Antisense oligonucleotides and their applications in pain treatment

Abstract

The present invention relates to an inhibitor of FXYD2, wherein the inhibitor reduces the expression and / or activity of FXYD2 in a subject in need thereof and targets at least a region comprising or consisting of nucleotides 219 to 229 of SEQ ID NO: 3. The inventors have demonstrated that targeting the FXYD2 region can be used to inhibit and / or reduce the expression and / or activity of FXYD2. They designed and synthesized an antisense oligonucleotide (SEQ ID NO: 4) targeting the rat and human FXYD2 genes. They performed intrathecal injection of the FXYD2-optimized ASO in two rat pain models (neuropathic pain and inflammatory pain). They have demonstrated that FXYD2 ASO can effectively reduce its expression in the rat dorsal root ganglion (DRG). They have demonstrated that FXYD2 ASO can significantly reduce neuropathic pain in the spinal nerve ligation (SNL) rat model, and the analgesic effect of FXYD2 ASO on neuropathic pain is greater than that of the current market leader, ziconotide. They have also shown that FXYD2 ASO can significantly reduce inflammatory pain in a rat model induced by complete Freund's adjuvant (CFA).

Description

Technical Field

[0001] The present invention belongs to the field of pain, and more particularly, the present invention relates to methods and pharmaceutical compositions for treating peripheral pain. Background Art

[0002] Pain is an unpleasant sensation, usually caused by intense or damaging stimuli. The definition widely used by the International Association for the Study of Pain states that: "Pain is an unpleasant sensory and emotional experience associated with actual or potential tissue damage, or described in terms of such damage." There are different types of pain.

[0003] Acute pain is a short-term pain that appears suddenly and has a specific cause, usually tissue damage. Generally, it lasts less than 6 months and disappears once the underlying cause is treated.

[0004] Chronic pain is a common problem that poses a major challenge to healthcare providers due to its complex natural history, unclear etiology, and adverse reactions to treatment. Chronic pain is a poorly defined disease. Most authors consider pain lasting more than 6 months as a diagnostic criterion, while other authors use 3 months as the minimum criterion. In chronic pain, the duration parameter is arbitrarily set. Various neuromuscular, reproductive, gastrointestinal, and urinary tract diseases can cause or contribute to chronic pain.

[0005] Nociceptive pain is the most common type of pain. It is caused by stimulating nociceptors, which are pain receptors for tissue damage. Nociceptors are distributed throughout the body, especially in the skin and internal organs. When they are stimulated by potential harm, such as cuts or other injuries, they send electrical signals to the brain, causing the subject to feel pain.

[0006] Visceral pain is caused by damage or injury to internal organs. The subject can feel pain in the trunk area of their body, including the chest, abdomen, and pelvis. It is usually difficult to determine the exact location of visceral pain. Visceral pain is usually described as: pressure, pain, squeezing, or cramping.

[0007] Somatic pain is caused by stimulation of pain receptors in tissues, rather than by stimulation of internal organs. This includes the skin, muscles, joints, connective tissues, and bones. Compared with visceral pain, somatic pain is usually easier to locate. Somatic pain generally feels like a constant ache or gnawing sensation. It can be further divided into deep or superficial: Deep somatic pain is pain felt in joints, tendons, bones, and muscles. It is usually described as aching; Superficial somatic pain is pain felt in the skin and mucous membranes. It may feel sharp or stabbing.

[0008] Peripheral neuropathic pain is caused by damage to the nerve structures of the peripheral nervous system, such as damage to the peripheral nerve endings in the skin (e.g., from nociceptors). These damaged nerve endings can generate impulses without stimulation, can be sensitive to normal stimuli, and / or can be triggered by remaining local inflammation. Even a very small number of damaged and hyperactive small nerve fibers in the epidermis are sufficient to trigger peripheral neuropathic pain. Examples of peripheral neuropathic pain due to diabetic neuropathy, postherpetic neuralgia, trigeminal neuralgia, chronic idiopathic axonal polyneuropathy, and chemotherapy-induced polyneuropathy.

[0009] The two most commonly used topical compounds for treating neuropathic pain are capsaicin (a vanilloid receptor agonist and counterirritant) and lidocaine (a membrane stabilizer). However, both 0.025% to 0.075% topical capsaicin and 8% capsaicin patches have the drawback that their application often causes intolerable side effects, such as increased burning sensation, and the treatment usually has to be combined with a local anesthetic to neutralize this side effect (Jay GW & Barkin RL, 2014). The 5% topical lidocaine patch disclosed in U.S. Patent Application 2014 / 0141056 and U.S. Patent Application 2013 / 0184351 needs to be changed every 12 hours, cannot be used on wounds, ulcers, damaged or inflamed skin, which is common in patients with diabetic neuropathy, and may cause problems when applied to the toes, especially in the elderly, because the patch has to be cut. In addition, there are other topical forms of lidocaine on the market, with a proportion of up to 8% in creams and gels (Deny S et al., 2014). However, there is currently no evidence from high-quality randomized controlled trials to support the use of topical lidocaine for treating neuropathic pain, although some individual studies seem to indicate that topical lidocaine may be able to effectively relieve neuropathic pain (Derry S et al., 2014). However, the consensus among patients and their doctors is that the response rate of patients with neuropathic pain to topical lidocaine, and more generally to any neuropathic pain medication, whether topical or oral, remains very unsatisfactory.

[0010] An increasing number of people believe that "neuropathic pain" is an inadequate umbrella concept. "Neuropathic pain" is a collection of different pathological states characterized by various pathological processes. Expecting a therapeutic molecule to be effective against a range of different neuropathic pain syndromes is clearly an overly demanding requirement. Therefore, there is an urgent need to develop personalized treatment strategies for patients suffering from specific neuropathic pain. In addition, in the case of long-term use, such as daily, weekly, or several times a month, for several days, weeks, months, or years, there is a strong need for treatment regimens that reduce side effects, or better yet, treatment regimens without side effects. Summary of the Invention

[0011] The present invention relates to an inhibitor of FXYD2, wherein the inhibitor reduces the expression and / or activity of FXYD2 in a subject in need thereof and targets at least a region comprising or consisting of nucleotides 219 to 229 of SEQ ID NO:3. Specifically, the present invention is defined by the claims.

[0012] Detailed Description of the Invention:

[0013] The inventors have demonstrated that targeting the FXYD2 region can be used to inhibit and / or reduce the expression and / or activity of FXYD2. They designed and synthesized an antisense oligonucleotide (ASO; e.g., SEQ ID NO:17) that targets the rat and human FXYD2 genes. They have performed intrathecal injection of the FXYD2-optimized ASO in two rat pain models (neuropathic pain and inflammatory pain). They have demonstrated that the FXYD2 ASO can effectively reduce its expression in the rat dorsal root ganglion (DRG). They have demonstrated that the FXYD2 ASO can significantly reduce neuropathic pain in the spinal nerve ligation (SNL) rat model, and that the FXYD2 ASO has a better analgesic effect on neuropathic pain than the current market leader, ziconotide. They have also shown that the FXYD2 ASO can significantly reduce inflammatory pain in a rat model induced by complete Freund's adjuvant (CFA).

[0014] Therefore, the inventors have obtained a tool for treating pain, more particularly neuropathic pain.

[0015] Sequences of the present invention

[0016] In a first aspect, the present invention relates to an inhibitor of FXYD2, wherein the inhibitor can reduce the expression and / or activity of FXYD2 in a subject in need of FXYD2 and targets at least a region comprising or consisting of nucleotides 219 to 229 of SEQ ID NO:3.

[0017] As used herein, the term "FXYD2" refers to the FXYD domain-containing ion transport regulator 2. It has its ordinary meaning in the art and refers to the γ-subunit of Na,K-ATPase. The term includes naturally occurring variants of FXYD2 and their modified forms. The FXYD2 mRNA sequence can be found in NCBI Gene ID NO: 486.

[0018] The nucleotide sequence of the naturally occurring human FXYD2 gene variant b is shown in Genbank accession number NM021603.4. The nucleotide sequence of the cDNA of Homo sapiens FXYD2 transcript variant b is defined by sequence SEQ ID NO:1 (593bp):

[0019] ACTCTCCATCCAGGCCCCAGGCAAGCAGCACCTCCCTGCTCTCCTGCACTCCTGGACACAACCAGCAGCTCCTGCCATGGACAGGTGGTACCTGGGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTACTATGACTATGAGACCGTTCGCAATGGGGGCCTGATCTTCGCTGGACTGGCCTTCATCGTGGGGCTCCTCATCCTCCTCAGCAGAAGATTCCGCTGTGGGGGCAATAAGAAGCGCAGGCAAATCAATGAAGATGAGCCGTAACAGCAGCCTCGGCGGTGCCACCCACTGCACTGGGGCCAGCTGGGAAGCCAAGCATGGCCCTGCCTCTGGCGCCTCCCCTTCTTCCCTGGGCTTTAGACCTTTGTCCCCGTCACTGCCAGCGCTTGGGCTGAAGGAAGCTCCAGACTCAATGTGACCCCCAGGTGGCATCGCCAACTCCTGCCTCGTGCCACCTCATGCTTATAATAAAGCCGGCGTCAGAGACCGCTGCTTCCCTCACCTGCCTGCCTGTCTCCCTCCTCTGTCACCACCAGCCTCTCCAAGCTCAAGTACAAATACAGCCGGGTCTCATTTGTTTTTTCAA.

[0020] The nucleotide sequence of the naturally occurring human FXYD2 gene variant a is shown in Genbank accession number NM001680.5. The nucleotide sequence of the cDNA of Homo sapiens FXYD2 transcript variant a is defined by sequence SEQ ID NO:2 (589bp):

[0021] AGACACTCTCCAAAAAGCAGAGACAGCAGGAAGAGGGGAGTGGAGGCAGCCCATTCACCTGGGGAAATGACTGGGTTGTCGATGGACGGTGGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTACTATGACTATGAGACCGTTCGCAATGGGGGCCTGATCTTCGCTGGACTGGCCTTCATCGTGGGGCTCCTCATCCTCCTCAGCAGAAGATTCCGCTGTGGGGGCAATAAGAAGCGCAGGCAAATCAATGAAGATGAGCCGTAACAGCAGCCTCGGCGGTGCCACCCACTGCACTGGGGCCAGCTGGGAAGCCAAGCATGGCCCTGCCTCTGGCGCCTCCCCTTCTTCCCTGGGCTTTAGACCTTTGTCCCCGTCACTGCCAGCGCTTGGGCTGAAGGAAGCTCCAGACTCAATGTGACCCCCAGGTGGCATCGCCAACTCCTGCCTCGTGCCACCTCATGCTTATAATAAAGCCGGCGTCAGAGACCGCTGCTTCCCTCACCTGCCTGCCTGTCTCCCTCCTCTGTCACCACCAGCCTCTCCAAGCTCAAGTACAAATACAGCCGGGTCTCATTTGTTTTTTCAA.

[0022] The naturally occurring human FXYD2 gene has a common sequence encoding the nucleotide sequences of two variants (a and b) defined by the sequence SEQ ID NO:3:

[0023] 5’-91

[0024] GGCGGCAGCCCCAAGGGGGACGTGGACCCGTTCTACTATGACTATGAGACCGTTCGCAATGGGGGCCTGATCTTCGCTGGACTGGCCTTCATCGTGGGGCTCCTCATCCTCCTCAGCAGAAGATTCCGCTGTGGGGGCAATAAGAAGCGCAGGCAAATCAATGAAGATGAGCCGTAA 267-3’.

[0025] In a specific embodiment, the nucleotide sequence ARN of Homo sapiens FXYD2, transcript variant b, is defined by the sequence SEQ ID NO:4:

[0026] UGA GAG GUA GGU CCG GGG UCC GUU CGU CGU GGA GGG ACG AGA GGA CGU GAGGAC CUG UGU UGG UCG UCG AGG ACG GUA CCU GUC CAC CAU GGA CCC GCC GUC GGG GUUCCC CCU GCA CCU GGG CAA GAU GAU ACU GAU ACU CUG GCA AGC GUU ACC CCC GGA CUAGAA GCG ACC UGA CCG GAA GUA GCA CCC CGA GGA GUA GGA GGA GUC GUC UUC UAA GGCGAC ACC CCC GUU AUU CUU CGC GUC CGU UUA GUU ACU UCU ACU CGG CAU UGU CGU CGGAGC CGC CAC GGU GGG UGA CGU GAC CCC GGU CGA CCC UUC GGU UCG UAC CGG GAC GGAGAC CGC GGA GGG GAA GAA GGG ACC CGA AAU CUG GAA ACA GGG GCA GUG ACG GUC GCGAAC CCG ACU UCC UUC GAG GUC UGA GUU ACA CUG GGG GUC CAC CGU AGC GGU UGA GGACGG AGC ACG GUG GAG UAC GAA UAU UAU UUC GGC CGC AGU CUC UGG CGA CGA AGG GAGUGG ACG GAC GGA CAG AGG GAG GAG ACA GUG GUG GUC GGA GAG GUU CGA GUU CAU GUUUAU GUC GGC CCA GAG UAA ACA AAA AAG UU.

[0027] In a specific embodiment, the nucleotide sequence ARN of Homo sapiens FXYD2, transcript variant a, is defined by the sequence SEQ ID NO:5:

[0028] UCU GUG AGA GGU UUU UCG UCU CUG UCG UCC UUC UCC CCU CAC CUC CGU CGGGUA AGU GGA CCC CUU UAC UGA CCC AAC AGC UAC CUG CCA CCG CCG UCG GGG UUC CCCCUG CAC CUG GGC AAG AUG AUA CUG AUA CUC UGG CAA GCG UUA CCC CCG GAC UAG AAGCGA CCU GAC CGG AAG UAG CAC CCC GAG GAG UAG GAG GAG UCG UCU UCU AAG GCG ACACCC CCG UUA UUC UUC GCG UCC GUU UAG UUA CUU CUA CUC GGC AUU GUC GUC GGA GCCGCC ACG GUG GGU GAC GUG ACC CCG GUC GAC CCU UCG GUU CGU ACC GGG ACG GAG ACCGCG GAG GGG AAG AAG GGA CCC GAA AUC UGG AAA CAG GGG CAG UGA CGG UCG CGA ACCCGA CUU CCU UCG AGG UCU GAG UUA CAC UGG GGG UCC ACC GUA GCG GUU GAG GAC GGAGCA CGG UGG AGU ACG AAU AUU AUU UCG GCC GCA GUC UCU GGC GAC GAA GGG AGU GGACGG ACG GAC AGA GGG AGG AGA CAG UGG UGG UCG GAG AGG UUC GAG UUC AUG UUU AUGUCG GCC CAG AGU AAA CAA AAA AGU U.

[0029] The naturally occurring human FXYD2 gene has a common sequence, and the two variants (a and b) encoded thereby have the following nucleotide sequences and are defined by sequence SEQ ID NO: 6:

[0030] CCG CCG UCG GGG UUC CCC CUG CAC CUG GGC AAG AUG AUA CUG AUA CUC UGGCAA GCG UUA CCC CCG GAC UAG AAG CGA CCU GAC CGG AAG UAG CAC CCC GAG GAG UAGGAG GAG UCG UCU UCU AAG GCG ACA CCC CCG UUA UUC UUC GCG UCC GUU UAG UUA CUUCUA CUC GGC AUU

[0031] In another embodiment, the present invention relates to an inhibitor of FXYD2, wherein the inhibitor can reduce the expression and / or activity of FXYD2 in a subject in need thereof and targets at least 15 nucleotides of the sequences SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0032] In a specific embodiment, the antisense oligonucleotides in the present invention target:

[0033] - a region comprising or consisting of nucleotides 210 to 238 of SEQ ID NO:3; and / or

[0034] - a region comprising or consisting of nucleotides 210 to 267 of SEQ ID NO:3.

[0035] In a specific embodiment, the inhibitor according to the present invention targets at least a region comprising or consisting of nucleotides of SEQ ID NO:3.

[0036] In a specific embodiment, the present invention relates to an FXYD2 inhibitor, wherein the inhibitor reduces the expression and / or activity of FXYD2 in a subject in need thereof and targets at least nucleotides comprising or consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0037] In a specific embodiment, the present invention relates to an inhibitor of FXYD2, wherein the inhibitor reduces the expression and / or activity of FXYD2 in a subject in need thereof and targets a region comprising or consisting of the following nucleic acids 219-229: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0038] In a specific embodiment, the present invention relates to an inhibitor of FXYD2, wherein the inhibitor reduces the expression and / or activity of FXYD2 in a subject in need thereof and targets a region comprising or consisting of the following nucleic acids 210-238: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0039] In a specific embodiment, the present invention relates to an inhibitor of FXYD2, wherein the inhibitor reduces the expression and / or activity of FXYD2 in a subject in need thereof and targets a region comprising or consisting of the following nucleic acids 210-267: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0040] In a specific embodiment, the present invention relates to an inhibitor of FXYD2, wherein the inhibitor reduces the expression and / or activity of FXYD2 in a subject in need thereof and targets a region comprising the following nucleic acids 91 to 267: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0041] In a specific embodiment, the present invention relates to an inhibitor of FXYD2, wherein the inhibitor reduces the expression and / or activity of FXYD2 in a subject in need thereof and targets a region consisting of the following nucleic acids 91 to 267: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0042] In a specific embodiment, the present invention relates to an inhibitor of FXYD2, wherein the inhibitor reduces the expression and / or activity of FXYD2 in a subject in need thereof and targets nucleic acid regions comprising: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0043] In a specific embodiment, the present invention relates to an inhibitor of FXYD2, wherein the inhibitor reduces the expression and / or activity of FXYD2 in a subject in need thereof and targets a region consisting of the following nucleic acids: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0044] In a specific embodiment, the antisense oligonucleotide according to the present invention targets a nucleotide sequence defined by SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 and / or SEQ ID NO:6.

[0045] In some embodiments, the oligonucleotides of the present invention have a length of at least 15 nucleotides.

[0046] In some embodiments, the oligonucleotides of the present invention have a length of 15 to 25 nucleotides

[0047] In particular, the oligonucleotides of the present invention have a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides.

[0048] As used herein, the term "inhibitor" refers to a natural or synthetic compound having a biological effect of inhibiting or reducing the expression and / or activity of FXD2.

[0049] In a specific embodiment, a gene expression inhibitor refers to a natural or synthetic compound having a biological effect of reducing and / or inhibiting the expression of the FXYD2 gene. Those skilled in the art will understand that inhibiting the expression of a gene, such as the FXYD2 gene, generally results in a decrease or even elimination of the gene product (protein, such as FXYD2 protein) in the target cell or tissue, although different degrees of inhibition can be achieved. Inhibiting or reducing expression is commonly referred to as knockdown.

[0050] In a specific embodiment, an FXYD2 activity inhibitor refers to a natural or synthetic compound having a biological effect of reducing and / or inhibiting the activity of FXYD2.

[0051] In a specific embodiment, the inhibitor of FXYD2 gene expression is siRNA, shRNA, antisense oligonucleotide, miRNA or ribozyme.

[0052] In one embodiment, the FXYD2 inhibitor in the present invention is siRNA.

[0053] Small inhibitory RNAs, also known as short interfering RNAs (siRNAs), can also be used as inhibitors of FXYD2 expression in the present invention. Treating a subject or cell with small double-stranded RNA (dsRNA) or a vector or construct that results in the production of small double-stranded RNA causes the expression of FXYD2 to be specifically inhibited by degrading mRNA in a sequence-specific manner (i.e., RNA interference or RNAi), which can reduce FXYD2 gene expression. For genes with known sequences, methods for selecting appropriate dsRNA or dsRNA-encoding vectors are known in the art (see, for example, Tuschl, T. et al. (1999); Elbashir, S.M. et al. (2001); McManus, M.T. et al. (2002); McManus, M.T. et al. (2002); Brummelkamp, T.R. et al. (2002); U.S. Patent Nos. 6,573,099 and 6,506,559; and International Patent Publication Nos.: WO 01 / 36646, WO 99 / 32619, and WO 01 / 68836, each of which is incorporated herein by reference in its entirety).

[0054] In a specific embodiment, the present invention relates to an inhibitor of FXYD2, wherein the inhibitor is siRNA.

[0055] In a specific embodiment, the siRNA according to the present invention targets a region comprising or consisting of a nucleic acid set forth by SEQ ID NO:1, SEQ ID NO:2, SEQ DI NO:3, SEQ DI NO:4, SEQ ID NO:5 or SEQ DI NO:6.

[0056] In a specific embodiment, the siRNA according to the present invention targets a region comprising or consisting of a nucleic acid set forth by SEQ ID NO:3.

[0057] In a specific embodiment, the siRNA according to the present invention consists of a sequence consisting of: SEQ ID NO:31. The nucleic acid set forth by SEQ ID NO:31 is defined by the following nucleic acid: 5'AAGAUUCCGCUGUGGGGGC(UU)3'.

[0058] In one embodiment, the FXYD2 inhibitor according to the present invention is shRNA.

[0059] Short hairpin RNAs (shRNAs) can also be used as FXYD2 expression inhibitors in the present invention. Short hairpin RNA (shRNA) is an RNA sequence that can tightly rotate a hairpin-like structure and can inhibit gene expression through RNA interference. shRNAs are usually expressed using vectors introduced into cells, where the vectors utilize the U6 promoter to ensure continuous expression of shRNAs. Such vectors are usually passed on to daughter cells, enabling genetic inheritance of gene silencing. The shRNA hairpin structure is cleaved by the cellular machinery into siRNA, which then binds to the RNA-induced silencing complex (RISC). This complex binds to and cleaves the mRNA that matches the siRNA to which it binds.

[0060] In one embodiment, the FXYD2 inhibitor according to the present invention is miRNA.

[0061] miRNA (miR) can also be used as an FXYD2 expression inhibitor in the present invention. miRNA has its general meaning in the art and refers to small RNA molecules that are usually 21 to 22 nucleotides in length, although lengths of 19 to 23 nucleotides have been reported, and inhibit the translation of target mRNAs. miRNAs are all processed from longer precursor RNA molecules ("precursor miRNAs"). Precursor miRNAs are transcribed from non-protein-coding genes. Precursor miRNAs have two complementary regions that enable them to form a stem-loop or stacked structure-like shape and are cleaved by a ribonuclease III-like nuclease called Dicer in animals. The processed miRNA is usually part of the stem. The processed miRNA (also called "mature miRNA") becomes part of a large complex for downregulation, such as reducing the translation of specific target genes.

[0062] Multiple miRNAs can be used to knockdown FXYD2. miRNAs can be complementary to different target transcripts or different binding sites of target transcripts. The knockdown efficiency of target genes can also be improved by using polycistronic transcripts. In some embodiments, multiple genes encoding the same miRNAs or different miRNAs can be co-regulated in a single transcript or regulated as separate transcripts in a single vector cassette. In one embodiment, the vector is a viral vector, including but not limited to recombinant adeno-associated virus (rAAV) vectors, lentiviral vectors, retroviral vectors, and retrotransposon-based vector systems.

[0063] In one embodiment, the FXYD2 inhibitor is an antisense nucleic acid.

[0064] The inhibitor of FXYD2 expression of the present invention is constructed based on antisense oligonucleotides. Antisense oligonucleotides, including antisense RNA molecules and antisense DNA molecules, bind to FXYD2 mRNA to prevent protein translation, or reduce the level of FXYD2 protein in cells by increasing mRNA degradation, thereby reducing activity, and directly blocking the translation of FXYD2 mRNA. For example, antisense oligonucleotides of at least about 15 bases complementary to a unique region of the mRNA transcript sequence encoding FXYD2 can be synthesized by conventional phosphodiester techniques and administered by intravenous injection or infusion. Methods for specifically reducing gene expression with known sequences using antisense technology are well known in the art (see, for example, U.S. Patents US6,566,135, US6,566,131, US6,365,354, US6,410,323, US6,107,091, US6,046,321, and US5,981,732, each of which is incorporated herein by reference in its entirety).

[0065] Antisense RNA complementary to the sense target sequence is encoded by a DNA sequence for producing any of the foregoing inhibitors (e.g., antisense, siRNA, shRNA, or miRNA). The DNA encoding the relevant double-stranded RNA is incorporated into a gene cassette, e.g., a DNA transcription expression cassette controlled by a promoter.

[0066] In a specific embodiment, the inhibitor of FXYD2 gene expression is an antisense oligonucleotide.

[0067] In a specific embodiment, the inhibitor of FXYD2 gene expression is an isolated, synthetic, or recombinant antisense oligonucleotide targeting the FXYD2 mRNA transcript. The oligonucleotides of the present invention can be of any suitable type.

[0068] In some embodiments, the oligonucleotide is an RNA oligonucleotide. In some embodiments, the oligonucleotide is a DNA oligonucleotide.

[0069] In a specific embodiment, the antisense oligonucleotides are selected from, but not limited to, the following group: SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41.

[0070]

[0071]

[0072] Table 1 Ability of test antisense oligonucleotide sequences to reduce FXYD2 protein levels in HEK293 cells

[0073] As used herein, the term "nucleotide" is defined as a modified or naturally occurring deoxyribonucleotide or ribonucleotide. Nucleotides generally include purines and pyrimidines, including thymidine (T), cytidine (C), guanosine (G), adenosine (A), and uridine (U).

[0074] As used herein, the term "oligonucleotide" refers to an oligomer of nucleotides as defined above. The term "oligonucleotide" refers to a nucleic acid sequence that is 3'-5' or 5'-3' oriented and can be single-stranded or double-stranded. Oligonucleotides used within the scope of the present invention are particularly DNA or RNA. Additionally, the term "oligonucleotide analog" refers to an oligonucleotide having the following characteristics: (i) having a modified backbone structure, e.g., a backbone other than the standard phosphodiester bond found in natural oligonucleotides and polynucleotides; and (ii) optionally, a modified sugar moiety, e.g., a morpholino group, rather than a ribose or deoxyribose moiety. Oligonucleotide analogs support bases capable of forming hydrogen bonds with standard polynucleotide bases via Watson-Crick base pairing, wherein the analog backbone is linked in a manner that permits specific sequence-based hydrogen bonding between the bases in the oligonucleotide analog molecule and the bases in a standard polynucleotide (e.g., single-stranded RNA or single-stranded DNA). In particular, analogs are those having a substantially uncharged phosphorus-containing backbone. A substantially uncharged phosphorus-containing backbone in an oligonucleotide analog means that most of the subunit linkages, e.g., between 50 and 100%, typically at least 60% to 100% or 75% or 80%, are uncharged and contain a phosphorus atom.

[0075] The term "oligonucleotide" also refers to an oligonucleotide sequence that is inverted relative to its normal transcription orientation and thus corresponds to an RNA or DNA sequence that is complementary to the target gene mRNA molecule expressed within the host cell (e.g., it can hybridize to the target gene mRNA molecule via Watson-Crick base pairing).

[0076] The antisense strand can be constructed in a variety of different ways provided that it is capable of interfering with the expression of the target gene. For example, the antisense strand can be constructed by reverse complementing the coding region (or a portion thereof) of the target gene relative to its normal transcription orientation to permit its complementary transcription (e.g., the RNAs encoded by the antisense and sense genes can be complementary). In some embodiments, the oligonucleotide does not need to have the same intron or exon pattern as the target gene, and non-coding segments of the target gene may be as effective as coding segments, such as antisense oligonucleotides (ASOs), in achieving antisense inhibition of target gene expression. In some embodiments, the oligonucleotide has the same exon pattern as the target gene, such as siRNA and antisense oligonucleotides (ASOs).

[0077] As used herein, the term "target" or "targeting" refers to an oligonucleotide capable of specifically binding to the FYXD2 gene or FXYD2 mRNA encoding the FYXD2 gene product. In particular, it refers to an oligonucleotide capable of inhibiting said gene or said mRNA by methods known to those skilled in the art (e.g., antisense, RNA interference).

[0078] According to the present invention, the antisense oligonucleotides in the present invention target the mRNA and / or DNA encoding the FXYD2 gene product and are capable of reducing the expression level and / or activity of FXYD2 in cells.

[0079] That is, the antisense oligonucleotide comprises a sequence that is at least partially complementary, particularly fully complementary, to a region of the mRNA sequence, and the complementarity is sufficient to produce specific binding under intracellular conditions. As is well known to those skilled in the art, a sequence that is "fully complementary" to a second sequence refers to the reverse complementary counterpart of the second sequence, whether in the form of a DNA molecule or an RNA molecule. If there is one or more mismatches, the sequence is "partially complementary" to the second sequence.

[0080] The antisense oligonucleotides of the present invention target the FXYD2 gene encoded by cDNA or mRNA (e.g., the FXYD2 gene including SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6) and can be designed by using the sequence of the mRNA as a basis, for example, using bioinformatics tools.

[0081] In particular, the antisense oligonucleotides according to the present invention are capable of reducing the expression and / or activity of FXYD2 in DRG. Methods for determining whether an oligonucleotide is capable of reducing the expression and / or activity of FXYD2 in cells are known to those skilled in the art.

[0082] This can be achieved, for example, by analyzing the expression of FXYD2 RNA, such as by RT-qPCR, in situ hybridization or FXYD2 protein expression, immunohistochemistry, Western blotting, and by comparing the FXYD2 protein expression or FXYD2 functional activity in the presence and absence of the antisense oligonucleotide to be tested.

[0083] In other embodiments, the oligonucleotide targets sequences in the translation initiation site (AUG codon), coding region (e.g., one or more exons), 5'-untranslated region or 3'-untranslated region of the mRNA. The aim is to interfere with the functions of messenger RNA, including all important functions, including RNA translocation to the protein translation site, actual translation of proteins from RNA, splicing or maturation of RNA, and even independent catalytic activities that RNA may participate in. The overall effect of this interference with RNA function is to result in interference with protein expression.

[0084] In some embodiments, the oligonucleotides of the invention are further modified, particularly chemically modified, to improve in vivo stability and / or therapeutic efficiency. Those skilled in the art can readily provide modifications that will enhance the efficacy of the oligonucleotides, such as stabilizing modifications (C. Frank Bennett and Eric E. Swayze, RNA Targeting Therapeutics: Molecular Mechanisms of Antisense Oligonucleotides as a Therapeutic Platform Annu. Rev. Pharmacol. Toxicol. 2010. 50:259-293; Juliano RL. The delivery of therapeutic oligonucleotides. Nucleic Acids Res. 2016 Aug 19;44(14):6518-48). In particular, the oligonucleotides used in the context of the present invention may contain modified nucleotides. Chemical modifications can occur at three different sites: (i) at the phosphate group, (ii) on the sugar molecule, and / or (iii) in the overall backbone structure of the oligonucleotide. Generally, chemical modifications include backbone modifications, heterocyclic modifications, sugar modifications, and conjugation strategies.

[0085] For example, the oligonucleotide is selected from the group consisting of: oligodeoxyribonucleotides, oligoribonucleotides, small regulatory RNAs (sRNAs), U7 or U1-mediated ASOs or their conjugates, such as: peptide-conjugated or nanoparticle-complexed ASOs, oligonucleotides chemically modified by backbone modifications such as: morpholinos, phosphorodiamidate morpholino oligomers (phosphorodiamidate morpholino oligomers, PMOs), peptide nucleic acids (PNAs), phosphorothioate (PS) oligonucleotides, stereochemically pure phosphorothioate (PS) oligonucleotides, phosphoramidate-modified oligonucleotides, thiophosphoramidate-modified oligonucleotides, and methylphosphonate-modified oligonucleotides; oligonucleotides chemically modified by heterocyclic modifications, such as: bicyclic-modified oligonucleotides, bicyclic nucleic acids (BNAs), tricyclic-modified oligonucleotides, tricyclic-DNA-antisense oligonucleotides (ASOs), nucleobase modifications, such as 5-methyl substitution on pyrimidine nucleobases, 5-substituted pyrimidine analogs, 2-thiothymine-modified oligonucleotides, and purine-modified oligonucleotides; oligonucleotides chemically modified by sugar modifications, such as: locked nucleic acid (LNA) oligonucleotides, 2',4'-methyleneoxy-bridged nucleic acids (BNAs), ethylene-bridged nucleic acids (ENAs), constrained ethyl (cEt) oligonucleotides, 2'-modified RNAs, 2'- and 4'-modified oligonucleotides, such as: 2'-O-Me RNA (2'-OMe), 2'-O-methoxyethyl RNA (MOE), 2'-fluoro RNA (FRNA), and 4'-thio-modified DNA and RNA; oligonucleotides chemically modified by conjugation strategies, such as: N-acetylgalactosamine (GalNAc) oligonucleotide conjugates, such as 5'-GalNAc and 3'-GalNAc ASO conjugates, lipid oligonucleotide conjugates (LASOs), cell-penetrating peptide (CPP) oligonucleotide conjugates, targeted oligonucleotide conjugates, antibody oligonucleotide conjugates, polymer oligonucleotide conjugates, such as: polyethylene glycolylated and targeted ligands; and, for example, Bennett and Swayze, 2010 (RNA targeting therapeutics: molecular mechanisms of antisense oligonucleotides as a therapeutic platform. Annu Rev Pharmacol Toxicol. 2010;50:259-93); Wan and Seth, 2016 (The Medicinal Chemistry of Therapeutic Oligonucleotides.The chemical modification and conjugation strategies reported by J Med Chem. 2016 Nov 10; 59(21):9645 - 9667); Juliano, 2016 (The delivery of therapeutic oligonucleotides. Nucleic Acids Res. 2016 Aug 19; 44(14):6518 - 48); Lundin et al., 2015 (Oligonucleotide Therapies: The Past and the Present. Hum Gene Ther. 2015 Aug; 26(8):475 - 85); and Prakash, 2011 (An overview of sugar - modified oligonucleotides for antisense therapeutics. Chem Biodivers. 2011 Sep; 8(9):1616 - 41). In fact, in order for oligonucleotides to be stabilized when used in vivo. A "stabilized" oligonucleotide refers to an oligonucleotide that is resistant to in - vivo degradation (e.g., by exonucleases or endonucleases). Stabilization can be a function of length or secondary structure. In particular, oligonucleotides can be stabilized by phosphate backbone modification, phosphodiester modification, phosphorothioate (PS) backbone modification, a combination of phosphodiester modification and phosphorothioate modification, thiophosphoramidate modifications, 2' modification (2'-O - Me, 2'-O-(2 - methoxyethyl) (MOE) modification and 2'-fluoro modification), methylphosphonate, methylthiophosphonate, dithiophosphonate, p - ethoxy and their combinations.

[0086] In a specific embodiment, the antisense oligonucleotide is lipid - conjugated and is called LASO. In certain embodiments, the modification of the antisense oligonucleotides of the present invention is modified by substitution at the 3' or 5' end with a moiety comprising at least three saturated or unsaturated, especially saturated, straight - chain or branched - chain, especially straight - chain hydrocarbon chains, the hydrocarbon chains as described in WO2014 / 195432, hydrocarbon chains comprising 2 to 30 carbon atoms, especially 5 to 20 carbon atoms, more especially 10 to 18 carbon atoms.

[0087] In some embodiments, the antisense oligonucleotides of the present invention are modified by partial substitution with a moiety comprising at least one ketal functional group at the 3' or 5' terminus, wherein the ketal carbon of the ketal functional group bears two saturated or unsaturated, especially saturated, straight-chain or branched-chain, particularly straight-chain hydrocarbon chains, as described in WO2014 / 195430, including from 1 to 22 carbon atoms, particularly from 6 to 20 carbon atoms, especially from 10 to 19 carbon atoms, and even more particularly from 12 to 18 carbon atoms.

[0088] For example, the oligonucleotide can be used as a phosphorothioate derivative (replacing non-bridging phosphoryl oxygen atoms with sulfur atoms), which has increased resistance to nuclease digestion. 2'-Methoxyethyl (MOE) modifications (such as the modified backbone commercialized by IONIS Pharmaceuticals) are also effective. Additionally or alternatively, the oligonucleotides of the present invention may comprise fully, partially or combinatorially modified nucleotides, which are derivatives having substitutions at the 2'-position of the sugar, particularly having the following chemical modifications: O-methyl (2'-O-Me) substitution, 2-methoxyethyl (2'-O-MOE) substitution, fluoro group (2'-fluoro) substitution, chloro group (2'-Cl) substitution, bromo group (2'-Br) substitution, cyanide group (2'-CN) substitution, trifluoromethyl (2'-CF 3 ) substitution, OCF 3 group (2'-OCF 3 ) substitution, OCN group (2'-OCN) substitution, O-alkyl (2'-O-alkyl) substitution, S-alkyl (2'-S-alkyl) substitution, N-alkyl (2'-N-alkyl) substitution, O-alkenyl (2'-O-alkenyl) substitution, S-alkenyl (2'-S-alkenyl) substitution, N-alkenyl (2'-N-alkenyl) substitution, SOCH 3 group (2'-SOCH 3 ) substitution, SO 2 CH 3 group (2'-SO 2 CH 3 ) substitution, ONO 2 group (2'-ONO 2 ) substitution, NO 2 group (2'-NO 2 ) substitution, N 3 group (2'-N 3 ) substitution and / or NH 2 group (2'-NH 2) Substitution. Additionally or alternatively, the oligonucleotides of the present invention may comprise fully or partially modified nucleotides, where the ribose moiety is used to generate locked nucleic acid (LNA), forming a covalent bridge between the 2'-oxygen and 4'-carbon of the ribose, fixing it in the 3'-endo conformation. These molecules are highly stable in biological media and are capable of activating RNase H, for example when LNA is located at the terminus (Gapmer), and form tight hybrids with complementary RNA and DNA.

[0089] In some embodiments, the oligonucleotides used within the scope of the present invention comprise those selected from LNA, 2'-OMe analogs, 2'-O-Met, 2'-O-(2-methoxyethyl) (MOE) oligomers, 2'-thiophosphate analogs, 2'-fluoro analogs, 2'-Cl analogs, 2'-Br analogs, 2'-CN analogs, 2'-CF3 analogs, 2'-OCF 3 analogs, 2'-OCN analogs, 2'-O-alkyl analogs, 2'-S-alkyl analogs, 2'-N-alkyl analogs, 2'-O-alkenyl analogs, 2'-S-alkenyl analogs, 2'-N-alkenyl analogs, 2'-SOCH 3 analogs, 2'-SO 2 CH 3 analogs, 2'-ONO 2 analogs, 2'-NO 2 analogs, 2'-N 3 analogs, 2'-NH 2 analogs, tricyclic (tc)-DNAs, U7 small nuclear (sn) RNAs, tricyclic-DNA antisense oligonucleotides, and combinations thereof (U.S. Provisional Patent 61 / 212384, filed Apr. 10, 2009, regarding tricyclic DNA antisense oligonucleotides, compositions, and methods for treating diseases; this reference is incorporated herein by reference).

[0090] In a specific embodiment, the oligonucleotide according to the present invention is an LNA oligonucleotide. As used herein, the term "LNA" (locked nucleic acid) (or "LNA oligonucleotide") refers to an oligonucleotide containing one or more bicyclic, tricyclic or polycyclic nucleoside analogs, also referred to as LNA nucleotides and LNA analog nucleotides. LNA oligonucleotides, LNA nucleotides and LNA analog nucleotides are generally described in International Publication No. WO 99 / 14226 and subsequent applications; International Publication Nos. WO 00 / 56746, WO00 / 56748, WO 00 / 66604, WO 01 / 25248, WO 02 / 28875, WO 02 / 094250, WO 03 / 006475; U.S. Patent Nos. US6,043,060, US6268490, US6770748, US6639051 and U.S. Publication Nos. 2002 / 0125241, 2003 / 0105309, 2003 / 0125241, 2002 / 0147332, 2004 / 0244840 and 2005 / 0203042, all of which are incorporated herein by reference. LNA oligonucleotides and LNA analog oligonucleotides are available from, for example, Proligo LLC, 6200 Lookout Road, Boulder, CO 80301 USA.

[0091] Other forms of oligonucleotides of the present invention are oligonucleotide sequences of small nuclear RNA molecules such as U1 or U7 in combination with virus transfer methods based on but not limited to lentivirus or adeno-associated virus (Denti, M.A. et al., 2008; Goyenvalle, A. et al., 2004).

[0092] Other forms of the oligonucleotides of the present invention are peptide nucleic acids (PNAs). In peptide nucleic acids, the deoxyribose backbone of the oligonucleotide is replaced by a backbone that is more similar to a peptide than a sugar. Each subunit or monomer has a natural or unnatural base attached to the backbone. One such backbone consists of repeating units of N-(2-aminoethyl)glycine linked by amide bonds. These compounds are named peptide nucleic acids because the radicals deviate from the deoxyribose backbone (Dueholm et al., New J. Chem., 1997, 21, 19-31). PNAs bind to DNA and RNA to form PNA / DNA or PNA / RNA duplexes. The resulting PNA / DNA or PNA / RNA duplexes have greater affinity than the corresponding DNA / DNA, DNA / RNA, or RNA / RNA duplexes, as determined by Tm. This high thermal stability may be due to the lack of charge repulsion in the neutral backbone of PNA. The neutral backbone of PNA also results in the Tm of PNA / DNA(RNA) duplexes being almost unaffected by salt concentration. Thus, compared to DNA / DNA, DNA / RNA, or RNA / RNA duplex interactions that are highly dependent on ionic strength, the interaction of PNA / DNA(RNA) duplexes provides further advantages. It has been demonstrated that high-pyrimidine PNAs bind to complementary DNA or RNA in an antiparallel orientation to form (PNA)2 / DNA(RNA) triplexes with high thermal stability (see, for example, Egholm et al., Science, 1991, 254, 1497; Egholm et al., J. Am. Chem. Soc. 1992, 114, 1895; Egholm et al., J. Am. Chem. Soc., 1992, 114, 9677). In addition to increased affinity, PNAs have also been shown to bind to DNA or RNA with increased specificity. When a PNA / DNA duplex mismatch dissociates relative to a DNA / DNA duplex, an 8 to 20 °C decrease in Tm can be seen. This magnitude of Tm decrease is not seen for the corresponding DNA / DNA duplexes with mismatches. The binding of a PNA strand to a DNA or RNA strand can occur in either of two orientations. The binding of a PNA strand to a DNA or RNA strand can occur in either of two directions. When a DNA or RNA strand in the 5' to 3' direction binds to a complementary PNA strand such that the carboxyl terminus of the PNA points towards the 5' terminus of the DNA or RNA and the amino terminus of the PNA points towards the 3' end of the DNA or RNA, this orientation is called antiparallel. In the parallel orientation, the carboxyl and amino termini of the PNA are exactly opposite to the 5'-3' direction of the DNA or RNA. Another advantage of PNA compared to oligonucleotides is that its polyamide backbone (with appropriate bases or other side chain groups attached to it) is not recognized by nucleases or proteases and is not cleaved. Thus, PNAs, unlike nucleic acids and peptides, can be resistant to enzymatic degradation.WO92 / 20702 describes a peptide nucleic acid (PNA) compound which binds more tightly to complementary DNA and RNA than does the corresponding DNA. PNA exhibits strong binding affinity and specificity for complementary DNA (Egholm, M. et al., Chem. Soc., Chem. Commun., 1993, 800; Egholm, M., et al., Nature, 1993, 365, 566; and Nielsen, P. et al., Nucl. Acids Res., 1993, 21, 197). In addition, PNA shows nuclease resistance and stability in cell extracts (Demidov, V.V. et al., Biochem. Pharmacol., 1994, 48, 1309-1313). Modifications of PNA include extended backbone (Hyrup, B. et al., Chem. Soc., Chem. Commun., 1993, 518), extended linker between the backbone and the nucleobase, inversion of the amida bond (Lagriffoul, P.H. et al., Biomed. Chem. Lett., 1994, 4, 1081), and use of an alanine-based chiral backbone (Dueholm, K.L. et al., BioMed. Chem. Lett., 1994, 4, 1077). U.S. Patent No. US5,539,082 and U.S. Patent No. US5,539,083 describe peptide nucleic acids. Peptide nucleic acids are further described in U.S. Patent Application No. 08 / 686,113.

[0093] Generally, the oligonucleotides of the present invention are obtained by conventional methods well known to those skilled in the art. For example, the oligonucleotides of the present invention can be synthesized de novo using any of a number of well-known methods in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage et al., 1981); the nucleoside H-phosphonate method (Garegg et al., 1986; Froehler et al., 1986, Garegg et al., 1986, Gaffney et al., 1988). These chemical reactions can be accomplished by various commercially available automated nucleic acid synthesizers. These nucleic acids can be referred to as synthetic nucleic acids. Alternatively, oligonucleotides can be produced on a large scale in plasmids (see Sambrook et al., 1989). Oligonucleotides can be prepared from existing nucleic acid sequences using known techniques, such as techniques using restriction endonucleases, exonucleases or endonucleases. Oligonucleotides prepared in this manner can be referred to as isolated nucleic acids.

[0094] Those skilled in the art can readily provide some methods and modifications for enhancing the delivery and efficacy of oligonucleotides, such as chemical modifications of oligonucleotides, lipid- and polymer-based nanoparticles or nanocarriers, ligand-oligonucleotide conjugates by linking oligonucleotides to targeting agents such as carbohydrates, peptides, antibodies, aptamers, lipids or small molecules and small molecules that improve oligonucleotide delivery, as described in Juliano RL. Improve the delivery of oligonucleotides. Nucleic Acids Res. 2016 Aug 19;44(14):6518-48. Lipophilic conjugates and lipid conjugates include fatty acid-oligonucleotide conjugates, sterol oligonucleotide conjugates and vitamin-oligonucleotide conjugates.

[0095] In a specific embodiment, the oligonucleotide of the present invention is conjugated to a second molecule. Generally, the second molecule is selected from the group consisting of aptamers, antibodies or polypeptides. For example, the oligonucleotide of the present invention can be conjugated to a cell-penetrating peptide. Cell-penetrating peptides are well known in the art, such as the TAT peptide (Bechara C, Sagan S. Cell-penetrating peptides: 20 years later, where do we stand? FEBS Lett. 2013 Jun 19;587(12):1693-702).

[0096] In some embodiments, the oligonucleotides of the present invention are associated with a carrier or vehicle, such as liposomes or micelles, although other carriers may be used as is well known to those skilled in the art. Liposomes are vesicles made of a lipid bilayer having a structure similar to that of biological membranes. Such carriers are used to facilitate cellular uptake or targeting of oligonucleotides, or to improve the pharmacokinetic or therapeutic properties of oligonucleotides. For example, the oligonucleotides of the present invention may also be encapsulated in liposomes and administered in a pharmaceutical composition, wherein the active ingredient is dispersed or otherwise present in vesicles composed of aqueous concentric layers attached to a lipid layer. Depending on solubility, the oligonucleotide may be present in both the aqueous and lipid layers, or in a substance commonly referred to as a liposome suspension. The hydrophobic layer generally but not limited to, includes phospholipids (such as lecithin and sphingomyelin), steroids (such as cholesterol), more or less ionic surfactants (such as diacetyl phosphate, stearylamine or phosphatidic acid) or other materials having hydrophobic properties. The diameter of liposomes generally ranges from 15 nanometers to 5 micrometers. The use of liposomes as drug delivery carriers has several advantages. Liposomes increase intracellular stability, improve absorption efficiency and enhance biological activity. Liposomes are hollow spherical vesicles composed of lipids, arranged in a manner similar to the lipids that make up cell membranes. They have an internal aqueous space for trapping water-soluble compounds, with a size range of 0.05 to several micrometers in diameter. Some studies have shown that liposomes can deliver nucleic acids into cells and the nucleic acids remain biologically active. For example, liposome delivery carriers initially designed as research tools, such as Lipofectin, can deliver intact nucleic acid molecules into cells. Specific advantages of using liposomes include: they are non-toxic and biodegradable in the composition; they exhibit a longer circulating half-life; recognition molecules can be easily attached to their surface for tissue targeting. Finally, the cost-effective production of liposome-based drugs in the form of liquid suspensions or lyophilized products has demonstrated the feasibility of this technology as an acceptable drug delivery system.

[0097] In some embodiments, the oligonucleotides of the present invention are complexed with a chelating agent to increase cellular uptake of the oligonucleotides. An example of a chelating agent includes a cationic lipid. Cationic lipids can be used to deliver oligonucleotides to cells. The term "cationic lipid" includes lipids and synthetic lipids having polar and nonpolar domains that are capable of being positively charged at or around physiological pH and that bind to polyanions such as nucleic acids and facilitate entry of the nucleic acids into cells. Generally, cationic lipids include esters, amides, or derivatives thereof of saturated and unsaturated alkyl and cycloaliphatic ethers and amines. The straight-chain and branched-chain alkyl and alkenyl groups of the cationic lipids can contain, for example, from 1 to about 25 carbon atoms. In particular, the straight-chain or branched-chain alkyl or olefin group has six or more carbon atoms. Cycloaliphatic groups include cholesterol and other steroid groups. Cationic lipids can be prepared with a variety of counterions (anions), including, for example, Cl−, Br−, I−, F−, acetate, trifluoroacetate, sulfate, nitrite, and nitrate. Examples of cationic lipids include: polyethyleneimine, polyamidoamine (PAMAM) starburst dendrimers, Lipofectin (a combination of DOTMA and DOPE), Lipofectase, Lipofectamine, DOPE, Cytofectin (Gilead Sciences, Foster City, Calif.), and Eufectins (JBL, San Luis Obispo, Calif.).Cationic liposomes can contain the following substances: N-[1-(2,3-dioleoloxy)-propyl]-N,N,N-trimethylammonium chloride (DOTMA), N-[1-(2,3-dioleoloxy)-propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP), 3p-[N-(N',N'-dimethylaminoethane)carbamoyl]cholesterol (DC-Chol), 2,3,-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-N,N-dimethyl-1-propanaminium trifluoroacetate (DOSPA), 1,2-dimyristyloxypropyl-3-dimethy-1-hydroxyethyl ammonium bromide, and dimethyldioctadecylammonium bromide (DDAB). For example, the cationic lipid N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA) has been found to increase the antisense effect of phosphorothioate oligonucleotides by 1000-fold. (Vlassov et al., 1994, Biochimica et Biophysica Acta 1197:95-108). Oligonucleotides can also be complexed with, for example, poly(L-lysine) or avidin, and such mixtures may or may not include lipids (e.g., steroid-poly(L-lysine)). Cationic lipids have been used in the art to deliver oligonucleotides to cells (see, e.g., U.S. Patent Nos. US5,855,910, US5,851,548, US5,830,430, US5,780,053, US5,767,099; Lewis et al., 1996. Proc. Natl. Acad. Sci. USA 93:3176; Hope et al., 1998. Molecular Membrane Biology 15:1).Other lipid compositions useful for facilitating the uptake of the oligonucleotides of the invention can be used in combination with the methods. Other lipid compositions are known in the art and include, for example, those disclosed in U.S. Patent Nos. US4,235,871, US4,501,728, US4,837,028, and US4,737,323, in addition to those listed above.

[0098] In certain embodiments, an inhibitor according to the invention, wherein the inhibitor targets a region consisting of the nucleotides of SEQ ID NO:3.

[0099] In specific embodiments, the antisense oligonucleotides according to the invention comprise a sequence consisting of: SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, or SEQ ID NO:41.

[0100] In a specific embodiment, the antisense oligonucleotides according to the present invention consist of the following sequences: SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41.

[0101] In a specific embodiment, the antisense oligonucleotides according to the present invention comprise and / or consist of sequences consisting of: SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41.

[0102] In a specific embodiment, the antisense oligonucleotides according to the invention comprise or consist of the sequences set forth in SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26.

[0103] In a specific embodiment, the inhibitor and / or antisense oligonucleotides according to the invention, wherein the inhibitor and / or antisense oligonucleotides are capable of reducing the amount of FYXD2 in the dorsal root ganglion (DRG).

[0104] According to the invention, the first nucleic acid sequence has at least 70% identity with the second nucleic acid sequence, i.e., the first nucleic acid sequence has 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99% similarity to the second nucleic acid sequence. The identity of nucleic acid sequences is determined in particular using suitable sequence alignment algorithms and default parameters, such as BLAST N (Karlin and Altschul, Proc. Natl. Acad. Sci. USA 87(6):2264-2268 (1990)).

[0105] Vectors of the present invention

[0106] In a second aspect, the invention relates to a vector for delivering allogeneic nucleic acid, wherein the nucleic acid encodes an inhibitory RNA that specifically binds to FXYD2 mRNA and inhibits the expression of FXYD2 in cells.

[0107] In a specific embodiment, the invention relates to a vector for delivering allogeneic nucleic acid, wherein the nucleic acid encodes an inhibitor according to the invention that specifically binds to FXYD2 mRNA and inhibits the expression of FXYD2 in cells.

[0108] In a specific embodiment, the vector according to the invention, wherein the inhibitor is an siRNA or antisense oligonucleotide as described above.

[0109] In another embodiment, the nucleic acid of the invention (e.g., antisense nucleic acid) can be delivered in vivo alone (naked ASO / LASO) or in combination with a vector.

[0110] In the broadest sense, a "vector" is any vector that can facilitate the transfer of the oligonucleotides of the present invention into cells. In particular, the degree of degradation of the vector when transporting nucleic acids into cells is reduced relative to the degree of degradation that would result in the loss of the vector. Generally, vectors for use in the present invention include, but are not limited to, naked plasmids, non-viral delivery systems (cationic transfection agents, liposomes, lipid nanoparticles, etc.), phagemids, viruses, and other vectors derived from viruses or bacteria that are engineered by inserting or incorporating oligonucleotide sequences. Viral vectors include, but are not limited to, nucleic acid sequences from the following viruses: RNA viruses such as retroviruses (e.g., Moloney murine leukemia virus and lentiviral derived vectors), Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus; adenoviruses, adeno-associated viruses (AAV), SV40-type viruses, polyomaviruses, Epstein-Barr viruses, papillomaviruses, herpesviruses, vaccinia viruses, and polioviruses. Other unnamed but known vectors in the art can be readily used.

[0111] Accordingly, an object of the present invention relates to a vector that comprises an oligonucleotide sequence encoding a portion or fragment or a variant of FXYD2.

[0112] In another embodiment, the vector of the present invention comprises any variant of an oligonucleotide sequence encoding a portion or fragment of FXYD2.

[0113] In another embodiment, the vector of the present invention comprises any variant of an oligonucleotide sequence encoding any variant of FXYD2.

[0114] In another embodiment, the present invention relates to a vector that comprises an antisense oligonucleotide sequence encoding a portion or fragment or a variant of FXYD2.

[0115] In another embodiment, the present invention relates to a vector comprising an shRNA sequence that encodes a portion or fragment or a variant of FXYD2.

[0116] In another embodiment, the present invention relates to a vector comprising an miRNA sequence that encodes a portion or fragment or a variant of FXYD2.

[0117] In another embodiment, the vector according to the invention, wherein the antisense oligonucleotide targets a region comprising or consisting of nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0118] In another embodiment, the invention relates to a vector comprising the sequences SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41, which encodes a part or fragment of FXYD2, or a variant thereof.

[0119] In another embodiment, the invention relates to a vector consisting of: SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41, which encodes a part or fragment of FXYD2, or a variant thereof.

[0120] In another embodiment, the vector of the invention comprises any variant of the sequence: SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29 or SEQ ID NO:30, SEQ ID NO:26 or SEQ ID NO:27, which encodes a part or fragment of FXYD2, or a variant thereof.

[0121] In another embodiment, the vector of the present invention consists of any variant of the following sequences: SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41, which encodes a part or fragment of FXYD2, or a variant thereof.

[0122] In a specific embodiment, the vector of the present invention consists of any variant of the following sequences: SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26.

[0123] In another embodiment, the present invention relates to a vector comprising a sequence selected from but not limited to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6 and a promoter.

[0124] In another embodiment, the invention relates to a vector comprising or consisting of a sequence selected from, but not limited to, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41 and a promoter.

[0125] In another embodiment, the invention relates to a vector comprising or consisting of a sequence selected from, but not limited to, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26 and a promoter.

[0126] In another embodiment, the vector according to the invention, wherein the antisense oligonucleotide targets a region comprising or consisting of the nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6 and the U6 promoter or the PolII promoter.

[0127] In some embodiments, the sequences comprised by the vector are sequences from a group selected from but not limited to SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41, as well as the U6 promoter or the PolII promoter.

[0128] In some embodiments, the vector comprises a sequence selected from a group consisting of but not limited to SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, as well as a sequence comprising the U6 promoter or the PolII promoter.

[0129] In another embodiment, the present invention relates to a vector comprising an oligonucleotide sequence encoding a part or fragment or a variant of FXYD2, as well as the CAG promoter.

[0130] In another embodiment, the present invention relates to a vector comprising an oligonucleotide sequence encoding a part or fragment or a variant of miRNA, as well as the CAG promoter.

[0131] In another embodiment, the present invention relates to a vector comprising an oligonucleotide sequence encoding a part or fragment or a variant of shRNA, as well as the U6 promoter.

[0132] In another embodiment, the vector according to the invention, wherein the antisense oligonucleotide targets a region comprising or consisting of a nucleotide having SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5 or SEQ ID NO: 6 and the CAG promoter.

[0133] In another embodiment, the invention relates to a vector comprising a sequence selected from, but not limited to, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40 or SEQ ID NO: 41 and the CAG promoter.

[0134] In a specific embodiment, the vector of the invention comprises a sequence selected from, but not limited to, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26 and the CAG promoter.

[0135] Variants include, for example, those that occur naturally due to allelic variations (e.g., polymorphisms) between individuals, alternative splicing forms, etc. The term "variant" also includes gene sequences of the present invention from other sources or organisms. Variants are preferably substantially homologous to the sequences of the present invention, i.e., exhibit nucleotide sequence identity with the sequences of the present invention typically of at least about 75%, preferably at least about 85%, more preferably at least about 90%, and even more preferably at least about 95%. Variants of the genes of the present invention also include nucleic acid sequences that hybridize to the sequences (or their complementary strands) defined above under stringent hybridization conditions. Typical stringent hybridization conditions include temperatures above 30°C, preferably above 35°C, more preferably above 42°C, and / or salinities below about 500 mM, preferably below 200 mM. Hybridization conditions can be adjusted by those skilled in the art by varying the temperature, salinity, and / or the concentration of other reagents such as SDS, SSC, etc.

[0136] In a specific embodiment, the vector used according to the present invention is a non-viral vector or a viral vector.

[0137] In a specific embodiment, the non-viral vector is a plasmid containing a nucleic acid sequence encoding FXYD2.

[0138] In another specific embodiment, the vector can be a viral vector.

[0139] Gene delivery viral vectors useful in the practice of the present invention can be constructed using methods well known in the field of molecular biology. Generally, viral vectors carrying a transgene are assembled from a polynucleotide encoding the transgene, appropriate regulatory elements, and elements necessary for the production of viral proteins that mediate cell transduction.

[0140] As used herein, the term "transgene" refers to the antisense oligonucleotides of the present invention.

[0141] The terms "gene transfer" or "gene delivery" refer to methods or systems for the reliable insertion of foreign DNA into host cells. Such methods can result in transient expression of non-integrated transferred DNA, extrachromosomal replication, and expression of transferred replicons (e.g., episomes), or integration of the transferred genetic material into the genomic DNA of the host cell.

[0142] Such recombinant viruses can be made by techniques known in the art, such as by transfecting packaging cells or by transient transfection with a helper plasmid or virus. Typical examples of virus packaging cells include PA317 cells, PsiCRIP cells, GPenv+ cells, 293 cells, etc. Detailed protocols for making such replication-defective recombinant viruses can be found, for example, in WO95 / 14785, WO96 / 22378, US5,882,877, US6,013,516, US4,861,719, US5,278,056, and WO94 / 19478.

[0143] In a specific embodiment, the viral vector can be an adenovirus, retrovirus, lentivirus, herpes virus or adeno-associated virus (AAV) vector.

[0144] In a specific embodiment, an adeno-associated virus (AAV) vector is used.

[0145] In another embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an oligonucleotide sequence encoding a portion or fragment or a variant of FXYD2.

[0146] In another embodiment, the adeno-associated virus (AAV) vector of the present invention comprises any variant of an oligonucleotide sequence encoding a portion or fragment of FXYD2.

[0147] In another embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an antisense sequence encoding a portion or fragment or a variant of FXYD2.

[0148] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an shRNA sequence encoding a portion or fragment or a variant of FXYD2.

[0149] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an miRNA sequence encoding a portion or fragment or a variant of FXYD2.

[0150] In another embodiment, the adeno-associated virus (AAV) according to the present invention, wherein the antisense oligonucleotide targets a region comprising or consisting of the nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0151] In a specific embodiment, the adeno-associated virus (AAV) vector of the present invention comprises a sequence encoding a portion or fragment or variant of FXYD2, which is selected from, but not limited to, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41.

[0152] In another embodiment, the adeno-associated virus (AAV) vector of the present invention comprises any variant of a sequence selected from, but not limited to, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41, which encodes a portion or fragment or variant of FXYD2.

[0153] In a specific embodiment, the adeno-associated virus (AAV) vector of the present invention comprises any variant of a sequence selected from, but not limited to, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26.

[0154] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an oligonucleotide sequence encoding a portion or fragment or a variant of FXYD2.

[0155] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an antisense sequence encoding a portion or fragment or a variant of FXYD2.

[0156] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an miRNA sequence encoding a portion or fragment or a variant of FXYD2.

[0157] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an shRNA sequence encoding a portion or fragment or a variant of FXYD2.

[0158] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an oligonucleotide sequence encoding a portion or fragment or a variant of FXYD2 and a CAG promoter.

[0159] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an antisense sequence encoding a portion or fragment or a variant of FXYD2 and a CAG promoter.

[0160] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an miRNA sequence encoding a portion or fragment or a variant of FXYD2 and a CAG promoter.

[0161] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an shRNA sequence encoding a portion or fragment or a variant of FXYD2 and a CAG promoter.

[0162] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising an antisense oligonucleotide that targets a region comprising or consisting of nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6 and the CAG promoter.

[0163] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising the sequences SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41 and the CAG promoter.

[0164] In a specific embodiment, the present invention relates to an adeno-associated virus (AAV) vector comprising a sequence selected from, but not limited to, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26 and the CAG promoter.

[0165] In one embodiment, the AAV vector is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10 or any other AAV serotype that can infect humans, rodents, monkeys or other species.

[0166] "AAV vector" refers to a vector derived from an adeno-associated virus serotype, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10, etc. The AAV vector can have one or more AAV wild-type genes partially or completely deleted, such as the rep and / or cap genes, but retain the functional flanking ITR sequences. The functional ITR sequences are necessary for the rescue, replication, and packaging of AAV virions. Therefore, the AAV vector is defined in the present invention as at least including those sequences required for replicating and packaging the virus in cis (e.g., functional ITR). The ITR does not need to be a wild-type polynucleotide sequence and can be altered by, for example, insertion, deletion, or substitution of nucleotides, as long as the sequence provides functional rescue, replication, and packaging. Known techniques are used to construct AAV expression vectors to at least provide components operably linked in the transcriptional direction, control elements including a transcription initiation region, a target DNA (i.e., the nucleic acid sequence of the present invention), and a transcription termination region.

[0167] In certain embodiments, the viral vector used in the compositions and methods of the present invention is recombinant adeno-associated virus (rAAV). The rAAV can be any serotype, modification, or derivative known in the art, or any combination thereof known in the art (e.g., a population of rAAV comprising two or more serotypes, e.g., comprising two or more of rAAV2, rAAV8, and rAAV9). In some embodiments, the rAAV is rAAV1, rAAV2, rAAV3, rAAV4, rAAV5, rAAV6, rAAV7, rAAV8, rAAV9, rAAV10, rAAV-11, rAAV-12, rAAV-13, rAAV-14, rAAV-15, rAAV-16, rAAV.rh8, rAAV.rh10, rAAV.rh20, rAAV.rh39, rAAV.Rh74, rAAV.RHM4-1, AAV.hu37, rAAV.Anc80, rAAV.Anc80L65, rAAV.7m8, rAAV.PHP.B, rAAV2.5, rAAV2tYF, rAAV3B, rAAV.LK03, rAAV.HSC1, rAAV.HSC2, rAAV.HSC3, rAAV.HSC4, rAAV.HSC5, rAAV.HSC6, rAAV.HSC7, rAAV.HSC8, rAAV.HSC9, rAAV.HSC10, rAAV.HSC11, rAAV.HSC12, rAAV.HSC13, rAAV.HSC14, rAAV.HSC15, or rAAV.HSC16, or other rAAV, or a combination of two or more thereof.

[0168] In some embodiments, the rAAV for use in the compositions and methods of the present invention comprises a capsid protein from an AAV capsid serotype selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-11, AAV-12, AAV-13, AAV-14, AAV-15, AAV-16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 or AAV.HSC16, or a derivative, modification, or pseudotype thereof. In some embodiments, the rAAV has at least 80% or more identical capsid proteins with the vp1, vp2, and / or vp3 sequences of the AAV capsid serotype, such as 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, up to 100% identity, and the vp1, vp2, and / or vp3 sequences of the AAV capsid serotype are selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-11, AAV-12, AAV-13, AAV-14, AAV-15, AAV-16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 or AAV.HSC16.

[0169] In certain embodiments, the AAV used in the methods of the present invention is Anc80 or Anc80L65, as described in Zinn et al., 2015:1056 - 1068, which is hereby incorporated by reference in its entirety into the present invention. In certain embodiments, the AAV used in the methods of the present invention comprises one of the following amino acid insertions: LGETTRP (SEQ ID NO:14) or LALGETTRP (SEQ ID NO:15), as described in U.S. Pat. Nos. 9,193,956, 9,458,517, and 9,587,282 and U.S. Patent Application Publication No. 2016 / 0376323, each of which is hereby incorporated by reference in its entirety into the present invention. In certain embodiments, the AAV used in the methods of the present invention is AAV.7m8, as described in U.S. Pat. Nos. 9,193,956, 9,458,517, and 9,587,282 and U.S. Patent Application Publication No. 2016 / 0376323, each of which is hereby incorporated by reference in its entirety into the present invention. In certain embodiments, the AAV used in the methods of the present invention is any AAV disclosed in U.S. Pat. No. 9,585,971, such as AAV-PHP.B. In certain embodiments, the AAV used in the methods of the present invention is any AAV disclosed in U.S. Pat. No. 9,840,719 and WO 2015 / 013313, such as AAV.Rh74 RHM4-1, each of which is hereby incorporated by reference in its entirety into the present invention. In certain embodiments, the AAV used in the methods of the present invention is any AAV disclosed in WO 2014 / 172669, such as AAV rh.74, which is hereby incorporated by reference in its entirety into the present invention. In certain embodiments, the AAV2 / 5 used in the methods of the present invention, as described in Georgiadis et al., 2016, Gene Therapy 23:857 - 862 and Georgiadis et al., 2018, Gene Therapy 25:450, each of which is hereby incorporated by reference in its entirety into the present invention. In certain embodiments, the AAV used in the methods of the present invention is any AAV disclosed in WO 2017 / 070491, such as AAV2tYF, which is hereby incorporated by reference in its entirety into the present invention. In certain embodiments, the AAV used in the methods of the present invention is AAVLK03 or AAV3B, as described in Puzzo et al., 2017, Sci. Transl. Med. 29(9):418, which is hereby incorporated by reference in its entirety into the present invention.In certain embodiments, the AAV used in the methods of the present invention is any AAV disclosed in U.S. Patents US8,628,966, US8,927,514, US9,923,120, and WO 2016 / 049230, such as HSC1, HSC2, HSC3, HSC4, HSC5, HSC6, HSC7, HSC8, HSC9, HSC10, HSC11, HSC12, HSC13, HSC14, HSC15, or HSC16, which are hereby incorporated by reference in their entirety into the present invention.

[0170] In certain embodiments, the AAV used in the methods of the present invention is an AAV disclosed in any of the following patents and patent applications, each of which is hereby incorporated by reference in its entirety into the present invention: U.S. Patents US7,282,199, US7,906,111, US8,524,446, US8,999,678, US8,628,966, US8,927,514, US8,734,809, US9,284,357, US9,409,953, US9,169,299, US9,193,956, US9458517, and US9,587,282 and U.S. Publication Nos. 2015 / 0374803, 2015 / 0126588, 2017 / 0067908, 2013 / 0224836, 2016 / 0215024, 2017 / 0051257, and International Patent Application Nos. PCT / US2015 / 034799, PCT / EP2015 / 053335. In some embodiments, the rAAV has a capsid protein that is at least 80% or more identical, e.g., 85%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, i.e., up to 100% identical, to the vp1, vp2, and / or vp3 sequences of the AAV capsids disclosed in any of the following patents and patent applications, each of which is hereby incorporated by reference in its entirety into the present invention: U.S. Patents US7,282,199, US7,906,111, US8,524,446, US8,999,678, US8,628,966, US8,927,514, US8,734,809, US9,284,357, US9,409,953, US9,169,299, US9,193,956, US9458517, and US9,587,282, U.S. Publication Nos. 2015 / 0374803, 2015 / 0126588, 2017 / 0067908, 2013 / 0224836, 2016 / 0215024, 2017 / 0051257, and International Patent Application Nos. PCT / US2015 / 034799, PCT / EP2015 / 053335.

[0171] In some embodiments, the rAAV has a capsid protein disclosed in International Publication Nos. WO 2003 / 052051 (see, e.g., SEQ ID NO:2), WO 2005 / 033321 (see, e.g., SEQ ID NOs: 123 and 88), WO 03 / 042397 (see, e.g., SEQ ID NOs: 2, 81, 85 and 97), WO 2006 / 068888 (see, e.g., SEQ ID NOs: 1 and 3-6), WO 2006 / 110689 (see, e.g., SEQ ID NOs: 5-38), WO 2009 / 104964 (see, e.g., SEQ ID NOs: 1-5, 7, 9, 20, 22, 24 and 31), WO 2010 / 127097 (see, e.g., SEQ ID NOs: 5-38) and WO 2015 / 191508 (see, e.g., SEQ ID NOs: 80-294) and U.S. Publication No. 20150023924 (see, e.g., SEQ ID NOs: 1, 5-10), each of which is incorporated herein by reference in its entirety. In some embodiments, the rAAV has at least 80% or more identical capsid proteins, i.e., for example 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, up to 100% identity, with the vp1, vp2, and / or vp3 sequences of the AAV capsid serotypes disclosed in or International Publication Nos. WO 2003 / 052051 (see, e.g., SEQ ID NO:2), WO 2005 / 033321 (see, e.g., SEQ ID NOs: 123 and 88), WO 03 / 042397 (see, e.g., SEQ ID NOs: 2, 81, 85 and 97), WO 2006 / 068888 (see, e.g., SEQ ID NOs: 1 and 3-6), WO 2006 / 110689 (see, e.g., SEQ ID NOs: 5-38), WO 2009 / 104964 (see, e.g., SEQ ID NOs: 1-5, 7, 9, 20, 22, 24 and 31), WO 2010 / 127097 (see, e.g., SEQ ID NOs: 5-38) and WO 2015 / 191508 (see, e.g., SEQ ID NOs: 80-294) and U.S. Publication No. 20150023924 (see, e.g., SEQ ID NOs: 1, 5-10).

[0172] Nucleic acid sequences of AAV-based viral vectors and methods for preparing recombinant AAV and AAV capsids disclosed in, for example, U.S. Patents US7,282,199, US7,906,111, US8,524,446, US8,999,678, US8,628,966, US8,927,514, US8,734,809, US9,284,357, US9,409,953, US9,169,299, US9,193,956, US9458517, and US9,587,282, U.S. Publication Nos. 2015 / 0374803, 2015 / 0126588, 2017 / 0067908, 2013 / 0224836, 2016 / 0215024, 2017 / 0051257, International Patent Application Nos. PCT / US2015 / 034799, PCT / EP2015 / 053335; WO 2003 / 052051, WO 2005 / 033321, WO 03 / 042397, WO 2006 / 068888, WO 2006 / 110689, WO2009 / 104964, W0 2010 / 127097, and WO 2015 / 191508, and U.S. Publication No. 20150023924.

[0173] In additional embodiments, the rAAV comprises pseudotyped rAAV. In some embodiments, the pseudotyped rAAV is rAAV2 / 8 or rAAV2 / 9 pseudotyped rAAV. Methods for producing and using pseudotyped rAAV are well known in the art (see, for example: Duan et al., J. Virol., 75:7662-7671 (2001); Halbert et al., J. Virol., 74:1524-1532 (2000); Zolotukhin et al., Methods 28:158-167 (2002); and Auricchio et al., Hum. Molec. Genet. 10:3075-3081, (2001)).

[0174] In additional embodiments, the rAAV comprises a capsid comprising a capsid protein that is chimeric for two or more AAV capsid serotypes. In some embodiments, the capsid protein is a chimera of two or more AAV capsid proteins of AAV serotypes selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV-11, AAV-12, AAV-13, AAV-14, AAV-15, AAV-16, AAV.rh8, AAV.rh10, AAV.rh20, AAV.rh39, AAV.Rh74, AAV.RHM4-1, AAV.hu37, AAV.Anc80, AAV.Anc80L65, AAV.7m8, AAV.PHP.B, AAV2.5, AAV2tYF, AAV3B, AAV.LK03, AAV.HSC1, AAV.HSC2, AAV.HSC3, AAV.HSC4, AAV.HSC5, AAV.HSC6, AAV.HSC7, AAV.HSC8, AAV.HSC9, AAV.HSC10, AAV.HSC11, AAV.HSC12, AAV.HSC13, AAV.HSC14, AAV.HSC15 or AAV.HSC16.

[0175] In certain embodiments, single-stranded AAV (ssAAV) can be used. In certain embodiments, self-complementary vectors such as scAAV can be used (see, e.g., Wu, 2007, Human Gene Therapy, 18(2):171-82, McCarty et al, 2001, Gene Therapy, Vol. 8, Number 16, Pages 1248-1254, and U.S. Patents US6,596,535, US7,125,717, and US7,456,683, each of which is incorporated herein by reference in its entirety).

[0176] In certain embodiments, recombinant AAV vectors for delivering transgenes are tropic for cells in the DRG. Such vectors can include non-replicating "rAAV", preferably those with AAV8 or AAVrh10 capsids. In certain embodiments, the viral vectors provided by the present invention are AAV9- or AAVrh10-based viral vectors. In certain embodiments, the AAV8- or AAVrh10-based viral vectors provided herein retain tropism for the DRG. AAV variant capsids can be used, including but not limited to the AAV variant capsids described by Wilson in U.S. Patent No. 7,906,111, particularly preferably AAV / hu.31 and AAV / hu.32, which are incorporated herein by reference in their entirety; and the AAV variant capsids described by Chatterjee in U.S. Patent Nos. 8,628,966, 8,927,514 and Smith et al., 2014, Mol Ther 22:1625-1634, each of which is incorporated herein by reference in its entirety.

[0177] In certain embodiments, the present invention relates to a recombinant adeno-associated virus (rAAV) comprising (i) an expression cassette comprising a transgene under the control of regulatory elements and flanked by ITRs, and (ii) an AAV capsid, wherein the transgene encodes an inhibitory RNA that specifically binds to FXYD2 mRNA and inhibits the expression of FXYD2 in cells.

[0178] In certain embodiments, AAV vectors comprising an artificial genome are provided, the artificial genome comprising (i) an expression cassette comprising a transgene under the control of regulatory elements and flanked by ITRs; and (ii) a viral capsid having the amino acid sequence of an AAV capsid protein or having at least 95%, 96%, 97%, 98%, 99% or 99.9% identity to the amino acid sequence of an AAV capsid protein while retaining the biological function of the AAV capsid.

[0179] In certain embodiments, provided is an AAVrh10 vector comprising an artificial genome, the artificial genome comprising (i) an expression cassette comprising a transgene under the control of regulatory elements and flanked by ITRs (i) a viral capsid having the amino acid sequence of an AAVrh10 capsid protein or having at least 95%, 96%, 97%, 98%, 99% or 99.9% identity to the amino acid sequence of an AAVrh10 capsid protein while retaining the biological function of the AAVrh10 capsid. In certain embodiments, the encoded AAVrh10 capsid has the sequence of SEQ ID NO:81 listed in U.S. Patent No. US9,790,427, which is incorporated herein by reference in its entirety, and which has 1, 2, 3, 4, 5, 6, 7, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 amino acid substitutions and retains the biological function of the AAVrh10 capsid.

[0180] The selected control element has an effect in mammalian cells. The resulting construct comprises operatively linked components flanked by (5' and 3') functional AAV ITR sequences. "Adeno-associated virus inverted terminal repeats" or "AAV ITRs" refers to the well-recognized regions found at each end of the AAV genome, which together function in cis as an origin of DNA replication and as a packaging signal for the virus. The AAV ITRs together with the AAV rep coding region provide for efficient excision and rescue, as well as integration of a polynucleotide sequence inserted between two flanking ITRs into the mammalian cell genome. The polynucleotide sequences of the AAV ITR region are known. As used herein, an "AAV ITR" need not contain the wild-type polynucleotide sequence, but may be altered, for example, by nucleotide insertion, deletion, or substitution. In addition, the AAV ITR can be from any of a variety of AAV serotypes, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10, etc. In addition, the 5' and 3' ITRs flanking the selected polynucleotide sequence in the AAV vector need not be the same or derived from the same AAV serotype or isolate, so long as they function as intended, i.e., allow excision and rescue of the target sequence from the host cell genome or vector and allow integration of a heterologous sequence into the recipient cell genome when the AAV Rep gene product is present in the cell. In addition, the AAV ITRs can be from any of a variety of AAV serotypes, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV 5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVrh.10. In addition, the 5' and 3' ITRs flanking the selected polynucleotide sequence in the AAV expression vector need not be the same or derived from the same AAV serotype or isolate, so long as they function as intended, i.e., allow excision and rescue of the target sequence from the host cell genome or vector and allow integration of a DNA molecule into the recipient cell genome when the AAV Rep gene product is present in the cell.

[0181] Specific embodiments are vectors derived from AAV serotypes that have tropism and high transduction efficiency in mammalian DRG cells. The transduction efficiencies of different serotypes were reviewed and analyzed in this patent application. In certain embodiments, vectors based on AAV2, AAV5, AAV8, AAV9, and rh.10 direct long-term expression of transgenes in DRG.

[0182] The selected polynucleotide sequence is operably linked to a control element that directs its transcription or expression in a subject. Such control elements can comprise control sequences normally associated with the selected gene.

[0183] Generally, the vector of the present invention contains an expression cassette. The term "expression cassette" refers to a nucleic acid construct containing nucleic acid elements sufficient to express the nucleic acid molecule of the present invention. Generally, the nucleic acid molecule encodes a heterologous gene and may also include appropriate regulatory elements. A heterologous gene refers to a transgene encoding a target RNA.

[0184] One or more expression cassettes can be used. Each expression cassette can contain at least one promoter sequence operably linked to a sequence encoding a target RNA. Each expression cassette can consist of additional regulatory elements, spacers, introns, UTRs, polyadenylation sites, etc. In certain embodiments, the expression cassette is polycistronic with respect to the transgene encoding, for example, two or more miRNAs. In other embodiments, the expression cassette contains a promoter, a nucleic acid encoding one or more target RNA molecules, and poly(A). In a further embodiment, the expression cassette contains a 5'-promoter sequence, a sequence encoding a first target RNA, a sequence encoding a second target RNA, and a polyadenylation sequence -3'.

[0185] In certain embodiments, the expression cassette can contain additional elements, such as, introns, enhancers, polyadenylation sites, a woodchuck posttranscriptional response element (WPRE), and / or other elements known to affect the expression level of the coding sequence. Generally, the expression cassette contains the nucleic acid molecule of the present invention operably linked to the promoter sequence.

[0186] The term "operably linked" refers to the joining of two or more nucleic acid fragments on a single nucleic acid fragment such that the function of one nucleic acid fragment is affected by the other nucleic acid fragment.

[0187] For example, a promoter is operably linked to a coding sequence when the promoter is capable of affecting the expression of the coding sequence (e.g., the coding sequence is under the transcriptional control of the promoter). The coding sequence can be operably linked to the regulatory sequence in the sense or antisense orientation.

[0188] As used herein, the term "promoter" sequence refers to a polynucleotide region containing a DNA regulatory sequence, wherein the regulatory sequence is derived from a gene capable of binding RNA polymerase and initiating transcription of a downstream (3'-direction) coding sequence. Transcriptional promoters can include "inducible promoters" (wherein the expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), "repressible promoters" (wherein the expression of a polynucleotide sequence operably linked to the promoter is induced by an analyte, cofactor, regulatory protein, etc.), and "constitutive promoters".

[0189] In some embodiments, the promoter is a heterologous promoter. As used herein, the term "heterologous promoter" refers to a promoter that is not found in nature operably linked to a given coding sequence.

[0190] Useful heterologous control sequences typically include those encoding mammalian or viral genes. Examples include but are not limited to the phophoglycerate kinase (PKG) promoter, CAG (a complex of (CMV) cytomegalovirus enhancer, chicken β-actin promoter (CBA), and rabbit β-globin intron), U6 promoter, neuronal promoters (human synapsin 1 (hSyn) promoter, NeuN promoter, CamKII promoter, promoters of dopamine-1 receptor and dopamine-2 receptor), SV40 early promoter, mouse mammary tumor virus LTR promoter; adenovirus major late promoter (Ad MLP); herpes simplex virus (HSV) promoter, CMV promoter such as CMV immediate early promoter region (CMV-IE), rous sarcoma virus (RSV) promoter, synthetic promoter, hybrid promoter, etc. In addition, sequences derived from non-viral genes, such as the murine metallothionein gene, will also find application in the present invention. Such promoter sequences are commercially available from, for example, Stratagene (San Diego, CA).

[0191] For the purposes of the present invention, heterologous promoters and other control elements, such as DRG-specific and inducible promoters, enhancers, etc., will have particular utility.

[0192] An "enhancer" is a polynucleotide sequence that can stimulate promoter activity and can be an inherent element of the promoter or an inserted heterologous element to enhance the level or tissue specificity of the promoter. In some embodiments, the promoter is wholly derived from a natural gene. In some embodiments, the promoter consists of different elements derived from different naturally occurring promoters. In some embodiments, the promoter contains a synthetic polynucleotide sequence. Those skilled in the art will understand that different promoters will direct the expression of genes in different tissues or cell types, or at different developmental stages, or in response to different environmental conditions or the presence or absence of drugs or transcriptional cofactors. Ubiquitous, cell type-specific, tissue-specific, development stage-specific, and conditional promoters, such as drug-responsive promoters (e.g., tetracycline-responsive promoters) well known to those skilled in the art.

[0193] In mammalian systems, there are three promoters that are candidates for constructing expression vectors: Pol I promoters control the transcription of large ribosomal RNAs; Pol II promoters control the transcription of mRNAs (which are translated into proteins) and small nuclear RNAs (snRNAs); and Pol III promoters uniquely transcribe small non-coding RNAs. When designing constructs for in vivo expression of RNA, each approach has its advantages and constraints to consider. For example, Pol III promoters are useful for synthesizing small interfering RNAs (shRNAs) from DNA templates in vivo. For better control of tissue-specific expression, Pol II promoters are preferred, but can only be used for the transcription of miRNAs. However, when using Pol II promoters, it may be preferable to omit the translation initiation signal so that the RNA functions as antisense, siRNA, shRNA, or miRNA and is not translated into polypeptides in vivo.

[0194] The target DNA molecule flanked by AAV ITRs can be directly inserted into the AAV genome from which the major AAV open reading frame ("ORF") has been excised to construct an AAV expression vector. Other portions of the AAV genome can also be deleted, as long as sufficient ITRs are retained to allow replication and packaging functions. The constructs can be designed using techniques known in the art. See, for example, U.S. Patent Nos. US5,173,414 and US5,139,941; International Publication Nos. WO92 / 01070 (published January 23, 1992) and WO 93 / 03769 (published March 4, 1993). Additionally, the AAV ITRs can be excised from the viral genome or from an AAV vector containing the same and fused 5' and 3' selected nucleic acid constructs using standard ligation techniques, and the nucleic acid constructs are present in another vector. AAV vectors containing ITRs are described, for example, in U.S. Patent No. 5,139,941. In particular, several AAV vectors are described therein, which are available from the American Type Culture Collection ("ATCC") under accession numbers 53222, 53223, 53224, 53225, and 53226. Additionally, chimeric genes can be generated by synthetic methods to include one or more selected nucleic acid sequences flanked 5' and 3' by AAV ITR sequences. Preferred codons for expressing chimeric gene sequences in mammalian DRG cells can be used, and in certain embodiments, codon optimization of the transgene is carried out by methods well known in the art. The complete chimeric sequence is assembled from overlapping oligonucleotides prepared by standard methods. To produce AAV virions, the AAV expression vector is introduced into a suitable host cell using known techniques, such as by transfection. Many transfection techniques are generally known in the art. Particularly suitable transfection methods include calcium phosphate co-precipitation, direct microinjection into cultured cells, electroporation, liposome-mediated gene transfer, lipid-mediated transduction, and nucleic acid delivery by high-velocity microprojectiles.

[0195] For example, in addition to the nucleic acid sequences of the present invention, a specific viral vector further comprises a backbone of an AAV vector plasmid having ITRs derived from AAV-2, a promoter, such as the murine PGK (phosphoglycerate kinase) gene or the cytomegalovirus / β-actin hybrid promoter (CAG) consisting of an enhancer from the CMV immediate-early gene, a promoter, a splice donor and intron from the chicken β-actin gene, a splice acceptor from the rabbit β-globin, or any neuronal promoter such as the promoter of dopamine-1 receptor or dopamine-2 receptor, or the synapsin promoter, with or without the post-transcriptional regulatory element (WPRE) of wild-type or mutant woodchuck hepatitis virus, and a rabbit β-globin polyA sequence. The viral vector may additionally comprise a nucleic acid sequence encoding an antibiotic resistance gene, such as the ampicillin resistance gene (AmpR), kanamycin, hygromycin B, geneticin, blasticidin S, or puromycin gene.

[0196] In one embodiment, a retroviral vector is used.

[0197] Retroviruses can be selected as gene delivery vectors because they are capable of integrating their genes into the host genome, transferring large amounts of foreign genetic material, infecting a wide range of species and cell types, and can be packaged in special cell lines. To construct a retroviral vector, a nucleic acid encoding a target gene is inserted into the viral genome in place of certain viral sequences to produce a replication-defective virus. To produce virions, a packaging cell line containing the gag, pol, and / or env genes but not containing the LTR and / or packaging components is constructed. When a recombinant plasmid containing cDNA together with the retroviral LTR and packaging sequences is introduced into this cell line (e.g., by calcium phosphate precipitation), the packaging sequences allow the RNA transcripts of the recombinant plasmid to be packaged into viral particles and then secreted into the culture medium. Then the culture medium containing the recombinant retrovirus is collected, selectively concentrated, and used for gene transfer. Retroviral vectors are capable of infecting a variety of cell types.

[0198] In another embodiment, a lentiviral vector is used.

[0199] In a specific embodiment, the present invention relates to a lentiviral vector comprising an oligonucleotide sequence encoding a portion or fragment or a variant of FXYD2.

[0200] In another embodiment, the lentiviral vector of the present invention comprises any variant of an oligonucleotide sequence encoding a portion or fragment of FXYD2.

[0201] In another embodiment, the lentiviral vector of the present invention comprises any variant of an oligonucleotide sequence encoding any variant of FXY2D.

[0202] In another embodiment, the present invention relates to a lentiviral vector comprising an antisense sequence encoding a portion or fragment or a variant of FXYD2.

[0203] In another embodiment, the present invention relates to a lentiviral vector comprising an shRNA sequence encoding a portion or fragment or a variant of FXYD2.

[0204] In another embodiment, the present invention relates to a lentiviral vector comprising an miRNA sequence encoding a portion or fragment or a variant of FXYD2.

[0205] In another embodiment, the present invention relates to a lentiviral vector comprising an antisense oligonucleotide that targets a region comprising or consisting of nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO: or a variant thereof.

[0206] In another embodiment, the present invention relates to a lentiviral vector comprising a sequence encoding a portion or fragment or a variant of FXYD2, which is selected from, but not limited to, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41.

[0207] In another embodiment, the present invention relates to a lentiviral vector comprising any variant of a sequence encoding a portion or fragment of FXYD2, the sequence selected from, but not limited to, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41.

[0208] In another embodiment, the lentiviral vector of the present invention comprises any variant of a sequence selected from, but not limited to, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26.

[0209] In another embodiment, the present invention relates to a lentiviral vector comprising an oligonucleotide sequence encoding a portion or fragment of FXYD2 or a variant thereof.

[0210] In another embodiment, the present invention relates to a lentiviral vector comprising an shRNA sequence encoding a portion or fragment of FXYD2 or a variant thereof and a U6 promoter.

[0211] In another embodiment, the present invention relates to a lentiviral vector comprising an antisense oligonucleotide targeting a region comprising or consisting of the nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6 and a U6 promoter.

[0212] In another embodiment, the present invention relates to a lentiviral vector comprising a sequence selected from, but not limited to, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41 and the U6 promoter.

[0213] In another embodiment, the lentiviral vector of the present invention comprises any variant of a sequence selected from, but not limited to, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26 and the U6 promoter.

[0214] In another embodiment, the present invention relates to a lentiviral vector comprising an oligonucleotide sequence encoding a portion or fragment or a variant of FXYD2 and the CAG promoter.

[0215] In another embodiment, the present invention relates to a lentiviral vector comprising an antisense sequence encoding a portion or fragment or a variant of FXYD2 and the CAG promoter.

[0216] In another embodiment, the present invention relates to a lentiviral vector comprising an miRNA sequence encoding a portion or fragment or a variant of FXYD2 and the CAG promoter.

[0217] In another embodiment, the present invention relates to a lentiviral vector comprising an shRNA sequence encoding a portion or fragment or variant of FXYD2 and a CAG promoter.

[0218] In a specific embodiment, the present invention relates to a lentiviral vector comprising an antisense oligonucleotide that targets a region comprising or consisting of the nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6 and a CAG promoter.

[0219] In a specific embodiment, the present invention relates to a lentiviral vector comprising the sequences SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41 and a CAG promoter.

[0220] Lentiviruses are complex retroviruses that, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural functions. The higher complexity enables the virus to regulate its life cycle, such as during latent infection. Some examples of lentiviruses include human immunodeficiency virus (HIV 1, HIV 2) and simian immunodeficiency virus (SIV). Lentiviral vectors are generated by multiple attenuation of HIV virulence genes, such as deletion of the genes env, vif, vpr, vpu, and nef, rendering the vectors biologically safe. Lentiviral vectors are known in the art; see, for example, U.S. Patent Nos. US6,013,516 and US5,994,136, both of which are incorporated herein by reference. Generally, vectors are plasmid-based or virus-based and are configured to carry key sequences for incorporation of foreign nucleic acids, for selection, and for transfer of nucleic acids into host cells. The gag gene, pol gene, and env gene of the target vector are known in the art. Accordingly, the relevant genes are cloned into a selected vector and then used to transform target cells of interest. Recombinant lentiviruses capable of infecting non-dividing cells, where suitable host cells are transfected with two or more vectors carrying packaging functions, namely gag, pol, and env, as well as rev and tat, are described in U.S. Patent No. US5,994,136, which is incorporated herein by reference. The present invention describes a first vector that can provide nucleic acids encoding viral gag and pol genes and another vector that can provide nucleic acids encoding viral env to generate packaging cells. Introduction of the vector providing the heterologous gene into the packaging cells results in production cells that release infectious viral particles carrying the target foreign gene. The env is preferably an amphotropic envelope protein that permits transduction of cells of humans and other species. Generally, the nucleic acid molecules or vectors of the present invention include "control sequences" that collectively refer to promoter sequences, polyadenylation signals, transcription termination sequences, upstream regulatory domains, origins of replication, internal ribosome entry sites ("IRES"), enhancers, etc., which together provide the conditions for replication, transcription, and translation of the coding sequences in recipient cells. It is not necessary for all of these regulatory sequences to always be present, as long as the selected coding sequences can be replicated, transcribed, and translated in a suitable host cell.

[0221] Methods for treating pain

[0222] In a third aspect, the present invention relates to the use of the above-mentioned inhibitors and / or antisense oligonucleotides in the treatment of pain in a subject in need thereof.

[0223] In a specific embodiment, the present invention relates to a method for treating pain in a subject in need thereof, the method comprising the step of administering to the subject a therapeutically effective amount of the above-mentioned inhibitors and / or antisense oligonucleotides.

[0224] In a specific embodiment, according to the method of the present invention, the antisense oligonucleotide targets at least a region comprising or consisting of the nucleotides of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5 or SEQ ID NO:6.

[0225] In a specific embodiment, according to the method of the present invention, the inhibitor targets a region comprising or consisting of the nucleotides of SEQ ID NO:3.

[0226] In a specific embodiment, according to the method of the present invention, wherein the antisense oligonucleotide comprises or consists of the sequences SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41.

[0227] In a specific embodiment, according to the method of the present invention, the antisense oligonucleotide comprises or consists of the sequences SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26.

[0228] In a specific embodiment, according to the method of the present invention, the antisense oligonucleotide is administered alone (naked) or in the above-mentioned vector.

[0229] As used herein, the terms "treat" or "administer treatment" refer to prophylactic or preventive treatment, as well as curative or disease-modifying treatment, including treating patients at risk of or suspected of having an infectious disease, as well as treating patients suffering from or diagnosed with a disease or having a problem with a bodily condition, and including preventing clinical recurrence. A subject having a disease or ultimately likely to have a disease can be treated to prevent, cure, delay the onset of the disease, reduce the severity of the disease, or improve one or more symptoms of the disease or a recurrent disease, or to extend the survival of the subject beyond what would be expected without such treatment. The term "treatment regimen" refers to the treatment of a disease, such as the dosing pattern used during treatment. A treatment regimen can include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to the treatment regimen (or part of the treatment regimen) for the initial treatment of a disease. The overall goal of an induction regimen is to provide a high level of drug to the patient at the beginning of the treatment regimen. An induction regimen can (partially or fully) employ "loading treatment", which can include a greater drug dose than that used by the doctor during the maintenance regimen, more frequent drug administration than that used by the doctor in the maintenance treatment regimen, or both. The phrase "maintenance therapy" or "maintenance period" refers to the treatment regimen (or part of the treatment regimen) for maintaining the efficacy of the patient during the treatment of a disease, e.g., keeping the patient in a stage of long-term remission (for months or years). A maintenance regimen can employ continuous treatment (e.g., regularly taking a drug, such as weekly, monthly, annually, etc.) or intermittent treatment (e.g., interrupted treatment, intermittent treatment, treatment at recurrence, or treatment when specific predetermined criteria [such as: disease symptoms, etc.] are met).

[0230] As used herein, the term "pain" refers to an unpleasant sensation, usually caused by intense or damaging stimuli. The widely used definition of "pain" by the International Association for the Study of Pain is: "Pain is an unpleasant sensory and emotional experience associated with actual or potential tissue damage, or described in terms of such damage". There are different types of pain: acute pain, chronic pain, somatic pain, nociceptive pain, visceral pain, or peripheral pain. In the context of the present invention, the pain is peripheral pain. More specifically, the peripheral pain is neuropathic pain, diabetic pain, chemotherapy pain, inflammatory pain, postoperative pain, and / or chronic postoperative pain.

[0231] As used herein, the term "subject" denotes a mammal, such as a rodent, feline, canine, and primate. In particular, the subjects of the present invention are humans, mice, or rats. As used herein, the term "subject" includes "patient".

[0232] In a specific embodiment, the subject experiences or is susceptible to pain.

[0233] In a specific embodiment, the subject has or is susceptible to peripheral pain.

[0234] In a specific embodiment, the subject has or is susceptible to neuropathic pain.

[0235] In a specific embodiment, the subject has or is susceptible to inflammatory pain.

[0236] In a specific embodiment, the subject has or is susceptible to diabetic pain.

[0237] In a specific embodiment, the subject has or is susceptible to chemotherapy pain.

[0238] In a specific embodiment, the subject has or is susceptible to postoperative pain.

[0239] In a specific embodiment, the subject has or is susceptible to chronic postoperative pain.

[0240] As used herein, the terms "administering" or "administration" refer to the act of injecting or otherwise physically delivering a substance that exists in vitro (e.g., an inhibitor of FXYD2, such as an ASO of the present invention) into a subject, e.g., by intravenous, intramuscular, enteral, subcutaneous, parenteral, systemic, topical, spinal, nasal, local, or epidermal administration (e.g., by injection or infusion). When treating a disease or its condition, the administration of the substance typically occurs after the onset of the disease or its symptoms. When the disease or its condition is being prevented, the administration of the substance typically occurs before the onset of the disease or its condition. In a specific embodiment, administration is by patch, paste, ointment, suspension, solution, or cream, gel, or spray. In a specific embodiment, administration is by cream.

[0241] In a specific embodiment, the administration of the inhibitor and / or antisense oligonucleotide is by intrathecal, subcutaneous, topical, or intravenous administration.

[0242] In a further embodiment, i) an antisense oligonucleotide according to the present invention and ii) a conventional treatment that is used simultaneously, separately, or sequentially as a combination preparation in the treatment of pain.

[0243] As used herein, the term "conventional treatment" refers to any compound, natural or synthetic. In a specific embodiment, conventional treatments are selected from, but not limited to: aspirin, paracetamol, non-steroidal anti-inflammatory drugs (NSAIDs); codeine, cryotherapy, virtual therapy, cannabis, morphine and its derivatives, opium and its derivatives.

[0244] "Effective therapeutic amount" refers to the minimum dose of an active agent (e.g., ASO in the present invention) required to provide effective treatment to a subject. For example, providing a subject with an "effective therapeutic amount" is an amount that can induce, ameliorate, or otherwise alleviate a pathological symptom, disease progression, or physiological state associated with a disease, or resistance to a disease to which a subject is susceptible. It should be understood that the total daily dose of the compounds of the present invention is determined by the attending physician within the scope of reasonable medical judgment. The specific effective therapeutic amount for a particular subject depends on a variety of factors, including the disease being treated and the severity of the disease, the activity of the particular compound used, the specific formulation of the drug used, the age, weight, general health, gender, and eating habits of the subject, the time of administration, the route of administration, and the excretion rate of the particular compound used, the duration of the treatment, drugs taken in combination with or concurrently with the particular compound used, and other factors well known in the medical art. For example, it is entirely within the skill of the art to start with a dose of the compound that is usually lower than the dose required to achieve the desired therapeutic effect and then gradually increase the dose until the desired effect is achieved. However, the daily dose for an adult taking the product varies within a broad range of from 0.01 mg to 1,000 mg. Generally, the active ingredient may be present in amounts of 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250, and 500 mg, and the dose can be adjusted according to the symptoms of the subject being treated. The drug generally contains from about 0.01 mg to 500 mg of the active ingredient, and preferably a drug containing from 1 mg to 100 mg of the active ingredient. The effective amount of the drug is usually supplied at a dose of from 0.0002 mg / kg to about 20 mg / kg of body weight per day, particularly at a dose of from about 0.001 mg / kg to 7 mg / kg of body weight per day.

[0245] Pharmaceutical compositions

[0246] In a fourth aspect, the present invention relates to a pharmaceutical composition comprising an inhibitor and / or an antisense oligonucleotide of the present invention.

[0247] In a specific embodiment, the pharmaceutical composition according to the present invention, wherein the antisense oligonucleotide targets at least a region comprising or consisting of nucleotides of SEQ ID NO:1, SEQ ID NO:2, or SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6.

[0248] In a specific embodiment, the pharmaceutical composition according to the present invention, wherein the inhibitor targets a region comprising or consisting of nucleotides of SEQ ID NO:3.

[0249] In a specific embodiment, the present invention relates to a pharmaceutical composition according to the present invention, comprising at least one antisense oligonucleotide, the antisense oligonucleotide comprising and / or consisting of a sequence selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40 or SEQ ID NO:41.

[0250] In a specific embodiment, the pharmaceutical composition according to the present invention, wherein the antisense oligonucleotide comprises or consists of a sequence selected from the group consisting of SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26.

[0251] In a specific embodiment, the present invention relates to the use of a pharmaceutical composition according to the present invention for the treatment of pain.

[0252] In a specific embodiment, the present invention relates to the use of a pharmaceutical composition, wherein the pain is peripheral pain.

[0253] In a specific embodiment, the present invention relates to the use of a pharmaceutical composition according to the present invention, wherein the pain is neuropathic pain, diabetic pain, chemotherapy pain, inflammatory pain, postoperative pain and / or chronic postoperative pain.

[0254] The inhibitor and / or antisense oligonucleotide as described above may be combined with a pharmaceutically acceptable excipient, and optionally a sustained release matrix, such as a biodegradable polymer, to form a pharmaceutical composition. "Pharmaceutically" or "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic, or other untoward reactions when administered to a mammal, particularly a human, under appropriate circumstances. A pharmaceutically acceptable carrier or excipient refers to any type of non-toxic solid, semi-solid, or liquid filler, diluent, encapsulating material, or formulation aid. The pharmaceutical compositions of the present invention, as mixtures supported by traditional pharmaceuticals, are administered to subjects such as animals and humans by oral, sublingual, subcutaneous, intramuscular, intravenous, transdermal, topical, or rectal routes, and the active ingredient, alone or in combination with another active ingredient, may be administered in unit dosage forms. Suitable unit dosage forms include forms for oral routes, such as tablets, gel capsules, powders, granules, and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subcutaneous, transdermal, intrathecal, and intranasal administration forms, and rectal administration forms.

[0255] In a specific embodiment, the pharmaceutical composition according to the present invention is administered by intrathecal, subcutaneous, topical, or intravenous injection.

[0256] Generally, a pharmaceutical composition contains a pharmaceutically acceptable carrier that can be used for injectable preparations. These carriers can be specific isotonic, sterile physiological saline (such as monosodium phosphate or disodium phosphate, sodium chloride, potassium chloride, calcium chloride or magnesium chloride, etc., or a mixture of these salts), or may be dry, especially lyophilized components. Depending on the specific situation, when these components are added to sterile water or physiological saline, an injectable solution is formulated. Pharmaceutical forms suitable for injection include sterile aqueous solutions or dispersions, including preparations in sesame oil, peanut oil or aqueous propylene glycol solutions, and sterile powders for the temporary preparation of sterile injectable solutions or dispersions. Regardless of the form, the preparation must be sterile and must be fluid to an extent that allows for easy injection. It must remain stable under the manufacturing and storage conditions and must be protected against the contaminating effects of microorganisms, such as bacteria and fungi. A solution containing a free radical or a pharmaceutically acceptable salt of the compound of the present invention can be prepared in water and mixed with a suitable amount of a surfactant, such as hydroxypropyl cellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycol and their mixtures and oils. Under normal storage and use conditions, these preparations contain preservatives to prevent microbial growth. The polypeptide (or its nucleic acid encoding) can be formulated into a composition in neutral or salt form. Pharmaceutically acceptable salts include acid addition salts (formed by combining with the free amino groups of the protein), for example, combined with inorganic acids such as hydrochloric acid or phosphoric acid, or with organic acids such as acetic acid, oxalic acid, tartaric acid, mandelic acid, etc. Salts formed with free carboxyl groups can also be derived from inorganic bases, such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide or ferric hydroxide, and may also be derived from organic bases, such as isopropylamine, trimethylamine, histidine, procaine. The carrier can be a solvent or a dispersion medium containing, for example, water, ethanol, polyols (such as glycerol, propylene glycol and liquid polyethylene glycol, etc.), their suitable mixtures and vegetable oils. Appropriate fluidity can be maintained, for example, by using coatings such as lecithin, and in the case of dispersion, by maintaining the required particle size and using surfactants. The prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, thimerosal, etc. In many cases, it is also preferable to use isotonic agents, such as sugars or sodium chloride. The absorption of injectable compositions is prolonged by using agents that delay absorption, such as aluminum monostearate and gelatin, in the composition. The method for preparing a sterile injectable solution is to add the required amount of the active polypeptide to a suitable solvent and, if necessary, add several of the other ingredients listed above, and then filter and sterilize. Generally, the method for preparing a dispersion is to add various sterilized active ingredients to a sterile carrier that contains a basic dispersion medium and the other required ingredients listed above. For the sterile powder required for preparing a sterile injectable solution, the preferred preparation methods include vacuum drying and freeze-drying methods, and this technique obtains a powder containing the active ingredient and other required ingredients from a previously sterile-filtered solution.After formulation, the solution will be administered in a manner that meets the dosage formulation requirements and enables efficacy. The preparation can be easily administered in various forms, such as the injection solution type mentioned above, but drug sustained-release capsules etc. can also be used. For example, for parenteral administration in an aqueous solution, if necessary, the solution should be appropriately buffered and diluted with sufficient saline or glucose to make the liquid diluent isotonic. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous, and intraperitoneal administration. In this regard, those skilled in the art will understand the sterile aqueous media that can be used according to the present invention. For example, one dose can be dissolved in 1 mL of isotonic NaCl solution and then added to 1000 mL of subcutaneous injection solution, or injected at the recommended injection site. Depending on the specific condition of the subject being treated, the dose will necessarily vary to some extent. In any case, the person responsible for administration will determine the dose suitable for the specific subject.

[0257] In a specific embodiment, the present invention provides a topical preparation comprising an antisense oligonucleotide. For example, by way of illustration only and not limitation, the present invention provides a topical preparation comprising an antisense oligonucleotide. Dosage forms for topical or transdermal administration of the inhibitor of the present invention include but are not limited to powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches, and inhalants. In certain non-limiting embodiments, the topical preparation comprises an antisense oligonucleotide composed of micelles, liposomes, or non-lipid-based microspheres. In certain non-limiting embodiments, such topical preparations may comprise penetration enhancers such as but not limited to dimethyl sulfoxide, hydrocarbons (such as alkanes and alkenes), alcohols (such as ethylene glycol and glycerol), acids (such as fatty acids), amines, amides, esters (such as isopropyl myristate), surfactants (such as anionic, cationic, or non-ionic surfactants), terpenes, and lipids (such as phospholipids).

[0258] In a specific embodiment, the preparation is a patch, paste, ointment, suspension, solution, cream, gel, or spray. In a specific embodiment, the preparation is a cream.

[0259] The present invention will be further illustrated by the following drawings and examples. However, these examples and drawings should not be construed in any way as limiting the scope of the present invention. Description of the Drawings

[0260] Figure 1: Identification of antisense oligonucleotides against human FXYD2 mRNA. Protein extracts from HEK293 cells transfected with a series of antisense oligonucleotides against human FXYD2 mRNA (A) and ASO75 and ASO82, 15, 17, and 20 nucleotides in length, respectively (B) were used to quantify FXYD2 protein levels by Western blot. FXYD2 protein levels were normalized to actin. Data are represented as mean ± s.e.m. * = p < 0.05; ** = p < 0.01; *** = p < 0.001 and **** = p < 0.0001, (n = 3 parallel determinations).

[0261] Figure 2 . Inhibition of Fxyd2 expression in rat DRG neurons in vivo by intrathecal injection of lipid-modified Fxyd2 antisense oligonucleotide Fxyd2-LASO. Increasing doses of Fxyd2-LASO were intrathecally injected daily for 14 days (n = 3), lumbar DRG (L4-L6) tissues were dissected and Fxyd2 protein levels were quantified. Fxyd2 protein levels were normalized to actin. Data are represented as mean ± s.e.m. * = p < 0.05; ns, not significant.

[0262] Figure 3. Daily intrathecal injection of lipid-modified Fxyd2 antisense oligonucleotide is at least as effective as intrathecal injection of ω-conotoxin peptide MVIIA in reducing pain sensitivity in the SNL neuropathic pain model. A group of rats underwent SNL surgery and were tested for responses to mechanical stimuli (A: von Frey test; B: Randall-Selitto paw pressure test). Daily intrathecal injection of 2 μg Fxyd2-LASO (n = 9), no injection of control-LASO (n = 9), led to a gradual and complete remission of mechanical hypersensitivity in both tests, but was reversed after interruption of treatment. Restoration of Fxyd2-LASO treatment restored the analgesic effect. Single intrathecal injection of ω-conotoxin peptide MVIIA (Conotoxin MVIIA) (n = 9) in a group of rats showing neuropathic pain symptoms reduced mechanical hypersensitivity for 1-2 h. Data are represented as mean ± s.e.m. * = p < 0.05; *** = p < 0.001 and **** = p < 0.0001.

[0263] Figure 4. Fxyd2-LASO treatment alleviates mechanical hypersensitivity in the inflammatory pain model. Mechanical hypersensitivity was induced by intraplantar injection of CFA (complete Freund's adjuvant). Daily injection of Fxyd2-LASO (n = 6), without injection of control-LASO (n = 6), alleviated the pain symptoms (A: von Frey test; B: Randall-Selitto paw pressure test). The analgesic effect of Fxyd2-LASO was dependent on continuous treatment, and interruption of the injection restored pain hypersensitivity. Data are presented as mean ± s.e.m. * = p < 0.05; ** = p < 0.01 and **** = p < 0.0001.

[0264] Figure 5. Lipid modification of Fxyd2-LASO is crucial for its analgesic effect in the neuropathic pain SNL model. After mechanical hypersensitivity was induced by SNL, rats were injected intrathecally with Fxyd2-LASO (n = 6) or Fxyd2-ASO (non-lipid modified form) (n = 6) daily. Fxyd2-LASO, but not Fxyd2-ASO, effectively reversed the pain behavior demonstrated by the mechanical sensitivity test (A: von Frey test; B: Randall-Selitto paw pressure test). Data are presented as mean ± s.e.m. * = p < 0.05; ** = p < 0.01; *** = p < 0.001 and **** = p < 0.0001.

[0265] Figure 6. Intrathecal injection of Accell Fxyd2-siRNA to inhibit Fxyd2 reduces mechanical hypersensitivity in the SNL model. After mechanical hypersensitivity was induced by SNL, animals were injected intrathecally with Accell Fxyd2-siRNA (n = 9) or Accell control-siRNA (n = 9) daily. In the Von Frey test (A) and Randall-Selitto paw pressure test (B), Accell Fxyd2-siRNA, but not Accell control-siRNA, reduced mechanical hypersensitivity. Data are presented as mean ± s.e.m. ** = p < 0.01; *** = p < 0.001 and **** = p < 0.0001. Detailed implementation

[0266] Materials and methods

[0267] Animals

[0268] All experiments were approved by the French Ministry of Research (authorization number: C34-172-36) and were conducted according to the guidelines of the International Association for the Study of Pain (IASP). All animals were housed in a 12 / 12 light / dark cycle with free access to food and water. Five-week-old male Sprague-Dawley rats (Janvier, France) weighing 200 to 250 g at the start of the experiment were used.

[0269] Chronic pain model

[0270] The spinal nerve ligation (SNL) model of peripheral neuropathic pain and the complete Freund's adjuvant (CFA) model of chronic inflammatory pain were used. All surgical procedures were performed under deep isoflurane anesthesia. The SNL procedure was carried out as described previously 2 . Briefly, the transverse process of L6 was removed to expose the L4 and L5 spinal nerves. Then the L5 spinal nerve was isolated and tightly ligated with 6.0 silk thread. The complete Freund's adjuvant (CFA)-induced pain model 3 has been used to evaluate chronic inflammatory pain. Briefly, under isoflurane anesthesia, a plantar injection (50 μL) of a solution of 1 mg of Mycobacterium tuberculosis (Sigma-Aldrich) per milliliter was given to the left hind paw of the animals.

[0271] Rats were injected intrathecally with ASO, LASO, siRNA, or ω-conotoxin peptide MVIIA

[0272] ASO and LASO were manufactured by ChemBioPharm in Bordeaux, France. ChemBioPharm provided non-targeted ASO and LASO (sense sequence: 5’CGTGTAGGTACGGCAGATC 3' = SEQ ID NO:32) and were used as negative controls. We designed 29 different Fxyd2-ASOs, and the sequences are shown in Table 1. The “Accell” siRNA targeting rat-human Fxyd2 mRNA was purchased from Dharmacon. The sense sequence is as follows: 5'AAGAUUCCGCUGUGGGGGC(UU)3' defined by SEQ ID NO:31. The “Accell non-in vivo-targeting” siRNA (Dharmacon, D-001910-01) was used as a negative control. ω-Conotoxin peptide MVIIA was purchased from Sigma Aldrich (reference C1182) and was injected intrathecally at a dose of 100 picomoles as described by de Souza et al. 1 .

[0273] SNL-operated rats were tested to confirm mechanical hypersensitivity and then, under brief isoflurane anesthesia, were injected intrathecally with 2 μg of control or Fxyd2-siRNA or ASO or LASO daily in 20 μL of 5% glucose solution into the subarachnoid space4 For rats injected with CFA, starting from the 3rd day after CFA injection, 4 μg of control or Fxyd2-LASO in 20 μl of 5% glucose aqueous solution was injected intrathecally daily.

[0274] Rat behavioral tests

[0275] Three Sprague-Dawley male rats were housed per cage under standard light and temperature conditions. Commercial feed pellets and tap water were available ad libitum. Upon arrival, the animals were allowed to acclimatize to the colony room for 4 days. To avoid stress caused by experimental conditions, the analysis was performed by the same experimenter under quiet conditions in a test room adjacent to the colony room. Two weeks before the experiment, the animals were weighed daily, gently handled for 5 minutes, and then placed in the test room for 1 hour to habituate them to the pain-sensing device. Mechanical allodynia and mechanical hyperalgesia were evaluated once daily before surgery, on the day of surgery (d0), and postoperatively. For mechanical allodynia, we performed the von Frey test on 6 animals under each experimental condition as described above. For mechanical hyperalgesia, as previously described, the paw pressure vocalization test was used to determine the nociceptive threshold of the held rat 5 Briefly, increasing pressure was applied to the injured hind paw until the rat squeaked. A Basile analgesimeter (Apelex; contact probe, 1 mm) was used. To prevent tissue damage, a cut-off value of 600 g was determined.

[0276] In vitro FXYD2 protein knockdown experiments with ASO

[0277] Control-ASO, 29 different Fxyd2-ASOs, each 20 nucleotides in length, and ASO#75 and ASO#82, 15 and 17 nucleotides in length respectively (sequences shown in Table 1) (ChemBioPharm, Bordeaux, France) were used and tested in vitro in HEK293M cells. HEK293M cells were maintained in DMEM Glutamax (Invitrogen), supplemented with antibiotics (penicillin 50 U / ml, streptomycin 50 μg / ml) and 10% heat-inactivated fetal bovine serum. The cells were plated at a density of 50% and treated with the designated ASO for 2 days after 1 day. Lipofectamine 2000, a cationic lipid (Invitrogen), was used to increase the uptake of ASO by the cells. After pre-incubating with Lipofectamine 2000 diluted 1 / 1000 in serum-free OPTI-MEM (Life Technologies) for 20 minutes, the cells were treated with 100 nM ASO. After 4 hours, the medium was replaced with the above standard medium.

[0278] In vivo Fxyd2 protein knockdown experiment using LASO

[0279] For 14 days, 0, 0.5, 2, 4, or 8 μg Fxyd2-LASO in 20 μl of 5% glucose solution was injected intrathecally daily. For each concentration of Fxyd2-LASO, 3 rats were injected. Rats were intraperitoneally injected with pentobarbital and perfused with PBS through the heart. Lumbar DRGs (L4-L6) were dissected and stored at -80 °C.

[0280] Western Blot

[0281] Cells or tissues were mechanically homogenized in NP40 buffer (1% NP40, 150 mM NaCl; 50 mM Tris-HCl, pH 7.5 and protease inhibitors) at 4 °C. The lysates were clarified at 12,000 × g for 10 minutes at 4 °C. After protein quantification using a BCA kit (Thermofisher, France), the lysates were run on SDS-PAGE and transferred to nitrocellulose membranes. Rabbit anti-C-terminal Fxyd2 and mouse anti-actin antibodies were used. After incubation with primary and fluorescent IRDye secondary antibodies (LI-COR Biosciences), immunodetection was performed using an Odyssey CLx Imager (LI-COR Biosciences). Quantification was performed using Image Studio Lite software (LI-COR Biosciences).

[0282] Statistical analysis

[0283] For Western blot experiments, statistical analysis was performed using one-way analysis of variance (ANOVA), followed by a post hoc Dunnett test. For behavioral studies, group effects and time effects were verified by two-way analysis of variance with repeated measures. When ANOVA showed a significant effect, a Bonferroni post hoc test was used to determine the significance of the differences. P values < 0.05 (*), P < 0.01 (**), P < 0.001 (***), and P < 0.0001 (****) were considered statistically significant. All data presented are mean ± s.e.m.

[0284] Results

[0285] We used the RNAfold program (http: / / rna.tbi.univie.ac.at / cgi-bin / RNAfold.cgi) to generate the secondary structure of human FXYD2 mRNA (NCBI reference sequence NM_001680) for the identification of oligonucleotide sequences with potential functional knockdown properties (data not shown). A series of overlapping oligonucleotide sequences covering bases 112 - 267 of human FXYD2 mRNA (Table 1) were tested by transfecting individual ASOs into human HEK293 cells and quantifying FXYD2 protein levels by Western blot. The region encompassing bases 210 - 238 (targeted by ASO#75 to #84) was found to be particularly conducive to antisense inhibition ( Figure 1A ).

[0286] ASO#75 and ASO#82 of lengths 15, 17, and 20 nucleotides (SEQ ID NO:17, 24, 38 - 41) were tested. The inhibitory efficiency was highest for the 20 - nucleotide - long ASOs ( Figure 1B ).

[0287] ASO#75 (SEQ ID NO:17; complementary to bases 210 - 229) was selected for further in - depth study because this sequence is 100% conserved between rat and human mRNA and thus its efficacy could be tested in a rat model system. The knockdown of Fxyd2 protein in rat DRG after intrathecal injection of ASO#75 was then tested in vivo ( Figure 2 ). To avoid the known toxic effects of transfection agents and to enhance the efficiency of ASO uptake into neurons, we used a lipid - modified form of ASO#75, hereinafter referred to as Fxyd2 - LASO. This lipid modification is described in WO2014 / 195430 and Pokholenko et al., 2013.

[0288] We first performed a dose - response analysis to find the lowest dose of Fxyd2 - LASO that could effectively reduce Fxyd2 protein levels in DRG neurons. Fxyd2 - LASO (0, 0.5, 2, 4, and 8 μg) or control - LASO was intrathecally injected daily in 20 μl of 5% glucose solution for 14 days. Lumbar DRGs (L4, L5, L6) were dissected and tissues were analyzed by Western blot. Figure 2 It was shown that injection of 2 μg of Fxyd2 - LASO achieved the maximum knockdown effect, and no further reduction in the knockdown effect was observed after injection of higher doses of LASO. Control - LASO had no effect on Fxyd2 protein levels.

[0289] Next, we tested the in vivo effects of intrathecal injection of Fxyd2-LASO on pain behavior in the SNL neuropathic pain model (Figure 3). Four days after surgery, rats exhibited hypersensitivity to mechanical stimuli, which was demonstrated by a decrease in the withdrawal threshold to von Frey filaments and an increase in the response to paw pressure on the ipsilateral paw (Randall-Selitto test). Daily injection of Fxyd2-LASO starting from day 14 after surgery led to a gradual reversal of pain behavior, and by day 21 after surgery, the response had returned to baseline levels. As long as Fxyd2-LASO was continuously injected (for 6 days), complete attenuation of pain behavior was maintained. Interruption of Fxyd2-LASO injection led to the recovery of hypersensitivity to mechanical stimuli within 2 days. Parallel injection of 2 μg of control LASO in neuropathic rats had no alleviating effect on pain behavior.

[0290] Next, we compared the analgesic effect of Fxyd2-LASO with the gold standard for intrathecal administration, ω-conotoxin peptide MVIIA, the synthetic form of which is commercialized for humans under the name Prialt. TM ω-Conotoxin peptide MVIIA is a calcium channel inhibitor used in certain cases of intractable pain. In the group of rats that had been successfully treated with Fxyd2-LASO, if mechanical hypersensitivity reappeared after injection was stopped, we initiated a new series of injections. Again, Fxyd2-LASO completely abolished pain behavior. Meanwhile, a group of rats that had undergone surgery and developed neuropathic pain received ω-conotoxin peptide MVIIA (100 picomoles / intrathecal injection 1 ). ω-Conotoxin peptide MVIIA partially alleviated pain behavior (Figure 3), although, as expected, the effect lasted for a short time (1 - 2 hours). This experiment demonstrated that intrathecal injection of Fxyd2-LASO is an effective analgesic in the rodent neuropathic pain model, with a longer duration of action (days instead of hours) and is at least as effective as the current gold standard Prialt. TM

[0291] ​We next tested whether inhibition of Fxyd2 by Fxyd2-LASO is effective in other pain models where the known underlying mechanisms differ from those involved in pain induced by nerve injury. Therefore, we employed a commonly used inflammatory pain model, the intraplantar injection of complete Freund’s adjuvant (CFA), which induces prolonged mechanical hypersensitivity (Fig. 4). Again, we tested mechanical sensitivity using Von Frey filaments and the Randall-Selitto test. Injection of CFA induced rapid mechanical hypersensitivity within 2 days, which remained unchanged in a time course experiment in control animals treated with control LASO. Once-daily intrathecal injection of 4 μg Fxyd2-LASO again attenuated pain behaviors, albeit for a longer period of time compared to neuropathic pain induced by nerve injury. The maximum analgesic effect was achieved after 15 days of treatment compared to 7 days in the injury-induced neuropathic pain model. Second, although pain behaviors were completely attenuated in the Von Frey filament test, the results showed partial efficacy in the Randall-Selitto test (Fig. 4). As in the nerve injury model, cessation of Fxyd2-LASO injections resulted in a rapid recovery of pain behaviors, and subsequent resumption of Fxyd2-LASO injections restored the analgesic effect.

[0292] We next explored the importance of lipid modification of Fxyd2-LASO in its analgesic efficacy by directly comparing the responses to intrathecal injection of unmodified Fxyd2-ASO antisense oligonucleotides and Fxyd2-LASO in the same experiment (Fig. 5). Following SNL surgery and induction of neuropathic pain behaviors, groups of rats were treated by daily intrathecal injections of 2 μg of Fxyd2-ASO or Fxyd2-LASO. Mechanical sensitivity testing showed that Fxyd2-ASO was ineffective in reducing pain behaviors and that lipid modification was necessary for the pain-suppressing effects of the oligonucleotide.

[0293] Finally, we tested the effectiveness of using siRNA directed against Fxyd2 mRNA as an alternative approach to inhibit its function (Figure 6). Custom siRNAs synthesized using AccellTM technology (Dharmacon) and directed against the same 100% conserved rat-human sequence as in ASO #75 were purchased. AccellTM technology facilitates cell penetration without the need for the addition of transfection agents. We used 2 μg of Fxyd2-siRNA per injection. A "non-targeting" siRNA was used as a control. Although not as effective as Fxyd2-LASO, daily Fxyd2-siRNA, but not control siRNA, reduced mechanical hypersensitivity in the SNL neuropathic pain model.

[0294] Conclusion:

[0295] Overall, these results identified several antisense oligonucleotides that can inhibit human FXYD2 expression in vitro. Intrathecal injection of the 100% conserved rat-human ASO (LASO#75) in lipid-modified form significantly reduced pain behaviors in two rodent models of neuropathic pain; neuropathic pain induced by peripheral nerve injury and inflammatory pain induced by CFA.

[0296] Thus, the inventors have demonstrated that the antisense oligonucleotides according to the invention are capable of inhibiting FXYD2 and thereby treating pain.

[0297] References:

[0298] Throughout this application, various references describe the prior art relevant to the present invention. The disclosures of these references are hereby incorporated by reference into this disclosure.

[0299] 1-De Souza, AH et al. An evaluation of the antinociceptive effects of Phα1β, a neurotoxin from the spider Phoneutria nigriventer, and ω-conotoxin MVIIA, a cone snail Conus magus toxin, in rat model of inflammatory and neuropathic pain. Cell Mol Neurobiol. 33, 59-67 (2013)

[0300] 2-Kim, S.H. & Chung, J.M. An experimental model for peripheral neuropathy produced by segmental spinal nerve ligation in the rat. Pain 50, 355–363 (1992).

[0301] 3-Ferreira, J. et al. Evidence for the participation of kinins in Freund’s adjuvant-induced inflammatory and nociceptive responses in kinin B1 and B2 receptor knockout mice. Neuropharmacology 41, 1006–1012 (2001).

[0302] 4 - Pieraut, S. et al. NKCC1 phosphorylation stimulates neurite growth of injured adult sensory neurons. J. Neurosci. 25, 6751–6759 (2007).

[0303] 5 - Rivat, C. et al. Non - nociceptive environmental stress induces hyperalgesia, not analgesia, in pain and opioid - experienced rats. Neuropsychopharmacology 32, 2217–2228 (2007). Sequence Listing <110> INSERM (Institut National de la Santé et de la Recherche Médicale) French National Center for Scientific Research (CNRS) University of Bordeaux University of Montpellier <120> Antisense Oligonucleotides and Their Application in Pain Treatment <130> 25615INS <150> 19306327.8 <151> 2019 - 10 - 10 <160> 41 <170> SIPOSequenceListing 1.0 <210> 1 <211> 593 <212> DNA <213> Homo sapiens <400> 1 actctccatc caggccccag gcaagcagca cctccctgct ctcctgcact cctggacaca 60 accagcagct cctgccatgg acaggtggta cctgggcggc agccccaagg gggacgtgga 120 cccgttctac tatgactatg agaccgttcg caatgggggc ctgatcttcg ctggactggc 180 cttcatcgtg gggctcctca tcctcctcag cagaagattc cgctgtgggg gcaataagaa 240 gcgcaggcaa atcaatgaag atgagccgta acagcagcct cggcggtgcc acccactgca 300 ctggggccag ctgggaagcc aagcatggcc ctgcctctgg cgcctcccct tcttccctgg 360 gctttagacc tttgtccccg tcactgccag cgcttgggct gaaggaagct ccagactcaa 420 tgtgaccccc aggtggcatc gccaactcct gcctcgtgcc acctcatgct tataataaag 480 ccggcgtcag agaccgctgc ttccctcacc tgcctgcctg tctccctcct ctgtcaccac 540 cagcctctcc aagctcaagt acaaatacag ccgggtctca tttgtttttt caa 593 <210> 2 <211> 589 <212> DNA <213> Homo sapiens <400> 2 agacactctc caaaaagcag agacagcagg aagaggggag tggaggcagc ccattcacct 60 ggggaaatga ctgggttgtc gatggacggt ggcggcagcc ccaaggggga cgtggacccg 120 ttctactatg actatgagac cgttcgcaat gggggcctga tcttcgctgg actggccttc 180 atcgtggggc tcctcatcct cctcagcaga agattccgct gtgggggcaa taagaagcgc 240 aggcaaatca atgaagatga gccgtaacag cagcctcggc ggtgccaccc actgcactgg 300 ggccagctgg gaagccaagc atggccctgc ctctggcgcc tccccttctt ccctgggctt 360 tagacctttg tccccgtcac tgccagcgct tgggctgaag gaagctccag actcaatgtg 420 acccccaggt ggcatcgcca actcctgcct cgtgccacct catgcttata ataaagccgg 480 cgtcagagac cgctgcttcc ctcacctgcc tgcctgtctc cctcctctgt caccaccagc 540 ctctccaagc tcaagtacaa atacagccgg gtctcatttg ttttttcaa 589 <210> 3 <211> 177 <212> DNA <213> Homo sapiens <400> 3 ggcggcagcc ccaaggggga cgtggacccg ttctactatg actatgagac cgttcgcaat 60 gggggcctga tcttcgctgg actggccttc atcgtggggc tcctcatcct cctcagcaga 120 agattccgct gtgggggcaa taagaagcgc aggcaaatca atgaagatga gccgtaa 177 <210> 4 <211> 593 <212> RNA <213> Homo sapiens <400> 4 ugagagguag guccgggguc cguucgucgu ggagggacga gaggacguga ggaccugugu 60 uggucgucga ggacgguacc uguccaccau ggacccgccg ucgggguucc cccugcaccu 120 gggcaagaug auacugauac ucuggcaagc guuacccccg gacuagaagc gaccugaccg 180 gaaguagcac cccgaggagu aggaggaguc gucuucuaag gcgacacccc cguuauucuu 240 cgcguccguu uaguuacuuc uacucggcau ugucgucgga gccgccacgg ugggugacgu 300 gaccccgguc gacccuucgg uucguaccgg gacggagacc gcggagggga agaagggacc 360 cgaaaucugg aaacaggggc agugacgguc gcgaacccga cuuccuucga ggucugaguu 420 acacuggggg uccaccguag cgguugagga cggagcacgg uggaguacga auauuauuuc 480 ggccgcaguc ucuggcgacg aagggagugg acggacggac agagggagga gacaguggug 540 gucggagagg uucgaguuca uguuuauguc ggcccagagu aaacaaaaaa guu 593 <210> 5 <211> 589 <212> RNA <213> Homo sapiens <400> 5 ucugugagag guuuuucguc ucugucgucc uucuccccuc accuccgucg gguaagugga 60 cugugagag guuuuucguc ucugucgucc uucuccccuc accuccgucg gguaagugga 60 ccccuuuacu gacccaacag cuaccugcca ccgccgucgg gguucccccu gcaccugggc 120 ccccuuuacu gacccaacag cuaccugcca ccgccgucgg gguucccccu gcaccugggc 120 aagaugauac ugauacucug gcaagcguua cccccggacu agaagcgacc ugaccggaag 180 aagaugauac ugauacucug gcaagcguua cccccggacu agaagcgacc ugaccggaag 180 uagcaccccg aggaguagga ggagucgucu ucuaaggcga cacccccguu auucuucgcg 240 uagcaccccg aggaguagga ggagucgucu ucuaaggcga cacccccguu auucuucgcg 240 uccguuuagu uacuucuacu cggcauuguc gucggagccg ccacgguggg ugacgugacc 300 uccguuuagu uacuucuacu cggcauuguc gucggagccg ccacgguggg ugacgugacc 300 ccggucgacc cuucgguucg uaccgggacg gagaccgcgg aggggaagaa gggacccgaa 360 ccggucgacc cuucgguucg uaccgggacg gagaccgcgg aggggaagaa gggacccgaa 360 aucuggaaac aggggcagug acggucgcga acccgacuuc cuucgagguc ugaguuacac 420 aucuggaaac aggggcagug acggucgcga acccgacuuc cuucgagguc ugaguuacac 420 ugggggucca ccguagcggu ugaggacgga gcacggugga guacgaauau uauuucggcc 480 ugggggucca ccguagcggu ugaggacgga gcacggugga guacgaauau uauuucggcc 480 gcagucucug gcgacgaagg gaguggacgg acggacagag ggaggagaca gugguggucg 540 gcagucucug gcgacgaagg gaguggacgg acggacagag ggaggagaca gugguggucg 540 gagagguucg aguucauguu uaugucggcc cagaguaaac aaaaaaguu 589 gagagguucg aguucauguu uaugucggcc cagaguaaac aaaaaaguu 589 <210> 6<210> 6 <211> 177 <211> 177 <212> RNA <212> RNA <213> Homo sapiens <213> Homo sapiens <400> 6 <400> 6 ccgccgucgg gguucccccu gcaccugggc aagaugauac ugauacucug gcaagcguua 60 ccgccgucgg gguucccccu gcaccugggc aagaugauac ugauacucug gcaagcguua 60 cccccggacu agaagcgacc ugaccggaag uagcaccccg aggaguagga ggagucgucu 120 ucuaaggcga cacccccguu auucuucgcg uccguuuagu uacuucuacu cggcauu 177 <210> 7 <211> 20 <212> DNA <213> Homo sapiens <400> 7 tcatagtaga acgggtccac 20 <210> 8 <211> 20 <212> DNA <213> Homo sapiens <400> 8 gtcatagtag aacgggtcca 20 <210> 9 <211> 20 <212> DNA <213> Homo sapiens <400> 9 agtcatagta gaacgggtcc 20 <210> 10 <211> 20 <212> DNA <213> Homo sapiens <400> 10 tagtcatagt agaacgggtc 20 <210> 11 <211> 20 <212> DNA <213> Homo sapiens <400> 11 agtccagcga agatcaggcc 20 <210> 12 <211> 20 <212> DNA <213> Homo sapiens <400> 12 cagtccagcg aagatcaggc 20 <210> 13 <211> 20 <212> DNA <213> Homo sapiens <400> 13 ccagtccagc gaagatcagg 20 <210> 14 <211> 20 <212> DNA <213> Homo sapiens <400> 14 gccagtccag cgaagatcag 20 <210> 15 <211> 20 <212> DNA <213> Homo sapiens <400> 15 ggccagtcca gcgaagatca 20 <210> 16 <211> 20 <212> DNA <213> Homo sapiens <400> 16 cccccacagc ggaatcttct 20 <210> 17 <211> 20 <212> DNA <213> Homo sapiens <400> 17 tgcccccaca gcggaatctt 20 <210> 18 <211> 20 <212> DNA <213> Homo sapiens <400> 18 ttgcccccac agcggaatct 20 <210> 19 <211> 20 <212> DNA <213> Homo sapiens <400> 19 attgccccca cagcggaatc 20 <210> 20 <211> 20 <212> DNA <213> Homo sapiens <400> 20 tattgccccc acagcggaat 20 <210> 21 <211> 20 <212> DNA <213> Homo sapiens <400> 21 ttattgcccc cacagcggaa 20 <210> 22 <211> 20 <212> DNA <213> Homo sapiens <400> 22 cttattgccc ccacagcgga 20 <210> 23 <211> 20 <212> DNA <213> Homo sapiens <400> 23 tcttattgcc cccacagcgg 20 <210> 24 <211> 20 <212> DNA <213> Homo sapiens <400> 24 ttcttattgc ccccacagcg 20 <210> 25 <211> 20 <212> DNA <213> Homo sapiens <400> 25 cttcttattg cccccacagc 20 <210> 26 <211> 20 <212> DNA <213> Homo sapiens <400> 26 gcttcttatt gcccccacag 20 <210> 27 <211> 20 <212> DNA <213> Homo sapiens <400> 27 cggctcatct tcattgattt 20 <210> 28 <211> 20 <212> DNA <213> Homo sapiens <400> 28 acggctcatc ttcattgatt 20 <210> 29 <211> 20 <212> DNA <213> Homo sapiens <400> 29 tacggctcat cttcattgat 20 <210> 30 <211> 20 <212> DNA <213> Homo sapiens <400> 30 ttacggctca tcttcattga 20 <210> 31 <211> 21 <212> RNA <213> Homo sapiens <400> 31 aagauuccgc ugugggggcu u 21 <210> 32 <211> 19 <212> DNA <213> Homo sapiens <400> 32 cgtgtaggta cggcagatc 19 <210> 33 <211> 20 <212> DNA <213> Homo sapiens <400> 33 gcgcttctta ttgcccccac 20 <210> 34 <211> 20 <212> DNA <213> Homo sapiens <400> 34 gcctgcgctt cttattgccc 20 <210> 35 <211> 20 <212> DNA <213> Homo sapiens <400> 35 tgatttgcct gcgcttctta 20 <210> 36 <211> 20 <212> DNA <213> Homo sapiens <400> 36 catcttcatt gatttgcctg 20 <210> 37 <211> 20 <212> DNA <213> Homo sapiens <400> 37 ggctcatctt cattgatttg 20 <210> 38 <211> 15 <212> DNA <213> Homo sapiens <400> 38 ccacagcgga atctt 15 <210> 39 <211> 17 <212> DNA <213> Homo sapiens <400> 39 ccccacagcg gaatctt 17 <210> 40 <211> 15 <212> DNA <213> Homo sapiens <400> 40 tcttattgcc cccac 15 <210> 41 <211> 17 <212> DNA <213> Homo sapiens <400> 41 tcttattgcc cccacag 17

Claims

1. An FXYD2 inhibitor, wherein, the inhibitor reduces the expression and / or activity of FXYD2 in a subject in need thereof and targets a region comprising or consisting of nucleotides 219 - 229 of SEQ ID NO:3; the FXYD2 inhibitor comprises an antisense oligonucleotide or siRNA; the antisense oligonucleotide consists of the sequence shown in SEQ ID NO:17, and the antisense oligonucleotide is a lipid-conjugated antisense oligonucleotide; the nucleotide sequence of the siRNA is as shown in SEQ ID NO.

31.

2. The inhibitor according to claim 1, wherein, the antisense oligonucleotide comprises modified nucleotides selected from the group consisting of 2'-O-Met, 2'-O-(2-methoxyethyl) (MOE) oligomers and / or 2'-thiophosphate analogs.

3. A pharmaceutical composition comprising the inhibitor according to any one of claims 1 - 2.

4. Use of the pharmaceutical composition according to claim 3 in the preparation of a medicament for treating pain; the pain is neuropathic pain and / or inflammatory pain; administration of the inhibitor is by intrathecal, subcutaneous, or topical intravenous administration.

Images