Application and methods of rice gene OsAL7.1

By editing the rice OsAL7.1 gene to create the mutant knAL7.1, the problem of insufficient drought resistance and seed size regulation in monocotyledonous plants was solved, and the seed size and drought resistance of rice were improved, thereby enhancing the high-yield and stable-yield capacity of rice.

CN114774431BActive Publication Date: 2026-04-03SHANGHAI AGROBIOLOGICAL GENE CENT
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-05-06
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Existing technologies lack effective regulation of drought resistance and seed size in monocotyledonous plants, affecting the high and stable yield of rice, especially under drought conditions.

Method used

By using gene editing technology and the CRISPR/Cas9 system to mutate the rice OsAL7.1 gene, inserting or deleting its first exon region to form the mutant knAL7.1, the size and drought resistance of rice seeds can be regulated. By constructing appropriate plant expression vectors, precise breeding of the OsAL7.1 gene can be achieved.

Benefits of technology

It significantly alters rice seed size and drought resistance, improves rice yield stability under drought conditions, provides a means of precision breeding, and expands the application value of high-yield rice genes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114774431B_ABST
    Figure CN114774431B_ABST
Patent Text Reader

Abstract

This invention discloses an application of the rice OsAL7.1 gene, which is used to regulate rice seed size and drought resistance. The OsAL7.1 gene mutant of this invention increases rice seed size, thereby changing rice grain shape and yield. The OsAL7.1 gene mutant of this invention increases rice seed size while improving rice drought resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and in particular to the application and method of the rice gene OsAL7.1. Background Technology

[0002] Rice is my country's staple food and plays a crucial role in ensuring the country's food security. High-yield and stress-resistant rice varieties are needed for rice production, a long-standing breeding goal for Chinese rice breeders. Yield is composed of three main factors: grain weight, number of grains per panicle, and number of effective panicles. Grain weight is primarily determined by grain size. During the domestication of rice, breeders have tended to select large-grained and long-grained varieties for cultivation, gradually leading to a situation where cultivated varieties have larger grains than their wild relatives. Studies have also found that increasing grain weight can increase yield by more than 30% (Ma Lilian et al., Analysis of Large-Grained Rice Germplasm Resources and Genetics, Bulletin of Botany, 2006, 23(4): 395-401). Developing large-grained rice varieties is also an important direction in current rice breeding.

[0003] Rice production is highly susceptible to natural disasters. The development of modern industry and the gradual rise in global temperatures have increased the probability of frequent extreme weather conditions, making it urgent to enhance plant resistance, especially drought and high / low temperature resistance. Plant transcription factors play an important role in regulating plant resistance. In 2004, Alfin1, a gene that helps increase salt tolerance in alfalfa (Medicago sativa L.), was discovered in salt-sensitive cell cultures (Winicov I, Valliyodan B, Xue L, et al. The MsPRP2 promoter enables strong heterologous gene expression in a root-specific manner and is enhanced by overexpression of Alfin1[J]. Planta. 2004, 219(6): 925-935). Subsequently, Alfin1-like proteins were also found in other plants. This Alfin-like protein is a plant-specific protein with a plant homeodomain (PHD) of about 50 amino acids at the C-terminus and a DUF3594 domain of about 150 amino acids with unknown function at the N-terminus. PHD is a highly conserved Cys4-His-Cys3 (C4HC3) zinc finger domain that can recognize and bind to lysine-methylated H3 histones (tri- and dimethylation of histone H3 at lysine 4, H3K4me2 / 3), and is therefore believed to be involved in plant epigenetic regulation. The function of the N-terminal conserved DUF3594 domain of the AL protein is unclear, but it is highly conserved in plant species (Lee WY, Lee D, Chung W, et al. ArabidopsisING and Alfin1-like protein families localize to the nucleus and bind to H3K4me3 / 2 via plant homeodomain fingers[J]. The Plant Journal. 2009, 58(3):511-524).

[0004] Existing studies have shown that Alfin-like (AL) proteins are closely related to abiotic stress. There are seven AL genes in Arabidopsis, and PEG and high salt can induce AL gene expression. Overexpression of the AL5 gene was found to significantly increase plant resistance to drought and salt stress (Wei W, Zhang Y, Tao J, et al. The Alfin-like homeodomain finger protein AL5 suppresses multiple negative factors to conferabiotic stress tolerance in Arabidopsis[J]. The Plant Journal. 2015, 81(6):871-883). Overexpression of the soybean GmPHD2 gene in Arabidopsis can improve its salt tolerance (Wei W, Huang J, Hao YJ, et al. Soybean GmPHD-type transcription regulators improve stress tolerance in transgenic Arabidopsis plants[J]. PLoS One. 2009, 4(9): e7209). In addition, AL genes also exist in spinach, and the expression of these genes can respond to high salt, drought, cold and ABA treatments. Among them, overexpression of the AhAL1 gene in Arabidopsis enhances salt and drought tolerance (Tao J, Wei W, Pan W, et al. An Alfin-like gene from Atriplex hortensis enhances salt and drought tolerance and abscisic acid response in transgenic Arabidopsis[J]. Scientific Reports.2018, 8(1), 2707.).

[0005] Currently, the functions of related Alfin-like genes have been mainly reported in dicotyledonous plants, but there are very few related studies in monocotyledonous plants. Do monocotyledonous plants also have similar functions? Through expression studies in rice under different treatments, we found that the OsAL7.1 gene is closely related to the stress resistance of rice, and gene knockout can affect rice seed size. This invention, through gene editing and modification, can be used for precision breeding of rice grains, laying the foundation for improving stable and high yields of rice under drought stress. Summary of the Invention

[0006] This invention provides a rice gene OsAL7.1 and its application and method.

[0007] This invention is based on the discovery that the OsAL7.1 gene, derived from rice, regulates drought resistance and grain development in rice. The purpose of this invention is to provide an application of the OsAL7.1 gene in altering rice drought resistance and seed size.

[0008] Therefore, this invention provides a method for altering rice seed size and drought resistance by gene editing the OsAL7.1 gene.

[0009] An application of the rice OsAL7.1 gene, which is used to regulate rice seed size and drought resistance.

[0010] As a preferred technical solution, the nucleotide sequence of the rice OsAL7.1 gene is shown in SEQ ID NO.1.

[0011] As a preferred technical solution, the first exon region of the OsAL7.1 gene is inserted or deleted. This mutation causes premature termination of gene translation, forming a mutant of the OsAL7.1 gene, the knAL7.1 gene. The nucleotide sequence of the knAL7.1 gene is shown in SEQ ID NO.3.

[0012] As a preferred technical solution, the application of the rice OsAL7.1 gene guide RNA target sequence primer in editing the rice genome is based on the nucleotide sequence of OsAL7.1 gene-induced RNA as OsAL7.1-sgRNA:GACTTCTCCGGCCGCCGCGC.

[0013] As a preferred technical solution, it also includes adding adapters and using PCR amplification to construct the OsAL7.1 gene for use in the production of sgRNA expression cassettes with guide RNA target sequences for drought-resistant transgenic plants;

[0014] The sgRNA expression cassette was loaded into a CRISPR / Cas9 vector to obtain a CRISPR / Cas9-sgRNA vector containing the target sequence.

[0015] The target CRISPR / Cas9-sgRNA vector was transformed into rice callus tissue to obtain the rice OsAL7.1 gene mutant knAL7.1 plant.

[0016] As a preferred technical solution, the loss of function of the OsAL7.1 gene can regulate the size of rice seeds; the weakening of the function of the OsAL7.1 gene can regulate the size of rice seeds.

[0017] As a preferred technical solution, the loss of function of the OsAL7.1 gene can improve the drought resistance of rice under drought conditions; the weakening of the function of the OsAL7.1 gene can improve the drought resistance of rice under drought conditions.

[0018] The present invention also discloses an application of an OsAL7.1 gene mutant, wherein the protein encoded by the OsAL7.1 gene mutant can regulate the size of rice seeds.

[0019] This invention also discloses a method for improving the drought resistance of rice by using a rice OsAL7.1 gene mutant under drought conditions.

[0020] This invention also provides a method for increasing rice seed size by artificially editing the rice genome to generate an early stop codon. The invention further includes alleles or derivatives of the OsAL7.1 gene obtained by modifying the 5' end sequence of the coding region using other methods. By modifying the OsAL7.1 gene to form mutant alleles, this invention significantly alters the drought resistance of rice. These results indicate that the OsAL7.1 gene has important application value in rice yield breeding and stress-resistant stable-yield breeding. Through precise modification of the OsAL7.1 gene and the construction of appropriate plant expression vectors, the range of genes applicable to stable and high-yield rice in current plant biotechnology can be expanded, providing precision breeding methods for improving rice.

[0021] The nucleotide sequence of the OsAL7.1 gene provided by this invention is shown in SEQ ID NO.1. The OsAL7.1 gene site is artificially edited to form the knAL7.1 gene, and the nucleotide sequence of the knAL7.1 gene is shown in SEQ ID NO.3.

[0022] The application of the rice OsAL7.1 gene guide RNA target sequence primer in editing the rice genome is based on the nucleotide sequence of OsAL7.1 gene-induced RNA as OsAL7.1-sgRNA: GACTTCTCCGGCCGCCGCGC.

[0023] This invention discloses a method for obtaining the knAL7.1 gene allele of the OsAL7.1 gene in the rice genome through gene editing. A CRISP / CAS9 vector containing an OsAL7.1-sgRNA expression cassette is constructed, and rice mutants with insertions or deletions are generated in the first exon region of the OsAL7.1 gene by rice genetic transformation. The nucleotide sequence of the first exon is shown in SEQ ID NO.3.

[0024] Due to the adoption of the above technical solution, an application of the rice OsAL7.1 gene has been achieved. The rice OsAL7.1 gene is used to regulate the size of rice seeds and the drought resistance of rice.

[0025] Compared with the prior art, the advantages of the present invention are as follows:

[0026] 1. The OsAL7.1 gene mutant of the present invention can increase or decrease the size of rice seeds, thereby changing the grain shape and yield of rice.

[0027] 2. The OsAL7.1 gene mutant of the present invention can increase or decrease the size of rice seeds, thereby improving the drought resistance of rice. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0029] Figure 1 The OsAL7.1 genome structure and sequence alignment diagram of CRISP / Cas9 knockout transformed plants; Figure 1 A: OsAL7.1 genome structure, boxes represent exons, dark boxes represent gene coding regions, and straight lines represent introns; Figure 1 B: Sequence alignment diagram, ZH11 represents a partial sequence of the recipient parent flower 11, and knAL7.1 represents a partial sequence of the knockout line.

[0030] Figure 2 This is a schematic diagram of the construction of the expression vector pCBH04-OsAL7.1.

[0031] Figure 3 A schematic diagram of the construction of the CRISP / Cas9 plant transformation vector.

[0032] Figure 4 This is a diagram for identifying the drought resistance of overexpressing transgenic plants; where "before treatment" indicates growth under normal irrigation conditions, and "after rehydration" indicates that irrigation was stopped and drought was treated for 10 days after the seedlings had 3 leaves, followed by 5 days of rehydration; ZH11 represents the recipient parent, OE represents the transgenic plant overexpressing OsAL7.1, and ** indicates p<0.01 in t-test analysis.

[0033] Figure 5This is a diagram for identifying the drought resistance of gene-edited mutant plants. Before treatment indicates growth under normal irrigation conditions; after rehydration, it indicates a 10-day drought treatment after the seedlings had 3 leaves, followed by 5 days of rehydration. ZH11 represents the recipient parent, knAL7.1 represents the gene-edited mutant plant, and ** indicates p<0.01 in t-test analysis.

[0034] Figure 6 A statistical graph showing the seed size of plants with the knAL7.1 gene-edited mutant. Figure 6 A: 10 grains arranged horizontally; Figure 6 B: 5 grains arranged vertically; Figure 6 C: Particle length: Figure 6 D: Particle width: Figure 6 E: Aspect ratio; where knAL7.1 represents the OsAL7.1 gene-edited loss-of-function mutant, ZH11 represents the recipient parent Zhonghua 11, and *** indicates t-test analysis p<0.001. Detailed Implementation

[0035] In this article, the terms "isolated" or "purified" DNA refer to DNA or fragments that have been separated from the sequences flanking them in their native state, and also to DNA or fragments that have been separated from the components that accompany nucleic acids in their native state, and from the proteins that accompany them in the cell.

[0036] Polynucleotides (DNA or RNA), vectors, transformants, and organisms can be isolated and purified using methods known in the art.

[0037] The vectors used in this invention can be, for example, bacteriophages, plasmids, granules, mini-chromosomes, viruses, or retroviruses. Vectors that can be used to clone and / or express the polynucleotides of this invention are vectors capable of replicating and / or expressing the polynucleotides in host cells where replication and / or expression of the polynucleotides are required. Generally, recombinant expression vectors carrying the nucleic acid sequences of this invention can be introduced into plant cells using conventional biotechnological methods such as Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, and electroporation (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp. 411-463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).

[0038] Several methods have been developed for operatively linking polynucleotides to vectors via complementary sticky ends. For example, complementary homomeric sequence fragments can be added to a DNA segment to be inserted into the vector DNA. The vector and the DNA segment are then linked by hydrogen bonds between the complementary homomeric tails to form a recombinant DNA molecule.

[0039] Synthetic adapters containing one or more restriction sites provide an alternative method for ligating DNA segments to vectors. DNA segments resulting from restriction digestion with endonucleases are treated with phage T4 DNA polymerase or E. coli DNA polymerase I. Both polymerases remove protruding γ-single-stranded ends with their 3',5'-exonuclease activity and fill in 3'-concave ends with their polymerization activity. This combination of activities produces blunt-ended DNA segments, which are then incubated with a molar excess of adapter molecules in the presence of an enzyme capable of catalyzing the ligation of blunt-ended DNA molecules, such as phage T4 DNA ligase. The reaction product is a DNA segment with polymerase sequences at its ends. These DNA segments are then lysed with a suitable restriction enzyme and ligated into an enzyme-lysed expression vector that produces ends compatible with the DNA segments. Synthetic adapters containing multiple restriction endonuclease sites are available from various vendors.

[0040] Other newly developed technologies utilize homologous recombination, which involves homologous recombination of a vector with a polynucleotide carrying a specific or homologous sequence adapter. The DNA segment to be inserted into the vector DNA is then combined with the vector, which also carries a specific or homologous sequence, to form a recombinant DNA molecule through the action of recombinase.

[0041] The polynucleotide insert should be operatively linked to a suitable promoter compatible with the host cell expressing the polynucleotide. The promoter can be a strong promoter and / or an inducible promoter. Examples of such promoters include the phage PL promoter, E. coli lac, trP, phoA, tac promoter, SV40 early and late promoters, and retroviral LTR promoters; other suitable promoters are known to those skilled in the art. The expression recombinant vector further contains transcription initiation and termination sites, and ribosome-binding sites for translation within the transcription region. The coding portion of the transcript expressed by the recombinant vector may include a translation initiation codon at the initiation site and a stop codon (UAA, UGA, or UAG) appropriately located at the end of the translated polypeptide.

[0042] As described above, the expression vector may include at least one selection marker. These markers include genes encoding antibiotic resistance, such as the neomycin phosphotransferase gene *nptⅡ*, the hygromycin phosphotransferase gene *hpt*, and the dihydrofolate reductase gene *dhfr*; another class is genes encoding herbicide resistance, such as the phosphinothricin acetyltransferase gene *bar* and the 5-enolpyruvate shikimatr-3-phosphate synthase gene *epsps*. Representative examples of suitable hosts include, but are not limited to, protoplast cells and plant cells. Suitable culture media and conditions for the aforementioned host cells are known in the art.

[0043] Transformation methods for target genes or polynucleotides can be categorized into three types: First, vector-mediated transformation, where the target gene is inserted into a vector molecule such as an Agrobacterium plasmid or viral DNA. The target gene is then introduced into the plant genome via the transfer of the vector DNA. Agrobacterium-mediated and virus-mediated transformations fall into this category. Second, direct gene introduction methods, which involve directly introducing exogenous target genes into the plant genome using physical or chemical methods. Physical methods include gene gun transformation, electroporation transformation, ultrasound transformation, microinjection, and laser microbeam transformation; chemical methods include PEG-mediated transformation and liposome transformation. Third, germplasm system methods, including pollen tube pathway methods, germ cell staining methods, and embryo sac and ovary injection methods.

[0044] In this invention, the term "transformant" refers to a host cell or organism carrying a foreign DNA molecule.

[0045] The present invention also includes host cells containing the nucleotide sequences of the present invention, said nucleotide sequences being operatively linked to one or more heterologous control regions (such as promoters and / or enhancers) using techniques known in the art. Host strains capable of regulating the expression of the inserted gene sequence, or capable of modifying and processing the gene product in a desired specific manner, can be selected. In the presence of certain inducers, the expression initiated by certain promoters may be increased.

[0046] Cells that have been successfully transformed can be identified using well-known techniques; that is, cells or organisms containing the recombinant vector with the nucleotide sequence described in this invention.

[0047] To overcome the above deficiencies, this invention provides an application and method of the rice gene OsAL7.1 to solve the problems in the background art.

[0048] An application of the rice OsAL7.1 gene, which is used to regulate rice seed size and drought resistance.

[0049] The nucleotide sequence of the rice OsAL7.1 gene is shown in SEQ ID NO.1.

[0050] The OsAL7.1 gene has an insertion or deletion in the first exon region. This mutation causes premature termination of gene translation, forming the mutant knAL7.1 gene of the OsAL7.1 gene. The nucleotide sequence of the knAL7.1 gene is shown in SEQ ID NO.3.

[0051] The application of the rice OsAL7.1 gene guide RNA target sequence primer in editing the rice genome is based on the nucleotide sequence of OsAL7.1 gene-induced RNA as OsAL7.1-sgRNA: GACTTCTCCGGCCGCCGCGC.

[0052] It also includes the addition of adapters and the use of PCR amplification to construct the OsAL7.1 gene for use in the production of sgRNA expression cassettes with guide RNA target sequences for drought-resistant transgenic plants;

[0053] The sgRNA expression cassette was loaded into a CRISPR / Cas9 vector to obtain a CRISPR / Cas9-sgRNA vector containing the target sequence.

[0054] The target CRISPR / Cas9-sgRNA vector was transformed into rice callus tissue to obtain the rice OsAL7.1 gene mutant knAL7.1 plant.

[0055] The loss of function of the OsAL7.1 gene can regulate the size of rice seeds; the weakening of the OsAL7.1 gene can regulate the size of rice seeds.

[0056] The loss of function of the OsAL7.1 gene can improve the drought resistance of rice under drought conditions; the weakening of the OsAL7.1 gene can improve the drought resistance of rice under drought conditions.

[0057] The present invention also discloses an application of an OsAL7.1 gene mutant, wherein the protein encoded by the OsAL7.1 gene mutant can regulate the size of rice seeds.

[0058] This invention also discloses a method for improving the drought resistance of rice by using a rice OsAL7.1 gene mutant under drought conditions.

[0059] This invention also provides a method for increasing rice seed size by artificially editing the rice genome to generate an early stop codon. The invention further includes alleles or derivatives of the OsAL7.1 gene obtained by modifying the 5' end sequence of the coding region using other methods. By modifying the OsAL7.1 gene to form mutant alleles, this invention significantly alters the drought resistance of rice. These results indicate that the OsAL7.1 gene has important application value in rice yield breeding and stress-resistant stable-yield breeding. Through precise modification of the OsAL7.1 gene and the construction of appropriate plant expression vectors, the range of genes applicable to stable and high-yield rice in current plant biotechnology can be expanded, providing precision breeding methods for improving rice.

[0060] The nucleotide sequence of the OsAL7.1 gene provided by this invention is shown in SEQ ID NO.1. The OsAL7.1 gene site is artificially edited to form the knAL7.1 gene, and the nucleotide sequence of the knAL7.1 gene is shown in SEQ ID NO.3.

[0061] The application of the rice OsAL7.1 gene guide RNA target sequence primer in editing the rice genome is based on the nucleotide sequence of OsAL7.1 gene-induced RNA as OsAL7.1-sgRNA: GACTTCTCCGGCCGCCGCGC.

[0062] This invention discloses a method for obtaining the knAL7.1 gene allele of the OsAL7.1 gene in the rice genome through gene editing. A CRISP / CAS9 vector containing an OsAL7.1-sgRNA expression cassette is constructed, and rice mutants with insertions or deletions are generated in the first exon region of the OsAL7.1 gene by rice genetic transformation. The nucleotide sequence of the first exon is shown in SEQ ID NO.3.

[0063] To make the technical means, creative features, objectives and effects of this invention easier to understand, the invention will be further described below with reference to specific embodiments.

[0064] Example 1: Cloning OsAL7.1 Gene

[0065] 1.1 OsAL7.1 Gene cloning

[0066] Based on the database provided by the Rice Genome Annotation Project website (http: / / rice.uga.edu / ) OsAL7.1 Based on the (LOC_Os07g12910) gene data, primers were designed to synthesize two splice-encoded cDNA sequences. The primers corresponding to OsAL7.1 were OsAL7.1F (5'-ATGGAGATGGCCGCCCCC-3') and OsAL7.1R (5'-TTATTGCCTACTCTTCTTGGAGC-3'). Total RNA was extracted from rice leaves using TRIzol reagent (GIBCO BRL, USA). The RNA was then reverse transcribed into cDNA using reverse transcriptase MLV (Tiangen, China). Primers OsAL7.1.1F and OsAL7.1R amplified the full-length OsAL7.1.1 cDNA, and primers OsAL7.1.2F and OsAL7.1R amplified the full-length OsAL7.1.2 cDNA. The PCR reaction conditions were: 94℃ pre-denaturation for 3 min; 35 cycles of 94℃ for 30 sec, 60℃ for 30 sec, and 72℃ for 60 sec; extension at 72℃ for 1 min. The amplified PCR products were ligated into the pGEM-T vector (Promega, USA), positive clones were screened and sequenced, and the desired PCR product was obtained. OsAL7.1 The cDNA sequence of the gene (SEQ ID NO. 1). OsAL7.1 Homologous gene alignment analysis of the inferred protein sequence revealed that the obtained sequence matched publicly available online sequences. OsAL7.1 The gene sequences are identical, encoding transcription factors with a conserved DUF3594 domain at the N-terminus and a conserved PHD domain at the C-terminus. Therefore, it is speculated that this sequence difference affects the gene function of the two spliced ​​versions.

[0067] Example 2: OsAL7.1 Construction of gene-related expression vectors

[0068] 2.1 Construction of vectors containing target gene overexpression:

[0069] according to OsAL7.1The full-length sequence of the gene (SEQ ID NO. 1) was used to design primers to amplify the complete coding reading frame. Adapter primers were added to both the upstream and downstream primers to construct the expression vector. Using the amplification product obtained in Example 1 as a template, PCR amplification was performed using high-fidelity Taq polymerase pfu (Tiangen, China). The full-length cDNA obtained in Example 1 was then cloned into an intermediate vector (e.g., pDONR207), further transformed into *E. coli* DH5α. The intermediate vector was identified while ensuring the correct reading frame. Plasmids were then extracted, and recombination was performed using LR clonase recombinase with the plant expression vector pCBH04, which contains promoter and terminator proteins, to form a complete expression unit (see [link to original text]). Figure 2 The bacteria were transformed into Agrobacterium EHA105, and finally, rice callus transformation experiments were carried out.

[0070] 2.2 Construction of CRISP / Cas9 plant transformation vector

[0071] 2.2.1 Guide RNA target sequence selection and primer design

[0072] Based on the genomic sequence of the rice gene OsAL7.1, an sgRNA for OsAL7.1 was designed. The 20 nt nucleotide target sequence of the sgRNA was designed according to the 5'-N20-NGG-3' sequence. Simultaneously, target sequence primers gRT+ and OsU6aT- were designed, with 15-17 nt at their 3' ends pairing with the sgRNA and U6a promoters, respectively. The specific target nucleotide sequence is as follows.

[0073] OsAL7.1-sgRNA: GACTTCTCCGGCCGCCGCGC

[0074] gRT+: 5'-ATCACTATGAACCGCACgttttagagctagaaat-3'

[0075] OsU6aT-:5'-GTGCGGTTCATAGTGATggcagccaagccagca-3'

[0076] 2.2.2 Construction of the target sequence sgRNA expression cassette

[0077] Following the method of Ma et al. (Ma et al., 2015, Molecular Plant, 8 (8): 1274-1284), 2-5 ng pYLgRNA-OsU6a / LacZ plasmid (1 μL) was used as a template, and PCR amplification was performed in two reaction systems: UF and OsU6aT- were used to amplify the OsU6a- target fragment, and gR-R and gRT+ were used to amplify the sgRNA- target fragment. Generally, KOD plus polymerase (TOYOBO) is used. The reaction system consists of 1 μL plasmid template, 2.5 μL 10× Buffer, 0.5 μL KOD plus polymerase, 1 μL 25 mM MgSO4, 2.5 μL 2 mM dNTPs, 0.5 μL each of 10 μM primers, and ddH2O added to a final volume of 25 μL. The PCR amplification program is: 95℃ for 2 min, 98℃ for 10 s, 58℃ for 15 s, and 68℃ for 20 s, for 25 cycles. Electrophoresis is used to detect the PCR products; the OsU6a-target fragment is approximately 700 bp, and the gRNA-target fragment is approximately 131 bp. Using 1 μL of each of the first-round PCR products as templates, a second round of PCR is performed using primers U-GAL and Pgs-GAR, following the same steps, for 30 cycles. The resulting product size is approximately 830 bp. Gel electrophoresis was performed, and the gel was cut and recovered. This product is the OsAL7.1 gene target sequence-sgRNA expression cassette.

[0078] The primers for the Gibson assembly are:

[0079] UF: 5'- ctccgttttacctgtggaatcg -3'

[0080] gR-R: 5'-cggaggaaaattccatccac-3'

[0081] U-GAL: 5'-accggtaaggcgcgccgtagtgctcgactagtatggaatcggcagcaaagg-3'

[0082] Pgs-GAR: 5'-tagctcgagaggcgcgccaatgataccgacgcgtatccatccactccaagctcttg-3'

[0083] 2.2.3 Construction of the target CRISPR / Cas9-sgRNA vector

[0084] Assemble the target sequence sgRNA expression cassette into the pYLCRISPR / Cas9Pubi-H vector. Using ClonExpress rapid cloning recombinase from Nanjing Novizan Biotechnology Co., Ltd. as an example: 4 μl 5 × CE II Buffer, 200 ng linearized pYLCRISPR / Cas9Pubi-H plasmid, 200 ng of the recovered PCR product containing the OsAL7.1 target sequence-sgRNA, 2 μl Exnase™ II, and finally water to 20 μl. Incubate at 37℃ for 30 min. Transform 5 μl of the reaction mixture into E. coli, plate on LB agar plates containing kanamycin to screen for positive clones. The next day, select positive single clones for sequencing verification and extract plasmids for preservation. The vector shown in the image is illustrated. Figure 3 The bacteria were transformed with Agrobacterium EHA105, and finally, rice callus transformation experiments were conducted. The resulting transgenic plants were named knAL7.1.

[0085] Example 3: Genetic transformation of rice

[0086] 3.1 Seed disinfection

[0087] After removing the husks from mature Nipponbare rice seeds, place them in sterile Erlenmeyer flasks and soak them in 75% alcohol for 1-2 minutes, then rinse twice with sterile water. Next, sterilize them with 30% NaClO for 30 minutes, shaking frequently during this time. Then rinse them 3-4 times with sterile water, blot off excess water with sterile filter paper, and inoculate approximately 30 seeds onto callus induction medium (MS + 2,4-D 2.0 mg / L) at a rate of 28°C in the dark.

[0088] 3.2 Subculture

[0089] After nearly a month of induction, rice plants developed yellow, swollen callus tissue. The scutellum was removed, and the callus was transferred to fresh callus induction medium (MS + 2,4-D 2.0 mg / L) for subculture. Subculture was performed every two weeks, and 2-4 subcultures were sufficient to obtain pale yellow, granular embryogenic callus tissue suitable for transgenic transformation. Two weeks after subculture, embryogenic granules were selected for genetic transformation.

[0090] 3.3 Culture of Agrobacterium

[0091] Pick a single colony from a transformation plate and culture it in 1 ml of Agrobacterium tumefaciens medium. Add 1 ml of the above culture to 50 ml of Agrobacterium tumefaciens medium (containing the appropriate antibiotic), and incubate at 200 rpm and 28°C for 5-6 hours until the OD600 reaches 0.6-1.0. Two hours before the end of the incubation, add acetosringone (AS, final concentration 100 uM). Take the above bacterial suspension, incubate at 4000 rpm for 10 minutes at room temperature, discard the supernatant, and resuspend the bacterial cells in MS liquid medium (containing 100 uM AS). Incubate under the same conditions for 2 hours until the OD600 of the bacterial suspension reaches 0.5-1. At this point, it can be used to transform callus tissue. AS = acetosringone.

[0092] 3.4 Co-cultivation

[0093] Immerse rice embryogenic callus in Agrobacterium tumefaciens solution for 20-30 minutes, then blot dry with sterile absorbent paper. Place the infected callus on co-culture medium (MS + 2,4-D 2.0 mg / L + AS 100 uM) and incubate in the dark at 28°C for three days.

[0094] 3.5 Washing with bacteria

[0095] The co-cultured callus was first rinsed three times with sterile water, then soaked in MS liquid medium containing 400 mg / L Cef / CN for 20-30 minutes, and then transferred to sterile filter paper to blot dry.

[0096] 3.6 Selection of Culture

[0097] The dried callus tissue was inoculated onto selective medium (MS + 2,4-D 2.0 mg / L + Hyg 30 mg / L + Cef 400 mg / L). After 3 weeks, newly grown callus tissue was selected and inoculated onto selective medium (MS + 2,4-D 2.0 mg / L + Hyg 50 mg / L + Cef 250 mg / L), and then selected for another 2 weeks.

[0098] 3.7 Differentiation Culture

[0099] The resistant callus tissues obtained after two selections were transferred to pre-differentiation medium (N6 + KT 2.0 mg / L + NAA 0.2 mg / L + 6-BA 2.0 mg / L + Hyg 30 mg / L + Cef 200 mg / L + agar 9 g / L + sucrose 45 g / L) and cultured in the dark for about 10 days. Then, they were transferred to differentiation medium (N6 + KT 2.0 mg / L + NAA 0.2 mg / L + 6-BA 2.0 mg / L + Hyg 30 mg / L + agar 4.5 g / L + sucrose 30 g / L) and cultured under light.

[0100] 3.8 Rooting Culture

[0101] After about 1-2 months, the seedlings, which are about 2cm tall, are transferred to rooting medium (1 / 2MS + Hyg 15 mg / L + agar 4.5g / L + sucrose 20g / L) to induce the formation of adventitious roots.

[0102] 3.9 Transplanting of transgenic seedlings

[0103] When the seedlings grow to 10cm in height, remove them, wash off the attached solid culture medium with sterile water, and transplant them into the soil. Cover them with a glass cover for a few days at first, and remove the glass cover after the plants are strong. Cultivate them in a greenhouse.

[0104] Example 4: OsAL7.1 Gene expression analysis in transgenic plants

[0105] 4.1 Material Preparation

[0106] After germination, transgenic T1 generation rice seeds were transplanted into liquid culture medium (prepared with tap water in a 1 / 5 MS macronutrient solution). After 15 days of seedling growth, leaves were cut and quickly immersed in liquid nitrogen for preservation and RNA extraction.

[0107] 4.2 Preparation of DNA-free total RNA

[0108] RNA was extracted according to the instructions of the plant leaf RNA mini-extraction kit provided by Shanghai TransGen Biotech Co., Ltd. RNA concentration was determined using a Beckman Coulter™ DU® 640 UV spectrophotometer. To remove residual DNA from the RNA, 5 μg of each total RNA sample was added, along with 1 μL of DNAase I (Invitrogen, USA) and 1 μL of 10× reaction buffer, bringing the volume to 10 μL. The reaction was incubated at room temperature for 30 min, then 1 μL of 2 mmol L⁻¹ EDTA was added to each tube to terminate the reaction. Finally, the tube was heated at 70°C for 10 min to inactivate DNAase I.

[0109] 4.3 Synthesis of First-Strand cDNA

[0110] Take 2 μL of each of the above RNA samples and add 4 μL of 25 mmol L⁻¹ MgCl₂, 2 μL of 10×RT buffer, 2 μL of dNTP mixture, and 1 μL of oligo(dT)₁₅ sequentially according to the reagents provided by the Promega reverse transcription kit. Add water to bring the volume to 18.5 μL, incubate at 70°C for 10 min to denature, and then rapidly cool on ice. Next, add 0.5 μL of RNase inhibitor and 1 μL of AMVRTase, incubate at 42°C for 60 min, and then heat at 70°C for 10 min to terminate the reaction.

[0111] 4.4 Quantitative PCR

[0112] According to genes OsAL7.1 Sequence-specific primers were designed, with the forward primer being QF: 5'-GTGGTTCCACGGCAAATGC-3' and the reverse primer being QR: 5'-GCCTACTCTTCTTGGAGCTG-3', for use in quantitative real-time PCR, based on rice... Actin Specific primers AF (5'-cttcctcatgccatcctgc-3') and AR (5'-gcaagcttctccttgatgtcc-3') were designed based on the cDNA sequence of the reference gene (GenBank accession No. AY212324) for quantitative real-time PCR. PCR was performed using a BioRad quantitative PCR instrument (USA), with each PCR run in triplicate. The reaction mixture contained 10 μL of Tiangen SYBR Premix Taq™ (2×), 0.5 μL each of the forward and reverse primers, 1 μL of cDNA template for each treatment, and water to a final volume of 25 μL. The reaction program was: 95℃ for 30 s, followed by 40 cycles of 95℃ for 10 s and 61℃ for 34 s. Fluorescence values ​​were read at 60℃ for 34 s in each cycle, and ROX correction was performed. Finally, melting curve analysis of the fluorescent PCR products was performed. For other operational details, please refer to the instrument's instruction manual. To detect DNA contamination in RNA samples, three samples were randomly selected, and 1 μL of RNA was taken from each sample as a template for PCR, using the same method as above.

[0113] 4.5 Analytical Methods

[0114] Ct was automatically generated using the BioRad quantitative PCR instrument software based on the fluorescence threshold of PCR. The data was then input into Excel for calculation and analysis. Data analysis employed method 2. -ΔΔCTThen, use an Excel spreadsheet to create a bar chart to show the differences.

[0115] 4.6 Analysis Results

[0116] Using the blank non-GMO Nipponbare variety as a reference, three independent transgenic lines OE1-3 were tested. All transgenic lines showed strong enhanced expression, with OsAL7.1 showing the highest enhancement exceeding 20-fold (see [link to original text]). Figure 4 (B) indicates that the gene was significantly enhanced in the leaves after being introduced into rice, and can be applied to further transgenic rice research.

[0117] Example 5: Identification of knAL7.1 plants

[0118] According to the genome structure, see Figure 1 Primers CasF (5'-CGACGCCGATGGAGATGGC-3') and CasR (5'-TACCTCATCAGATCCGATCC-3') were designed at both ends of the gene editing site to amplify the edited region fragment. Transgenic rice plants obtained by transforming the CRISPR / Cas9-sgRNA vector were transplanted, and 20 mg of leaves were cut. Following the instructions provided by the rapid plant genomic DNA extraction system (Tiangen, China), leaf DNA was extracted. 1-2 μL of DNA was used as a template, and PCR amplification was performed using Taq polymerase (Tiangen, China). The PCR fragments were recovered, purified, and submitted to the company for sequencing to identify single plants with homozygous mutations at the site. Sequence analysis revealed that... OsAL7.1 A deletion of one T base 61 downstream of the start site of the gene translation codon (see SEQ ID NO.3) results in a frameshift mutation, causing premature termination of the transcript and forming a 125-amino acid polypeptide, while the full-length OsAL7.1 protein sequence is 244 amino acids. It is speculated that after gene editing... OsAL7.1 A gene may lose its function due to premature termination caused by a frameshift mutation (see...). Figure 1 Therefore, the knock-out mutant plants produced in this experiment can be used as functional knockout mutant plants for further research, and the resulting plant is named knAL7.1.

[0119] Example 6: OsAL7.1 Growth status of transgenic plants under drought stress during the seedling stage

[0120] Examples 4 were selected respectively OsAL7.1Overexpression of the OE1 and knAL7.1 gene-edited plants was used in a seedling drought stress experiment. The specific steps were as follows: seeds of each material were sown in small soil containers. When the plants reached the 3-leaf stage, irrigation was stopped and drought treatment was initiated. After 10 days, the seedlings showed severe curling, and irrigation was performed to restore watering. After 5 days of normal growth, the growth status of the transgenic plants was observed. The results showed that the cloned... OsAL7.1 Transgenic plants with overexpressed genes, knAL7.1 gene-edited plants, and recipient parents showed no significant differences from the control under normal conditions. However, after drought treatment, the leaves of all plants exhibited significant curling. Ten days after treatment, under rehydration conditions... OsAL7.1 The survival rate of overexpressing plants was significantly lower than that of non-transgenic control plants (see...). Figure 4 The survival rate of knAL7.1 gene-edited plants was significantly higher than that of non-transgenic control plants (see...). Figure 5 This illustrates overexpression OsAL7.1 It reduced the drought resistance of rice. OsAL7.1 The loss of function improved the plant's drought resistance, indicating that this gene negatively regulates the drought resistance of rice.

[0121] Example 7: OsAL7.1 Seed size identification of gene knockout mutants

[0122] Three transgenic T1 plants of knAL7.1 obtained in Example 5 and recipient Zhonghua 11 were selected and planted in the field. When the plants matured, the seeds of the transgenic T2 plants were harvested and the seed size was observed and measured.

[0123] By photographing and analyzing wild-type rice and knAL7.1 knockout seeds together, we found that the knAL7.1 knockout seeds were significantly larger, especially in grain length, while grain width did not change significantly. This resulted in a significantly higher length-to-width ratio than the control (see...). Figure 6 The seed size of the overexpressed transgenic material was also observed, and no significant changes were observed.

[0124] In summary, knockout OsAL7.1 Gene function makes rice seeds larger.

[0125] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. An application of the rice OsAL7.1 gene, characterized in that: By knocking out or mutating the rice OsAL7.1 gene using gene editing technology, rice seeds can be enlarged. The nucleotide sequence of the rice OsAL7.1 gene is shown in SEQ ID NO.

1.

2. The application of the rice OsAL7.1 gene as described in claim 1, characterized in that: The gene editing involves introducing an insertion or deletion mutation into the first exon region of the rice OsAL7.1 gene. This mutation causes premature termination of gene translation, forming a mutant knAL7.1 gene of the OsAL7.1 gene. The nucleotide sequence of the knAL7.1 gene is shown in SEQ ID NO.

3.

3. The application of the rice OsAL7.1 gene as described in claim 2, characterized in that: The application can improve the drought resistance of rice plants.

4. The application of the rice OsAL7.1 gene as described in claim 2, characterized in that: The application of the rice OsAL7.1 gene guide RNA target sequence primer in editing the rice genome is based on the nucleotide sequence of OsAL7.1 gene-induced RNA as OsAL7.1-sgRNA:GACTTCTCCGGCCGCCGCGC.

5. The application of the rice OsAL7.1 gene as described in claim 2, characterized in that: It also includes the addition of adapters and the use of PCR amplification to construct the OsAL7.1 gene for use in the production of sgRNA expression cassettes with guide RNA target sequences for drought-resistant transgenic plants; The sgRNA expression cassette was loaded into a CRISPR / Cas9 vector to obtain a CRISPR / Cas9-sgRNA vector containing the target sequence. Transforming rice callus tissue with a CRISPR / Cas9-sgRNA vector containing the target sequence yielded rice OsAL7.1 gene mutant knAL7.1 plants.

6. An application of the rice OsAL7.1 gene editing mutant as described in claim 2, characterized in that: The loss of function of the OsAL7.1 gene can increase the size of rice seeds.

7. An application of the rice OsAL7.1 gene editing mutant as described in claim 2, characterized in that: The loss of function of the OsAL7.1 gene can improve the drought resistance of rice under drought conditions.