non-limiting examples of TCR fusion molecules include HLA-independent TCR-based chimeric antigen receptors (also referred to as "HIT-CAR," such as those disclosed in International Patent Application No. PCT / US19 / 017525, which are incorporated herein by reference in their entirety) and T cell receptor fusion constructs (TRuC) (e.g., at Baeuerle et al., " Synthetic TRuC receptors engaging the complete T cellreceptor for potent anti-tumor response, " Nature Communications Vol. 10, Article No.: 2087 (2019) disclosed in those, which are incorporated herein by reference in their entirety).

[0359] In certain embodiments, the TCR-like fusion molecule comprises an antigen-binding chain comprising an extracellular antigen-binding domain and a constant domain, wherein the TCR-like fusion molecule binds to an antigen in an HLA-independent manner. In certain embodiments, the constant domain comprises a T cell receptor constant region selected from a natural or modified TRAC peptide, a natural or modified TRBC peptide, a natural or modified TRDC peptide, a natural or modified TRGC peptide, and any variant or functional fragment thereof. In certain embodiments, the constant domain comprises a natural or modified TRAC peptide. In certain embodiments, the constant domain comprises a natural or modified TRBC peptide. In certain embodiments, the constant domain is capable of forming a homodimer or heterodimer with another constant domain. In certain embodiments, the antigen-binding chain is capable of associating with a CD3 ζ polypeptide. In certain embodiments, the antigen-binding chain is capable of activating a CD3 ζ polypeptide bound to the antigen-binding chain after binding to the antigen. In certain embodiments, activation of the CD3 ζ polypeptide is capable of activating immune response cells. In certain embodiments, the TCR-like fusion molecule is capable of integrating with the CD3 complex and providing HLA-independent antigen recognition. In certain embodiments, the TCR sample fusion molecule replaces the endogenous TCR in the CD3 / TCR complex. In certain embodiments, the extracellular antigen-binding domain of the TCR sample fusion molecule can dimerize with another extracellular antigen-binding domain. In certain embodiments, the extracellular antigen-binding domain of the TCR sample fusion molecule comprises the ligand of cell surface receptor, the receptor of cell surface ligand, the antigen-binding portion thereof of antibody or its fragment or the antigen-binding portion thereof of TCR. In certain embodiments, the extracellular antigen-binding domain of the TCR sample fusion molecule comprises one or two immunoglobulin variable regions. In certain embodiments, the extracellular antigen-binding domain of the TCR sample fusion molecule comprises the heavy chain variable region (V H In certain embodiments, the extracellular antigen-binding domain of the TCR-like fusion molecule comprises the light chain variable region (V L In some embodiments, the extracellular antigen binding domain of a TCR-like fusion molecule is capable of dimerizing with another extracellular antigen binding domain. In some embodiments, the extracellular antigen binding domain of a TCR-like fusion molecule comprises a V domain of an antibody. H , where V H Able to react with antibodies containing V L In certain embodiments, the extracellular antigen binding domain of the TCR-like fusion molecule comprises the V domain of an antibody. L , where V L Able to react with antibodies containing V H The other extracellular antigen-binding domain of the mitochondria dimerizes to form the variable fragment (Fv).

[0360] TCR-like fusion molecules can bind to tumor antigens or pathogen antigens. In certain embodiments, TCR-like fusion molecules bind to tumor antigens.

[0361] 5.4. Cells

[0362] The subject matter of the present disclosure provides cells comprising an antigen recognition receptor targeting CD371 of the present disclosure (e.g., one disclosed in Section 5.3). In certain embodiments, the cells are selected from cells of the lymphoid lineage and cells of the myeloid lineage. In certain embodiments, the cells are immune response cells. In certain embodiments, the immune response cells are cells of the lymphoid lineage.

[0363] In some embodiments, the cell is a cell of the lymphoid lineage. The cell of the lymphoid lineage can provide the production of antibodies, the regulation of the cellular immune system, the detection of foreign substances in the blood, the detection of host foreign cells, etc. The non-limiting examples of cells of the lymphoid lineage include T cells, natural killer (NK) cells, B cells, dendritic cells, stem cells that can be differentiated into lymphoid cells. In some embodiments, the stem cell is a pluripotent stem cell (e.g., embryonic stem cell).

[0364] In certain embodiments, the cell is a T cell. T cells can be lymphocytes that mature in the thymus and are primarily responsible for cell-mediated immunity. T cells participate in the adaptive immune system. The T cells of the present disclosure can be any type of T cell, including but not limited to helper T cells, cytotoxic T cells, memory T cells (including central memory T cells, stem cell-like memory T cells (or stem-like memory T cells), and two types of effector memory T cells: for example, T cells. EM cells and T EMRA Cells), regulatory T cells (also called suppressor T cells), tumor infiltrating lymphocytes (TIL), natural killer T cells, mucosal-associated invariant T cells and γδ T cells. Cytotoxic T cells (CTL or killer T cells) are a subset of T lymphocytes that can induce the death of infected somatic cells or tumor cells. The patient's own T cells can be genetically modified to target specific antigens through the introduction of antigen recognition receptors (such as CAR or TCR). In certain embodiments, the immune response cells are T cells. T cells can be CD4 + T cells or CD8 + In some embodiments, the T cells are CD8 + T cells.

[0365] In certain embodiments, the cell is a NK cell. Natural killer (NK) cells can be lymphocytes, which are part of cell-mediated immunity and play a role in the innate immune response. NK cells do not require prior activation to perform cytotoxic effects on target cells.

[0366] The types of human lymphocytes of the presently disclosed subject matter include, but are not limited to, peripheral donor lymphocytes, such as those described in Sadelain et al., Nat Rev Cancer (2003); 3:35-45 (disclosing peripheral donor lymphocytes genetically modified to express CARs), in Morgan, RA et al., 2006 Science 314:126-129 (disclosing peripheral donor lymphocytes genetically modified to express a full-length tumor antigen-recognizing T cell receptor complex comprising α and β heterodimers), in Panelli, et al. J Immunol (2000); 164:495-504; Panelli, et al. J Immunol (2000); 164:4382-4392 (disclosing lymphocyte cultures derived from tumor infiltrating lymphocytes (TILs) in tumor biopsies), and in Dupont, et al. Cancer Res (2005): 65: 5417-5427; Papanicolaou, et al. Blood (2003): 102: 2498-2505 (selectively disclosing antigen-specific peripheral blood leukocytes expanded in vitro using artificial antigen presenting cells (AAPCs) or pulsed dendritic cells).

[0367] The cells (eg, T cells) can be autologous, non-autologous (eg, allogeneic), or derived in vitro from engineered progenitor or stem cells.

[0368] The cell of the present invention can be a cell of the bone marrow lineage. Non-limiting examples of bone marrow lineage cells include monocytes, macrophages, neutrophils, dendritic cells, basophils, neutrophils, eosinophils, megakaryocytes, mast cells, erythrocytes, platelets and stem cells that can be differentiated into bone marrow cells. In some embodiments, stem cell is a pluripotent stem cell (e.g., embryonic stem cell or induced pluripotent stem cell).

[0369] In certain embodiments, the cells of the present disclosure are capable of modulating the tumor microenvironment. Tumors have a microenvironment that is hostile to the host immune response, involving a series of mechanisms by which malignant cells protect themselves from immune recognition and elimination. This "hostile tumor microenvironment" contains a variety of immunosuppressive factors, including infiltrating regulatory CD4 +T cells (Tregs), myeloid-derived suppressor cells (MDSCs), tumor-associated macrophages (TAMs), immunosuppressive cytokines including TGF-b, and the expression of ligands targeting immunosuppressive receptors (CTLA-4 and PD-1) expressed by activated T cells. These immunosuppressive mechanisms play a role in maintaining tolerance and suppressing inappropriate immune responses, but within the tumor microenvironment, these mechanisms prevent effective anti-tumor immune responses. These immunosuppressive factors can jointly induce significant anergy or apoptosis of adoptively transferred CAR-modified T cells after encountering target tumor cells.

[0370] In certain embodiments, cells can be transduced with the CD371-targeting antigen recognition receptor of the present disclosure, such that the cells express the antigen recognition receptor.

[0371] In some embodiments, the cell further comprises a soluble single-chain variable fragment (scFv) that binds to a polypeptide having immunosuppressive activity or immunostimulatory activity. In some embodiments, immunosuppressive activity refers to changes in signal transduction or protein expression in induced cells (e.g., activated immune response cells), resulting in a reduced immune response. Polypeptides known to inhibit or reduce immune responses through their binding include CD47, PD-1, CTLA-4 and their corresponding ligands, including SIRPa, PD-L1, PD-L2, B7-1 and B7-2. This polypeptide is present in the tumor microenvironment and suppresses the immune response to tumor cells. In various embodiments, inhibiting, blocking or antagonizing the interaction of immunosuppressive polypeptides and / or their ligands enhances the immune response of immune response cells.

[0372] In certain embodiments, immunostimulatory activity refers to changes in signal transduction or protein expression in induced cells (e.g., activated immune response cells), thereby leading to an increase in immune response. Immunostimulatory activity can include proinflammatory activity. It is known that polypeptides that stimulate or increase immune response by their combination include CD28, OX-40, 4-IBB and their corresponding ligands, including B7-1, B7-2, OX-40L and 4-1BBL. Such polypeptides are present in the tumor microenvironment and activate the immune response to tumor cells. In various embodiments, promotion, stimulation or excitement of proinflammatory polypeptides and / or their ligands enhance the immune response of immune response cells.

[0373] Cells comprising an antigen recognition receptor (e.g., CAR) and a soluble scFv that binds a polypeptide having immunosuppressive or immunostimulatory activity are disclosed in International Patent Publication No. WO2014 / 134165, which is incorporated by reference in its entirety.

[0374] In certain embodiments, the cells further comprise exogenous CD40L. Cells comprising an antigen recognition receptor (eg, CAR) and exogenous CD40L are disclosed in International Patent Publication No. WO2014 / 134165.

[0375] Additionally, in certain embodiments, the cells are engineered to express IL-18. In certain embodiments, the cells further comprise an exogenous IL-18 polypeptide. In certain embodiments, the exogenous IL-18 polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 103 provided below.

[0376]

[0377] In certain embodiments, the cells further comprise a nucleic acid molecule encoding an IL-18 polypeptide. In certain embodiments, the nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO: 104 provided below.

[0378]

[0379] Alternatively, in certain embodiments, the cells further comprise a modified promoter / enhancer at the IL-18 locus that can increase IL-18 gene expression, for example, placing a constitutive or inducible promoter to drive IL-18 gene expression.

[0380] Cells comprising an antigen recognition receptor (e.g., CAR) and engineered to express IL-18, such as cells comprising an exogenous IL-18 polypeptide or a modified promoter / enhancer at the IL-18 locus, are disclosed in International Patent Publication No. WO2018 / 027155, which is incorporated herein by reference in its entirety.

[0381] Additionally or alternatively, the cells are engineered to express IL-33. In certain embodiments, the cells further comprise an exogenous IL-33 polypeptide. In certain embodiments, the exogenous IL-33 polypeptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 105 provided below.

[0382]

[0383] In certain embodiments, the cells further comprise a nucleic acid molecule encoding an IL-33 polypeptide. In certain embodiments, the nucleic acid molecule comprises the nucleotide sequence set forth in SEQ ID NO: 106 provided below.

[0384]

[0385] Alternatively, in certain embodiments, the cell further comprises a modified promoter / enhancer at the IL-33 locus that can increase IL-33 gene expression, for example, placing a constitutive or inducible promoter to drive IL-33 gene expression. Cells comprising an antigen recognition receptor (e.g., CAR) and engineered to express IL-33 (e.g., comprising an exogenous IL-33 polypeptide or a modified promoter / enhancer at the IL-33 locus) are disclosed in International Patent Publication No. WO2019 / 099479, which is incorporated by reference in its entirety.

[0386] Additionally or alternatively, cells are engineered to express IL-36. In certain embodiments, cells further comprise exogenous IL-36 polypeptides. In certain embodiments, cells further comprise modified promoters / enhancers at IL-36 loci, which can increase IL-36 gene expression, for example, constitutive or inducible promoters are placed to drive IL-36 gene expression. Antigen recognition receptors (for example, CAR) and engineered to express IL-36, for example, cells comprising exogenous IL-36 polypeptides or promoters / enhancers modified at IL-36 loci are disclosed in International Patent Publication No. WO2019 / 099483, which are incorporated herein by reference in their entirety.

[0387] 5.5. Compositions and carriers

[0388] The presently disclosed subject matter provides compositions comprising a disclosed antigen recognition receptor targeting CD371 (e.g., one disclosed in Section 5.3). Also provided are cells comprising such compositions.

[0389] In certain embodiments, the antigen recognition receptor targeting CD371 of the present disclosure is operably linked to a promoter.

[0390] In addition, the subject matter of the present disclosure provides a nucleic acid composition comprising a polynucleotide encoding an antigen recognition receptor targeting CD371 of the present disclosure (eg, one disclosed in Section 5.3). Cells comprising such a nucleic acid composition are also provided.

[0391] In certain embodiments, the nucleic acid composition further comprises a promoter operably linked to the antigen recognition receptor targeting CD371 of the present disclosure.

[0392] In some embodiments, the promoter is endogenous or exogenous. In some embodiments, the exogenous promoter is selected from elongation factor (EF) -1 promoter, cytomegalovirus immediate early promoter (CMV) promoter, simian virus 40 early promoter (SV40) promoter, phosphoglycerate kinase (PGK) promoter and metallothionein promoter. In some embodiments, the promoter is an inducible promoter. In some embodiments, the inducible promoter is selected from NFAT transcription response element (TRE) promoter, CD69 promoter, CD25 promoter and IL-2 promoter.

[0393] Compositions and nucleic acid compositions can be applied to a subject or and / or delivered to a cell by methods known in the art or as described herein. The genetic modification of a cell (for example, a T cell or a NK cell) can be accomplished by transducing a substantially homogeneous cell composition with a recombinant DNA construct. In certain embodiments, a retroviral vector (for example a gamma-retroviral vector or a slow virus vector) is used to introduce a DNA construct into a cell. For example, the polynucleotide encoding the antigen recognition receptor can be cloned into a retroviral vector, and expression can be driven from its endogenous promoter, a retroviral long terminal repeat sequence, or a promoter specific to the target cell type of interest. Non-viral vectors can also be used.

[0394] For the initial genetic modification of cells to include the antigen recognition receptors (for example, CAR or TCR) of the targeting CD371 of the present disclosure, retroviral vectors can be used for transduction, but any other suitable viral vectors or non-viral delivery systems can be used. Antigen recognition receptors can be constructed in a single polycistronic expression cassette, multiple expression cassettes of a single vector or multiple vectors. The example of the element producing a polycistronic expression cassette includes but is not limited to various viral and non-viral internal ribosome entry sites (IRES, for example, FGF-1IRES, FGF-2IRES, VEGF IRES, IGF-II IRES, NF-κB IRES, RUNX1IRES, p53 IRES, hepatitis A IRES, hepatitis C IRES, pestivirus IRES, no baculovirus IRES, picornavirus IRES, poliovirus IRES and encephalomyocarditis virus IRES) and cleavable linkers (such as 2A peptides, such as P2A, T2A, E2A and F2A peptides). Combinations of retroviral vectors and suitable packaging lines are also suitable, wherein the capsid protein will have the function of infecting human cells. Various cell lines that produce amphoteric viruses are known, including but not limited to PA12 (Miller et al., (1985) Mol Cell Biol (1985); 5: 431-437); PA317 (Miller et al., Mol Cell Biol (1986); 6: 2895-2902); and CRIP (Danos et al., Proc Natl Acad Sci USA (1988); 85: 6460-6464). Non-amphoteric particles are also suitable, for example, particles with VSVG, RD114 or GALV envelopes and any other pseudotyped particles known in the art.

[0395] Possible transduction methods also include direct co-cultivation of cells with producer cells (Bregni et al. Blood (1992); 80: 1418-1422), or culturing with viral supernatant alone or concentrated vector stocks with or without appropriate growth factors and polycations (Xu, et al. Exp. Hemat. (1994); 22: 223-230); and Hughes, et al. J. Clin. Invest. (1992); 89: 1817).

[0396] Other transduction virus vectors can be used to modify cells. In certain embodiments, the selected vectors exhibit high infection efficiency and stable integration and expression (see, e.g., Cayouette et al., Human Gene Therapy 8:423-430, 1997; Kido et al., Current Eye Research 15:833-844, 1996; Bloomer et al., Journal of Virology 71:6641-6649, 1997; Naldini et al., Science 272:263-267, 1996; and Miyoshi et al., Proc. Natl. Acad. Sci. USA 94:10319, 1997). Other viral vectors that can be used include, for example, adenovirus, lentivirus and adeno-associated virus vectors, vaccinia virus, bovine papilloma virus, or herpes virus, such as Epstein-Barr virus (see also, for example, Miller, Human Gene Thera (1990); 15-14; Friedman, Science 244:1275-1281, 1989; Eglitis et al., BioTechniques (1988); 6:608-614; Tolstoshev et al., Cur Opin Biotechnol (1990); 1:55-61; Sharp, The Lancet (1991); 337:1277-78; Cornetta et al., Nucleic Acid Research and Molecular Biology 36:311-22, 1987; Anderson, Science (1984); 226:401-409; Moen, Blood Cells 17:407-16, 1991; Miller et al., Biotechnol (1989); 7:980-90; LeGal La Salle et al., Science (1993); 259:988-90; and Johnson, Chest (1995) 107:77S-83S). Retroviral vectors are particularly well developed and have been used clinically (Rosenberg et al., N. Engl. J. Med (1990); 323:370, 1990; Anderson et al., U.S. Patent No. 5,399,346).

[0397] Non-viral methods can also be used for the genetic modification of cells. For example, nucleic acid molecules can be introduced into cells by administering nucleic acid in the presence of lipofection (Feigner et al., Proc Natl Acad Sci USA (1987); 84: 7413; Ono et al., Neurosci Lett (1990); 17: 259; Brigham et al., Am J Med Sci (1989); 298: 278; Staubinger et al., Methods in Enzymol (1983); 101: 512; Wu et al., J Biol Chem (1988); 263: 14621; Wu et al., J Biol Chem (1989); 264: 16985), or microinjection (Wolff et al., Science (1990) under surgical conditions; 247: 1465). Other non-viral gene transfer methods include in vitro transfection using calcium phosphate, DEAE dextran, electroporation and protoplast fusion. Liposomes may also be beneficial for DNA delivery to cells. It is also possible to complete the normal gene transplantation into the affected tissue of the experimenter by transferring normal nucleic acids to a cell type (for example, autologous or heterologous primary cells or their offspring) that can be cultured in vitro, after which the cell (or its offspring) is injected into the target tissue or systemically injected. Recombinant receptors can also be derived or obtained using transposases or targeted nucleases (such as zinc finger nucleases, meganucleases or TALE nucleases, CRISPR). Transient expression can be obtained by RNA electroporation.

[0398] Any targeted genome editing method can also be used to deliver the antigen recognition receptors of the present disclosure to cells or subjects. In certain embodiments, the CRISPR system is used to deliver the antigen recognition receptors of the present disclosure disclosed herein. In certain embodiments, zinc finger nucleases are used to deliver the antigen recognition receptors of the present disclosure. In certain embodiments, the TALEN system is used to deliver the antigen recognition receptors of the present disclosure.

[0399] The clustered regularly interspaced short palindromic repeats (CRISPR) system is a genome-editing tool found in prokaryotic cells. When used for genome editing, the system consists of Cas9 (a protein capable of modifying DNA using crRNA as its guide), CRISPR RNA (crRNA, containing the RNA that Cas9 uses to guide it to the correct section of host DNA, and a region (usually in the form of a hairpin loop) that binds to tracrRNA, forming an active complex with Cas9), a transactivating crRNA (tracrRNA, which binds to the crRNA and forms an active complex with Cas9), and an optional segment of a DNA repair template (DNA that directs the cellular repair process, allowing the insertion of a specific DNA sequence). CRISPR / Cas9 is typically transfected into target cells using a plasmid. The crRNA must be designed specifically for each application, as it is the sequence that Cas9 uses to recognize and directly bind to the target DNA in the cell. The repair template carrying the CAR expression cassette also requires specific design, as it must overlap with the sequences on either side of the cut and encode the insertion sequence. Multiple crRNAs and tracrRNAs can be packaged together to form a single guide RNA (sgRNA). The sgRNA can be linked to the Cas9 gene and made into a plasmid for transfection into cells.

[0400] Zinc finger nuclease (ZFN) is an artificial restriction enzyme produced by combining a zinc finger DNA binding domain with a DNA cleavage domain. The zinc finger domain can be engineered to target a specific DNA sequence, which allows the zinc finger nuclease to target the desired sequence within the genome. The DNA binding domain of each ZFN typically contains multiple independent zinc finger repeats, and each can recognize multiple base pairs. The most common method to generate new zinc finger domains is to combine smaller zinc finger "modules" of known specificity. The most common cleavage domain in ZFN is the non-specific cleavage domain from the type II restriction endonuclease FokI. Using the endogenous homologous recombination (HR) machinery and a homologous DNA template with a CAR expression cassette, ZFN can be used to insert the CAR expression cassette into the genome. After the target sequence is cleaved by the ZFN enzyme, the HR machinery searches for homology between the damaged chromosome and the homologous DNA template, and then copies the sequence of the template between the two broken ends of the chromosome, thereby integrating the homologous DNA template into the genome.

[0401] Transcription activator-like effector nucleases (TALENs) are restriction enzymes that can be engineered to cut specific sequences of DNA. The TALEN system works almost identically to ZFNs. They are produced by combining a transcription activator-like effector DNA binding domain with a DNA cleavage domain. Transcription activator-like effectors (TALEs) consist of a 33-34 amino acid repeat motif with two variable positions that have strong recognition for specific nucleotides. By assembling an array of these TALEs, the TALE DNA binding domain can be engineered to bind to the desired DNA sequence, thereby directing the nuclease to cut a specific location in the genome. cDNA expression for polynucleotide therapy can be directed from any suitable promoter (e.g., human cytomegalovirus (CMV), simian virus 40 (SV40), or metallothionein promoter) and regulated by any appropriate mammalian regulatory element or intron (e.g., elongation factor 1a enhancer / promoter / intron structure). For example, if desired, enhancers known to preferentially direct gene expression in specific cell types can be used to direct the expression of nucleic acids. The enhancers used may include, but are not limited to, those characterized as tissue- or cell-specific enhancers. Alternatively, if a genomic clone is used as a therapeutic construct, regulation may be mediated by homologous regulatory sequences or, if desired, by heterologous regulatory sequences derived from any of the promoters or regulatory elements described above.

[0402] The method for delivering genome editing agent / system can be changed as needed. In some embodiments, the component of the genome editing method of selection is delivered as a DNA construct in one or more plasmids. In some embodiments, the component is delivered by a viral vector. Common delivery methods include but are not limited to electroporation, microinjection, gene gun, puncture (impalefection), hydrostatic pressure, continuous infusion, ultrasonic treatment, magnetic transfection, adeno-associated virus, viral vector envelope protein pseudotype, replicable carrier cis and trans elements, herpes simplex virus and chemical media (such as oligonucleotides, lipid complexes, polymer bodies, polycomplexes, dendrimers, inorganic nanoparticles and peptides that penetrate cells).

[0403] 5.6. Peptides

[0404] The subject matter of the present disclosure provides a method for optimizing an amino acid sequence or a nucleic acid sequence by producing sequence changes. Such changes may include certain mutations, deletions, insertions, or post-translational modifications. The subject matter of the present disclosure also includes analogs of any naturally occurring polypeptide disclosed herein (including but not limited to CD371, CD8, CD28, 4-1BB, and CD3ζ). Analogs may differ from the naturally occurring polypeptides disclosed herein by amino acid sequence differences, by post-translational modifications, or by both. Analogs may exhibit at least about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more homology or identity with all or part of the naturally occurring amino acid sequence of the subject matter of the present disclosure. The length of the sequence difference is at least 5, 10, 15, or 20 amino acid residues, such as at least 25, 50, or 75 amino acid residues, or more than 100 amino acid residues. Similarly, in an exemplary method for determining the degree of identity, the BLAST program may be used, with a probability score in the range of e -3 and e -100 Between, indicating closely related sequences. Modification includes in vivo and in vitro chemical derivatization of polypeptides, such as acetylation, carboxylation, phosphorylation or glycosylation; Such modifications can occur during polypeptide synthesis or processing or after treatment with isolated modifying enzymes. Analogs can also be different from naturally occurring polypeptides by changes in the native sequence. These include natural and induced genetic variations (for example, as described in Sambrook, Fritsch and Maniatis, "Molecular Cloning: A Laboratory Manual" (2nd Edition), CSH Press, 1989, or Ausubel et al., supra, due to random mutagenesis by radiation or exposure to ethane methylsulfate or by site-specific mutagenesis). Also included are cyclized peptides, molecules and analogs containing residues other than L-amino acids, such as D-amino acids or non-naturally occurring or synthetic amino acids, such as β or γ amino acids.

[0405] In addition to full-length polypeptides, the disclosed subject matter also provides fragments of any polypeptide disclosed herein. As used herein, the term "fragment" refers to at least 5, 10, 13 or 15 amino acids. In certain embodiments, the fragment comprises at least 20 consecutive amino acids, at least 30 consecutive amino acids or at least 50 consecutive amino acids. In certain embodiments, the fragment comprises at least 60 to 80, 100, 200, 300 or more consecutive amino acids. Fragments can be produced by methods known to those skilled in the art, or can be produced by normal protein processing (e.g., removing amino acids that are not needed for biological activity from nascent polypeptides, or removing amino acids by alternative mRNA splicing or alternative protein processing events).

[0406] 5.7. Dosage Form and Administration

[0407] The subject matter of the present disclosure also provides compositions comprising cells of the present disclosure. Compositions comprising cells of the present disclosure can be conveniently provided in the form of sterile liquid preparations, such as isotonic aqueous solutions, suspensions, emulsions, dispersants or viscous compositions, which can be buffered to selected pH. Liquid preparations are generally easier to prepare than gels, other viscous compositions and solid compositions. In addition, liquid compositions are more convenient to use to a certain extent, especially by injection. On the other hand, viscous compositions can be prepared within a suitable viscosity range to provide a longer contact time with specific tissues. Liquid or viscous compositions can include carriers, which can be solvents or dispersion media, including, for example, water, saline, phosphate buffered saline, polyols (such as glycerol, propylene glycol, liquid polyethylene glycol, etc.) and suitable mixtures thereof.

[0408] Can be by genetically modified cell is mixed in the appropriate solvent of desired amount, and as required mix different amount of other components to prepare sterile injection solution.Such composition can be mixed with suitable carrier, diluent or excipient such as sterile water, normal saline, glucose, dextrose etc..Composition can also be lyophilized.Described composition can include auxiliary substance, such as wetting agent, dispersant or emulsifier (for example, methylcellulose), pH buffer, gelling agent or tackifier, preservative, flavoring, pigment etc., this depends on route of administration and required preparation.Can refer to standard text, such as " REMINGTON ' S PHARMACEUTICAL SCIENCE ", the 17th edition in 1985, is incorporated herein by reference, to prepare suitable preparation, without the need to carry out too much experiment.

[0409] Various additives that enhance the stability and sterility of the composition can be added, including antimicrobial preservatives, antioxidants, chelating agents, and buffers. Various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, etc., can be used to ensure that the effect of microorganisms is prevented. The absorption of the injectable drug form can be extended by using reagents that delay absorption, such as aluminum monostearate and gelatin. However, according to the subject matter of the present disclosure, any vehicle, diluent, or additive used must be compatible with the genetically modified cells.

[0410] The compositions can be isotonic, i.e., they can have the same osmotic pressure as blood and tears. The desired isotonicity of the composition can be achieved using sodium chloride or other pharmaceutically acceptable agents such as glucose, boric acid, sodium tartrate, propylene glycol, or other inorganic or organic solutes. Sodium chloride can be a particularly suitable buffer containing sodium ions.

[0411] If desired, pharmaceutically acceptable thickening agents can be used to maintain the viscosity of the composition at a selected level. For example, methylcellulose easily and economically obtains and is easy to use. Other suitable thickening agents include, for example, xanthan gum, carboxymethyl cellulose, hydroxypropyl cellulose, carbomer etc. The concentration of the thickening agent can depend on the reagent selected. It is important to use the consumption that can reach selected viscosity. Obviously, the selection of suitable carrier and other additives will depend on the character of definite route of administration and specific dosage form, for example liquid dosage form (for example, whether composition is mixed with solution, suspension, gel or other liquid form, for example timed release form or liquid-filled form).

[0412] The composition comprising the cells of the present disclosure can be provided to the subject systematically or directly to induce and / or enhance the immune response to the antigen and / or treat and / or prevent tumors. In certain embodiments, the immune response cells of the present disclosure or the composition comprising the same are directly injected into the organ of interest (e.g., an organ affected by a tumor). Alternatively, the cells of the present disclosure or the composition comprising the same are provided indirectly to the organ of interest, such as by administration to the circulatory system (e.g., tumor vasculature). Amplification and differentiation agents can be provided before, during, or after the administration of cells or compositions to increase the generation of cells (e.g., T cells or NK cells) in vitro or in vivo.

[0413] The cells of the present disclosure may be administered, typically intravascularly, in any physiologically acceptable carrier, although they may also be introduced into the bone or other convenient site where the cells can find appropriate sites of regeneration and differentiation (eg, the thymus).

[0414] The number of cells to be administered may vary depending on the subject being treated. In certain embodiments, about 10 cells of the present disclosure are administered to a subject (e.g., a human subject). 4 to about 10 10 Between, about 10 4 to about 10 7 Between, about 10 5 to about 10 7 , about 10 5 to about 10 9 Between or about 10 6 to about 10 8 More effective cells can be administered in smaller quantities. Typically, at least about 1×10 5 cells, eventually reaching about l×l0 10 or more. In certain embodiments, at least about 1×10 5 , 5×10 5 , 1×10 6 , about 5×10 6 , about 1×107 , about 5×10 7 , about 1×10 8 or about 5×10 8 In certain embodiments, about 1×10 6 The cells of the present disclosure are administered to a subject. The precise determination of an effective dose can be determined based on individual factors of each subject, including their size, age, sex, weight, and the specific subject's condition. A person skilled in the art can readily determine the dosage from this disclosure and knowledge in the art.

[0415] Cell of the present disclosure can comprise purified cell colony. Those skilled in the art can use various well-known methods, such as fluorescence activated cell sorting (FACS), easily determine the percentage of cell of the present disclosure in colony. In the colony comprising immune response cells of the present disclosure, the suitable range of purity is about 50% to about 55%, about 5% to about 60% and about 65% to about 70%. In certain embodiments, purity is about 70% to about 75%, about 75% to about 80% or about 80% to about 85%. In certain embodiments, purity is about 85% to about 90%, about 90% to about 95% or about 95% to about 100%. Dosage can be easily adjusted by those skilled in the art (for example, purity reduction may need to increase dosage). Cells can be introduced by injection, conduit etc.

[0416] Those skilled in the art can easily determine the amount of cells and optional additives, vehicles and / or carriers used in the composition and in the method. Typically, any additive (except one or more active cells and / or one or more reagents) is present in phosphate buffered saline in an amount of 0.001% to 50% (weight) solution, and the active ingredient is present in the order of micrograms to milligrams, such as about 0.0001wt% to about 5wt%, about 0.0001wt% to about 1wt%, about 0.0001wt% to about 0.05wt% or about 0.001wt% to about 20wt%, about 0.01wt% to about 10wt% or about 0.05wt% to about 5wt%. For any composition to be applied to an animal or a human, the following results can be determined: toxicity, for example, by determining the lethal dose (LD) and LD50 in a suitable animal model, for example, a rodent such as a mouse; the dosage of the composition, the concentration of the components therein and the time of administering the composition, causing a suitable reaction. According to the knowledge of the technician, the present disclosure and the literature cited herein, this determination does not require excessive experiments. Furthermore, the duration of continuous administration can be determined without undue experimentation.

[0417] In certain embodiments, the composition is a pharmaceutical composition comprising the cells disclosed herein and a pharmaceutically acceptable carrier.

[0418] Administration of the composition can be autologous or allogeneic. For example, cells can be obtained from one subject and administered to the same subject or to a different, compatible subject. Peripheral blood-derived cells or their progeny (e.g., derived in vivo, ex vivo, or in vitro) can be administered. When administering a composition of the present disclosure (e.g., a pharmaceutical composition comprising cells of the present disclosure), it can be formulated into an injectable form (solution, suspension, emulsion) in a unit dose.

[0419] The cells and compositions of the present disclosure can be administered by any method known in the art, including but not limited to oral administration, intravenous administration, subcutaneous administration, intranodal administration, intratumoral administration, intrathecal administration, intrapleural administration, intraosseous administration, intraperitoneal administration, pleural administration, and direct administration to a subject.

[0420] 5.8. Treatment

[0421] The cells of the present disclosure and compositions comprising the same can be used to treat and / or prevent tumors or neoplasia. Such cells can be administered to a subject in need (e.g., a human subject) to treat and / or prevent tumors or neoplasia (e.g., acute myeloid leukemia (AML), multiple myeloma, non-Hodgkin's lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia (CLL), glioblastoma). In certain embodiments, the cells are T cells. The T cells can be CD4 + T cells or CD8 + In some embodiments, the T cells are CD4 + T cells.

[0422] The subject matter of the present disclosure provides methods for inducing and / or increasing an immune response in a subject in need thereof. The cells of the present disclosure and compositions comprising the same can be used for therapy or medicine. The subject matter of the present disclosure provides various methods using cells (e.g., T cells) or compositions comprising the same. For example, the cells of the present disclosure and compositions comprising the same can be used to reduce the tumor burden of a subject. The cells of the present disclosure can reduce the number of tumor cells in a subject, reduce tumor size, and / or eradicate tumors. The cells of the present disclosure and compositions comprising the same can be used to treat and / or prevent tumors or neoplasia in a subject. The cells of the present disclosure and compositions comprising the same can be used to prolong the lifespan of a subject suffering from a tumor or neoplasia. These methods include administering the cells disclosed herein or compositions comprising the same (e.g., pharmaceutical compositions) to achieve the desired effect, such as alleviating an existing condition or preventing recurrence. For treatment, the amount administered is the amount that effectively produces the desired effect. An effective amount can be provided by one or more administrations. An effective amount can be provided in large doses or by continuous infusion.

[0423] The subject matter of the present disclosure provides various methods using cells (e.g., T cells) or compositions comprising the same. For example, the subject matter of the present disclosure provides methods for reducing tumor burden in a subject. In certain embodiments, the method for reducing tumor burden comprises administering cells disclosed herein or compositions comprising the same to a subject. The cells disclosed herein can reduce the number of tumor cells in a subject, reduce tumor size, and / or eradicate tumors.

[0424] The tumor or neoplasia can be a solid tumor. Non-limiting examples of solid tumors include mesothelioma, lung cancer, pancreatic cancer, ovarian cancer, breast cancer, colon cancer, pleural tumor, glioblastoma, esophageal cancer, gastric cancer, synovial sarcoma, thymic carcinoma, endometrial cancer, stomach cancer, and bile duct cancer.

[0425] The subject matter of the present disclosure also provides methods for increasing or extending the survival of a subject suffering from a tumor or neoplasia. In certain embodiments, the method for increasing or extending the survival of a subject suffering from a tumor or neoplasia comprises administering to the subject an immune response cell disclosed herein or a composition comprising the same. This method can reduce or eradicate the tumor burden of the subject. In addition, the subject matter of the present disclosure provides methods for increasing the immune response of a subject, comprising administering to the subject a cell disclosed herein or a composition comprising the same. The subject matter of the present disclosure also provides methods for treating and / or preventing a tumor or neoplasia in a subject, comprising administering to the subject a cell disclosed herein or a composition comprising the same.

[0426] Non-limiting examples of neoplasia or tumors include acute myeloid leukemia (AML), multiple myeloma, chronic lymphocytic leukemia (CLL), lymphomas (Hodgkin lymphoma, non-Hodgkin lymphoma), glioblastoma, myelodysplastic syndrome (MDS) and chronic myelogenous leukemia (CML), bone cancer, intestinal cancer, liver cancer, skin cancer, head or neck cancer, melanoma (cutaneous or intraocular malignant melanoma), kidney cancer (e.g., clear cell carcinoma), laryngeal cancer, prostate cancer (e.g., hormone-refractory prostate adenocarcinoma), blood cancers (e.g., leukemia, lymphoma and myeloma), uterine cancer, rectal cancer, cancer of the anal region, bladder cancer, brain cancer, stomach cancer, cancer), testicular cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, leukemias (e.g., acute leukemias, acute lymphocytic leukemias, acute myeloid leukemias, acute lymphoblastic leukemias, acute promyelocytic leukemias, acute monocytic leukemias, acute erythroleukemias, chronic leukemias, chronic myeloid leukemias, polycythemia vera, small intestine cancer, endocrine system cancers, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcomas, urethral cancer, penile cancer, solid tumors in children, lymphocytic lymphomas, bladder cancer, cancer of the kidney or ureter, renal pelvis cancer, central nervous system (CNS) tumors, primary CNS lymphomas, tumor angiogenesis, spinal cord axis tumors, brain stem gliomas, pituitary adenomas, Kaposi's sarcoma sarcoma), epidermoid carcinoma, squamous cell carcinoma, T-cell lymphoma, environmentally induced cancers including those induced by asbestos, including Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors such as sarcomas and carcinomas (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor). tumor), cervical cancer, salivary gland cancer, uterine cancer, testicular cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, Schwannoma, meningioma, melanoma, neuroblastoma, and retinoblastoma).

[0427] In certain embodiments, the tumor or neoplasia is selected from acute myeloid leukemia (AML), multiple myeloma, chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma, glioblastoma, myelodysplastic syndrome (MDS) and chronic myelogenous leukemia (CML). In certain embodiments, the tumor or neoplasia is AML.

[0428] The subject may have an advanced form of the disease, in which case the goal of treatment may include slowing or reversing disease progression and / or alleviating side effects. The subject may have a history of a disease for which treatment has already been performed, in which case the goal of treatment typically includes reducing or delaying the risk of relapse.

[0429] Due to the surface expression of the antigen recognition receptor targeting CD371 disclosed herein, adoptively transferred cells (e.g., immune response cells, such as T cells or NK cells) are endowed with enhanced and selective cytolytic activity at the tumor site. In addition, after localization to the tumor or viral infection and its proliferation, the cells transform the tumor or viral infection site into a highly conductive environment for a wide range of immune cells (tumor-infiltrating lymphocytes, NK cells, NKT cells, dendritic cells and macrophages) involved in physiological anti-tumor or anti-viral responses.

[0430] The cells of the present disclosure (e.g., T cells) can be further modified to avoid or minimize immune complications (called "malignant T cell transformation"), such as graft-versus-host disease (GvHD), or when healthy tissue expresses the same target antigen as tumor cells, the risk of a result similar to GvHD can be caused. A potential solution to this problem is to engineer suicide genes into the cells of the present disclosure. Suitable suicide genes include, but are not limited to, herpes simplex virus thymidine kinase (hsv-tk), inducible Caspase 9 suicide gene (iCasp-9), and truncated human epidermal growth factor receptor (EGFRt) polypeptides. In certain embodiments, the suicide gene is an EGFRt polypeptide. The EGFRt polypeptide can eliminate T cells by administering an anti-EGFR monoclonal antibody (e.g., cetuximab). EGFRt can be covalently linked to the upstream of an antigen recognition receptor (e.g., CAR). The suicide gene can be contained in a vector comprising a nucleic acid encoding an antigen recognition receptor (e.g., CAR) of the present disclosure. In this way, administration of a prodrug designed to activate a suicide gene (e.g., a prodrug (e.g., AP1903 that can activate iCasp-9)) during malignant T cell transformation (e.g., GVHD) can trigger apoptosis of cells expressing antigen recognition receptors (e.g., CARs) activated by the suicide gene. Incorporating a suicide gene into the CAR of the present disclosure can improve safety and enable the elimination of most receptor-expressing cells in a very short period of time. Cells of the present disclosure (e.g., T cells) that have incorporated a suicide gene can be preemptively eliminated at a given time point after cell infusion, or can be eliminated at the earliest sign of toxicity.

[0431] 5.9. Kit

[0432] The subject matter of the present disclosure provides a kit for inducing and / or enhancing an immune response, treating and / or preventing a tumor or neoplasia in a subject, reducing the tumor load of the subject and / or increasing or prolonging the survival period of a subject with a tumor or neoplasia in the subject. In certain embodiments, the kit comprises cells of the present disclosure or a composition comprising the same. In certain embodiments, the kit includes a sterile container; such a container can be a box, an ampoule, a bottle, a vial, a tube, a bag, a pouch, a blister pack or other suitable container forms known in the art. Such a container can be made of plastic, glass, laminated paper, metal foil or other materials suitable for holding a drug. In certain non-limiting embodiments, the kit includes nucleic acid molecules encoding antigen recognition receptors (e.g., CAR or TCR) targeting CD371 of the present disclosure.

[0433] If desired, the cells and / or nucleic acid molecules are provided together with instructions for administering the cells or nucleic acid molecules to a subject having a tumor or pathogen or immune disease or at risk of developing a tumor or neoplasia. The instructions typically include information about the use of the composition for treating and / or preventing a tumor or neoplasia. In certain embodiments, the instructions include at least one of the following: a description of the therapeutic agent; a dosage schedule and administration for treating or preventing a tumor or neoplasia; precautions; warnings; indications; contraindications; medication information; adverse reactions; animal pharmacology; clinical studies; and / or references. These instructions can be printed directly on the container (if any), or as a label affixed to the container, or provided within or with the container as a separate sheet, brochure, card, or folder.

[0434] Example

[0435] Unless otherwise indicated, the practice of the present disclosure employs conventional techniques of molecular biology, microbiology, cell biology, biochemistry, and immunology (including recombinant techniques), which are within the capabilities of the skilled artisan. These techniques are fully explained in, for example, "Molecular Cloning: A Laboratory Manual," Second Edition (Sambrook, 1989); "Oligonucleotide Synthesis" (Gait, 1984); "Animal Cell Culture" (Freshney, 1987); "Enzymatic Methods," "Handbook of Experimental Immunology" (Weir, 1996); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Current Methods in Molecular Biology" (Ausubel, 1987); "PCR: Polymerase Chain Reaction," (Mullis, 1994); "Current Methods in Immunology" (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides disclosed herein and, therefore, can be considered in preparing and practicing the subject matter disclosed herein. Particularly useful techniques for specific embodiments will be discussed in the following sections.

[0436] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the cells and compositions of the present disclosure and are not intended to limit the scope of what the inventors regard as their invention.

[0437] Example 1 - Generation of CAR targeting CD371

[0438] The following six CARs targeting CD371 were generated: “Et.B10L3H_MT_h28z,” “Et.B10L4H_MT_hBBz,” “Et.B10L4H_MT_h28z,” “Et.B10H3L_MT_h28z,” “Et.B10H4L_MT_h28z,” “Et.C3H3L_MT_LHt28z,” “Et.C3L3H_MT_h28z,” and “Et.D6L3H_MT_h28z.” The structures of the CARs are shown in Figure 4. Figure 1 shown.

[0439] like Figure 2 As shown, CAR was detected on the surface of transduced human T cells by EGFR and Myc-tag. Antibodies against EGFRt (cetuximab-APC (CETUXIMAB-APC)) and Myc-tag (9B11-PE) were used to detect surface expression of EGFRt and human anti-human CAR in B10-based constructs. Controls included non-transduced human T cells that do not express EGFRt or Myc tags, as well as non-Myc-tagged Etah19h28Z (anti-human CD19 CAR T cells) and EtC1HVh28Z (anti-CD371 CAR T cells derived from mouse anti-human CD371 antibody 1075.7) containing CAR constructs.

[0440] Example 2 - In vitro cytotoxic activity of CAT T cells targeting CD371

[0441] T cells were transfected with a number of CARs targeting CD371 (i.e., "Et.C1HVh28Z," "Et.B10LH_MT_h28Z," "Et.B10LHg4s_MT_h28Z," "Et.B10HL_MT_h28Z," "Et.C3HL_MT_h28Z," "Et.C3LH_MT_h28Z," and "Et.D6LH_MT_h28Z"). Et.C1HVh28Z was used as a positive control and was derived from the mouse anti-human CD371 antibody 1075.7. "Et.B10LHg4s_MT_hDEL" is a non-functional CAR T cell targeting CD371 (based on B10L4H but without the CD28 or CD3ζ signaling domains). These CD371-targeted CAR T cells were co-cultured with CD371+U937 cells expressing GFP and firefly luciferase (U937gL) at different effector:tumor ratios. After 24 hours, bioluminescence was measured and plotted as a percentage of the signal detected in co-cultures of non-functional CD371-targeted CAR T cells (based on B10L4H but without CD28 or CD3ζ signaling domains) and U937gL. The results are shown in Figure 3 In. Figure 3 As shown, CAR T cells targeting CD371 are able to lyse cells expressing CD371.

[0442] Example 3 - In vitro cytotoxic activity of CAT T cells targeting CD371

[0443] T cells were transfected with a number of CARs targeting CD371 (i.e., "Et.C1HVh28Z," "Et.B10L4H_MT_h28Z," "Et.B10L3H_MT_h28Z," "Et.B10L4H_MT_hBBZ," "Et.B10H3L_MT_h28Z," "Et.C3HL_MT_h28Z," "Et.C3LH_MT_h28Z," and "Et.M195_MT_h28Z"). Et.C1HVh28Z was used as a positive control and is derived from mouse anti-human antibody 1075.7. "Et.M195MTh28Z" represents a CD33-targeted CAR T cell derived from the mouse anti-human CD33 antibody M195. "Et.M195MTh28Z" was used as a positive control because U937 cells also express CD33. CAR T cells targeting CD371 from healthy human donors (i.e., donor C and donor D) were co-cultured with CD33+ / CD371+ U937 cells (U937gL) expressing GFP and firefly luciferase at different effector:tumor ratios. After 24 hours, bioluminescence was measured and plotted as the percentage of the signal detected in the co-culture of non-functional CAR T cells targeting CD371 (based on B10L4H but without CD28 or CD3ζ signaling domains) and U937gL. The results are shown in Figure 4 (Donor C) and Figure 5 (Donor D). Figure 4 and 5 As shown, B10-based CAR (both HL / LH) T cells are superior to C3-based CAR T cells.

[0444] Example 4 - Antigen stimulation of CAR T cells targeting CD371

[0445] CAR T cells targeting CD371 from healthy human donors (i.e., donor C and donor D) were co-cultured with CD33+ / CD371+U937gL at an E:T ratio of 1:12.5 and a concentration of 30,000 CAR+ / mL. Approximately every 4-5 days, CAR T cells were counted and characterized by flow cytometry, and then the initial number of tumor cells was added back to the culture (as indicated by the arrow). The results are shown in Figure 6 (Donor C) and Figure 7(Donor D). "Et.B10LHdel" represents a non-functional CAR T cell (lacking a signaling domain). "Et.C1HVh28Z" represents a CAR targeting CD371 derived from mouse anti-human CD371 antibody 1075.7), and "EtM195MTh28Z" or "M19528" represents a CAR T cell targeting CD33 derived from mouse anti-human CD33 antibody M195. Figure 6 and 7 As shown, B10-based CAR T cells outperformed C3-based CAR T cells in a long-term repeated stimulation assay.

[0446] Example 5 - In vitro cytotoxic activity of CAT T cells targeting CD371

[0447] CAR T cells targeting CD371 from healthy human donors (i.e., donor A and donor B) were co-cultured with CD371-positive U937 cells or HL60 cells expressing GFP and firefly luciferase (U937gL or HL60gL) at different effector:tumor ratios. Bioluminescence was measured after 24 hours of co-culture and plotted as the percentage of the signal detected in the co-culture of non-functional CAR T cells targeting CD371 (based on B10L4H but without CD28 or CD3ζ signaling domains) and U937gL. The results are shown in Figure 8A and 8B (for U937gL cells) and Figure 9A and 9B (For HL 60 cells). Figures 8A-8B As shown in Figures 9A-9B , B10HL-based CAR T cells targeting CD371 are superior to B10LH-based CAR T cells targeting CD371.

[0448] Example 6 - Antigen-specific cytotoxic activity of CAR T cells targeting CD371

[0449] We evaluated whether the cytotoxic activity of CD371-targeting CAR T cells is specific for CD371. We generated a human CD371 (hCD371) CRISPR knockout cell line. Human CD371 was knocked out from HL60gL and U937gL cells using CRISPR, and knockout was confirmed by flow cytometry using an anti-human CD371 APC-conjugated antibody. See Figure 10.

[0450] CAR T cells targeting CD371 from healthy human donors (i.e., donor A and donor B) were co-cultured with antigen-negative U937 cells or HL60 (U937RFPcyp.371KO or HLgL.371KO) expressing RFP and cytochrome luciferase at different effector:tumor ratios. After 24 hours, bioluminescence was measured and plotted as the percentage of the signal detected in the co-culture of non-functional CAR T cells targeting CD371 (based on B10L4H, but without CD28 or CD3ζ signaling domains) and U937RFPcyp.371KO. The results are shown in Figures 11A-11B (for U937 cells) and Figures 12A-12B (For HL60 cells). Figures 11A-11B As shown in Figures 12A-12B, both B10HL-based and B10LH-based CD371-targeting CAR T cells showed no significant cytotoxicity against CD371-negative U937 cells and showed limited cytotoxicity against CD371-negative HL60 cells.

[0451] Example 7 - Cytokine secretion by CAR T cells targeting CD371

[0452] The ability of CD371-targeted CAR T cells to produce cytokines was evaluated. CD371-targeted CAR T cells were co-cultured with CD371-negative tumor cells or CD371-positive U937 cells at a 1:1 effector:tumor ratio (40,000:40,000 cells in 200 μL). After 24 hours, supernatants were collected from the cultures and the secretion levels of IFN-γ, IL-2, and TNF-α were measured using a bead-based multiplex assay. The results are shown in Figures 13A-13B (for IFN-γ), Figures 14A-14B (for IL-2) and Figures 15A-15B (For TNF-α). Figures 13A-13B 、 Figures 14A-14B and Figures 15A-15B As shown, B10HL-based CAQR T cells produced more cytokines than B10LH-based CAR T cells in an antigen-dependent manner.

[0453] Example 8 - Proliferative capacity of CAR T cells targeting CD371

[0454] CAR T cells are produced by two healthy donors (i.e., donor A and donor B). CAR T cells targeting CD371 are co-cultured with CD371+U937gL at an E:T ratio of 1:5 and a concentration of 50,000CAR+ / mL. CAR T cells are counted approximately every 5 days and characterized by flow cytometry. The initial number of tumor cells is added back to the culture at the time point indicated by the arrow. The results are shown in Figure 16. As shown in Figure 16, B10HL-based and B10-LH-based CD371-targeting CAR T cells show nearly comparable expansion capabilities in vitro.

[0455] Example 9 - In vivo anti-tumor activity of CAR T cells targeting CD371

[0456] The in vivo antitumor activity of B10-based CAR T cells targeting CD371 was evaluated. Figure 17 The xenograft model of AML is shown. NCG mice were inoculated via the tail vein with 5.0×10 4 U937gL tumor cells, AML FAB-M5 cell line, and three days later, approximately 1.25×10 6 CAR T cell therapy. The survival rate of mice was monitored. The results were shown in Figure 18 (Donor 1) and Figure 19 (Donor 2). Figure 18 and 19 As shown, B10HL-based CAR T cells showed a higher survival rate in AML xenograft mice compared with B10LH-based CAR T cells.

[0457] Next, we evaluated whether the in vivo activity was dose-dependent. NCG mice were inoculated with 5.0 × 10 4 U937gL tumor cells were then treated with different doses of CAR T cells (1.25×10 5 , 2.5×10 5 , 5.0×10 5 and 1.0×10 6 ) treatment. The results showed Figure 20 In. Figure 20 As shown, B10HL-based CAR T cells outperformed B10LH-based CAR T cells in a dose-response treatment model.

[0458] Example 10: Binding of B10 scFv to CD371-expressing cell lines

[0459] Two directions (V H -V L or V L -V HThe results are shown in Figure 3. Figure 21 In. Figure 21 As shown, V L -V H However, flow cytometry did not observe the binding of V H -V L Binding of the B10 scFv in the α-directed orientation indicated lower affinity, thus requiring bivalent binding.

[0460] Example 11: Binding of B10 scFv to recombinant CD371 in solution

[0461] For scFv affinity measurements, biotinylated CD371 was captured with streptavidin and soluble scFv was used as the analyte. Table 8 shows the dissociation constants (K) for different scFv formats. D ), opening rate (k on ) and closing rate (k off ). Consistent with the flow cytometry results, V H -V L The 1B10 scFv showed weak binding in the 2D direction, but the dissociation constant could not be calculated by any curve fitting method.

[0462] Therefore, it is surprising that CARs comprising lower binding affinity scFvs outperform CARs comprising higher binding affinity scFvs in vitro and in vivo, as shown in Examples 5, 7, and 9.

[0463] Table 8.V H -V L or V L -V H Binding affinity of B10 scFv to soluble CD371 in the direction

[0464]

[0465] Example 12: In vivo and in vitro activity of second-generation CAR T cells based on B10HL

[0466] Successfully generated B10HL-based second-generation CAR T cells with truncated EGFR (Et), Myc-tag (MT), and G4S linker:

[0467] • Et.B10H4L_MT_h28Z is described in Example 1.

[0468] · Et.B10H1L_MT_h28Z contains V H -V LThe invention relates to a B10-based scFv in the scFv direction (designated B10H1L), a 5-amino acid long G4S linker (GGGGS [SEQ ID NO:93]), and a CD28Z-based signaling domain.

[0469] · Et.B10H2L_MT_h28Z contains V H -V L The invention relates to a B10-based scFv in the scFv-directed B10 region (designated B10H2L) and a 10-amino acid long G4S linker (GGGGSGGGGS [SEQ ID NO:94]), and a CD28Z-based signaling domain.

[0470] · Et.B10H5L_MT_h28Z contains V H -V L The invention relates to a B10-based scFv (designated B10H5L) in the scFv-directed manner and a 24-amino acid long G4S linker (GGGGSGGGGSGGGGSGGGSGGGGS [SEQ ID NO:91]), and a CD28Z-based signaling domain.

[0471] · Et.B10H6L_MT_h28Z contains V H -V L The invention comprises a B10-based scFv (designated B10H6L) in the 29-amino acid G4S linker (GGGGSGGGGSGGGGSGGGGSGGGSGGGGS [SEQ ID NO:92]) in the 28-direction, and a CD28Z-based signaling domain.

[0472] Additional second-generation B10H4L-based CAR T cells were generated that included constitutive IL18 (designated "Et.B10H4Lmt28ZpIL18") or IL33 (designated "Et.B10H4Lmt28ZpIL33") secretion. T cells containing Et.B10H4Lmt28ZpIL18 contained a CAR designated "Et.B10H4L_MT_h28Z" and an exogenous IL-18 polypeptide (e.g., an exogenous IL-18 polypeptide comprising the amino acid sequence set forth in SEQ ID NO 103). T cells containing Et.B10H4Lmt28ZpIL33 contained a CAR designated "Et.B10H4L_MT_h28Z" and an exogenous IL-33 polypeptide (e.g., an exogenous IL-33 polypeptide comprising the amino acid sequence set forth in SEQ ID NO 105).

[0473] like Figure 22 As shown, with V H -V LThe cytotoxicity of CAR T cells with V-directed scFv was better than that of CAR T cells with V-directed scFv against U937 cells. L -V H To evaluate the in vivo activity of these B10-based CAR T cells, NCG mice were inoculated with 5×10 4 U937gL tumor cells were injected into the mice and treated with different doses of CAR T cells. The survival rate of the treated mice was monitored and recorded. Figure 23 As shown, in 5×10 5 At the dose of CAR T cells, CAR T cells targeting human CD371 based on B10H3L, B10H5L, and IL33-secreting B10H4L were superior to CAR T cells based on B10H4L. Figure 24 As shown, at 2.5×10 5 At the dose of CAR T cells, CAR T cells targeting human CD371 based on IL18-secreting and IL33-secreting B10H4L were superior to CAR T cells based on B10H4L. Figure 25 As shown, at 1.0×10 5 At low doses of CAR T cells, IL18-secreting B10H4L-targeted human CD371 CAR T cells outperformed other CAR T cells.

[0474] Implementations of the Disclosed Subject Matter

[0475] From the foregoing description, it will be apparent that the subject matter of the present disclosure can be modified and adapted to suit various usages and conditions. Such embodiments are also within the scope of the appended claims.

[0476] The listing of elements in variable definitions described herein includes defining the variable as any single element or combination (or subcombination) of the listed elements. The embodiments described herein include that embodiment as any single embodiment or in combination with any other embodiment or portion thereof.

[0477] All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent or publication was specifically and individually indicated to be incorporated by reference. Sequence Listing <110> Memorial Sloan-Kettering Cancer Center <120> Antigen recognition receptor targeting CD371 and its use <130> 072734.1147 <150> US 62 / 900,141 <151> 2019-09-13 <150> US 62 / 936,951 <151> 2019-11-18 <160> 112 <170> PatentIn Version 3.5 <210> 1 <211> 122 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 1 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 20 25 30 Gln Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Gln Gly Gly Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Met Trp Arg Gly Asp Tyr Tyr Ser Gly Met Asp Val Trp 100 105 110 Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 <210> 2 <211> 113 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 2 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Asp Ser 20 25 30 Tyr Asn Asn Glu Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Thr Ser Glu Pro Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Light <210> 3 <211> 125 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 3 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Asp Gly Ser Gly Gly Gly Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Ala Tyr Tyr Asp Ile Leu Thr Gly Tyr Pro Val Asp Gly Met 100 105 110 Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <210> 4 <211> 113 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 4 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Ser Ser 20 25 30 Tyr Asn Asn Glu Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Tyr Ser Glu Pro Tyr Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Light <210> 5 <211> 117 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 5 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Asp Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Asp Ile Asp Gly Ser Gly Gly Ser Thr Asp Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Leu Glu Leu Gly Ala Thr Thr Val Tyr Trp Gly Gln Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 6 <211> 113 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 6 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Arg Ser 20 25 30 Ser Asn Asn Lys Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Tyr Arg Glu Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys <210> 7 <211> 120 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 7 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Thr 20 25 30 Gln Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Glu Ile Ser Gly Tyr Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Lys Asp Thr Glu Val Ser Gly Asp Ala Phe Asp Ile Trp Gly Gln 100 105 110 Gly Thr Met Val Thr Val Ser Ser 115 120 <210> 8 <211> 108 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 8 Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Asp Ser Ser 20 25 30 Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45 Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu 65 70 75 80 Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Arg Ser Trp Pro 85 90 95 Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys 100 105 <210> 9 <211> 122 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 9 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Tyr 20 25 30 Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Gly Ile Ser Gly Ser Gly Asp Ser Thr Ser Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Ala Gly Gly Asp Tyr Asp Ser Gly Ala Phe Asp Ile Trp 100 105 110 Gly Gln Gly Thr Met Val Thr Val Ser Ser 115 120 <210> 10 <211> 113 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 10 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser 20 25 30 Gly Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Asp Tyr Ala Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Light <210> 11 <211> 127 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 11 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Ser Tyr 20 25 30 Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Ser Glu Ile Asp Gly Glu Gly Gly Tyr Thr Asn Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Arg Glu Gly Val Asp Tyr Asp Ile Leu Thr Gly Tyr Tyr Pro Tyr 100 105 110 Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 115 120 125 <210> 12 <211> 114 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 12 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Asp Ser 20 25 30 Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Asp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Gly Thr Ser Ser Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Light Gly <210> 13 <211> 19 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 13 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly 1 5 10 15 Gly Gly Ser <210> 14 <211> 15 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 14 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 1 5 10 15 <210> 15 <211> 265 <212> PRT <213> Homo sapiens <400> 15 Met Ser Glu Glu Val Thr Tyr Ala Asp Leu Gln Phe Gln Asn Ser Ser 1 5 10 15 Glu Met Glu Lys Ile Pro Glu Ile Gly Lys Phe Gly Glu Lys Ala Pro 20 25 30 Pro Ala Pro Ser His Val Trp Arg Pro Ala Ala Leu Phe Leu Thr Leu 35 40 45 Leu Cys Leu Leu Leu Leu Ile Gly Leu Gly Val Leu Ala Ser Met Phe 50 55 60 His Val Thr Leu Lys Ile Glu Met Lys Lys Met Asn Lys Leu Gln Asn 65 70 75 80 Ile Ser Glu Glu Leu Gln Arg Asn Ile Ser Leu Gln Leu Met Ser Asn 85 90 95 Met Asn Ile Ser Asn Lys Ile Arg Asn Leu Ser Thr Thr Leu Gln Thr 100 105 110 Ile Ala Thr Lys Leu Cys Arg Glu Leu Tyr Ser Lys Glu Gln Glu His 115 120 125 Lys Cys Lys Pro Cys Pro Arg Arg Trp Ile Trp His Lys Asp Ser Cys 130 135 140 Tyr Phe Leu Ser Asp Asp Val Gln Thr Trp Gln Glu Ser Lys Met Ala 145 150 155 160 Cys Ala Ala Gln Asn Ala Ser Leu Leu Lys Ile Asn Asn Lys Asn Ala 165 170 175 Leu Glu Phe Ile Lys Ser Gln Ser Arg Ser Tyr Asp Tyr Trp Leu Gly 180 185 190 Leu Ser Pro Glu Glu Asp Ser Thr Arg Gly Met Arg Val Asp Asn Ile 195 200 205 Ile Asn Ser Ser Ala Trp Val Ile Arg Asn Ala Pro Asp Leu Asn Asn 210 215 220 Met Tyr Cys Gly Tyr Ile Asn Arg Leu Tyr Val Gln Tyr Tyr His Cys 225 230 235 240 Thr Tyr Lys Lys Arg Met Ile Cys Glu Lys Met Ala Asn Pro Val Gln 245 250 255 Leu Gly Ser Thr Tyr Phe Arg Glu Ala 260 265 <210> 16 <211> 254 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 16 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Asp Ser 20 25 30 Tyr Asn Asn Glu Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Thr Ser Glu Pro Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Ser Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val 130 135 140 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 145 150 155 160 Phe Ser Asp Tyr Gln Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly 165 170 175 Leu Glu Trp Val Ser Gly Ile Gln Gly Gly Gly Gly Ser Thr Tyr Tyr 180 185 190 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys 195 200 205 Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 210 215 220 Val Tyr Tyr Cys Ala Arg Glu Met Trp Arg Gly Asp Tyr Tyr Ser Gly 225 230 235 240 Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser Ser 245 250 <210> 17 <211> 257 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 17 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Ser Ser 20 25 30 Tyr Asn Asn Glu Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 [[ID=十七]]Pro Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80​​​​​​​​​​​​​​​​​Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 145 150 155 160 Phe Thr Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly 165 170 175 Leu Glu Trp Val Ser Gly Ile Asp Gly Ser Gly Gly Gly Thr Asn Tyr 180 185 190 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys 195 200 205 Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 210 215 220 Val Tyr Tyr Cys Ala Arg Ala Tyr Tyr Asp Ile Leu Thr Gly Tyr Pro 225 230 235 240 Val Asp Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr Val Ser 245 250 255 Looking <210> 18 <211> 249 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 18 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Arg Ser 20 25 30 Ser Asn Asn Lys Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Ala Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Tyr Arg Glu Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Ser Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val 130 135 140 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 145 150 155 160 Phe Thr Asp Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly 165 170 175 Leu Glu Trp Val Ser Asp Ile Asp Gly Ser Gly Gly Ser Thr Asp Tyr 180 185 190 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys 195 200 205 Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 210 215 220 Val Tyr Tyr Cys Ala Leu Glu Leu Gly Ala Thr Thr Val Tyr Trp Gly 225 230 235 240 Gln Gly Thr Leu Val Thr Val Ser Ser 245 <210> 19 <211> 247 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 19 Glu Ile Val Leu Thr Gln Ser Pro Gly Thr Leu Ser Leu Ser Pro Gly 1 5 10 15 Glu Arg Ala Thr Leu Ser Cys Arg Ala Ser Gln Ser Val Asp Ser Ser 20 25 30 Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Arg Leu Leu 35 40 45 Ile Tyr Gly Ala Ser Ser Arg Ala Thr Gly Ile Pro Asp Arg Phe Ser 50 55 60 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Arg Leu Glu 65 70 75 80 Pro Glu Asp Phe Ala Val Tyr Tyr Cys Gln Gln Tyr Arg Ser Trp Pro 85 90 95 Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Gly Gly Gly 100 105 110 Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu 115 120 125 Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser 130 135 140 Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Thr Ser Thr Gln 145 150 155 160 Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser 165 170 175 Glu Ile Ser Gly Tyr Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys 180 185 190 Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu 195 200 205 Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala 210 215 220 Lys Asp Thr Glu Val Ser Gly Asp Ala Phe Asp Ile Trp Gly Gln Gly 225 230 235 240 Thr Met Val Thr Val Ser Ser 245 <210> 20 <211> 254 <212> PRT <213> artificial sequence <220> <223> synthetic <400> 20 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Tyr Ser 20 25 30 Gly Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Tyr Asp Tyr Ala Pro Phe Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Ser Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val 130 135 140 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 145 150 155 160 Phe Thr Ser Tyr Tyr Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly 165 170 175 Leu Glu Trp Val Ser Gly Ile Ser Gly Ser Gly Asp Ser Thr Ser Tyr 180 185 190 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys 195 200 205 Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 210 215 220 Val Tyr Tyr Cys Ala Arg Glu Ala Gly Gly Asp Tyr Asp Ser Gly Ala 225 230 235 240 Phe Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser 245 250 <210> 21 <211> 259 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 21 Asp Ile Val Met Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly 1 5 10 15 Glu Arg Ala Thr Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Asp Ser 20 25 30 Ser Asn Asn Lys Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 35 40 45 Pro Pro Lys Leu Leu Ile Tyr Asp Ala Ser Thr Arg Glu Ser Gly Val 50 55 60 Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr 65 70 75 80 Ile Ser Ser Leu Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln 85 90 95 Gly Thr Ser Ser Pro Leu Thr Phe Gly Gln Gly Thr Lys Val Glu Ile 100 105 110 Lys Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly 115 120 125 Gly Gly Gly Ser Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val 130 135 140 Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr 145 150 155 160 Phe Ser Ser Tyr Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly 165 170 175 Leu Glu Trp Val Ser Glu Ile Asp Gly Glu Gly Gly Tyr Thr Asn Tyr 180 185 190 Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys 195 200 205 Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala 210 215 220 Val Tyr Tyr Cys Ala Arg Glu Gly Val Asp Tyr Asp Ile Leu Thr Gly 225 230 235 240 Tyr Tyr Pro Tyr Gly Met Asp Val Trp Gly Gln Gly Thr Thr Val Thr 245 250 255 Val Ser Ser <210> 22 <211> 762 <212> DNA <213> artificial sequence <220> <223> synthetic <400> 22 gacatcgtga tgacccagtc tccagactcc ctggctgtgt ctctgggcga gcgtgccacc 60 atcaactgca agtccagcca gagtgtttta gacagctata acaatgagaa caatttagct 120 tggtatcagc agaaaccagg acagcctcct aagctgctca tttactgggc atctacccgg 180 gaatccgggg tccctgaccg attcagtggc agcgggtctg ggacagattt cactctcacc 240 atcagcagcc tgcaggctga agatgtggca gtttattact gtcagcaata taccagcgaa 300 cctatcacgt tcggccaagg taccaaggtg gaaatcaaag gtggtggtgg ttcaggtggt 360 ggtggttctg gcggcggctc cggtggtggt ggatccgagg tgcagctgtt ggagtctggg 420 ggaggcttgg tacagcctgg ggggtccctg cgactctcct gtgcagcctc tggattcacc 480 tttagcgact atcagatgag ctgggtccgc caggctccag ggaaggggct ggagtgggtg 540 tcaggcattc agggtggcgg tggtagcaca tattacgcag actccgtgaa gggccggttc 600 accatctccc gtgacaattc caagaacacg ctgtatctgc aaatgaacag cctgcgtgcc 660 gaggacacgg ctgtgtatta ctgtgcgaga gagatgtggc gtggggacta ctactccggt 720 atggacgtct ggggccaggg gaccacggtc accgtctcct ca 762 <210> 23 <211> 771 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 23 gacatcgtga tgacccagtc tccagactcc ctggctgtgt ctctgggcga gcgtgccacc 60 atcaactgca agtccagcca gagtgtttta agcagctata acaatgagaa caatttagct 120 tggtatcagc agaaaccagg acagcctcct aagctgctca tttacgccgc atctacccgg 180 gaatccgggg tccctgaccg attcagtggc agcgggtctg ggacagattt cactctcacc 240 atcagcagcc tgcaggctga agatgtggca gtttattact gtcagcaata ttatagcgaa 300 ccttatacgt tcggccaagg taccaaggtg gaaatcaaag gtggtggtgg ttcaggtggt 360 ggtggttctg gcggcggctc cggtggtggt ggatccgagg tgcagctgtt ggagtctggg 420 ggaggcttgg tacagcctgg ggggtccctg cgactctcct gtgcagcctc tggattcacc 480 tttaccagct atgccatgag ctgggtccgc caggctccag ggaaggggct ggagtgggtg 540 tcaggcattg acggtagcgg tggtggcaca aattacgcag actccgtgaa gggccggttc 600 accatctccc gtgacaattc caagaacacg ctgtatctgc aaatgaacag cctgcgtgcc 660 gaggacacgg ctgtgtatta ctgtgcgaga gcgtattacg atattttgac tggttacccc 720 gtggacggta tggacgtctg gggccaaggg accacggtca ccgtctcctc a 771 <210> 24 <211> 747 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 24 gacatcgtga tgacccagtc tccagactcc ctggctgtgt ctctgggcga gcgtgccacc 60 atcaactgca agtccagcca gagtgtttta cgcagcagca acaataaaaa caatttagct 120 tggtatcagc agaaaccagg acagcctcct aagctgctca tttacgccgc atctacccgg 180 gaatccgggg tccctgaccg attcagtggc agcgggtctg ggacagattt cactctcacc 240 atcagcagcc tgcaggctga agatgtggca gtttattact gtcagcaata ttatcgcgaa 300 cctctgacgt tcggccaagg taccaaggtg gaaatcaaag gtggtggtgg ttcaggtggt 360 ggtggttctg gcggcggctc cggtggtggt ggatccgagg tgcagctgtt ggagtctggg 420 ggaggcttgg tacagcctgg ggggtccctg cgactctcct gtgcagcctc tggattcacc 480 tttaccgact atgccatgag ctgggtccgc caggctccag ggaaggggct ggagtgggtg 540 tcagacattg acggtagcgg tggtagcaca gactacgcag actccgtgaa gggccggttc 600 accatctccc gtgacaattc caagaacacg ctgtatctgc aaatgaacag cctgcgtgcc 660 gaggacacgg ctgtgtatta ctgtgcgcta gagctgggag ctactaccgt ctactggggc 720 cagggaaccc tggtcaccgt ctcctca 747 <210> 25 <211> 741 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 25 gaaattgtgt tgacgcagtc tccaggcacc ctgtctttgt ctccagggga acgtgccacc 60 ctctcctgcc gtgccagtca gagtgttgac agcagcaatt tagcctggta tcagcagaaa 120 cctggccagg ctccccgact cctcatctat ggcgcatcta gccgtgccac tggtatccca 180 gaccgtttca gtggcagtgg gtctgggaca gacttcactc tcaccatcag cagactggag 240 cctgaagatt ttgcagtgta ttactgtcag cagtatcgca gctggcctat cacgttcggc 300 caaggtacca aggtggaaat caaaggtggt ggtggttcag gtggtggtgg ttctggcggc 360 ggctccggtg gtggtggatc cgaggtgcag ctgttggagt ctgggggagg cttggtacag 420 cctggggggt ccctgcgact ctcctgtgca gcctctggat tcacctttac cagcacccag 480 atgagctggg tccgccaggc tccagggaag gggctggagt gggtgtcaga gattagcggt 540 [[ID=⑨]]tatggtggta gcacatacta cgcagactcc gtgaagggcc ggttcaccat ctcccgtgac 600 aattccaaga acacgctgta tctgcaaatg aacagcctgc gtgccgagga cacggctgtg 660 tattactgtg caaaagacac ggaggtttcg ggagatgctt ttgatatctg gggccaaggg 720 acaatggtca ccgtctcttc a 741 <210> 26 <211> 762 <212> DNA<L <213> Artificial sequence <220> <223> Synthetic <400> 26 gacatcgtga tgacccagtc tccagactcc ctggctgtgt ctctgggcga gcgtgccacc 60 atcaactgca agtccagcca gagtgtttta tatagcggca acaataaaaa ctatttagct 120 Note: In the original text, there is a potential error in ID=9 where the Chinese character "⑨" is used instead of a proper English character or number. I've translated it as "⑨" as it's not clear what it should be. If it's a misprint, please correct it in the original text for a more accurate translation.tggtatcagc agaaaccagg acagcctcct aagctgctca tttacggcgc atctacccgg 180 gaatccgggg tccctgaccg attcagtggc agcgggtctg ggacagattt cactctcacc 240 atcagcagcc tgcaggctga agatgtggca gtttattact gtcagcaata tgactatgcc 300 ccttttacgt tcggccaagg taccaaggtg gaaatcaaag gtggtggtgg ttcaggtggt 360 ggtggttctg gcggcggctc cggtggtggt ggatccgagg tgcagctgtt ggagtctggg 420 ggaggcttgg tacagcctgg ggggtccctg cgactctcct gtgcagcctc tggattcacc 480 tttaccagct attatatgag ctgggtccgc caggctccag ggaaggggct ggagtgggtg 540 tcaggcatta gcggtagcgg tgacagcaca agctacgcag actccgtgaa gggccggttc 600 accatctccc gtgacaattc caagaacacg ctgtatctgc aaatgaacag cctgcgtgcc 660 gaggacacgg ctgtgtatta ctgtgcgaga gaggcaggtg gtgactacga tagtggtgct 720 tttgatatct ggggccaagg gacaatggtc accgtctctt ca 762 <210> 27 <211> 777 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 27 gacatcgtga tgacccagtc tccagactcc ctggctgtgt ctctgggcga gcgtgccacc 60 atcaactgca agtccagcca gagtgtttta gacagcagca acaataaaaa ctatttagct 120 tggtatcagc agaaaccagg acagcctcct aagctgctca tttacgacgc atctacccgg 180 gaatccgggg tccctgaccg attcagtggc agcgggtctg ggacagattt cactctcacc 240 atcagcagcc tgcaggctga agatgtggca gtttattact gtcagcaagg caccagcagc 300 cctctgacgt tcggccaagg taccaaggtg gaaatcaaag gtggtggtgg ttcaggtggt 360 ggtggttctg gcggcggctc cggtggtggt ggatccgagg tgcagctgtt ggagtctggg 420 ggaggcttgg tacagcctgg ggggtccctg cgactctcct gtgcagcctc tggattcacc 480 tttagcagct atgccatgag ctgggtccgc caggctccag ggaaggggct ggagtgggtg 540 tcagagattg acggtgaggg tggttataca aattacgcag actccgtgaa gggccggttc 600 accatctccc gtgacaattc caagaacacg ctgtatctgc aaatgaacag cctgcgtgcc 660 gaggacacgg ccgtgtatta ctgtgcgaga gaaggggtag attacgatattttgactggt 720 tattatcctt acggtatgga cgtctggggc caagggacca cggtcaccgt ctcctca 777 <210> 28 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 28 Gly Phe Thr Phe Ser Asp Tyr Gln 1 5 <210> 29 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 29 Ile Gln Gly Gly Gly Gly Ser Thr 1 5 <210> 30 <211> 15 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 30 Ala Arg Glu Met Trp Arg Gly Asp Tyr Tyr Ser Gly Met Asp Val 1 5 10 15 <210> 31 <211> 12 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 31 Gln Ser Val Leu Asp Ser Tyr Asn Asn Glu Asn Asn 1 5 10 <210> 32 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 32 Trp Ala Ser 1 <210> 33 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 33 Gln Gln Tyr Thr Ser Glu Pro Ile Thr 1 5 <210> 34 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 34 Gly Phe Thr Phe Thr Ser Tyr Ala 1 5 <210> 35 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 35 Ile Asp Gly Ser Gly Gly Gly Thr 1 5 <210> 36 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 36 Ala Arg Ala Tyr Tyr Asp Ile Leu 1 5 <210> 37 <211> 12 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 37 Gln Ser Val Leu Ser Ser Tyr Asn Asn Glu Asn Asn 1 5 10 <210> 38 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 38 Ala Ala Ser 1 <210> 39 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 39 Gln Gln Tyr Tyr Ser Glu Pro Tyr Thr 1 5 <210> 40 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 40 Gly Phe Thr Phe Thr Asp Tyr Ala 1 5 <210> 41 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 41 Ile Asp Gly Ser Gly Gly Ser Thr 1 5 <210> 42 <211> 10 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 42 Ala Leu Glu Leu Gly Ala Thr Thr Val Tyr 1 5 10 <210> 43 <211> 12 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 43 Gln Ser Val Leu Arg Ser Ser Asn Asn Lys Asn Asn 1 5 10 <210> 44 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 44 Ala Ala Ser 1 <210> 45 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 45 Gln Gln Tyr Tyr Arg Glu Pro Leu Thr 1 5 <210> 46 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 46 Gly Phe Thr Phe Thr Ser Thr Gln 1 5 <210> 47 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 47 Ile Ser Gly Tyr Gly Gly Ser Thr 1 5 <210> 48 <211> 13 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 48 Ala Lys Asp Thr Glu Val Ser Gly Asp Ala Phe Asp Ile 1 5 10 <210> 49 <211> 7 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 49 Gln Ser Val Asp Ser Ser Asn 1 5 <210> 50 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 50 Gly Ala Ser 1 <210> 51 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 51 Gln Gln Tyr Arg Ser Trp Pro Ile Thr 1 5 <210> 52 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 52 Gly Phe Thr Phe Thr Ser Tyr Tyr 1 5 <210> 53 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 53 Ile Ser Gly Ser Gly Asp Ser Thr 1 5 <210> 54 <211> 15 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 54 Ala Arg Glu Ala Gly Gly Asp Tyr Asp Ser Gly Ala Phe Asp Ile 1 5 10 15 <210> 55 <211> 12 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 55 Gln Ser Val Leu Tyr Ser Gly Asn Asn Lys Asn Tyr 1 5 10 <210> 56 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 56 Gly Ala Ser 1 <210> 57 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 57 Gln Gln Tyr Asp Tyr Ala Pro Phe Thr 1 5 <210> 58 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 58 Gly Phe Thr Phe Ser Ser Tyr Ala 1 5 <210> 59 <211> 8 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 59 Ile Asp Gly Glu Gly Gly Tyr Thr 1 5 <210> 60 <211> 20 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 60 Ala Arg Glu Gly Val Asp Tyr Asp Ile Leu Thr Gly Tyr Tyr Pro Tyr 1 5 10 15 Gly Met Asp Val 20 <210> 61 <211> 12 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 61 Gln Ser Val Leu Asp Ser Ser Asn Asn Lys Asn Tyr 1 5 10 <210> 62 <211> 3 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 62 Asp Ala Ser 1 <210> 63 <211> 9 <212> PRT <213> Artificial sequence <220> <223> synthetic <400> 63 Gln Gln Gly Thr Ser Ser Pro Leu Thr 1 5 <210> 64 <211> 235 <212> PRT <213> Homo sapiens <400> 64 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Ser Gln Phe Arg Val Ser Pro Leu Asp Arg Thr 20 25 30 Trp Asn Leu Gly Glu Thr Val Glu Leu Lys Cys Gln Val Leu Leu Ser 35 40 45 Asn Pro Thr Ser Gly Cys Ser Trp Leu Phe Gln Pro Arg Gly Ala Ala 50 55 60 Ala Ser Pro Thr Phe Leu Leu Tyr Leu Ser Gln Asn Lys Pro Lys Ala 65 70 75 80 Ala Glu Gly Leu Asp Thr Gln Arg Phe Ser Gly Lys Arg Leu Gly Asp 85 90 95 Thr Phe Val Leu Thr Leu Ser Asp Phe Arg Arg Glu Asn Glu Gly Tyr 100 105 110 Tyr Phe Cys Ser Ala Leu Ser Asn Ser Ile Met Tyr Phe Ser His Phe 115 120 125 Val Pro Val Phe Leu Pro Ala Lys Pro Thr Thr Thr Pro Ala Pro Arg 130 135 140 Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg 145 150 155 160 Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly 165 170 175 Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr 180 185 190 Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Asn His 195 200 205 Arg Asn Arg Arg Arg Val Cys Lys Cys Pro Arg Pro Val Val Lys Ser 210 215 220 Gly Asp Lys Pro Ser Leu Ser Ala Arg Tyr Val 225 230 235 <210> 65 <211> 247 <212> PRT <213> Mus musculus <400> 65 Met Ala Ser Pro Leu Thr Arg Phe Leu Ser Leu Asn Leu Leu Leu Met 1 5 10 15 Gly Glu Ser Ile Ile Leu Gly Ser Gly Glu Ala Lys Pro Gln Ala Pro 20 25 30 Glu Leu Arg Ile Phe Pro Lys Lys Met Asp Ala Glu Leu Gly Gln Lys 35 40 45 Val Asp Leu Val Cys Glu Val Leu Gly Ser Val Ser Gln Gly Cys Ser 50 55 60 Trp Leu Phe Gln Asn Ser Ser Ser Lys Leu Pro Gln Pro Thr Phe Val 65 70 75 80 Val Tyr Met Ala Ser Ser His Asn Lys Ile Thr Trp Asp Glu Lys Leu 85 90 95 Asn Ser Ser Lys Leu Phe Ser Ala Val Arg Asp Thr Asn Asn Lys Tyr 100 105 110 Val Leu Thr Leu Asn Lys Phe Ser Lys Glu Asn Glu Gly Tyr Tyr Phe 115 120 125 Cys Ser Val Ile Ser Asn Ser Val Met Tyr Phe Ser Ser Val Val Pro 130 135 140 Val Leu Gln Lys Val Asn Ser Thr Thr Thr Lys Pro Val Leu Arg Thr 145 150 155 160 Pro Ser Pro Val His Pro Thr Gly Thr Ser Gln Pro Gln Arg Pro Glu 165 170 175 Asp Cys Arg Pro Arg Gly Ser Val Lys Gly Thr Gly Leu Asp Phe Ala 180 185 190 Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Ile Cys Val Ala Pro 195 200 205 Leu Leu Ser Leu Ile Ile Thr Leu Ile Cys Tyr His Arg Ser Arg Lys 210 215 220 Arg Val Cys Lys Cys Pro Arg Pro Leu Val Arg Gln Glu Gly Lys Pro 225 230 235 240 Arg Pro Ser Glu Lys Ile Val 245 <210> 66 <211> 220 <212> PRT <213> Homo sapiens <400> 66 Met Leu Arg Leu Leu Leu Ala Leu Asn Leu Phe Pro Ser Ile Gln Val 1 5 10 15 Thr Gly Asn Lys Ile Leu Val Lys Gln Ser Pro Met Leu Val Ala Tyr 20 25 30 Asp Asn Ala Val Asn Leu Ser Cys Lys Tyr Ser Tyr Asn Leu Phe Ser 35 40 45 Arg Glu Phe Arg Ala Ser Leu His Lys Gly Leu Asp Ser Ala Val Glu 50 55 60 Val Cys Val Val Tyr Gly Asn Tyr Ser Gln Gln Leu Gln Val Tyr Ser 65 70 75 80 Lys Thr Gly Phe Asn Cys Asp Gly Lys Leu Gly Asn Glu Ser Val Thr 85 90 95 Phe Tyr Leu Gln Asn Leu Tyr Val Asn Gln Thr Asp Ile Tyr Phe Cys 100 105 110 Lys Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Lys Ser 115 120 125 Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro Ser Pro 130 135 140 Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val Val Val Gly<H 145 150 155 160 Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile 165 170 175<00027\(76>Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met 180 185 190 Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro 195 200 205 Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser 210 215 220 <210> 67 <211> 81 <212> DNA <213> Homo sapiens <400> 67 ttttgggtgc tggtggtggt tggtggagtc ctggcttgct atagcttgct agtaacagtg 60 gcctttatta ttttctgggt g 81 [[ID=^1]] <210> 68 <211> 218 <212> PRT <213> Mus musculus It should be noted that there seems to be an error in the tag <00027\(76> in the original text. It might be a misprint and should probably be . The above translation is based on the corrected assumption. If this is not what you intended, please provide more context or clarify the issue.<400> 68 Met Thr Leu Arg Leu Leu Phe Leu Ala Leu Asn Phe Phe Ser Val Gln 1 5 10 15 Val Thr Glu Asn Lys Ile Leu Val Lys Gln Ser Pro Leu Leu Val Val 20 25 30 Asp Ser Asn Glu Val Ser Leu Ser Cys Arg Tyr Ser Tyr Asn Leu Leu 35 40 45 Ala Lys Glu Phe Arg Ala Ser Leu Tyr Lys Gly Val Asn Ser Asp Val 50 55 60 Glu Val Cys Val Gly Asn Gly Asn Phe Thr Tyr Gln Pro Gln Phe Arg 65 70 75 80 Ser Asn Ala Glu Phe Asn Cys Asp Gly Asp Phe Asp Asn Glu Thr Val 85 90 95 Thr Phe Arg Leu Trp Asn Leu His Val Asn His Thr Asp Ile Tyr Phe 100 105 110 Cys Lys Ile Glu Phe Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu Arg 115 120 125 Ser Asn Gly Thr Ile Ile His Ile Lys Glu Lys His Leu Cys His Thr 130 135 140 Gln Ser Ser Pro Lys Leu Phe Trp Ala Leu Val Val Val Ala Gly Val 145 150 155 160 Leu Phe Cys Tyr Gly Leu Leu Val Thr Val Ala Leu Cys Val Ile Trp 165 170 175 Thr Asn Ser Arg Arg Asn Arg Leu Leu Gln Ser Asp Tyr Met Asn Met 180 185 190 Thr Pro Arg Arg Pro Gly Leu Thr Arg Lys Pro Tyr Gln Pro Tyr Ala 195 200 205 Pro Ala Arg Asp Phe Ala Ala Tyr Arg Pro 210 215 <x210> 69 <x211> 164 <x212> PRT <x213> Homo sapiens <x400> 69 Met Lys Trp Lys Ala Leu Phe Thr Ala Ala Ile Leu Gln Ala Gln Leu 1 5 10 15 Pro Ile Thr Glu Ala Gln Ser Phe Gly Leu Leu Asp Pro Lys Leu Cys[[ID=三十二]] [[ID=三十三]]20 25 30[[ID=三十四]] [[ID=三十五]]Tyr Leu Leu Asp Gly Ile Leu Phe Ile Tyr Gly Val Ile Leu Thr Ala[[ID=三十六]] [[ID=三十七]]35 40 45[[ID=三十八]] [[ID=三十九]]Leu Phe Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr[[ID=四十]] [[ID=四十一]]50 5s 60[[ID=四十二]] [[ID=四十三]]Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg[[ID=四十四]] [[ID=四十五]]65 70 75 80[[ID=四十六]] It should be noted that there may be some inaccuracies in the translation of the specific amino acid sequence names, but overall, it tries to follow the translation rules as closely as possible while retaining the original tags and sequences. If there are more specific requirements or corrections needed for certain terms, it can be adjusted accordingly.Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met 85 90 95 Gly Gly Lys Pro Gln Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn 100 105 110 Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met 115 120 125 Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly 130 135 140 Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala 145 150 155 160 Leu Pro Pro Arg <210> 70 <211> 123 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 70 aggagtaaga ggagcaggct cctgcacagt gactacatga acatgactcc ccgccgcccc 60 gggcccaccc gcaagcatta ccagccctat gccccaccac gcgacttcgc agcctatcgc 120 tcc 123 <210> 71 <211> 255 <212> PRT <213> Homo sapiens <400> 71 Met Gly Asn Ser Cys Tyr Asn Ile Val Ala Thr Leu Leu Leu Val Leu 1 5 10 15 Asn Phe Glu Arg Thr Arg Ser Leu Gln Asp Pro Cys Ser Asn Cys Pro 20 25 30 Ala Gly Thr Phe Cys Asp Asn Asn Arg Asn Gln Ile Cys Ser Pro Cys 35 40 45 Pro Pro Asn Ser Phe Ser Ser Ala Gly Gly Gln Arg Thr Cys Asp Ile 50 55 60 Cys Arg Gln Cys Lys Gly Val Phe Arg Thr Arg Lys Glu Cys Ser Ser 65 70 75 80 Thr Ser Asn Ala Glu Cys Asp Cys Thr Pro Gly Phe His Cys Leu Gly 85 90 95 Ala Gly Cys Ser Met Cys Glu Gln Asp Cys Lys Gln Gly Gln Glu Leu 100 105 110 Thr Lys Lys Gly Cys Lys Asp Cys Cys Phe Gly Thr Phe Asn Asp Gln 115 120 125 Lys Arg Gly Ile Cys Arg Pro Trp Thr Asn Cys Ser Leu Asp Gly Lys 130 135 140 Ser Val Leu Val Asn Gly Thr Lys Glu Arg Asp Val Val Cys Gly Pro 145 150 155 160 Ser Pro Ala Asp Leu Ser Pro Gly Ala Ser Ser Val Thr Pro Pro Ala 165 170 175 Pro Ala Arg Glu Pro Gly His Ser Pro Gln Ile Ile Ser Phe Phe Leu 180 185 190 Ala Leu Thr Ser Thr Ala Leu Leu Phe Leu Leu Phe Phe Leu Thr Leu 195 200 205 Arg Phe Ser Val Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe 210 215 220 Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly 225 230 235 240 Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu 245 250 255 <210> 72 <211> 126 <212> PRT <213> Synthetic sequence <220> <223> Synthetic <400> 72 Ala Ala Ala Cys Gly Gly Gly Gly Cys Ala Gly Ala Ala Ala Gly Ala 1 5 10 15 Ala Ala Cys Thr Cys Cys Thr Gly Thr Ala Thr Ala Thr Ala Thr Thr 20 25 30 Cys Ala Ala Ala Cys Ala Ala Cys Cys Ala Thr Thr Thr Ala Thr Gly 35 40 45 Ala Gly Ala Cys Cys Ala Gly Thr Ala Cys Ala Ala Ala Cys Thr Ala 50 55 60 Cys Thr Cys Ala Ala Gly Ala Gly Gly Ala Ala Gly Ala Thr Gly Gly 65 70 75 80 Cys Thr Gly Thr Ala Gly Cys Thr Gly Cys Cys Gly Ala Thr Thr Thr 85 90 95 Cys Cys Ala Gly Ala Ala Gly Ala Ala Gly Ala Ala Gly Ala Ala Gly 100 105 110 Gly Ala Gly Gly Ala Thr Gly Thr Gly Ala Ala Cys Thr Gly 115 120 125 <210> 73 <211> 878 <212> PRT <213> Synthetic Sequence <220> <223> Synthetic <400> 73 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Arg Lys Val Cys Asn Gly Ile Gly Ile Gly 20 25 30 Glu Phe Lys Asp Ser Leu Ser Ile Asn Ala Thr Asn Ile Lys His Phe 35 40 45 Lys Asn Cys Thr Ser Ile Ser Gly Asp Leu His Ile Leu Pro Val Ala 50 55 60 Phe Arg Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp Pro Gln Glu 65 70 75 80 Leu Asp Ile Leu Lys Thr Val Lys Glu Ile Thr Gly Phe Leu Leu Ile 85 90 95 Gln Ala Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe Glu Asn Leu 100 105 110 Glu Ile Ile Arg Gly Arg Thr Lys Gln His Gly Gln Phe Ser Leu Ala 115 120 125 Val Val Ser Leu Asn Ile Thr Ser Leu Gly Leu Arg Ser Leu Lys Glu 130 135 140 Ile Ser Asp Gly Asp Val Ile Ile Ser Gly Asn Lys Asn Leu Cys Tyr 145 150 155 160 Ala Asn Thr Ile Asn Trp Lys Lys Leu Phe Gly Thr Ser Gly Gln Lys 165 170 175 Thr Lys Ile Ile Ser Asn Arg Gly Glu Asn Ser Cys Lys Ala Thr Gly 180 185 190 Gln Val Cys His Ala Leu Cys Ser Pro Glu Gly Cys Trp Gly Pro Glu 195 200 205 Pro Arg Asp Cys Val Ser Cys Arg Asn Val Ser Arg Gly Arg Glu Cys 210 215 220 Val Asp Lys Cys Asn Leu Leu Glu Gly Glu Pro Arg Glu Phe Val Glu 225 230 235 240 Asn Ser Glu Cys Ile Gln Cys His Pro Glu Cys Leu Pro Gln Ala Met 245 250 255 Asn Ile Thr Cys Thr Gly Arg Gly Pro Asp Asn Cys Ile Gln Cys Ala 260 265 270 His Tyr Ile Asp Gly Pro His Cys Val Lys Thr Cys Pro Ala Gly Val 275 280 285 Met Gly Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp Ala Gly His 290 295 300 Val Cys His Leu Cys His Pro Asn Cys Thr Tyr Gly Cys Thr Gly Pro 305 310 315 320 Gly Leu Glu Gly Cys Pro Thr Asn Gly Pro Lys Ile Pro Ser Ile Ala 325 330 335 Thr Gly Met Val Gly Ala Leu Leu Leu Leu Leu Val Val Ala Leu Gly 340 345 350 Ile Gly Leu Phe Met Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr 355 360 365 Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Leu Pro Val Thr 370 375 380 Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu His Ala Asp Ile Val Met 385 390 395 400 Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr 405 410 415 Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Asp Ser Tyr Asn Asn Glu 420 425 430 Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu 435 440 445 Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe 450 455 460 Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu 465 470 475 480 Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Thr Ser Glu 485 490 495 Pro Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Gly Gly 500 505 510 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Glu Val Gln Leu 515 520 525 Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly Ser Leu Arg Leu 530 535 540 Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr Gln Met Ser Trp 545 550 555 560 Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val Ser Gly Ile Gln 565 570 575 Gly Gly Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Lys Gly Arg Phe 580 585 590 Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr Leu Gln Met Asn 595 600 605 Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Glu Met 610 615 620 Trp Arg Gly Asp Tyr Tyr Ser Gly Met Asp Val Trp Gly Gln Gly Thr 625 630 635 640 Thr Val Thr Val Ser Ser Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu 645 650 655 Ala Ala Ala Ile Glu Val Met Tyr Pro Pro Pro Tyr Leu Asp Asn Glu 660 665 670 Lys Ser Asn Gly Thr Ile Ile His Val Lys Gly Lys His Leu Cys Pro 675 680 685 Ser Pro Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp Val Leu Val Val 690 695 700 Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe 705 710 715 720 Ile Ile Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp 725 730 735 Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr 740 745 750 Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Arg Val 755 760 765 Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn 770 775 780 Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val 785 790 795 800 Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg 805 810 815 Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys 820 825 830 Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg 835 840 845 Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys 850 855 860 Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 865 870 875 <210> 74 <211> 2637 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 74 atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60 atcccacgca aagtgtgtaa cggaataggt attggtgaat ttaaagactc actctccata 120 aatgctacga atattaaaca cttcaaaaac tgcacctcca tcagtggcga tctccacatc 180 ctgccggtgg catttagggg tgactccttc acacatactc ctcctctgga cccacaggaa 240 ctggatattc tgaaaaccgt aaaggaaatc acagggtttt tgctgattca ggcttggcct 300 gaaaacagga cggacctcca tgcctttgag aacctagaaa tcatacgcgg caggaccaag 360 caacatggtc agttttctct tgcagtcgtc agcctgaaca taacatcctt gggattacgc 420 tccctcaagg agataagtga tggagatgtg ataatttcag gaaacaaaaa tttgtgctat 480 gcaaatacaa taaactggaa aaaactgttt gggacctccg gtcagaaaac caaaattata 540 agcaacagag gtgaaaacag ctgcaaggcc acaggccagg tctgccatgc cttgtgctcc 600 cccgagggct gctggggccc ggagcccagg gactgcgtct cttgccggaa tgtcagccga 660 ggcagggaat gcgtggacaa gtgcaacctt ctggagggtg agccaaggga gtttgtggag 720 aactctgagt gcatacagtg ccacccagag tgcctgcctc aggccatgaa catcacctgc 780 acaggacggg gaccagacaa ctgtatccag tgtgcccact acattgacgg cccccactgc 840 gtcaagacct gcccggcagg agtcatggga gaaaacaaca ccctggtctg gaagtacgca 900 gacgccggcc atgtgtgcca cctgtgccat ccaaactgca cctacggatg cactgggcca 960 ggtcttgaag gctgtccaac gaatgggcct aagatcccgt ccatcgccac tgggatggtg 1020 ggggccctcc tcttgctgct ggtggtggcc ctggggatcg gcctcttcat gggttccggt 1080 gagggacggg ggtcactgct cacctgcgga gatgtagaag agaatcccgg tcccatggct ctcccagtga ctgccctact gcttccccta gcgcttctcc tgcatgcaga catcgtgatg acccagtctc cagactccct ggctgtgtct ctgggcgagc gtgccaccat caactgcaag 1260 tccagccaga gtgttttaga cagctataac aatgagaca atttagcttg gtatcagcag aaaccaggac agcctcctaa gctgctcatt tactgggcat ctacccgga atccggggtc cctgaccgat tcagtggcag cgggtctggg acagatttca ctctcaccat cagcagcctg 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500. 1500 ggccaaggta ccaaggtgga aatcaaaggc gggggtggta gtggcggtgg aggtagcgga ggtggcgggt ctgaggtgca gctgttggag tctgggggag gcttggtaca gcctgggggg 1620 tccctgcgac tctcctgtgc agcctctgga ttcaccttta gcgactatca gatgagctgg 1680 gtccgccagg ctccaggga ggggctggag tgggtgtcag gcattcaggg tggcggtggt 1740. agcacatatt acgcagactc cgtgaagggc cggttcacca tctcccgtga caattccaag aaccgctgt atctgcaaat gaacagcctg cgtgccgagg acacggctgt gtattactgt 1860 gcgagagaga tgtggcgtgg ggactactac tccggtatgg acgtctgggg ccaggggacc 1920 acggtcaccg tctcctcaga acagaaactg atctctgaag aagacctggc ggccgcaatt 1980 gaagttatgt atcctcctcc ttacctagac aatgagaaga gcaatggaac cattatccat 2040 gtgaaaggga aacacctttg tccaagtccc ctatttcccg gaccttctaa gcccttttgg 2100 gtgctggtgg tggttggtgg agtcctggct tgctatagct tgctagtaac agtggccttt 2160 attattttct gggtgaggag taagaggagc aggctcctgc acagtgacta catgaacatg 2220 actccccgcc gccccgggcc cacccgcaag cattaccagc cctatgcccc accacgcgac 2280 ttcgcagcct atcgctccag agtgaagttc agcaggagcg cagacgcccc cgcgtaccag 2340 cagggccaga accagctcta taacgagctc aatctaggac gaagagagga gtacgatgtt 2400 ttggacaaga gacgtggccg ggaccctgag atggggggaa agccgagaag gaagaaccct 2460 caggaaggcc tgtacaatga actgcagaaa gataagatgg cggaggccta cagtgagatt 2520 gggatgaaag gcgagcgccg gaggggcaag gggcacgatg gcctttacca gggtctcagt 2580 acagccacca aggacaccta cgacgccctt cacatgcagg ccctgccccc tcgctag 2637 <210> 75 <211> 883 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 75 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Arg Lys Val Cys Asn Gly Ile Gly Ile Gly 20 25 30 Glu Phe Lys Asp Ser Leu Ser Ile Asn Ala Thr Asn Ile Lys His Phe<9003098>35 40 45 Lys Asn Cys Thr Ser Ile Ser Gly Asp Leu His Ile Leu Pro Val Ala 50 55 60 Phe Arg Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp Pro Gln Glu 65 70 75 80 Leu Asp Ile Leu Lys Thr Val Lys Glu Ile Thr Gly Phe Leu Leu Ile 85 90 95 Gln Ala Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe Glu Asn Leu 100 105 110 Glu Ile Ile Arg Gly Arg Thr Lys Gln His Gly Gln Phe Ser Leu Ala 115 120 125 Val Val Ser Leu Asn Ile Thr Ser Leu Gly Leu Arg Ser Leu Lys Glu 130 135 140 Ile Ser Asp Gly Asp Val Ile Ile Ser Gly Asn Lys Asn Leu Cys Tyr 145 150 155 160 Ala Asn Thr Ile Asn Trp Lys Lys Leu Phe Gly Thr Ser Gly Gln Lys 165 170 175 Thr Lys Ile Ile Ser Asn Arg Gly Glu Asn Ser Cys Lys Ala Thr Gly 180 185 190 Gln Val Cys His Ala Leu Cys Ser Pro Glu Gly Cys Trp Gly Pro Glu 195 200 205 Pro Arg Asp Cys Val Ser Cys Arg Asn Val Ser Arg Gly Arg Glu Cys 210 215 220 Val Asp Lys Cys Asn Leu Leu Glu Gly Glu Pro Arg Glu Phe Val Glu 225 230 235 240 Asn Ser Glu Cys Ile Gln Cys His Pro Glu Cys Leu Pro Gln Ala Met 245 250 255 Asn Ile Thr Cys Thr Gly Arg Gly Pro Asp Asn Cys Ile Gln Cys Ala 260 265 270 His Tyr Ile Asp Gly Pro His Cys Val Lys Thr Cys Pro Ala Gly Val 275 280 285 Met Gly Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp Ala Gly His 290 295 300 Val Cys His Leu Cys His Pro Asn Cys Thr Tyr Gly Cys Thr Gly Pro 305 310 315 320 Gly Leu Glu Gly Cys Pro Thr Asn Gly Pro Lys Ile Pro Ser Ile Ala 325 330 335 Thr Gly Met Val Gly Ala Leu Leu Leu Leu Leu Val Val Ala Leu Gly 340 345 350 Ile Gly Leu Phe Met Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr 355 360 365 Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Leu Pro Val Thr 370 375 380 Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu His Ala Asp Ile Val Met 385 390 395 400 Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr 405 410 415 Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Asp Ser Tyr Asn Asn Glu 420 425 430 Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu 435 440 445 Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe 450 455 460 Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu 465 470 475 480 Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Thr Ser Glu 485 490 495 Pro Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Gly Gly 500 505 510 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser 515 520 525 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 530 535 540 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 545 550 555 560 Gln Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 565 570 575 Ser Gly Ile Gln Gly Gly Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 580 585 590 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 595 600 605 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 610 615 620 Ala Arg Glu Met Trp Arg Gly Asp Tyr Tyr Ser Gly Met Asp Val Trp 625 630 635 640 Gly Gln Gly Thr Thr Val Thr Val Ser Ser Glu Gln Lys Leu Ile Ser 645 650 655 Glu Glu Asp Leu Ala Ala Ala Ile Glu Val Met Tyr Pro Pro Pro Tyr 660 665 670 Leu Asp Asn Glu Lys Ser Asn Gly Thr Ile Ile His Val Lys Gly Lys 675 680 685 His Leu Cys Pro Ser Pro Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp 690 695 700 Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val 705 710 715 720 Thr Val Ala Phe Ile Ile Phe Trp Val Lys Arg Gly Arg Lys Lys Leu 725 730 735 Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln 740 745 750 Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly 755 760 765 Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr 770 775 780 Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg 785 790 795 800 Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met 805 810 815 Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu 820 825 830 Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys 835 840 845 Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu 850 855 860 Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu 865 870 875 880 Pro Pro Arg <210> 76 <211> 2652 <212> DNA <213> Artificial Sequence <220> <223> Synthetic <400> 76 atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60 atcccacgca aagtgtgtaa cggaataggt attggtgaat ttaaagactc actctccata 120 aatgctacga atattaaaca cttcaaaaac tgcacctcca tcagtggcga tctccacatc 180 ctgccggtgg catttagggg tgactccttc acacatactc ctcctctgga cccacaggaa 240 ctggatattc tgaaaaccgt aaaggaaatc acagggtttt tgctgattca ggcttggcct 300 gaaaacagga cggacctcca tgcctttgag aacctagaaa tcatacgcgg caggaccaag 360 caacatggtc agttttctct tgcagtcgtc agcctgaaca taacatcctt gggattacgc 420 tccctcaagg agataagtga tggagatgtg ataatttcag gaaacaaaaa tttgtgctat 480 gcaaatacaa taaactggaa aaaactgttt gggacctccg gtcagaaaac caaaattata 540 agcaacagag gtgaaaacag ctgcaaggcc acaggccagg tctgccatgc cttgtgctcc 600 cccgagggct gctggggccc ggagcccagg gactgcgtct cttgccggaa tgtcagccga 660 ggcagggaat gcgtggacaa gtgcaacctt ctggagggtg agccaaggga gtttgtggag 720 aactctgagt gcatacagtg ccacccagag tgcctgcctc aggccatgaa catcacctgc 780 acaggacggg gaccagacaa ctgtatccag tgtgcccact acattgacgg cccccactgc 840 gtcaagacct gcccggcagg agtcatggga gaaaacaaca ccctggtctg gaagtacgca 900 gacgccggcc atgtgtgcca cctgtgccat ccaaactgca cctacggatg cactgggcca 960 ggtcttgaag gctgtccaac gaatgggcct aagatcccgt ccatcgccac tgggatggtg 1020 ggggccctcc tcttgctgct ggtggtggcc ctggggatcg gcctcttcat gggttccggt 1080 gagggacggg ggtcactgct cacctgcgga gatgtagaag agaatcccgg tcccatggct 1140 ctcccagtga ctgccctact gcttccccta gcgcttctcc tgcatgcaga catcgtgatg 1200 acccagtctc cagactccct ggctgtgtct ctgggcgagc gtgccaccat caactgcaag 1260 tccagccaga gtgttttaga cagctataac aatgagaaca atttagcttg gtatcagcag 1320 aaaccaggac agcctcctaa gctgctcatt tactgggcat ctacccggga atccggggtc 1380 cctgaccgat tcagtggcag cgggtctggg acagatttca ctctcaccat cagcagcctg 1440 caggctgaag atgtggcagt ttattactgt cagcaatata ccagcgaacc tatcacgttc 1500 ggccaaggta ccaaggtgga aatcaaaggt ggtggtggtt caggtggtgg tggttctggc 1560 ggcggctccg gtggtggtgg atccgaggtg cagctgttgg agtctggggg aggcttggta 1620 cagcctgggg ggtccctgcg actctcctgt gcagcctctg gattcacctt tagcgactat 1680 cagatgagct gggtccgcca ggctccaggg aaggggctgg agtgggtgtc aggcattcag 1740 ggtggcggtg gtagcacata ttacgcagac tccgtgaagg gccggttcac catctcccgt 1800 gacaattcca agaacacgct gtatctgcaa atgaacagcc tgcgtgccga ggacacggct 1860 gtgtattact gtgcgagaga gatgtggcgt ggggactact actccggtat ggacgtctgg 1920 ggccagggga ccacggtcac cgtctcctca gaacagaaac tgatctctga agaagacctg 1980 gcggccgcaa ttgaagttat gtatcctcct ccttacctag acaatgagaa gagcaatgga 2040 accattatcc atgtgaaagg gaaacacctt tgtccaagtc ccctatttcc cggaccttct 2100 aagccctttt gggtgctggt ggtggttggt ggagtcctgg cttgctatag cttgctagta 2160 acagtggcct ttattatttt ctgggtgaaa cggggcagaa agaaactcct gtatatattc 2220 aaacaaccat ttatgagacc agtacaaact actcaagagg aagatggctg tagctgccga 2280 tttccagaag aagaagaagg aggatgtgaa ctgagagtga agttcagcag gagcgcagac 2340 gcccccgcgt accagcaggg ccagaaccag ctctataacg agctcaatct aggacgaaga 2400 gaggagtacg atgttttgga caagagacgt ggccgggacc ctgagatggg gggaaagccg 2460 agaaggaaga accctcagga aggcctgtac aatgaactgc agaaagataa gatggcggag 2520 gcctacagtg agattgggat gaaaggcgag cgccggaggg gcaaggggca cgatggcctt 2580 taccagggtc tcagtacagc caccaaggac acctacgacg cccttcacat gcaggccctg 2640 ccccctcgct ag 2652 <210> 77 <211> 882 <212> PRT <213> Synthetic Sequence <220> <223> Synthetic <400> 77 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Arg Lys Val Cys Asn Gly Ile Gly Ile Gly 20 25 30 Glu Phe Lys Asp Ser Leu Ser Ile Asn Ala Thr Asn Ile Lys His Phe 35 40 45 Lys Asn Cys Thr Ser Ile Ser Gly Asp Leu His Ile Leu Pro Val Ala 50 55 60 Phe Arg Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp Pro Gln Glu 65 70 75 80 Leu Asp Ile Leu Lys Thr Val Lys Glu Ile Thr Gly Phe Leu Leu Ile 85 90 95 Gln Ala Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe Glu Asn Leu 100 105 110 Glu Ile Ile Arg Gly Arg Thr Lys Gln His Gly Gln Phe Ser Leu Ala 115 120 125 Val Val Ser Leu Asn Ile Thr Ser Leu Gly Leu Arg Ser Leu Lys Glu 130 135 140 Ile Ser Asp Gly Asp Val Ile Ile Ser Gly Asn Lys Asn Leu Cys Tyr 145 150 155 160 Ala Asn Thr Ile Asn Trp Lys Lys Leu Phe Gly Thr Ser Gly Gln Lys 165 170 175 Thr Lys Ile Ile Ser Asn Arg Gly Glu Asn Ser Cys Lys Ala Thr Gly 180 185 190 Gln Val Cys His Ala Leu Cys Ser Pro Glu Gly Cys Trp Gly Pro Glu 195 200 205 Pro Arg Asp Cys Val Ser Cys Arg Asn Val Ser Arg Gly Arg Glu Cys 210 215 220 Val Asp Lys Cys Asn Leu Leu Glu Gly Glu Pro Arg Glu Phe Val Glu 225 230 235 240 Asn Ser Glu Cys Ile Gln Cys His Pro Glu Cys Leu Pro Gln Ala Met 245 250 255 Asn Ile Thr Cys Thr Gly Arg Gly Pro Asp Asn Cys Ile Gln Cys Ala 260 265 270 His Tyr Ile Asp Gly Pro His Cys Val Lys Thr Cys Pro Ala Gly Val 275 280 285 Met Gly Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp Ala Gly His 290 295 300 Val Cys His Leu Cys His Pro Asn Cys Thr Tyr Gly Cys Thr Gly Pro 305 310 315 320 Gly Leu Glu Gly Cys Pro Thr Asn Gly Pro Lys Ile Pro Ser Ile Ala 325 330 335 Thr Gly Met Val Gly Ala Leu Leu Leu Leu Leu Val Val Ala Leu Gly 340 345 350 Ile Gly Leu Phe Met Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr 355 360 365 Cys Gly Asp Val Glu Glu Asn Pro Gly Pro Met Ala Leu Pro Val Thr 370 375 380 Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu His Ala Asp Ile Val Met 385 390 395 400 Thr Gln Ser Pro Asp Ser Leu Ala Val Ser Leu Gly Glu Arg Ala Thr 405 410 415 Ile Asn Cys Lys Ser Ser Gln Ser Val Leu Asp Ser Tyr Asn Asn Glu 420 425 430 Asn Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu 435 440 445 Leu Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Asp Arg Phe 450 455 460 Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu 465 470 475 480 Gln Ala Glu Asp Val Ala Val Tyr Tyr Cys Gln Gln Tyr Thr Ser Glu 485 490 495 Pro Ile Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Gly Gly Gly 500 505 510 Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Gly Ser 515 520 525 Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 530 535 540 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asp Tyr 545 550 555 560 Gln Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 565 570 575 Ser Gly Ile Gln Gly Gly Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val 580 585 590 Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr 595 600 605 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 610 615 620 Ala Arg Glu Met Trp Arg Gly Asp Tyr Tyr Ser Gly Met Asp Val Trp 625 630 635 640 Gly Gln Gly Thr Thr Val Thr Val Ser Ser Glu Gln Lys Leu Ile Ser 645 650 655 Glu Glu Asp Leu Ala Ala Ala Ile Glu Val Met Tyr Pro Pro Pro Tyr 660 665 670 Leu Asp Asn Glu Lys Ser Asn Gly Thr Ile Ile His Val Lys Gly Lys 675 680 685 His Leu Cys Pro Ser Pro Leu Phe Pro Gly Pro Ser Lys Pro Phe Trp 690 695 700 Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val 705 710 715 720 Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser Lys Arg Ser Arg Leu 725 730 735 Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr 740 745 750 Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr 755 760 765 Arg Ser Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln 770 775 780 Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu 785 790 795 800 Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly 805 810 815 Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu 820 825 830 Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly 835 840 845 Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser 850 855 860 Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro 865 870 875 880 Pro Arg <210> 78 <211> 2649 <212> DNA <213> Artificial sequence <220> <223> Synthetic <400> 78 atgcttctcc tggtgacaag ccttctgctc tgtgagttac cacacccagc attcctcctg 60 atcccacgca aagtgtgtaa cggaataggt attggtgaat ttaaagactc actctccata 120 aatgctacga atattaaaca cttcaaaaac tgcacctcca tcagtggcga tctccacatc 180 ctgccggtgg catttagggg tgactccttc acacatactc ctcctctgga cccacaggaa 240 ctggatattc tgaaaaccgt aaaggaaatc acagggtttt tgctgattca ggcttggcct 300 gaaaacagga cggacctcca tgcctttgag aacctagaaa tcatacgcgg caggaccaag 360 caacatggtc agttttctct tgcagtcgtc agcctgaaca taacatcctt gggattacgc 420 tccctcaagg agataagtga tggagatgtg ataatttcag gaaacaaaaa tttgtgctat 480 gcaaatacaa taaactggaa aaaactgttt gggacctccg gtcagaaaac caaaattata 540 agcaacagag gtgaaaacag ctgcaaggcc acaggccagg tctgccatgc cttgtgctcc 600 cccgagggct gctggggccc ggagcccagg gactgcgtct cttgccggaa tgtcagccga 660 ggcagggaat gcgtggacaa gtgcaacctt ctggagggtg agccaaggga gtttgtggag 720 aactctgagt gcatacagtg ccacccagag tgcctgcctc aggccatgaa catcacctgc 780 acaggacggg gaccagacaa ctgtatccag tgtgcccact acattgacgg cccccactgc 840 gtcaagacct gcccggcagg agtcatggga gaaaacaaca ccctggtctg gaagtacgca 900 gacgccggcc atgtgtgcca cctgtgccat ccaaactgca cctacggatg cactgggcca 960 ggtcttgaag gctgtccaac gaatgggcct aagatcccgt ccatcgccac tgggatggtg 1020 ggggccctcc tcttgctgct ggtggtggcc ctggggatcg gcctcttcat gggttccggt 1080 gagggacggg ggtcactgct cacctgcgga gatgtagaag agaatcccgg tcccatggct 1140 ctcccagtga ctgccctact gcttccccta gcgcttctcc tgcatgcaga catcgtgatg 1200 acccagtctc cagactccct ggctgtgtct ctgggcgagc gtgccaccat caactgcaag 1260 tccagccaga gtgttttaga cagctataac aatgagaaca atttagcttg gtatcagcag 1320 aaaccaggac agcctcctaa gctgctcatt tactgggcat ctacccggga atccggggtc 1380 cctgaccgat tcagtggcag cgggtctggg acagatttca ctctcaccat cagcagcctg 1440 caggctgaag atgtggcagt ttattactgt cagcaatata ccagcgaacc tatcacgttc 1500 ggccaaggta ccaaggtgga aatcaaaggt ggtggtggtt caggtggtgg tggttctggc 1560 ggcggctccg gtggtggtgg atccgaggtg cagctgttgg agtctggggg aggcttggta 1620 cagcctgggg ggtccctgcg actctcctgt gcagcctctg gattcacctt tagcgactat 1680 cagatgagct gggtccgcca ggctccaggg aaggggctgg agtgggtgtc aggcattcag 1740 ggtggcggtg gtagcacata ttacgcagac tccgtgaagg gccggttcac catctcccgt 1800 gacaattcca agaacacgct gtatctgcaa atgaacagcc tgcgtgccga ggacacggct 1860 gtgtattact gtgcgagaga gatgtggcgt ggggactact actccggtat ggacgtctgg 1920 ggccagggga ccacggtcac cgtctcctca gaacagaaac tgatctctga agaagacctg 1980 gcggccgcaa ttgaagttat gtatcctcct ccttacctag acaatgagaa gagcaatgga 2040 accattatcc atgtgaaagg gaaacacctt tgtccaagtc ccctatttcc cggaccttct 2100 aagcccttt gggtgctggt ggtggttggt ggagtcctgg cttgctatag cttgctagta 2160 acagtggcct ttattatttt ctgggtgagg agtaagagga gcaggctcct gcacagtgac 2220 tacatgaaca tgactccccg ccgccccggg cccacccgca agcattacca gccctatgcc 2280 ccaccacgcg acttcgcagc ctatcgctcc agagtgaagt tcagcaggag cgcagacgcc 2340 cccgcgtacc agcagggcca gaaccagctc tataacgagc tcaatctagg acgaagagag 2400 gagtacgatg ttttggacaa gagacgtggc cgggaccctg agatgggggg aaagccgaga 2460 aggaagaacc ctcaggaagg cctgtacaat gaactgcaga aagataagat ggcggaggcc 2520 tacagtgaga ttgggatgaa aggcgagcgc cggaggggca aggggcacga tggcctttac 2580 cagggtctca gtacagccac caaggacacc tacgacgccc ttcacatgca ggccctgccc 2640 cctcgctag 2649 <210> 79 <211> 878 <212> PRT <213> Artificial Sequence <220> <223> Synthetic <400> 79 Met Leu Leu Leu Val Thr Ser Leu Leu Leu Cys Glu Leu Pro His Pro 1 5 10 15 Ala Phe Leu Leu Ile Pro Arg Lys Val Cys Asn Gly Ile Gly Ile Gly 20 25 30 Glu Phe Lys Asp Ser Leu Ser Ile Asn Ala Thr Asn Ile Lys His Phe 35 40 45 Lys Asn Cys Thr Ser Ile Ser Gly Asp Leu His Ile Leu Pro Val Ala 50 55 60 Phe Arg Gly Asp Ser Phe Thr His Thr Pro Pro Leu Asp Pro Gln Glu 65 70 75 80 Leu Asp Ile Leu Lys Thr Val Lys Glu Ile Thr Gly Phe Leu Leu Ile 85 90 95 Gln Ala Trp Pro Glu Asn Arg Thr Asp Leu His Ala Phe Glu Asn Leu 100 105 110 Glu Ile Ile Arg Gly Arg Thr Lys Gln His Gly Gln Phe Ser Leu Ala 115 120 125 Val Val Ser Leu Asn Ile Thr Ser Leu Gly Leu Arg Ser Leu Lys Glu 130 135 140 Ile Ser Asp Gly Asp Val Ile Ile Ser Gly Asn Lys Asn Leu Cys Tyr 145 150 155 160 Ala Asn Thr Ile Asn Trp Lys Lys Leu Phe Gly Thr Ser Gly Gln Lys 165 170 175 Thr Lys Ile Ile Ser Asn Arg Gly Glu Asn Ser Cys Lys Ala Thr Gly 180 185 190 Gln Val Cys His Ala Leu Cys Ser Pro Glu Gly Cys Trp Gly Pro Glu 195 200 205 Pro Arg Asp Cys Val Ser Cys Arg Asn Val Ser Arg Gly Arg Glu Cys 210 215 220 Val Asp Lys Cys Asn Leu Leu Glu Gly Glu Pro Arg Glu Phe Val Glu 225 230 235 240 Asn Ser Glu Cys Ile Gln Cys His Pro Glu Cys Leu Pro Gln Ala Met 245 250 255 Asn Ile Thr Cys Thr Gly Arg Gly Pro Asp Asn Cys Ile Gln Cys Ala 260 265 270 His Tyr Ile Asp Gly Pro His Cys Val Lys Thr Cys Pro Ala Gly Val 275 280 285 Met Gly Glu Asn Asn Thr Leu Val Trp Lys Tyr Ala Asp Ala Gly His 290 295 300 Val Cys His Leu Cys His Pro Asn Cys Thr Tyr Gly Cys Thr Gly Pro 305 310 ...

Claims

1. An antigen recognition receptor, comprising an extracellular antigen binding domain, a transmembrane domain and an intracellular signaling domain, wherein the extracellular antigen binding domain specifically binds to CD371 and comprises a heavy chain variable region comprising a CDR1 as shown in SEQ ID NO:28, a CDR2 as shown in SEQ ID NO:29 and a CDR3 as shown in SEQ ID NO:30, and a light chain variable region comprising a CDR1 as shown in SEQ ID NO:31, a CDR2 as shown in SEQ ID NO:32 and a CDR3 as shown in SEQ ID NO:

33.

2. The antigen recognition receptor according to claim 1, wherein the extracellular antigen binding domain is a single-chain variable fragment (scFv).

3. The antigen recognition receptor according to claim 2, wherein the extracellular antigen binding domain is a human scFv.

4. The antigen recognition receptor according to claim 1, wherein the extracellular antigen binding domain is a Fab, which is optionally cross-linked. The antigen recognition receptor according to claim 1 , wherein the extracellular antigen binding domain is F(ab) 2 .

6. The antigen recognition receptor according to any one of claims 2 to 5, wherein one or more of scFv, Fab and F(ab)2 is contained in a fusion protein with a heterologous sequence to form the extracellular antigen binding domain.

7. An antigen recognition receptor according to any one of claims 1-5, wherein the extracellular antigen binding domain comprises a heavy chain variable region whose amino acid sequence is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO:

1.

8. The antigen recognition receptor according to any one of claims 1 to 5, wherein the extracellular antigen binding domain comprises a heavy chain variable region having an amino acid sequence as shown in SEQ ID NO:

1.

9. The antigen recognition receptor according to any one of claims 1-5, wherein the extracellular antigen binding domain comprises a light chain variable region whose amino acid sequence is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO:

2.

10. The antigen recognition receptor according to any one of claims 1 to 5, wherein the extracellular antigen binding domain comprises a light chain variable region having an amino acid sequence as shown in SEQ ID NO:

2.

11. An antigen recognition receptor according to any one of claims 1-5, wherein the extracellular antigen binding domain comprises: (a) a heavy chain variable region whose amino acid sequence is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO:1; and (b) a light chain variable region whose amino acid sequence is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO:

2.

12. The antigen recognition receptor according to any one of claims 1 to 5, wherein the extracellular antigen binding domain comprises a heavy chain variable region whose amino acid sequence is shown in SEQ ID NO: 1; and a light chain variable region whose amino acid sequence is shown in SEQ ID NO:

2.

13. The antigen recognition receptor according to any one of claims 1 to 5, wherein the extracellular antigen binding domain comprises a linker between the heavy chain variable region and the light chain variable region of the extracellular antigen binding domain.

14. The antigen recognition receptor according to claim 13, wherein the amino acid sequence of the linker is shown in SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:91, SEQ ID NO:92, SEQ ID NO:93, or SEQ ID NO:

94.

15. The antigen recognition receptor according to claim 14, wherein the amino acid sequence of the linker is shown in SEQ ID NO: 13 or SEQ ID NO:

14.

16. The antigen recognition receptor according to any one of claims 1 to 5, wherein the extracellular antigen binding domain comprises a signal peptide covalently linked to the 5' end of the extracellular antigen binding domain.

17. The antigen recognition receptor according to any one of claims 1 to 3, wherein the extracellular antigen binding domain comprises a heavy chain variable region and a light chain variable region, and the positions of the heavy chain variable region and the light chain variable region from the N-terminus to the C-terminus are: V H -V L .

18. The antigen recognition receptor according to any one of claims 1 to 5, wherein the extracellular antigen binding domain binds to CD371 with low binding affinity.

19. The antigen recognition receptor according to any one of claims 1 to 5, wherein the extracellular antigen binding domain is 1×10 -8 M or higher dissociation constant (K d ) binds to CD371.

20. The antigen recognition receptor according to any one of claims 1-5, wherein the transmembrane domain comprises a CD8 polypeptide, a CD28 polypeptide, a CD3ζ polypeptide, a CD4 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a CTLA-4 polypeptide, a PD-1 polypeptide, a LAG-3 polypeptide, a 2B4 polypeptide, a BTLA polypeptide, or a combination thereof.

21. The antigen recognition receptor according to claim 20, wherein the transmembrane domain comprises a CD28 polypeptide.

22. The antigen recognition receptor according to any one of claims 1-5, wherein the intracellular signaling domain comprises a CD3 zeta polypeptide.

23. The antigen recognition receptor according to any one of claims 1-5, wherein the intracellular signaling domain further comprises at least one co-stimulatory signaling region.

24. The antigen recognition receptor of claim 23, wherein the at least one co-stimulatory signaling region comprises a CD28 polypeptide, a 4-1BB polypeptide, an OX40 polypeptide, an ICOS polypeptide, a DAP-10 polypeptide, or a combination thereof.

25. The antigen recognition receptor according to claim 23, wherein the at least one co-stimulatory signaling region comprises a CD28 polypeptide or a 4-1BB polypeptide.

26. The antigen recognition receptor according to any one of claims 1-5, wherein the antigen recognition receptor is a chimeric antigen receptor (CAR), a T cell receptor (TCR), or a T cell-like fusion protein.

27. The antigen recognition receptor according to any one of claims 1-5, wherein the antigen recognition receptor is CAR.

28. The antigen recognition receptor according to claim 27, wherein the amino acid sequence of the CAR is as shown in SEQ ID NO:

99.

29. A cell comprising the antigen recognition receptor according to any one of claims 1-28.

30. The cell of claim 29, wherein the cell is transduced with the antigen recognition receptor.

31. The cell of claim 29 or 30, wherein the antigen recognition receptor is constitutively expressed on the surface of the cell.

32. The cell of claim 29 or 30, wherein the cell is engineered to express a cytokine.

33. The cell of claim 32, wherein the cell comprises an exogenous polypeptide of the cytokine.

34. The cell of claim 32, wherein the cell comprises a nucleic acid molecule encoding the cytokine.

35. The cell of claim 32, wherein the cytokine is selected from IL-18, IL-33, IL-36, and combinations thereof.

36. The cell of claim 32, wherein the cytokine is IL-18.

37. The cell of claim 29 or 30, wherein the cell is an immune response cell.

38. The cell of claim 29 or 30, wherein the cell is a cell of lymphoid lineage or a cell of myeloid lineage.

39. The cell of claim 29 or 30, wherein the cell is selected from the group consisting of a T cell, a natural killer (NK) cell, and a stem cell that can differentiate into a lymphoid cell.

40. The cell of claim 29 or 30, wherein the cell is a T cell.

41. The cell of claim 40, wherein the T cell is a cytotoxic T lymphocyte (CTL) or a regulatory T cell.

42. The cell of claim 39, wherein the stem cell is a pluripotent stem cell.

43. The cell of claim 42, wherein the pluripotent stem cell is an embryonic stem cell or an induced pluripotent stem cell.

44. A nucleic acid molecule encoding the antigen recognition receptor according to any one of claims 1-28.

45. The nucleic acid molecule according to claim 44, wherein the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:

22.

46. ​​The nucleic acid molecule according to claim 44, wherein the nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO:

100.

47. A vector comprising the nucleic acid molecule according to any one of claims 44-46.

48. The vector of claim 47, wherein the vector is a gamma-retroviral vector.

49. A host cell expressing a nucleic acid molecule according to any one of claims 44-46.

50. The host cell of claim 49, wherein the host cell is a T cell.

51. A composition comprising the cells of any one of claims 29-43.

52. The composition according to claim 51, which is a pharmaceutical composition further comprising a pharmaceutically acceptable carrier.

53. Use of an effective amount of a cell according to any one of claims 29-43 or a composition according to claim 51 or 52 in the preparation of a medicament for reducing tumor burden in a subject, for increasing or prolonging the survival of a subject suffering from a tumor or neoplasia, and / or for treating and / or preventing a tumor or neoplasia in a subject; wherein the tumor or neoplasia is selected from the group consisting of acute myeloid leukemia (AML), multiple myeloma, non-Hodgkin's lymphoma, Hodgkin's lymphoma, chronic lymphocytic leukemia (CLL), glioblastoma, myelodysplastic syndrome (MDS), and chronic myeloid leukemia (CML).

54. The use of claim 53, wherein the medicament reduces the number of tumor cells in the subject, reduces the size of a tumor in the subject, and / or eradicates a tumor in the subject.

55. The use according to any one of claims 53-54, wherein the tumor or neoplasia is acute myeloid leukemia (AML).

56. A method for producing a cell comprising an antigen recognition receptor according to any one of claims 1-28, comprising introducing a nucleic acid molecule encoding the antigen recognition receptor into the cell.

57. A kit for reducing tumor burden in a subject, treating and / or preventing a tumor or neoplasia in a subject, and / or increasing or prolonging the survival of a subject suffering from a tumor or neoplasia, comprising a cell according to any one of claims 29-43.

Images