A silicon-based rhodamine compound, a preparation method thereof, a fluorescent modified nucleotide and a kit

By using silicon-based rhodamine compounds to improve the linking mechanism of fluorescently modified nucleotides, the problem of poor selectivity of fluorescent dyes in DNA sequencing of multiple fluorescently labeled nucleotides was solved, resulting in improved fluorescence intensity and incorporation efficiency, reduced sequencing costs and errors, and improved sequencing speed and accuracy.

CN114656499BActive Publication Date: 2026-04-21SIKUN LIFE SCIENCE CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
SIKUN LIFE SCIENCE CO LTD
Filing Date
2020-12-24
Publication Date
2026-04-21

AI Technical Summary

Technical Problem

Existing multiplex fluorescently labeled nucleotides suffer from poor selectivity of fluorescent dyes and incompatibility with other reagents during DNA sequencing, affecting sequencing speed and accuracy, and are also costly.

Method used

Silicon-based rhodamine compounds are used as fluorescently modified nucleotides. They are attached to nucleotides via covalent linkage or surface conjugation to improve the sequence-specific interaction between the fluorescent compound and nucleobases, thereby increasing fluorescence intensity and incorporation efficiency. Furthermore, they are linked to the core structure of the fluorescent compound rhodamine through a heteroalkyl structure containing dioxygen, which enhances fluorescence stability.

Benefits of technology

It improves the fluorescence intensity and incorporation efficiency of fluorescently modified nucleotides, reduces sequencing errors, reduces the cost of nucleic acid sequencing, and improves sequencing speed and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114656499B_ABST
    Figure CN114656499B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of organic compound reagent, specifically relates to a silicon-based rhodamine compound and a preparation method thereof, fluorescent modified nucleotide and kit, wherein the fluorescent modified nucleotide can be applied to the nucleic acid sequencing reaction of sequencing by synthesis. The present application creatively improves -COR 11 The connection structure between the fluorescent compound dye core structure adopts a heteroalkyl structure containing dioxygen -O-(CH2) m -O-(CH2) n -COR 11 As the connection structure, the connecting group -COR The silicon-based rhodamine compound is connected to the fluorescent compound core structure, and the fluorescence stability, fluorescence intensity and incorporation efficiency of the modified nucleotide formed by the silicon-based rhodamine compound as a modified molecule used in the nucleic acid sequencing reaction are improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of organic compound reagent technology, specifically to a silicon-based rhodamine compound and its preparation method, fluorescently modified nucleotides, and a reagent kit, wherein the fluorescently modified nucleotides are used in nucleic acid sequencing. Background Technology

[0002] DNA sequencing, as an important experimental technique, has wide applications in biological research. DNA sequencing technology was reported shortly after the discovery of the DNA double helix structure, but the complex procedures at that time prevented large-scale implementation. Then, in 1977, Sanger invented the landmark end-termination sequencing method, and in the same year, A.M. Maxam and W. Gilbert invented the chemical degradation method. The Sanger method, due to its simplicity and speed, and through continuous improvements, has become the mainstream DNA sequencing method to this day. However, with the development of science, traditional Sanger sequencing can no longer fully meet the needs of research. Genome resequencing of model organisms and genome sequencing of some non-model organisms require sequencing technologies that are cheaper, have higher throughput, and are faster. Next-generation sequencing (NGS) emerged to meet this need. The basic principle of NGS is sequencing-by-synthesis. Four different dNTPs are labeled with different colored fluorescent markers. When DNA polymerase synthesizes the complementary strand, each addition of a dNTP releases a different fluorescence. Based on the captured fluorescence signals and processed by specific computer software, the sequence information of the DNA to be tested is obtained.

[0003] However, the fundamental principle of sequencing using multiplex fluorescently labeled nucleotides is to distinguish different nucleotides through the spectral distinguishability of multiplex fluorescence. This spectral distinguishability can be reflected in the distinguishability of absorption spectra or emission spectra. Multiplex fluorescence detection is limited by several factors in the selection of fluorescent labels. For example, the most important factor is the compatibility of the fluorescent dye with other reagents used, such as buffers, polymerases, and ligases. In particular, the nucleic acid modified by the fluorescent dye must be recognizable by the polymerase. Furthermore, with the continuous development of sequencing technology, researchers have found that fluorescent dye molecules with improved fluorescence properties (e.g., fluorescence intensity, the position of the fluorescence peak, and the shape of the fluorescence band) can improve the speed and accuracy of nucleic acid sequencing. Since the buffer environment, temperature environment, and base structure of the sequencing reaction all affect the luminescence performance of fluorescent compounds, such as fluorescence peak and fluorescence intensity, researchers have gradually begun to improve the structure of fluorescent compounds to enhance the sequence-specific interaction between the fluorescent compound and the nucleobases, thereby improving the luminescence performance of the fluorescent compound during the sequencing process. Meanwhile, improving the structure of fluorescent compounds to increase the efficiency of modified nucleotide incorporation, reduce sequencing error levels, and decrease reagent usage in nucleic acid sequencing, thereby lowering the cost of nucleic acid sequencing, has become a research hotspot. Summary of the Invention

[0004] One objective of this invention is to provide a silicon-based rhodamine compound that can be used as a fluorescent modification structure for modified nucleotides in nucleic acid sequencing, thereby improving the fluorescence intensity and incorporation efficiency of the fluorescently modified nucleotides in the sequencing environment.

[0005] The second objective of this invention is to provide a method for preparing silicon-based rhodamine.

[0006] A third objective of this invention is to provide fluorescently modified nucleotides that are linked to the compounds of this invention for use in sequencing-by-synthesis systems, thereby improving the fluorescence intensity of the modified nucleotides.

[0007] In addition, the present invention provides a kit containing fluorescently modified nucleotides provided by the present invention, which are used for nucleic acid sequencing.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0009] A silicon-based rhodamine compound, formed from compounds of the general chemical structure shown in formula (I):

[0010]

[0011] Where m and n are integers from 1 to 3;

[0012] R1, R2, R3, R 12They are H or alkyl, aryl or substituted alkyl or substituted aryl, respectively;

[0013] R4 is H, alkyl or substituted alkyl, halogen, carboxyl, formamido, hydroxy- or alkoxy, or a carbon chain or heterosubstituted chain in which R4 forms a ring together with R2 or R8.

[0014] R5 is H, alkyl or substituted alkyl, halogen, carboxyl, formamido, hydroxy- or alkoxy, or a carbon chain or heterosubstituted chain in which R5 forms a ring together with R3 or R9.

[0015] R6 is H, halogen, hydroxyl or alkoxy, alkyl or substituted alkyl or a carbon chain or heterosubstituted carbon chain that forms a ring together with R1.

[0016] R7 is H, halogen, hydroxyl or alkoxy, alkyl or substituted alkyl or a carbon chain or heterosubstituted carbon chain that forms a ring together with R3.

[0017] R8 and R9 are H, alkyl or substituted alkyl, halogen, hydroxyl or alkoxy;

[0018] R 10 OR 13 or NR 13 R 14 , where R 13 and R 14 Independently H, alkyl, or substituted alkyl;

[0019] R 11 OR 15 or NR 15 R 16 , where R 15 and R 16 Independently H, alkyl or substituted alkyl, aryl or substituted aryl;

[0020] R 17 R 18 It is a halogen, alkyl, aryl or substituted alkyl or substituted aryl.

[0021] It should be explained that the formation of a compound with the general chemical structure shown in formula (I) means that the structure of silicon-based rhodamine can be the chemical structure shown in formula (I), a meso compound of the chemical structure shown in formula (I), or other resonance structures of the chemical structure shown in formula (I).

[0022] This invention relates to silicon-based rhodamine compounds used as markers for detection using fluorescence as a signal. These compounds are typically attached to reagents involved in the detection process, such as protein reagents and nucleic acid reagents, through covalent linkage, surface conjugation, or other means. Specifically, this invention illustrates the use of these fluorescent compounds as fluorescent modifying groups on nucleotides. Specifically, the fluorescent compounds of this invention are attached to nucleotides via linkers to form modified nucleotides, giving the modified nucleotides unique fluorescent properties. The presence of the modified nucleotides, and even the type of modified nucleotide, can be determined by detecting the fluorescence signal. The fluorescent compounds of this invention are typically linked via -COR... 11 - As a linker attached to nucleotides to form modified nucleotides, this invention offers a creative improvement - COR 11 -The linking structure between the fluorescent compound rhodamine dye core structure and the dye core structure adopts a heteroalkyl structure containing dioxygen -O-(CH2). m -O-(CH2) n -As a connecting structure, the connecting base-COR 11 - By linking to the core structure of the fluorescent compound rhodamine, the fluorescence stability, fluorescence intensity, and incorporation efficiency of the modified nucleotides formed by the fluorescent compound as a modifying molecule can be further improved when used in nucleic acid sequencing reactions.

[0023] In a preferred embodiment of the present invention, m is 2 or 3 and n is 1 in the structure of the fluorescent compound; R6, R7, R8, R9, R2, R 12 Both are H, R 17 R 18 R1 and R3 are ethyl groups, R4 and R5 are methyl groups, and R... 10 For OH, R 11 It is OH. In another embodiment of the invention, R 17 Methyl, R 18 The form is vinyl. It should be understood that, without affecting the fluorescence properties of the fluorescent compound claimed in this invention and other properties of forming modified nucleotides as a modifying molecule, the substituents at different positions of the core structure of the fluorescent compound of this invention can also be other structural substituents, where m and n are integers from 1 to 3.

[0024] The above-mentioned method for preparing silicon-based rhodamine compounds uses the compounds shown in formulas (i), (ii), and (iii) as raw materials.

[0025]

[0026] The above-mentioned silicon-based rhodamine compounds are linked by the R group 15Fluorescently modified nucleotides are formed by attachment to nucleotides, typically at the C5 position of a pyrimidine base or the C7 position of a 7-deoxypurine base. Furthermore, to facilitate sequencing-while-synthesizing nucleic acid sequencing processes, a blocking group is covalently attached to the 3'OH position of the ribose or deoxyribose of the fluorescently modified nucleotide. In one preferred embodiment of the present invention, the blocking group is a methyl azide.

[0027] The present invention also provides a kit for nucleotide sequencing, comprising four nucleotide reagents, one of which is the fluorescently modified nucleotide described above, and the other three nucleotide reagents are labeled and modified with different fluorescent compounds. Each fluorescent compound has distinguishable spectral properties and may have different maximum absorbance or distinguishable emission spectral properties.

[0028] In another embodiment of the present invention, a kit for nucleotide sequencing is provided, comprising four nucleotide reagents, wherein the first nucleotide uses the aforementioned fluorescent compound as a fluorescent modifying group, the second nucleotide uses the aforementioned fluorescent compound with a different structure from the first nucleotide as a fluorescent modifying group, the third nucleotide is modified with a fluorescent modifying group different from the first and second nucleotides, and the fourth nucleotide does not have a fluorescent modifying group; the sequencing instrument can be configured to excite different fluorescent modifying groups under one, two, or three laser conditions to achieve the recognition of the four modified nucleotides.

[0029] The aforementioned silicon-based rhodamine compounds, modified nucleotides, and kits can be used not only for nucleotide sequencing but also for expression analysis, hybridization analysis, cell assays, and protein assays. These fluorescent compounds can be attached to substrates for specific applications. The substrate can be any molecule or substance requiring fluorescent labeling, such as nucleotides, polynucleotides, carbohydrates, ligands, particles, solid surfaces, organic or inorganic polymers, chromosomes, cell nuclei, live cells, and combinations or aggregates thereof. The fluorescent compounds can be attached to the corresponding substrates through various mechanisms, including hydrophobic attraction, ionic attraction, and covalent attachment. Preferably, they are covalently attached to the substrate via a linker after converting -COR5 to an amide or ester structure. Attached Figure Description

[0030] Figure 1 This is a comparison of the fluorescence intensity of different silicon-based rhodamine compounds in Experiment Example 1;

[0031] Figure 2 This is a comparative diagram showing the fluorescence performance and stability of different modified nucleotides in Experiment Example 2. Detailed Implementation

[0032] definition:

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention is described.

[0034] The term "alkyl" refers to C1-C20 hydrocarbons and may include C3-C10 non-aromatic carbon rings. Alkyl groups may contain one or more unsaturated groups, such as alkenyl and ynyl groups.

[0035] The term "halogen" refers to fluorine, chlorine, bromine, or iodine, and usually involves the substitution of H atoms in the core structure.

[0036] The term "substituted alkyl" refers to the aforementioned alkyl, alkenyl, or ynyl groups, optionally replaced by halogen, cyano, or SO3. - Further substitutions may be made with SRa, ORa, NRbRc, oxo, CONRbRc, COOH, and COORb. Ra, Rb, and Rc may each be independently selected from H, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, and substituted aryl. The substituted alkyl, substituted alkenyl, and substituted alkynyl groups may optionally be interrupted by at least one heteroatom or group selected from O, NRb, S, SO, and the like. The substituted alkyl may also include additional aryl or substituted aryl moieties.

[0037] Detailed description of the technical solution of this invention:

[0038] The present invention will be further described below with reference to specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field. Unless otherwise specified, the reagents and materials used in the following embodiments are all commercially available.

[0039] This invention provides a silicon-based rhodamine compound having the general chemical structure shown in formula (I), or a meso compound or resonance structure of the general chemical structure shown in formula (I):

[0040]

[0041] Where m and n are integers from 1 to 3;

[0042] R1, R2, R3, R 12 They are H or alkyl, aryl or substituted alkyl or substituted aryl, respectively;

[0043] R4 is H, alkyl or substituted alkyl, halogen, carboxyl, formamido, hydroxy- or alkoxy, or a carbon chain or heterosubstituted chain in which R4 forms a ring together with R2 or R8.

[0044] R5 is H, alkyl or substituted alkyl, halogen, carboxyl, formamido, hydroxy- or alkoxy, or a carbon chain or heterosubstituted chain in which R5 forms a ring together with R3 or R9.

[0045] R6 is H, halogen, hydroxyl or alkoxy, alkyl or substituted alkyl or a carbon chain or heterosubstituted carbon chain that forms a ring together with R1.

[0046] R7 is H, halogen, hydroxyl or alkoxy, alkyl or substituted alkyl or a carbon chain or heterosubstituted carbon chain that forms a ring together with R3.

[0047] R8 and R9 are H, alkyl or substituted alkyl, halogen, hydroxyl or alkoxy;

[0048] R 10 OR 13 or NR 13 R 14 , where R 13 and R 14 Independently H, alkyl, or substituted alkyl;

[0049] R 11 OR 15 or NR 15 R 16 , where R 15 and R 16 Independently H, alkyl or substituted alkyl, aryl or substituted aryl;

[0050] R 17 R 18 It is a halogen, alkyl, aryl or substituted alkyl or substituted aryl.

[0051] As a preferred embodiment, one embodiment of the present invention provides a silicon-based rhodamine compound having the general chemical formula shown in Formula (II), or a meso compound or resonance structure of the general chemical formula compound shown in Formula (II):

[0052]

[0053] Where m and n are integers from 1 to 3; q and k are integers from 1 to 6;

[0054] R1, R 12 R6, R7, R8, and R9 are unsubstituted alkyl groups;

[0055] R2 and R3 are H or alkyl, aryl or substituted alkyl or substituted aryl, respectively;

[0056] R4 is H, alkyl or substituted alkyl, halogen, carboxyl, formamido, hydroxy- or alkoxy, or a carbon chain or heterosubstituted chain in which R4 forms a ring together with R2 or R8.

[0057] R5 is H, alkyl or substituted alkyl, halogen, carboxyl, formamido, hydroxy- or alkoxy, or a carbon chain or heterosubstituted chain in which R5 forms a ring together with R3 or R9.

[0058] R 10 OR 13 or NR 13 R 14 , where R 13 and R 14 Independently H, alkyl, or substituted alkyl;

[0059] R 11 OR 15 or NR 15 R 16 , where R 15 and R 16 Independently, it is H, alkyl or substituted alkyl, aryl or substituted aryl; R17 and R18 are methyl.

[0060] As a further preferred embodiment, another embodiment of the present invention provides a silicon-based rhodamine compound having the general chemical formula shown in Formula (III), or a meso compound or resonance structure of the general chemical formula compound shown in Formula (III):

[0061]

[0062] Where m and n are integers from 1 to 3; q and k are integers from 1 to 6;

[0063] R6, R7, R8, R9, R2, and R3 are H; R1, R 12 It is an unsubstituted alkyl group;

[0064] R4 is H, alkyl or substituted alkyl, halogen, carboxyl, formamido, hydroxy- or alkoxy, or a carbon chain or heterosubstituted chain in which R4 forms a ring together with R2 or R8.

[0065] R5 is H, alkyl or substituted alkyl, halogen, carboxyl, formamido, hydroxy- or alkoxy, or a carbon chain or heterosubstituted chain in which R5 forms a ring together with R3 or R9.

[0066] R 10 OR 13 or NR 13 R 14 , where R 13 and R 14 Independently H, alkyl, or substituted alkyl;

[0067] R 11 OR 15 or NR 15R 16 , where R 15 and R 16 Independently, it is H, alkyl or substituted alkyl, aryl or substituted aryl; R17 and R18 are methyl.

[0068] As a further preferred embodiment, another embodiment of the present invention provides a silicon-based rhodamine compound having the general chemical formula shown in Formula (IV), or a meso compound or resonance structure of the general chemical formula compound shown in Formula (IV):

[0069]

[0070] Where m and n are integers from 1 to 3; q, k, h, and j are integers from 1 to 6;

[0071] R6, R7, R8, R9, R2, and R3 are H; R1, R 12 R4 and R5 are unsubstituted alkyl groups;

[0072] R 10 OR 13 or NR 13 R 14 , where R 13 and R 14 Independently H, alkyl, or substituted alkyl;

[0073] R 11 OR 15 or NR 15 R 16 , where R 15 and R 16 Independently, it is H, alkyl or substituted alkyl, aryl or substituted aryl; R17 and R18 are methyl.

[0074] As a further preferred embodiment, another embodiment of the present invention provides a silicon-based rhodamine compound having the general chemical structure shown in formula (V), or a meso compound or resonance structure of the general chemical structure compound shown in formula (V):

[0075]

[0076] Where m and n are integers from 1 to 3; q, k, h, and j are integers from 1 to 6;

[0077] R6, R7, R8, R9, R2, and R3 are H; R1, R12, R4, and R5 are unsubstituted alkyl groups.

[0078] R10 is OR13 or NR13R14, wherein R13 and R14 are independently H, alkyl, or substituted alkyl;

[0079] R11 is OR15 or NR15R16, wherein R15 and R16 are independently H, alkyl or substituted alkyl, aryl or substituted aryl; R17 is methyl and R18 is vinyl.

[0080] As a further preferred embodiment, another embodiment of the present invention provides a silicon-based rhodamine compound having the general chemical formula shown in formula (VI), or a meso compound or resonance structure of the general chemical formula compound shown in formula (VI):

[0081]

[0082] Where m and n are integers from 1 to 3; q and k are integers from 1 to 6;

[0083] R6, R7, R8, R9, R2, and R3 are H; R1, R 12 It is an unsubstituted alkyl group;

[0084] R4 is a 6-membered ring formed by connecting a chain via -CH2- to R1; R5 is a chain connected via -CH2- to R 12 The formed 6-membered ring;

[0085] R 10 OR 13 or NR 13 R 14 , where R 13 and R 14 Independently H, alkyl, or substituted alkyl;

[0086] R 11 OR 15 or NR 15 R 16 , where R 15 and R 16 Independently, it is H, alkyl or substituted alkyl, aryl or substituted aryl; R17 and R18 are methyl.

[0087] As a further preferred embodiment, another embodiment of the present invention provides a silicon-based rhodamine compound having the general chemical structure shown in formula (VII), or a meso compound or resonance structure of the general chemical structure compound shown in formula (VII):

[0088]

[0089] Where m and n are integers from 1 to 3; q and k are integers from 1 to 6;

[0090] R6, R7, R8, R9, R2, and R3 are H; R1, R 12 It is an unsubstituted alkyl group;

[0091] R4 is a 6-membered ring formed by connecting the -CH2- chain to R1; R5 is a 6-membered ring formed by connecting the -CH2- chain to R12.

[0092] R10 is OR13 or NR13R14, wherein R13 and R14 are independently H, alkyl, or substituted alkyl;

[0093] R11 is OR15 or NR15R16, wherein R15 and R16 are independently H, alkyl or substituted alkyl, aryl or substituted aryl; R17 is methyl and R18 is vinyl.

[0094] The COR in the above silicon-based rhodamine compound structure 11 or COR 10 As part of a linker group, fluorescent compounds are attached to detection reagents or carriers that require fluorescent signals in the detection reaction, such as proteins, magnetic microparticles, and nucleic acids, to achieve fluorescent labeling of the reagents and carriers. Typically, when these fluorescent compounds are used as fluorescent modifiers of nucleotides for nucleic acid sequencing reactions, they are used as COR (fluorescently modified nucleotides). 11 As part of a linking group, the fluorescent compound is linked to the corresponding position of the nucleotide. In the above-mentioned silyl rhodamine compound of the present invention, COR 11 Through heteroalkyl chains containing dioxy groups -O-(CH2) m -O-(CH2) n - By linking to the core structure of rhodamine, the spectral performance of the fluorescent compound as a nucleotide modification structure is optimized, resulting in enhanced fluorescence intensity and improved temperature stability of the formed complete modified nucleotide molecule. This also improves the incorporation efficiency of the modified nucleotide molecule in nucleic acid sequencing reactions to some extent. The following examples, using fluorescent compounds with specific structures and the resulting modified nucleotide molecules, illustrate and verify these beneficial effects:

[0095] Example 1

[0096] This embodiment provides a silicon-based rhodamine compound, the general chemical formula of which is shown in formula (VIII):

[0097]

[0098] Example 2

[0099] This embodiment provides a silicon-based rhodamine compound, the general chemical formula of which is shown in formula (IX):

[0100]

[0101] Example 3

[0102] This embodiment provides a silicon-based rhodamine compound, the general chemical formula of which is shown in formula (X):

[0103]

[0104] Example 4

[0105] This embodiment provides a silicon-based rhodamine compound, the general chemical formula of which is shown in formula (VIII-1):

[0106]

[0107] Example 5

[0108] This embodiment provides a silicon-based rhodamine compound, the general chemical formula of which is shown in formula (VIII-2):

[0109] This embodiment provides a silicon-based rhodamine compound, the chemical structural formula of which is shown in formula (VIII-3):

[0110]

[0111] Example 7

[0112] This embodiment provides a silicon-based rhodamine compound, the chemical structural formula of which is shown in formula (VIII-4):

[0113]

[0114] Example 8

[0115] This embodiment provides a silicon-based rhodamine compound, the general chemical formula of which is shown in formula (XI):

[0116]

[0117] Example 9

[0118] This embodiment provides a silicon-based rhodamine compound, the general chemical formula of which is shown in formula (XII):

[0119]

[0120] Examples 1-9 above: silicon-based rhodamine compounds - COR 11 All of these compounds have a -COOH structure. When fluorescent compounds are used as modifying molecules to fluoresce nucleotides, an intermediate linker structure is usually required to attach the fluorescent compound to the corresponding position of the nucleotide. Typically, the -COOH structure of the fluorescent compounds in Examples 1-8 needs to be first... 11 The COOH structure reacts with compounds that form linker structures to form -COOR. 15Structure or -CONR 15 R 16 Structure, via R 15 Or R 15 R 16 The structure attaches fluorescent compounds to nucleotides to form fluorescently modified nucleotides, OR 15 NR 15 R 16 The structure is equivalent to the linker structure in fluorescently modified nucleotide compounds. Any linker structure known to those skilled in the art is applicable to this application, such as R... 15 and R 16 The linker can be selected from alkyl or substituted alkyl, aryl or substituted aryl, and typically includes a chemically cleavable or physically / biologically cleavable structure. The following examples illustrate the fluorescently modified nucleotides of this invention using a specific linker structure.

[0121] Example 10

[0122] This embodiment provides a fluorescently modified nucleotide. In this embodiment, a silyl rhodamine compound of formula (XI) is attached to the C7 position of an adenine nucleotide via a specific linker structure to form a fluorescently modified nucleotide, which can still respond to the enzymatic Watson-Crick base pairing reaction. It should be understood that other silyl rhodamine compounds provided in other embodiments of the present invention can also be attached to adenine nucleotides via a linker structure to form new fluorescently modified nucleotides. Similarly, it should be understood that the rhodamine compound provided in the embodiments of the present invention can also be attached to other types of nucleotides via a linker structure to form fluorescently modified nucleotides. For pyrimidine nucleotides, the attachment position is the C5 position of the pyrimidine base, and the resulting fluorescently modified nucleotide can also respond to the enzymatic Watson-Crick base pairing reaction.

[0123] Additionally, it should be explained that the above embodiments illustrate the linker structure between the silicon-based rhodamine compound and the nucleotide. In order to avoid the fluorescent compound molecule affecting the DNA polymerase's ability to recognize nucleotides, the linker structure is usually extended or improved, such as by adding spacer units. It should be understood that other linker structures known to those skilled in the art are also applicable to the modified nucleotides of this invention, as long as the fluorescent modified nucleotides formed can respond normally to the enzymatic Watson-Crick base pairing reaction.

[0124] In addition, commonly used high-throughput sequencing methods using sequencing-by-synthesis involve modifying different nucleotide triphosphates (A, T, C, and G) with unique and distinguishable fluorescent molecules. During the sequencing reaction, the modified nucleotide reagent is added, and the type of incorporated nucleotide is determined by detecting the signal of the unique fluorescent molecule incorporating it into the sequencing template polynucleotide chain, thus enabling sequencing of the polynucleotide chain. Typically, the nucleotides to be modified have a 3'-OH blocking group, which includes structures that can be cleaved or removed, controlling the continuation of the polymerization extension reaction. After one fluorescence signal detection, the 3'-blocking group and fluorescent molecule of the incorporated modified nucleotide are removed using the same or different chemical, enzymatic, or physical methods, exposing an elongable nascent chain for the next incorporation of modified nucleotides, achieving continuous sequencing of the nucleotide chain. Therefore, the fluorescently modified nucleotides provided in this invention can be used as nucleotide reagents in a sequencing-by-synthesis kit. When the fluorescently modified nucleotides of this invention are used as nucleotide reagents for nucleotide sequencing, a blocking group is covalently attached to the 3'OH position of the ribose or deoxyribose of the fluorescently modified nucleotide. This blocking group is typically chemically cleavable or physically / biologically cleavable, such as methyl azide. Furthermore, the aforementioned kit for nucleotide sequencing also includes three other nucleotide reagents besides the fluorescently modified nucleotides provided in this invention. These other three nucleotide reagents may be fluorescently labeled or not. Preferably, the other three nucleotide reagents have different fluorescent modifications, and each fluorescent compound has a different maximum absorbance and is distinguishable from one another.

[0125] As a further preferred embodiment, the kit of the present invention contains four fluorescently labeled nucleotides, wherein the first nucleotide is labeled with the fluorescent compound of the present invention, the second nucleotide is labeled with a compound whose spectral emission color is different from that of the fluorescent compound of the present invention, the third nucleotide is labeled with a mixture of fluorescent modifying groups of the first and second nucleotides, and the fourth nucleotide is not connected to a fluorescent label. Specifically, the first, second, third, and fourth nucleotides form "red", "green", "red / green", and "dark" light signals, respectively.

[0126] Example 11

[0127] This embodiment provides a method for preparing the silicon-based rhodamine compound shown in Example 8, using compounds of formulas (i), (ii), (iii), (iv), and (v) as raw materials:

[0128]

[0129] The specific operating steps are as follows:

[0130] 1) Synthesis of key silicone intermediates:

[0131] ① In a 500 mL reaction flask, compound (i) (2.07 g, 10.0 mmol) and paraformaldehyde (6.0 g, 200 mmol) were added sequentially. Under argon protection, 20 mL of anhydrous DMF was added, and the mixture was magnetically stirred at 0 °C for 10 min. At the same temperature, formic acid (9.2 g, 200 mmol) was slowly added to the reaction flask, followed by sodium cyanoborohydride (6.28 g, 100 mmol) added in batches. The reaction temperature was slowly raised to 60 °C, and the mixture was stirred overnight. 50 mL of water was added to quench the reaction mixture, and the mixture was cooled to 0 °C. 3 M sodium hydroxide solution was added to adjust the alkalinity to that of the reaction mixture, and then 100 mL of dichloromethane was added. The organic phase was separated and washed with saturated brine. The organic phase was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and subjected to silica gel column chromatography (petroleum ether: ethyl acetate = 50:1) to give 1.3 g of a yellow oily methylene-bridged intermediate, with a yield of 63%. The reaction process is shown in the following formula:

[0132]

[0133] ② Under argon protection, add methylene-bridged intermediate (0.62 g, 2 mmol) and 20 mL anhydrous diethyl ether to a 100 mL single-necked flask. Cool to -78 °C, and slowly add n-BuLi (3.74 mL, 1.6 M in n-hexane, 6 mmol) dropwise to the reaction solution. After the addition is complete, continue the reaction at the same temperature for 2 h. Dissolve dimethyldichlorosilane (0.4 g, 3 mmol) in 10 mL anhydrous diethyl ether and slowly add it dropwise to the above reaction solution. After the addition is complete, slowly raise the reaction system to room temperature and continue stirring overnight. Quench the reaction with 30 mL of water, add 50 mL of dichloromethane, separate the organic phase and wash with saturated brine. Dry the organic phase with anhydrous sodium sulfate and concentrate under reduced pressure to obtain the crude product. No purification is required; it can be used directly in the next reaction.

[0134] The crude product obtained from the above reaction was dissolved in 30 mL of acetone and cooled to 0 °C. At this temperature, potassium permanganate (632 mg, 4 mmol) was slowly added to the reaction solution in batches. After the addition was complete, the reaction was continued for 2 h. After the reaction was complete, the solid residue was removed by diatomaceous earth filtration and washed with ethyl acetate. The filtrate was concentrated under reduced pressure to obtain the crude product, and silica gel column chromatography was performed to obtain a yellow solid silicone ketone intermediate. The reaction process is shown in the following formula:

[0135]

[0136] 2) Synthesis of bromooxazolin derivatives:

[0137] ① In a 250 mL reaction flask, compound (ii), DMF, and K2CO3 were added sequentially. After stirring at room temperature for 10 min, compound (iii) was added, and the reaction was carried out at 65 °C. The reaction was allowed to proceed until TLC confirmed complete. The mixture was then extracted with water and ethyl acetate, and the organic phase was separated and washed with saturated sodium chloride solution. The organic phase was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain a yellow oily liquid. The obtained liquid intermediate, ethanol, water, and NaOH were added sequentially to the reaction flask, and the mixture was heated to reflux until TLC confirmed complete. The mixture was cooled to room temperature, concentrated under reduced pressure to remove ethanol, and the pH was adjusted to 1 with dilute hydrochloric acid. Ethyl acetate was added for extraction, and the organic phase was separated. The aqueous phase was extracted twice more with ethyl acetate. The organic phases were combined and concentrated under reduced pressure to obtain a solid intermediate. The reaction process is shown in the following formula:

[0138]

[0139] ② Add the above solid intermediate sequentially to a 250 mL reaction flask, dissolve in an appropriate amount of anhydrous acetonitrile, add NBS and a catalytic amount of concentrated sulfuric acid to the system, and continue the reaction at room temperature. After the reaction is complete as detected by TLC, concentrate under reduced pressure, slurry with acetonitrile, and filter to obtain a white solid brominated product; the reaction process is shown in the following formula:

[0140]

[0141] ③ Take the above brominated product in a single-necked flask, add an appropriate amount of thionyl chloride to the system under argon protection, and heat under reflux in an oil bath for 6 hours under argon protection. After the reaction is complete, concentrate directly under reduced pressure to obtain the acyl chloride intermediate; dissolve the obtained intermediate in an appropriate amount of anhydrous dichloromethane and cool to 0℃, then add it dropwise to a dichloromethane solution of 2-amino-2-methyl-1-propanol, maintaining the internal temperature at 0-5℃ during the dropwise addition. After the dropwise addition is complete, move to room temperature and continue the reaction for 2 hours. After the reaction is complete, drain the system using a 3N... The organic phase was washed three times with hydrochloric acid solution, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain a white foamy intermediate. Under argon protection, the obtained product was mixed with an appropriate amount of thionyl chloride and stirred thoroughly. After the reaction was complete, an appropriate amount of diethyl ether was added to the system, and the reaction was continued for 6 hours. After the reaction was complete, the product was concentrated under reduced pressure to obtain a white solid product, which was neutralized with 20% sodium hydroxide solution and extracted with ethyl acetate. The combined organic phases were dried over anhydrous sodium sulfate, concentrated under reduced pressure, and purified by silica gel column chromatography to obtain the key bromooxazolin product. The reaction process is shown in the following equation:

[0142]

[0143] 3) Synthesis of silicon-based rhodamine:

[0144] Under argon protection, a bromooxazolin derivative and anhydrous diethyl ether were added to a flask equipped with a stirrer. The system was cooled to -78°C, and after the temperature stabilized, n-BuLi was slowly added dropwise to the reaction solution. After the addition was complete, the reaction was continued for 2 hours at the same temperature. The ketone intermediate was dissolved in anhydrous diethyl ether and slowly added dropwise to the aforementioned reaction system at -78°C. After the addition was complete, the reaction was slowly raised to room temperature and stirred overnight. The reaction was quenched with an appropriate amount of water, and an appropriate amount of dichloromethane was added. The organic layer was separated and washed with saturated brine. The organic phase was dried with anhydrous sodium sulfate and concentrated under reduced pressure to obtain the crude product.

[0145] The crude product was dissolved in a concentrated hydrochloric acid / water mixture and heated to 80°C for 24 hours. After the reaction was complete, a suitable amount of a water / dichloromethane / ethyl acetate mixture was added, followed by neutralization with a saturated sodium bicarbonate solution. The organic phase was separated and washed with saturated brine. Finally, the organic phase was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and purified by silica gel column chromatography to obtain a yellow solid product with a yield of 55%. The silanized rhodamine compound described in Example 8 was successfully synthesized by mass spectrometry. The reaction process is shown in the following formula:

[0146]

[0147] It should be noted that the same method and principle as in Example 11 can be used to synthesize the silicon-based rhodamine compounds shown in other examples. It is only necessary to replace the corresponding raw materials according to the compound structure of the final product. For example, formula (i) can be replaced.

[0148] Comparative Example 1

[0149] This comparative example provides a fluorescently modified nucleotide, the general chemical formula of which is shown in formula (VI-5):

[0150]

[0151] Using the fluorescent compound provided in this comparative example as a raw material, fluorescent modified nucleotides of Comparative Example 1 were prepared according to the same method and principle as in Example 11.

[0152] Comparative Example 2

[0153] This comparative example provides a fluorescent compound whose general chemical structure is shown in formula (VI-6) below:

[0154]

[0155] Using the fluorescent compound provided in this comparative example as a raw material, fluorescent modified nucleotides of Comparative Example 1 were prepared according to the same method and principle as in Example 11.

[0156] Experimental Example 1

[0157] The silicon-based rhodamine compounds provided in Examples 1 and Comparative Examples 1-2 were prepared into solutions of the same concentration (0.05 μmol / L). The fluorescence intensity of each silicon-based rhodamine compound was detected using a fluorescence spectrophotometer under excitation conditions of 700 V and 610 nm. Figure 1 As shown, by Figure 1 The results show that the fluorescence intensity of silicon-based rhodamine varies with different structures. Overall, COR 11 Through heteroalkyl chains containing dioxy groups -O-(CH2) m -O-(CH2) n The fluorescence intensity of compounds with -(m, n = 1~3)-linked to the core structure of silicon-based rhodamine is greater than that of compounds with -O-(CH2)3-linked to the core structure of rhodamine.

[0158] Experimental Example 2

[0159] The modified nucleotides prepared using the silyl rhodamine compounds provided in Examples 1 and Comparative Examples 1-2 as modifying groups were prepared into solutions of the same concentration (0.5 μmol / L). A fluorescence spectrophotometer was used to detect the rate of fluorescence intensity decay of different modified nucleotide solutions with increasing temperature (20℃, 40℃, 60℃). The results are as follows: Figure 2 As shown, by Figure 2 The results show that the temperature stability of the fluorescence properties of modified nucleotides prepared from different structural silicon-based rhodamine compounds varies. Overall, COR 11 Through heteroalkyl chains containing dioxy groups -O-(CH2) m -O-(CH2) n Nucleotides modified with compounds whose -(m=2 or 3, n=1 or 2) links to the core structure of the compound exhibit better fluorescence temperature stability than those modified with compounds whose -O-(CH2)3- links to the core structure of the compound.

[0160] Experimental Example 3

[0161] Detection of polymerase affinity Kd values ​​for different modified nucleotides A:

[0162] Detection method: 50 μL reaction system, Therminator TMIII DNA Polymerase 1uL, 1*Thermopol Reaction Buffer, 10uM ONA26, and analyte A concentrations of 0.1uM, 0.2uM, 0.4uM, 0.8uM, 1.6uM, 5uM, and 10uM were reacted at 65℃ for 10 min, respectively. The reaction was terminated with 25mM EDTA, and the mixture was diluted. The incorporation rate was analyzed using an Aglient DNA 1000 kit, and Kd was calculated according to the Michaelis-Menten equation. ONA26 is a hairpin-structured nucleic acid substrate with the sequence GACT. GCGCCGCGC CATCATGACAGCTAG TT CTAGCTGTCATGATGGCGCGGCGC, The underlined portions are complementary and paired, then annealed to form a hairpin structure, as shown in Table 1 below:

[0163] Table 1

[0164] Example 1 Comparative Example 1 Comparative Example 2 KdμM 1.12 3.15 4.02

[0165] As shown in Table 1 above, compared to COR 11 The modified nucleotide A, which is a compound linked to the rhodamine core structure via -O-(CH2)3-, is the modifying group. This invention's COR 11 Through heteroalkyl chains containing dioxy groups -O-(CH2) m -O-(CH2) n The modified nucleotide A formed by compounds with -(m, n = 1~3) linked to the core structure of rhodamine as modifying groups has higher polymerase affinity, improves the incorporation efficiency of modified nucleotides, reduces the amount of modified nucleotides used, and reduces reagent costs.

[0166] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A silicon-based rhodamine compound, characterized by, formed from a chemical structure general formula of formula (I): (I) wherein -COR11is COOH.

2. A fluorescently modified nucleotide, characterized in that, The silicon-based rhodamine compound as claimed in claim 1 is used as a modification group.

3. The fluorescently modified nucleotide of claim 2, wherein, The -COR11 of the fluorescent compound is attached to a nucleotide through a linker to form the fluorescent modified nucleotide.

4. The fluorescently modified nucleotide of claim 3, wherein, The linker is attached to the C5 position of a pyrimidine base or the C7 position of a 7-deaza purine base of a nucleotide.

5. The fluorescently modified nucleotide of claim 3 or 4, wherein, The 3' OH position of the ribose or deoxyribose of the fluorescent modified nucleotide is covalently attached to a blocking group.

6. The fluorescently modified nucleotide of claim 5, wherein, The blocking group is a methyl azide.

7. A kit characterized in that, The fluorescent modified nucleotide as claimed in any one of claims 2-6.

8. A method of preparing silicon-based rhodamine according to claim 1, characterized by, Prepared from a compound of formula (v), formula (II), formula (III) as raw materials: (v)、 (ⅱ)、 (ⅲ)。

Citation Information

Patent Citations

  • Rhodamine compounds and their use as fluorescent labels

    CN105263918A

  • Novel fluorescent labeling method

    US20200199174A1