Nucleic acid sequence for detecting soybean plant dbn8205 and method for detecting the same

Abstract

The present application relates to a nucleic acid sequence for detecting a soybean plant DBN8205 and a detection method thereof, the nucleic acid sequence comprising SEQ ID NO:1 or its complementary sequence, and / or SEQ ID NO:2 or its complementary sequence. The soybean plant DBN8205 of the present application has good resistance to lepidoptera insects and good tolerance to glufosinate herbicide, and has no effect on yield. The detection method can accurately and quickly identify whether the DNA molecule of the transgenic soybean event DBN8205 is contained in the biological sample.

Description

Technical Field

[0001] This invention relates to the field of plant molecular biology, particularly to the field of transgenic crop breeding in agricultural biotechnology research. Specifically, this invention relates to the transgenic soybean event DBN8205 exhibiting insect resistance and glufosinate herbicide tolerance, and to the nucleic acid sequence for detecting whether a biological sample contains the specific transgenic soybean event DBN8205, as well as the detection method thereof. Background Technology

[0002] Soybean (Glycine max) is one of the world's five major crops. Biotechnology has been applied to this crop to produce soybean varieties with desired traits. The two most important agronomic traits in soybean production are insect resistance and herbicide tolerance. Insect resistance in soybeans can be acquired through transgenic methods by expressing insect resistance genes in soybean plants. However, transgenic soybeans relying on the expression of a single insect-resistant protein against insect infestation are at risk of limited durability. This is because insects, under continuous selective pressure, will evolve resistance to the insecticidal proteins expressed in transgenic soybeans. Once such resistance develops and cannot be effectively controlled, it will undoubtedly limit the commercial value of transgenic soybean varieties containing insecticidal proteins. Therefore, combining two or more insecticidal proteins can serve as a method to delay insect resistance and broaden the spectrum of insect resistance. Phosphinicotin N-acetyltransferase (PAT), isolated from Streptomyces, catalyzes the acetylation of L-phosphinicotin to its inactive form. Genes expressing plant-optimized forms of PAT have been used in soybeans to confer tolerance to glufosinate herbicides, such as soybean event A5547-127.

[0003] Designing expression vectors containing exogenous functional genes (cCry2Ab, cCry1Ac, and cPAT genes) suitable for transforming soybean crops and obtaining corresponding commercially viable transgenic soybean events is of great significance. Besides the functional genes (cCry2Ab, cCry1Ac, and cPAT genes) themselves, the selection of regulatory elements is crucial for obtaining successful transformation events, and the technical effects are unpredictable. For example, the commercial glyphosate-resistant soybean transformation events GTS 40-3-2 (US5633435) and MON89788 (CN101252831B), both transformed with the CP4-EPSPS gene (with the same amino acid sequence) and both used a single expression cassette molecular design. However, due to the selection of different regulatory elements, the EPSPS protein expression levels and yields of the two transformation events differed significantly. Therefore, when designing expression vectors, it is necessary to fully consider and analyze the combination and interaction of regulatory elements, as well as their arrangement on T-DNA. Meanwhile, successful commercial soybean transformation events must comprehensively consider the vector design of cCry2Ab, cCry1Ac, and cPAT genes in soybean plants, the interaction of the three expression cassettes, insect resistance, herbicide tolerance, and the impact on yield and other plant physiological indicators. This will ensure that cCry2Ab, cCry1Ac, and cPAT genes are expressed in appropriate amounts in soybeans and achieve their corresponding functions without affecting soybean yield and other physiological indicators.

[0004] It is known that the expression of exogenous genes in plants is influenced by their chromosomal location, possibly due to the proximity of chromatin structures (such as heterochromatin) or transcriptional regulatory elements (such as enhancers) to the integration site. Therefore, screening a large number of events is often required to identify commercially viable events (i.e., events where the introduced target gene is optimally expressed). For example, significant differences in the expression levels of introduced genes have been observed between events in plants and other organisms; differences may also exist in spatial or temporal patterns of expression, such as the relative expression of transgenes in different plant tissues. These differences manifest as actual expression patterns that may not match the expected expression patterns based on the transcriptional regulatory elements in the introduced gene construct. Therefore, it is often necessary to generate hundreds or thousands of different events and screen for a single event with the expected transgene expression levels and patterns for commercial purposes. Events with the expected transgene expression levels and patterns can be used to introduce transgenes into other genetic backgrounds through sexual crossbreeding using conventional breeding methods. Offspring produced through this crossbreeding retain the transgene expression characteristics of the original transformant. Applying this strategy can ensure reliable gene expression in many varieties that are well adapted to local growing conditions.

[0005] Being able to detect the presence of specific events to determine whether the offspring of sexual hybridization contain the target gene would be beneficial. Furthermore, methods for detecting specific events would help comply with relevant regulations, such as the requirement for formal approval and labeling of foods derived from recombinant crops before they can be placed on the market. Detecting the presence of transgenes using any well-known polynucleotide detection method is possible, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. These methods typically focus on commonly used genetic elements, such as promoters, terminators, and marker genes. Therefore, unless the sequence of the chromosomal DNA adjacent to the inserted transgene DNA (“flanking DNA”) is known, these methods cannot be used to distinguish different events, especially those produced using the same DNA construct. Therefore, currently, a pair of primers spanning the junction of the inserted transgene and the flanking DNA is commonly used to identify transgene-specific events via PCR; specifically, a first primer contained within the inserted sequence and a second primer contained within the inserted sequence. Summary of the Invention

[0006] The purpose of this invention is to provide a method for detecting the nucleic acid sequence of the soybean plant DBN8205. The transgenic soybean event DBN8205 exhibits good resistance to insects and good tolerance to glufosinate herbicide. Furthermore, the detection method can accurately and rapidly identify whether a biological sample contains the DNA molecule of the transgenic soybean event DBN8205.

[0007] To achieve the above objectives, the present invention provides a nucleic acid molecule having the following nucleic acid sequence, wherein the nucleic acid sequence comprises at least 11 consecutive nucleotides in positions 1-462 of SEQ ID NO:3 or its complementary sequence and at least 11 consecutive nucleotides in positions 463-634 of SEQ ID NO:3 or its complementary sequence, and / or at least 11 consecutive nucleotides in positions 1-225 of SEQ ID NO:4 or its complementary sequence and at least 11 consecutive nucleotides in positions 226-642 of SEQ ID NO:4 or its complementary sequence.

[0008] Preferably, the nucleic acid sequence comprises 22-25 consecutive nucleotides in positions 1-462 of SEQ ID NO:3 or its complementary sequence and 22-25 consecutive nucleotides in positions 463-634 of SEQ ID NO:3 or its complementary sequence, and / or 22-25 consecutive nucleotides in positions 1-225 of SEQ ID NO:4 or its complementary sequence and 22-25 consecutive nucleotides in positions 226-642 of SEQ ID NO:4 or its complementary sequence.

[0009] Preferably, the nucleic acid sequence comprises SEQ ID NO:1 or its complementary sequence, and / or SEQ ID NO:2 or its complementary sequence.

[0010] The SEQ ID NO:1 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence in the transgenic soybean event DBN8205. The SEQ ID NO:1 or its complementary sequence spans the flanking genomic DNA sequence of the soybean insertion site and the DNA sequence at the 5' end of the inserted sequence. The presence of the SEQ ID NO:1 or its complementary sequence is sufficient to identify the transgenic soybean event DBN8205. The SEQ ID NO:2 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence in the transgenic soybean event DBN8205. The SEQ ID NO:2 or its complementary sequence spans the DNA sequence at the 3' end of the inserted sequence and the flanking genomic DNA sequence of the soybean insertion site. The presence of the SEQ ID NO:2 or its complementary sequence is sufficient to identify the transgenic soybean event DBN8205.

[0011] Preferably, the nucleic acid sequence comprises SEQ ID NO:3 or its complementary sequence, and / or SEQ ID NO:4 or its complementary sequence.

[0012] In this invention, the nucleic acid sequence comprises at least 11 or more consecutive polynucleotides (first nucleic acid sequence) of any portion of the T-DNA insertion sequence in SEQ ID NO:3 or its complementary sequence, and at least 11 or more consecutive polynucleotides (second nucleic acid sequence) of any portion of the 5' flanking soybean genomic DNA region in SEQ ID NO:3 or its complementary sequence. The nucleic acid sequence may further be homologous to or complementary to a portion of SEQ ID NO:3 comprising the complete SEQ ID NO:1. When the first and second nucleic acid sequences are used together, these nucleic acid sequences can be used as DNA primer pairs in DNA amplification methods to generate amplification products. When the amplification product generated in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO:1, the presence of the transgenic soybean event DBN8205 or its progeny can be diagnosed. The SEQ ID NO:3 or its complementary sequence is a 634-nucleotide sequence located near the insertion junction at the 5' end of the T-DNA insert sequence in the transgenic soybean event DBN8205. The SEQ ID NO:3 or its complementary sequence consists of a 462-nucleotide soybean genome 5' flanking sequence (nucleotides 1-462 of SEQ ID NO:3) and 172 nucleotides from the pDBN4031 construct DNA sequence (nucleotides 463-634 of SEQ ID NO:3). The presence of the transgenic soybean event DBN8205 can be identified by the presence of the SEQ ID NO:3 or its complementary sequence.

[0013] The nucleic acid sequence comprises at least 11 or more consecutive polynucleotides (third nucleic acid sequence) of any portion of the T-DNA insert sequence in SEQ ID NO:4 or its complementary sequence, and at least 11 or more consecutive polynucleotides (fourth nucleic acid sequence) of any portion of the 3' flanking soybean genomic DNA region in SEQ ID NO:4 or its complementary sequence. The nucleic acid sequence may further be a portion homologous to or complementary to SEQ ID NO:4 comprising the complete SEQ ID NO:2. When the third and fourth nucleic acid sequences are used together, these nucleic acid sequences can be used as DNA primer pairs in DNA amplification methods to generate amplification products. When the amplification product generated in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO:2, the presence of the transgenic soybean event DBN8205 or its progeny can be diagnosed. The SEQ ID NO:4 or its complementary sequence is a 642-nucleotide sequence located near the T-DNA insertion junction at the 3' end of the inserted sequence in the transgenic soybean event DBN8205. The SEQ ID NO:4 or its complementary sequence consists of a 21-nucleotide DNA sequence of the t35S transcription terminator (nucleotides 1-21 of SEQ ID NO:4), 204 nucleotides of the pDBN4031 construct DNA sequence (nucleotides 22-225 of SEQ ID NO:4), and a 417-nucleotide 3' flanking sequence of the soybean genome (nucleotides 226-642 of SEQ ID NO:4). The presence of the SEQ ID NO:4 or its complementary sequence is sufficient to identify the transgenic soybean event DBN8205.

[0014] Furthermore, the nucleic acid sequence comprises SEQ ID NO:5 or its complementary sequence.

[0015] The SEQ ID NO:5 or its complementary sequence is a 12813-nucleotide sequence characterizing the transgenic soybean event DBN8205, and its specific genomic and genetic elements are shown in Table 1. The presence of the transgenic soybean event DBN8205 can be identified by the presence of the SEQ ID NO:5 or its complementary sequence.

[0016] Table 1. Genome and genetic elements contained in SEQ ID NO:5

[0017]

[0018]

[0019] As is well known to those skilled in the art, the first, second, third, and fourth nucleic acid sequences do not necessarily consist solely of DNA, but may also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or analogues that do not serve as templates for one or more polymerases. Furthermore, the probes or primers described in this invention should be at least approximately 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides in length, which may be selected from the nucleotides described in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. When selected from the nucleotides shown in SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5, the probes and primers may be at least approximately 21 to approximately 50 or more consecutive nucleotides in length.

[0020] The nucleic acid sequence or its complementary sequence can be used in DNA amplification methods to generate amplicones, which are used to detect the presence of transgenic soybean event DBN8205 or its progeny in biological samples; the nucleic acid sequence or its complementary sequence can be used in nucleotide detection methods to detect the presence of transgenic soybean event DBN8205 or its progeny in biological samples.

[0021] To achieve the above objectives, the present invention also provides a method for detecting the presence of DNA from the transgenic soybean event DBN8205 in a sample, comprising:

[0022] The sample to be tested is brought into contact with at least two primers used to amplify the target amplification product during the nucleic acid amplification reaction;

[0023] Perform nucleic acid amplification reaction; and

[0024] Detect the presence of the target amplification product;

[0025] The target amplification product contains the nucleic acid sequence.

[0026] Preferably, the target amplification product comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and / or SEQ ID NO:7 or its complementary sequence.

[0027] Specifically, the two primers include complementary sequences of SEQ ID NO:8 and SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:11, or SEQ ID NO:1 and SEQ ID NO:2.

[0028] To achieve the above objectives, the present invention also provides a method for detecting the presence of DNA from the transgenic soybean event DBN8205 in a sample, comprising:

[0029] The sample to be tested is brought into contact with the probe, the probe containing the nucleic acid sequence;

[0030] The sample to be tested and the probe are hybridized under strict hybridization conditions; and

[0031] The hybridization between the sample to be tested and the probe is detected.

[0032] The stringent conditions can be defined as hybridization at 65°C in a 6×SSC (sodium citrate) and 0.5% SDS (sodium dodecyl sulfate) solution, followed by washing the membrane once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS.

[0033] Preferably, the probe comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and / or SEQ ID NO:7 or its complementary sequence.

[0034] Optionally, at least one of the probes is labeled with at least one fluorescent group.

[0035] To achieve the above objectives, the present invention also provides a method for detecting the presence of DNA from the transgenic soybean event DBN8205 in a sample, comprising:

[0036] The sample to be tested is brought into contact with a labeled nucleic acid molecule, wherein the labeled nucleic acid molecule includes the nucleic acid sequence;

[0037] The sample to be tested and the labeled nucleic acid molecules are hybridized under strict hybridization conditions;

[0038] The hybridization of the sample to be tested and the marker nucleic acid molecule is detected, and then marker-assisted breeding analysis is used to determine whether insect resistance and / or herbicide tolerance are genetically linked to the marker nucleic acid molecule.

[0039] Preferably, the marker nucleic acid molecule includes at least one selected from: SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, and SEQ ID NO:6-11 or their complementary sequences.

[0040] To achieve the above objectives, the present invention also provides a DNA detection kit comprising at least one DNA molecule containing the nucleic acid sequence, which can serve as one of the DNA primers or probes specific to the transgenic soybean event DBN8205 or its progeny.

[0041] Preferably, the DNA molecule comprises SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and / or SEQ ID NO:7 or its complementary sequence.

[0042] To achieve the above objectives, the present invention also provides a plant cell or portion comprising a nucleic acid sequence encoding an insect resistance Cry2Ab protein, a nucleic acid sequence encoding an insect resistance Cry1Ac protein, a nucleic acid sequence encoding a glufosinate-tolerant PAT protein, and a nucleic acid sequence in a specific region, wherein the nucleic acid sequence in the specific region comprises the sequences shown in SEQ ID NO:1 and / or SEQ ID NO:2; preferably, the nucleic acid sequence in the specific region comprises the sequences shown in SEQ ID NO:3 and / or SEQ ID NO:4.

[0043] Preferably, the plant cell or part thereof sequentially comprises the nucleic acid sequence of SEQ ID NO:1, the nucleic acid sequence of SEQ ID NO:5 from position 866 to 12192, and SEQ ID NO:2, or comprises the sequence shown in SEQ ID NO:5.

[0044] Preferably, the plant cells or portions contain the transgenic soybean event DBN8205;

[0045] Optionally, the plant cells or portions may further comprise at least one other transgenic soybean event different from transgenic soybean event DBN8205; preferably, the other transgenic soybean event is transgenic soybean event DBN9004 and / or transgenic soybean event DBN8002.

[0046] To achieve the above objectives, the present invention also provides a method for protecting soybean plants from insect infestation, comprising providing at least one transgenic soybean plant cell in the diet of target insects, said transgenic soybean plant cell containing the sequence shown in SEQ ID NO:1 and / or SEQ ID NO:2 in its genome, wherein the target insects that feed on said transgenic soybean plant cell are inhibited from further feeding on said transgenic soybean plant.

[0047] Preferably, the transgenic soybean plant cells contain the sequences shown in SEQ ID NO:3 and / or SEQ ID NO:4 in their genome.

[0048] Preferably, the transgenic soybean plant cell contains, in sequence, the nucleic acid sequences of SEQ ID NO:1, SEQ ID NO:5 positions 866-12192 and SEQ ID NO:2 in its genome, or contains SEQ ID NO:5.

[0049] To achieve the above objectives, the present invention also provides a method for protecting soybean plants from damage caused by herbicides or controlling weeds in fields where soybean plants are grown, comprising applying a dose of glufosinate-ammonium herbicide to a field where at least one transgenic soybean plant is grown, the transgenic soybean plant containing the sequence shown in SEQ ID NO:1 and / or SEQ ID NO:2 in its genome, the transgenic soybean plant being tolerant to glufosinate-ammonium herbicide.

[0050] Preferably, the transgenic soybean plant contains the sequences shown in SEQ ID NO:3 and / or SEQ ID NO:4 in its genome.

[0051] Preferably, the transgenic soybean plant contains, in sequence, the nucleic acid sequences of SEQ ID NO:1, SEQ ID NO:5 positions 866-12192, and SEQ ID NO:2 in its genome, or contains the sequence shown in SEQ ID NO:5.

[0052] To achieve the above objectives, the present invention also provides a method for cultivating soybean plants that are resistant to and / or tolerant to glufosinate-ammonium herbicides, comprising:

[0053] Plant at least one soybean seed, wherein the genome of the soybean seed contains a nucleic acid sequence encoding an insect resistance Cry2Ab protein and / or an insect resistance Cry1Ac protein and / or an encoder of a glufosinate-ammonium herbicide tolerance PAT protein, and a nucleic acid sequence of a specific region, or the genome of the soybean seed contains the nucleic acid sequence shown in SEQ ID NO:5;

[0054] The soybean seeds are then allowed to grow into soybean plants.

[0055] The soybean plants were attacked with target insects and / or sprayed with an effective dose of glufosinate herbicide, and the plants with reduced plant damage compared to other plants that do not have a specific region of nucleic acid sequence were harvested.

[0056] The nucleic acid sequence of the specific region is the sequence shown in SEQ ID NO:1 and / or SEQ ID NO:2; preferably, the nucleic acid sequence of the specific region is the sequence shown in SEQ ID NO:3 and / or SEQ ID NO:4.

[0057] To achieve the above objectives, the present invention also provides a method for generating soybean plants resistant to insects and / or resistant to glufosinate herbicide, comprising introducing a nucleic acid sequence encoding an insect resistance Cry2Ab protein and / or an insect resistance Cry1Ac protein and / or a glufosinate resistance PAT protein, and a nucleic acid sequence of a specific region contained in the genome of a first soybean plant, or introducing the nucleic acid sequence shown in SEQ ID NO:5 contained in the genome of the first soybean plant into a second soybean plant, thereby generating a large number of progeny plants; selecting the progeny plants having the nucleic acid sequence of the specific region, and the progeny plants being resistant to insects and / or resistant to glufosinate herbicide; the nucleic acid sequence of the specific region is the sequence shown in SEQ ID NO:1 and / or SEQ ID NO:2; preferably, the nucleic acid sequence of the specific region is the sequence shown in SEQ ID NO:3 and / or SEQ ID NO:4;

[0058] Preferably, the method includes sexually hybridizing a first soybean plant containing the transgenic soybean event DBN8205 with a second soybean plant to produce a large number of progeny plants, and selecting the progeny plants having the nucleic acid sequence of the specific region.

[0059] The progeny plants were attacked with target insects and / or treated with glufosinate-ammonium;

[0060] Select the progeny plants that are resistant to the target insects and / or tolerant to glufosinate herbicides.

[0061] To achieve the above objectives, the present invention also provides an agricultural product or commodity derived from a soybean plant containing the genetically modified soybean event DBN8205, wherein the agricultural product or commodity is lecithin, fatty acids, glycerol, sterols, soybean flakes, soybean flour, soybean protein or its concentrate, soybean oil, soybean protein fiber, soy milk curd or tofu.

[0062] To achieve the above objectives, the present invention also provides an agricultural product or commodity derived from a soybean plant containing the transgenic soybean event DBN8205, wherein the soybean plant further contains at least one other transgenic soybean event different from the transgenic soybean event DBN8205.

[0063] Preferably, the other genetically modified soybean events are genetically modified soybean event DBN9004 and / or genetically modified soybean event DBN8002.

[0064] To achieve the above objectives, the present invention also provides a method for expanding the spectrum of plant insect resistance and / or the range of herbicides tolerated, by expressing the transgenic soybean event DBN8205 in the plant together with at least one other transgenic soybean event different from DBN8205;

[0065] Preferably, the other genetically modified soybean events are genetically modified soybean event DBN9004 and / or genetically modified soybean event DBN8002.

[0066] The DBN9004 provided by this invention is the genetically modified soybean event disclosed in patent CN106086011A. The genetically modified soybean event DBN9004 is deposited in the form of seeds at the China General Microbiological Culture Collection Center with the accession number CGMCC No.11171.

[0067] The DBN8002 provided by this invention is a genetically modified soybean event disclosed in patent CN111406117A. The genetically modified soybean event DBN8002 is deposited in the form of seeds at the China General Microbiological Culture Collection Center with the accession number CGMCC No.17299.

[0068] In the present invention for detecting nucleic acid sequences of soybean plants and the detection method thereof, the following definitions and methods are intended to better define the present invention and guide those skilled in the art to implement the present invention. Unless otherwise stated, the terms shall be understood according to their conventional usage by those skilled in the art.

[0069] The term "soybean" refers to soybean (Glycine max) and includes all plant species that can interbreed with soybeans, including wild soybean species.

[0070] The terms “comprising,” “including,” or “containing” mean “including, but not limited to”.

[0071] The term "plant" includes the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can regenerate, plant callus, plant clumps, and complete plant cells in a plant or plant part, such as embryo, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It should be understood that parts of transgenic plants within the scope of this invention include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves, and roots, all of which are derived from transgenic plants or their progeny that have been previously transformed with the DNA molecules of this invention and are therefore at least partially composed of transgenic cells.

[0072] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including the regulatory sequence preceding the coding sequence (5' non-coding sequence) and the regulatory sequence following the coding sequence (3' non-coding sequence). A "natural gene" is a gene that is naturally found to have its own regulatory sequence. A "chimeric gene" is any gene that is not a natural gene but contains regulatory and coding sequences not naturally found. An "endogenous gene" is a natural gene located at its natural position in an organism's genome. A "foreign gene" is a foreign gene that is currently present in an organism's genome and was not originally present; it also refers to a gene introduced into a recipient cell through a transgenic process. Foreign genes can include natural genes inserted into non-natural organisms or chimeric genes. A "transgenic gene" is a gene that has been introduced into the genome through a transformation process. The site where recombinant DNA has been inserted into the plant genome can be called an "insertion site" or a "target site."

[0073] "Flanking DNA" can comprise the genome naturally present in organisms such as plants or exogenous (heterologous) DNA introduced through a transformation process, such as fragments associated with the transformation event. Therefore, flanking DNA can include a combination of natural and exogenous DNA. In this invention, "flanking DNA," also referred to as a "flanking region," "flanking sequence," "flanking genomic sequence," or "flanking genomic DNA," refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500, or 5000 base pairs or longer, located directly upstream or downstream of the initially exogenous inserted DNA molecule and adjacent to it. When the flanking region is downstream, it can also be referred to as a "3' flanking region" or "left boundary flanking region," etc. When the flanking region is upstream, it can also be referred to as a "5' flanking region" or "right boundary flanking region," etc.

[0074] Transformation procedures that induce random integration of exogenous DNA result in transformants containing distinct flanking regions, which are unique to each transformant. When recombinant DNA is introduced into plants via conventional hybridization, these flanking regions typically remain unchanged. Transformants also contain unique junctions between segments of the heterologous insert DNA and genomic DNA, or between two segments of genomic DNA, or between two segments of heterologous DNA. A "junction" is the point where two specific DNA segments join. For example, junctions exist where the insert DNA joins flanking DNA. Junction sites also exist in transformed organisms where two DNA segments are joined together in a manner modified from those found in natural organisms. A "junction region" or "junction sequence" refers to the DNA containing the junction site.

[0075] This invention provides a transgenic soybean event known as DBN8205 and its progeny, also referred to as soybean plant DBN8205, which includes the plant and seeds of transgenic soybean event DBN8205 and its plant cells or renewable parts thereof. The plant parts of transgenic soybean event DBN8205 include, but are not limited to, cells, pollen, ovules, flowers, buds, roots, stems, leaves, pods and products derived from soybean plant DBN8205, such as soybean meal, flour and oil, specifically lecithin, fatty acids, glycerol, sterols, edible oils, defatted soybean flakes, including defatted and roasted soybean flour, soy milk coagulant, tofu, soy protein concentrate, isolated soy protein, hydrolyzed plant protein, textured soy protein and soy protein fiber.

[0076] The present invention relates to a transgenic soybean event DBN8205, comprising a DNA construct that, when expressed in plant cells, acquires resistance to insects and tolerance to glufosinate-ammonium herbicide. The DNA construct comprises three tandem expression cassettes. The first expression cassette contains a suitable promoter for expression in plants, a nucleic acid sequence encoding a signal peptide / transporter peptide, a nucleic acid sequence encoding a Cry2Ab protein, and a suitable polyadenylation signal sequence, wherein the Cry2Ab protein is primarily resistant to lepidopteran insects. The second expression cassette contains a suitable promoter for expression in plants, a nucleic acid sequence encoding a signal peptide / transporter peptide, a nucleic acid sequence encoding a Cry1Ac protein, and a suitable polyadenylation signal sequence, wherein the Cry1Ac protein is also primarily resistant to lepidopteran insects. The third expression cassette contains a suitable promoter for expression in plants, a nucleic acid sequence encoding phosphinothricin N-acetyltransferase (PAT), and a suitable polyadenylation signal sequence, wherein the PAT protein is resistant to glufosinate herbicide. Further, the promoter can be a suitable promoter isolated from plants, including constitutive, inducible, and / or tissue-specific promoters, including but not limited to, cauliflower mosaic virus (CaMV) 35S promoter, Scrophularia mosaic virus (FMV) 35S promoter, ubiquitin promoter, actin promoter, and Agrobacterium tumefaciens promoter. The following promoters are used: *Nicotinamide adenocarboxylase* (NOS) promoter, *Octopine adenocarboxylase* (OCS) promoter, *Cestrum* yellow leaf curl virus promoter, *Patatin* potato tuber storage protein promoter, ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 promoter, GOS promoter, alcA / alcR promoter, *Agrobacterium rhizogenes* RolD promoter, and *Arabidopsis thaliana* Suc2 promoter. These signal peptides / transport peptides can guide the transport of Cry2Ab and / or Cry1Ac proteins to specific organelles or compartments within the cell, for example, targeting chloroplasts using sequences encoding chloroplast transport peptides, or targeting the endoplasmic reticulum using the 'KDEL' preserved sequence.The polyadenylation signal sequence can be a suitable polyadenylation signal sequence that functions in plants. The suitable polyadenylation signal sequence includes, but is not limited to, polyadenylation signal sequences derived from the Agrobacterium tumefaciens cauliflower mosaic virus (CaMV) 35S terminator, polyadenylation signal sequences derived from the protease inhibitor II (PINII) gene, and polyadenylation signal sequences derived from the α-tubulin gene.

[0077] In addition, the expression cassette may also include other genetic elements, including but not limited to enhancers. These enhancers can amplify gene expression levels and include, but are not limited to, tobacco etching virus (TEV) translation activator, CaMV35S enhancer, and FMV35S enhancer.

[0078] Cry2Ab and Cry1Ac are two types of insecticidal proteins, insoluble parasporal crystalline proteins produced by Bacillus thuringiensis (Bt). When ingested by insects, either Cry2Ab or Cry1Ac protein enters the midgut. The protoxin dissolves in the alkaline pH environment of the midgut. The N- and C-termini of the protein are digested by alkaline proteases, converting the protoxin into active fragments. These active fragments bind to receptors on the surface of the midgut epithelial cell membrane, inserting into the intestinal membrane and causing perforation lesions. This disrupts the osmotic pressure changes and pH balance across the cell membrane, interfering with the insect's digestive process and ultimately leading to death.

[0079] The order "Lepidoptera" includes moths and butterflies, and is the order with the most agricultural and forestry pests, such as cutworms, bollworms, beet armyworms, two-spotted cutworms, and peach borers.

[0080] The phosphinothricin N-acetyltransferase (PAT) gene can be an enzyme isolated from *Streptomyces viridochromogenes* strains, which catalyzes the acetylation of L-phosphinothricin to its inactive form, thereby conferring plant tolerance to glufosinate herbicides. Phosphinothricin (PTC, 2-amino-4-methylphosphonobutyrate) is an inhibitor of glutamine synthetase. PTC is the structural unit of the antibiotic 2-amino-4-methylphosphono-alanyl-alanine; this tripeptide (PTT) possesses activity against Gram-positive and Gram-negative bacteria, as well as against the fungus *Botrytis cinerea*. The phosphinothricin N-acetyltransferase (PAT) gene can also serve as a selective marker gene.

[0081] The term "glufosinate," also known as glufosinate-butanol, refers to ammonium 2-amino-4-[hydroxy(methyl)phosphono]butyrate. Treatment with "glufosinate herbicide" means treatment with any herbicide formulation containing glufosinate. The selection of the application rate of a particular glufosinate formulation to achieve an effective biological dosage shall not exceed the skill level of a general agronomist. Treatment of fields containing plant material derived from the DBN8205 genetically modified soybean event using any glufosinate-containing herbicide formulation will control weed growth in the fields without affecting the growth or yield of the plant material derived from the DBN8205 genetically modified soybean event.

[0082] The DNA construct is introduced into plants using transformation methods, including but not limited to Agrobacterium-mediated transformation, gene gun transformation, and pollen tube pathway transformation.

[0083] Agrobacterium-mediated transformation is a commonly used method for plant transformation. Exogenous DNA to be introduced into the plant is cloned into the T-DNA region between the common sequences on the left and right boundaries of a vector. The vector is then transformed into Agrobacterium cells, which are subsequently used to infect plant tissues, whereby the T-DNA region of the vector containing the exogenous DNA is inserted into the plant genome.

[0084] The gene gun transformation method refers to bombarding plant cells with a vector containing exogenous DNA (particle-mediated biological bombardment transformation).

[0085] The pollen tube pathway transformation method utilizes the natural pollen tube pathway (also known as pollen tube guiding tissue) formed after plant pollination to carry exogenous DNA into the embryo sac via the nucellus pathway.

[0086] After transformation, transgenic plants must be regenerated from the transformed plant tissues, and offspring with exogenous DNA must be selected using appropriate markers.

[0087] DNA constructs are combinations of interconnected DNA molecules that provide one or more expression cassettes. Preferably, the DNA constructs are plasmids capable of self-replication within bacterial cells and containing various restriction endonuclease sites for introducing DNA molecules that provide functional genetic elements, i.e., promoters, introns, leader sequences, coding sequences, 3' terminator regions, and other sequences. The expression cassettes contained in the DNA constructs include genetic elements necessary for the transcription of messenger RNA, and these cassettes can be designed for expression in prokaryotic or eukaryotic cells. The expression cassettes of the present invention are designed, most preferably, for expression in plant cells.

[0088] A transgenic “event” is obtained by transforming plant cells with a heterologous DNA construct, which includes at least one nucleic acid expression cassette containing the target gene, inserted into the plant genome via transgenic methods to generate a plant population, regenerate the plant population, and select specific plants with characteristics of the insertion site in the specific genome. The term “event” refers to the original transformant containing heterologous DNA and its offspring. The term “event” also refers to the offspring obtained by sexual hybridization between the original transformant and other varietal individuals containing heterologous DNA, where, even after repeated backcrossing with a backcross parent, the inserted DNA and flanking genomic DNA from the original transformant parent are present at the same chromosomal location in the hybrid offspring. The term “event” also refers to a DNA sequence from the original transformant containing the inserted DNA and flanking genomic sequences closely adjacent to the inserted DNA, which is intended to be transferred to offspring produced by sexual hybridization of a parental line containing the inserted DNA (e.g., the original transformant and its self-crossed offspring) with a parental line not containing the inserted DNA, and the offspring receiving the inserted DNA containing the target gene.

[0089] In this invention, "recombination" refers to a form of DNA and / or protein and / or organism that is not normally found in nature and is therefore produced through artificial intervention. Such artificial intervention can produce recombinant DNA molecules and / or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two sequence segments that are otherwise separate, for example, by chemical synthesis or by manipulating isolated nucleic acid segments using genetic engineering techniques. Techniques for manipulating nucleic acids are well known.

[0090] The term "transgenic" includes any cell, cell line, callus, tissue, plant part, or plant whose genotype has been altered due to the presence of a heterologous nucleic acid. "Transgenic" includes the original transgenic organism that was so altered, as well as offspring individuals generated from the original transgenic organism through sexual hybridization or asexual reproduction. In this invention, the term "transgenic" does not include genomic (chromosomal or extrachromosomal) alterations achieved through conventional plant breeding methods or naturally occurring events such as random allogeneic fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.

[0091] In this invention, "heterogeneous" means that the first molecule is not typically found to combine with the second molecule in nature. For example, a molecule may originate from a first species and be inserted into the genome of a second species. Therefore, such a molecule is heterologous to the host and is artificially introduced into the host cell's genome.

[0092] A method for generating a transgenic soybean event DBN8205 that is resistant to lepidopteran insects and tolerant to glufosinate herbicide comprises the following steps: First, sexually hybridizing a first parent soybean plant with a second parent soybean plant to produce a variety of first-generation progeny plants. The first parent soybean plant consists of soybean plants bred from the transgenic soybean event DBN8205 and its progeny, which are obtained by transformation using the expression cassette of the present invention that is resistant to lepidopteran insects and tolerant to glufosinate herbicide. The second parent soybean plant lacks resistance to lepidopteran insects and / or is tolerant to glufosinate herbicide. Then, progeny plants that are resistant to lepidopteran insect invasion and / or tolerant to glufosinate herbicide are selected to produce soybean plants that are resistant to lepidopteran insects and tolerant to glufosinate herbicide. These steps may further include backcrossing progeny plants that are lepidopteran-resistant and / or glufosinate-tolerant with a second or third parent soybean plant, and then selecting progeny by lepidopteran invasion, glufosinate-applied herbicide application, or by identification through trait-related molecular markers (such as DNA molecules containing the 5' and 3' junction sites identified in the inserted sequence in transgenic soybean event DBN8205), thereby producing soybean plants that are lepidopteran-resistant and glufosinate-tolerant.

[0093] It should also be understood that two different transgenic plants can mate to produce offspring containing two independent, segregated foreign genes. Self-pollination of appropriate offspring can yield plants that are homozygous for both added foreign genes. Backcrossing of parental plants and heteromorphic hybridization with non-transgenic plants, as mentioned above, are also to be expected, as is asexual reproduction.

[0094] The term "probe" refers to a segment of isolated nucleic acid molecule bound with a conventionally detectable marker or reporter molecule, such as a radioisotope, ligand, chemiluminescent agent, or enzyme. This probe is complementary to one strand of the target nucleic acid. In this invention, the probe is complementary to one strand of the genome of the transgenic soybean event DBN8205, regardless of whether the genomic DNA originates from the transgenic soybean event DBN8205, its seeds, or derived from the plant, seeds, or extracts of the transgenic soybean event DBN8205. The probes of this invention include not only deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), but also polyamides and other probe materials that specifically bind to the target DNA sequence and can be used to detect the presence of that target DNA sequence.

[0095] The term "primer" refers to a segment of isolated nucleic acid molecule that binds to a complementary target DNA strand through nucleic acid hybridization and annealing, forming a hybrid between the primer and the target DNA strand, and then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pairs of this invention relate to their application in the amplification of target nucleic acid sequences, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0096] The probes and primers are typically 11 polynucleotides or longer, preferably 18 polynucleotides or longer, more preferably 24 polynucleotides or longer, and most preferably 30 polynucleotides or longer. These probes and primers specifically hybridize to the target sequence under highly stringent hybridization conditions. Although probes that differ from the target DNA sequence and maintain hybridization ability to the target DNA sequence can be designed using conventional methods, preferably, the probes and primers of this invention have complete DNA sequence identity with the continuous nucleic acid of the target sequence.

[0097] Primers and probes for the flanking genomic DNA and insert sequences based on the present invention can be determined using conventional methods, for example, by isolating the corresponding DNA molecules from plant material derived from the transgenic soybean event DBN8205 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule contains the transgenic insert sequence and the soybean genome flanking sequence, and fragments of the DNA molecule can be used as primers or probes.

[0098] The nucleic acid probes and primers of this invention hybridize with target DNA sequences under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from the transgenic soybean event DBN8205 in a sample. Nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules under certain conditions. As used in this invention, if two nucleic acid molecules can form antiparallel double-stranded nucleic acid structures, it can be said that the two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules exhibit perfect complementarity, one nucleic acid molecule is said to be a "complement" of the other nucleic acid molecule. As used in this invention, when every nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "perfect complementarity". If two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under at least conventional "low stringent" conditions, the two nucleic acid molecules are said to be "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under conventional "high stringent" conditions, the two nucleic acid molecules are said to be "complementary". Deviations from perfect complementarity are permissible, as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. For a nucleic acid molecule to function as a primer or probe, it only needs to be sufficiently complementary in sequence to form a stable double-stranded structure under the specific solvent and salt concentration used.

[0099] As used in this invention, the substantially homologous sequence is a nucleic acid molecule that, under highly stringent conditions, can specifically hybridize with the complementary strand of a matching nucleic acid molecule. Suitable stringent conditions for promoting DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C followed by washing with 2.0× SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from approximately 2.0× SSC, 50°C for low-stringent conditions to approximately 0.2× SSC, 50°C for high-stringent conditions. Furthermore, the temperature conditions in the washing step can be increased from approximately 22°C (room temperature) for low-stringent conditions to approximately 65°C for high-stringent conditions. Both the temperature conditions and the salt concentration can be changed, or one can remain constant while the other is changed. Preferably, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences, under moderately stringent conditions, such as about 2.0 × SSC and about 65°C. More preferably, a nucleic acid molecule of the present invention can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences, under highly stringent conditions. In the present invention, preferred marker nucleic acid molecules have SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, or SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences. Another preferred marker nucleic acid molecule of the present invention has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or their complementary sequences, or any fragment of the above sequences. SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 can be used as markers in plant breeding methods to identify offspring of genetic hybridization. Hybridization of the probe with the target DNA molecule can be detected by any method well known to those skilled in the art, including but not limited to fluorescent labeling, radioactive labeling, antibody labeling and chemiluminescent labeling.

[0100] Regarding amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "strict conditions" refer to conditions in which primers are allowed to hybridize only with the target nucleic acid sequence during a DNA thermal amplification reaction. Primers having a wild-type sequence (or its complementary sequence) corresponding to the target nucleic acid sequence are able to bind to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.

[0101] The term "specific binding (target sequence)" means that, under strict hybridization conditions, the probe or primer hybridizes only with the target sequence in a sample containing the target sequence.

[0102] As used in this invention, "amplifier" refers to the nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether soybean plants are produced by sexual hybridization from the transgenic soybean event DBN8205 of this invention, or whether soybean samples collected from the field contain the transgenic soybean event DBN8205, or whether soybean extracts, such as flour, wheat flour, or oil, contain the transgenic soybean event DBN8205, DNA extracted from soybean plant tissue samples or extracts can be amplified using a primer pair nucleic acid amplification method to generate an amplifier that is diagnostic for the presence of DNA related to the transgenic soybean event DBN8205. The primer pair includes a first primer derived from a flanking sequence in the plant genome adjacent to the insertion site of the foreign DNA, and a second primer derived from the inserted foreign DNA. The amplifier has a specific length and sequence that is also diagnostic for the transgenic soybean event DBN8205. The length of the amplicon can be the binding length of the primer pair plus one nucleotide base pair, preferably about 50 nucleotide base pairs, more preferably about 250 nucleotide base pairs, and most preferably about 450 nucleotide base pairs or more.

[0103] Optionally, primer pairs can be derived from flanking genomic sequences on either side of the inserted DNA to produce an amplicon comprising the entire inserted nucleotide sequence. One of the primer pairs derived from plant genome sequences can be located at a distance from the inserted DNA sequence, ranging from one nucleotide base pair to approximately 20,000 nucleotide base pairs. The use of the term "amplicon" specifically excludes primer dimers formed during thermal amplification of DNA.

[0104] Nucleic acid amplification reactions can be performed using any nucleic acid amplification method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify up to 22 kb of genomic DNA and up to 42 kb of phage DNA. These methods, as well as other DNA amplification methods in the art, can be used in this invention. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic soybean event DBN8205 can be used to amplify the genome of the transgenic soybean event DBN8205 using the provided primer sequences, followed by standard DNA sequencing of the PCR amplicons or cloned DNA.

[0105] DNA detection kits based on DNA amplification methods contain DNA molecules used as primers that specifically hybridize to target DNA and amplify diagnostic amplicones under appropriate reaction conditions. The kits provide agarose gel-based detection methods or many other methods known in the art for detecting diagnostic amplicones. Kits containing DNA primers homologous to or complementary to any portion of the soybean genome of SEQ ID NO:3 or SEQ ID NO:4, and homologous to or complementary to any portion of the transgenic insertion region of SEQ ID NO:5, are provided by this invention. Primer pairs particularly useful in DNA amplification methods are SEQ ID NO:8 and SEQ ID NO:9, which amplify diagnostic amplicones homologous to a portion of the 5' transgenic / genomic region of the transgenic soybean event DBN8205, wherein the amplicon includes SEQ ID NO:1. Other DNA molecules used as DNA primers may be selected from SEQ ID NO:5.

[0106] The amplicon generated by these methods can be detected using a variety of techniques. One such method is Genetic Bit Analysis, which involves designing a DNA oligonucleotide chain that spans the insert DNA sequence and adjacent flanking genomic DNA sequences. This oligonucleotide chain is immobilized within the wells of a microplate. After PCR amplification of the target region (using one primer each in the insert sequence and adjacent flanking genomic sequences), the single-stranded PCR product hybridizes with the immobilized oligonucleotide chain and serves as a template for a single-base extension reaction using DNA polymerase and ddNTPs specifically labeled for the next expected base. Results can be obtained using fluorescence or ELISA-like methods. The signal indicates the presence of the insert / flanking sequence, signifying successful amplification, hybridization, and single-base extension.

[0107] Another method is pyrosequencing. This method designs an oligonucleotide chain that spans the insertion DNA sequence and the binding site of adjacent genomic DNA. This oligonucleotide chain is hybridized with single-stranded PCR products of the target region (using one primer each within the insertion sequence and in adjacent flanking genomic sequences), and then incubated with DNA polymerase, ATP, thioacylase, luciferase, adenosine triphosphate diphosphatase, adenosine-5'-phosphate sulfate, and luciferin. dNTPs are added separately, and the resulting light signal is measured. The light signal represents the presence of the insertion / flanking sequence, indicating that amplification, hybridization, and single- or multi-base extension reactions were successful.

[0108] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) can also be used to detect the amplicon of this invention. This method requires designing an oligonucleotide chain that spans the insertion DNA sequence and the binding site of adjacent genomic DNA. This oligonucleotide chain is hybridized with a single-stranded PCR product of the target region (using one primer within the insertion sequence and one primer in adjacent flanking genomic sequences), and then incubated with DNA polymerase and a fluorescently labeled ddNTP. Single-base extension results in the insertion of the ddNTP. This insertion can be measured using a fluorometer to determine the change in polarization. The change in polarization indicates the presence of the insertion / flanking sequence, signifying that the amplification, hybridization, and single-base extension reactions were successful.

[0109] Taqman is described as a method for detecting and quantifying the presence of DNA sequences, detailed in the manufacturer's instructions for use. Briefly, a FRET oligonucleotide probe is designed to bind across the insert DNA sequence and adjacent flanking genomic regions. This FRET probe and PCR primers (one primer within the insert sequence and one primer in adjacent flanking genomic sequences) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the splitting of the fluorescent and quenched portions of the probe, and the release of the fluorescent portion. The generation of a fluorescent signal indicates the presence of the insert / flanking sequence, signifying successful amplification and hybridization.

[0110] Based on the principle of hybridization, suitable techniques for detecting plant material derived from the DBN8205 transgenic soybean event can also include Southern blot, Northern blot, and in situ hybridization. Specifically, these suitable techniques include incubating the probe and sample, washing to remove unbound probes, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe; for example, radiolabeled probes can be detected by X-ray exposure and development, or enzyme-labeled probes can be detected by color changes achieved through substrate transformation.

[0111] Tyangi et al. (Nature Biotech. 14:303-308, 1996) described the application of molecular markers in sequence detection. Briefly, a FRET oligonucleotide probe was designed that spans the insertion DNA sequence and the adjacent flanking genomic region. The unique structure of this FRET probe results in a secondary structure that allows for the retention of fluorescent and quenched portions in close proximity. The FRET probe and PCR primers (one primer within the insertion sequence and one primer in the adjacent flanking genomic sequence) were cyclically reacted in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe and the target sequence leads to the loss of the probe's secondary structure, causing spatial separation of the fluorescent and quenched portions and generating a fluorescent signal. The generation of the fluorescent signal indicates the presence of the insertion / flanking sequence, signifying successful amplification and hybridization.

[0112] Other described methods, such as microfluidics, provide methods and devices for isolating and amplifying DNA samples. Optical dyes are used to detect and determine specific DNA molecules. Nanotube devices containing electronic sensors for detecting DNA molecules or nanobeads that bind specific DNA molecules and are thus detectable are useful for detecting the DNA molecules of this invention.

[0113] DNA detection kits can be developed using the compositions described in this invention and methods described or known in the field of DNA detection. These kits are advantageous for identifying the presence of DNA related to the transgenic soybean event DBN8205 in samples and can also be used to cultivate soybean plants containing DNA from the transgenic soybean event DBN8205. The kits may contain DNA primers or probes homologous to or complementary to at least a portion of SEQ ID NO: 1, 2, 3, 4, or 5, or other DNA primers or probes homologous to or complementary to DNA contained in transgenic genetic elements of DNA. These DNA sequences can be used for DNA amplification reactions or as probes in DNA hybridization methods. [The text then abruptly shifts to a seemingly unrelated topic:] ...contained in the soybean genome and in... Figure 1 The DNA structure at the site of the transgenic insertion sequence binding to the soybean genome, as described in Table 1, comprises: a portion of the insertion sequence from the right boundary region (RB) of the soybean plant DBN8205 located at the 5' end of the transgenic insertion sequence; the first expression cassette consists of the Arabidopsis ACT2 promoter (prAtAct2-01), operably linked to the Arabidopsis chloroplast transport peptide gene (spAtCTP2), operably linked to the Bacillus thuringiensis insect resistance cCry2Ab gene, and operably linked to the terminator (tPsE9) of the pea RbcS gene; the second expression cassette consists of the Arabidopsis ribulose 1,5-bisphosphate carboxylase small subunit gene promoter (prAtRbcS4), operably linked to the Arabidopsis thuringiensis ACT2 promoter (prAtRbcS4). The first expression cassette consists of a small subunit gene of mustard ribulose 1,5-bisphosphate carboxylase, a chloroplast transport peptide gene (spAtRbcS4), operably linked to the insect resistance cCry1Ac gene of Bacillus thuringiensis, and operably linked to the transcription terminator (tNos) of the carmine synthase gene; the second expression cassette consists of a portion of the insert sequence from the left border region (LB) of Agrobacterium, and the flanking genomic region of soybean plant DBN8205 located at the 3' end of the transgenic insert sequence (SEQ ID NO:5). In the DNA amplification method, the DNA molecule used as a primer can be any part of the transgenic insertion sequence from the transgenic soybean event DBN8205, or any part of the flanking DNA sequence of the soybean genome from the transgenic soybean event DBN8205.

[0114] The transgenic soybean event DBN8205 can be combined with other transgenic soybean varieties, such as herbicide-tolerant transgenic soybean varieties (e.g., glyphosate, dicamba, etc.) or transgenic soybean varieties carrying other insect-resistant genes. Various combinations of all these different transgenic events, bred together with the transgenic soybean event DBN8205 of this invention, can provide improved hybrid transgenic soybean varieties resistant to multiple insect pests and multiple herbicides. These varieties can exhibit superior characteristics compared to non-transgenic varieties and single-trait transgenic varieties.

[0115] For example, this invention provides a superimposed transgenic soybean event DBN8205 x DBN8002 x DBN9004, obtained through hybridization of DBN8205, DBN8002, and DBN9004. The superimposed transgenic soybean event DBN8205 x DBN8002 x DBN9004 includes the cCry2Ab, cCry1Ac, cPAT, cVip3Aa, and cEPSPS genes inserted at specific sites within the soybean cell genome. It effectively controls major lepidopteran pests of soybean in South America (Argentina and Brazil) and China through three insect-resistant mechanisms. Furthermore, the cPAT and cEPSPS genes in the superimposed transgenic soybean event can confer tolerance to glufosinate and glyphosate herbicides on soybean plants without affecting yield.

[0116] The term "superposition" refers to combining at least two transgenic events possessing the desired trait into the same plant. Superposition of transgenic events is achieved by crossing parents with transgenic events possessing the desired trait and then identifying offspring possessing all of those desired traits. Superposition of transgenic events can be used to combine two or more different traits, including, for example, two or more different insect resistance traits, two or more herbicide resistance traits, and / or insect resistance and herbicide resistance traits.

[0117] The superimposed transgenic soybean event DBN8205 x DBN8002 x DBN9004 described in this invention, also known as soybean plant DBN8205 x DBN8002 x DBN9004, includes the plant and seeds of the superimposed transgenic soybean event DBN8205 x DBN8002 x DBN9004, as well as their plant cells or renewable parts thereof. The plant parts of the superimposed transgenic soybean event DBN8205 x DBN8002 x DBN9004 include, but are not limited to, cells, pollen, ovules, flowers, buds, roots, stems, leaves, pods, and products from the superimposed transgenic soybean event DBN8205 x DBN8002 x DBN9004, such as soybean meal, flour, and oil. Specifically, these can be lecithin, fatty acids, glycerol, sterols, edible oil, defatted soybean flakes, including defatted and roasted soybean flour, soy milk coagulant, tofu, soy protein concentrate, isolated soy protein, hydrolyzed plant protein, textured soy protein, and soy protein fiber.

[0118] The present invention relates to the transgenic soybean species DBN8205, which is resistant to feeding damage from lepidopteran pests and tolerant to the phytotoxic effects of glufosinate-containing agricultural herbicides. This dual-trait soybean plant expresses the Cry2Ab and Cry1Ac proteins of Bacillus thuringiensis, providing resistance to feeding damage from lepidopteran pests, and expresses the glufosinate-resistant phosphatidylin N-acetyltransferase (PAT) protein of Streptomyces, conferring tolerance to glufosinate. The dual-trait soybean offers the following advantages: 1) protection from economic losses caused by lepidopteran pests (such as bollworm, beet armyworm, and cutworm), which are major pests in soybean-growing areas; 2) the ability to apply glufosinate-containing agricultural herbicides to soybean crops for broad-spectrum weed control; and 3) no reduction in soybean yield. Furthermore, the transgenes encoding insect resistance and glufosinate tolerance are linked to the same DNA segment and exist at a single locus in the genome of the transgenic soybean event DBN8205. This provides enhanced breeding efficiency and enables the use of molecular markers to track transgene insertions in breeding populations and their progeny. Simultaneously, the detection method of this invention uses SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, or SEQ ID NO:7 or its complementary sequence as DNA primers or probes to generate amplification products that diagnose the transgenic soybean event DBN8205 or its progeny, and can rapidly, accurately, and stably identify the presence of plant material derived from the transgenic soybean event DBN8205.

[0119] Sequence Summary

[0120] SEQ ID NO:1 In the transgenic soybean event DBN8205, there is a 22-nucleotide sequence at the 5' end of the insertion sequence near the insertion junction, wherein nucleotides 1-11 and 12-22 are located on either side of the insertion site on the soybean genome;

[0121] SEQ ID NO:2 In the transgenic soybean event DBN8205, there is a 22-nucleotide sequence at the 3' end of the insertion sequence near the insertion junction, wherein nucleotides 1-11 and 12-22 are located on either side of the insertion site on the soybean genome;

[0122] SEQ ID NO:3 A 634-nucleotide sequence in the genetically modified soybean event DBN8205, located near the insertion junction at the 5' end of the inserted sequence;

[0123] SEQ ID NO:4 A 642-nucleotide sequence in the genetically modified soybean event DBN8205, located near the insertion junction at the 3' end of the inserted sequence;

[0124] SEQ ID NO:5 The entire T-DNA sequence, and the soybean genome flanking sequences at the 5' and 3' ends;

[0125] SEQ ID NO:6 spans the pDBN4031 construct DNA sequence and the prAtAct2-01 transcription initiation sequence;

[0126] SEQ ID NO:7 spans the t35S transcription terminator sequence and the pDBN4031 construct DNA sequence;

[0127] SEQ ID NO:8 amplifies the first primer of SEQ ID NO:3;

[0128] SEQ ID NO:9 amplifies the second primer of SEQ ID NO:3;

[0129] SEQ ID NO:10 amplifies the first primer of SEQ ID NO:4;

[0130] SEQ ID NO:11 amplifies the second primer of SEQ ID NO:4;

[0131] Primers on the 5' flanking genome sequence of SEQ ID NO:12;

[0132] Primers located on T-DNA that pair with SEQ ID NO:13 and SEQ ID NO:12;

[0133] The primer on the 3' flanking genome sequence of SEQ ID NO:14, when paired with SEQ ID NO:12, can detect whether the transgene is homozygous or heterozygous;

[0134] Primers located on T-DNA that pair with SEQ ID NO:15 and SEQ ID NO:14;

[0135] SEQ ID NO:16 The first primer for Taqman detection of the cCry2Ab gene;

[0136] SEQ ID NO:17 The second primer for Taqman detection of the cCry2Ab gene;

[0137] SEQ ID NO:18 Taqman probe for detecting the cCry2Ab gene;

[0138] SEQ ID NO:19 The first primer for Taqman detection of the cCry1Ac gene;

[0139] SEQ ID NO:20 The second primer for Taqman detection of the cCry1Ac gene;

[0140] SEQ ID NO:21 Taqman probe for detecting the cCry1Ac gene;

[0141] SEQ ID NO:22 The first primer for Taqman detection of the cPAT gene;

[0142] SEQ ID NO:23 The second primer for Taqman detection of the cPAT gene;

[0143] SEQ ID NO:24 Taqman probe for detecting the cPAT gene;

[0144] SEQ ID NO:25 First primer for the soybean endogenous gene lectin;

[0145] SEQ ID NO:26 The second primer for the soybean endogenous gene lectin;

[0146] SEQ ID NO:27 Probe for detecting the cCry2Ab gene in Southern hybridization;

[0147] SEQ ID NO:28 Probe for detecting the cCry1Ac gene in Southern hybridization;

[0148] SEQ ID NO:29 Probe for detecting the cPAT gene in Southern hybridization;

[0149] The primer in SEQ ID NO:30 located on the T-DNA is aligned with the direction of SEQ ID NO:13;

[0150] The primer in SEQ ID NO:31 located on the T-DNA is aligned with the direction of SEQ ID NO:15;

[0151] SEQ ID NO:32 is the primer located on the T-DNA, in the opposite direction to SEQ ID NO:13;

[0152] The primer in SEQ ID NO:33 is located on the T-DNA and is in the opposite direction to that in SEQ ID NO:13;

[0153] SEQ ID NO:34 is the primer located on the T-DNA, in the opposite direction to SEQ ID NO:15;

[0154] SEQ ID NO:35 is the primer located on the T-DNA, in the opposite direction to SEQ ID NO:15;

[0155] SEQ ID NO:36 Nucleotide sequence of prAtAct2-02 on recombinant expression vector pDBN4032;

[0156] SEQ ID NO:37 Nucleotide sequence of tOsMth on recombinant expression vector pDBN4032;

[0157] SEQ ID NO:38 Nucleotide sequence of tMtPt1 on recombinant expression vector pDBN4032.

[0158] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0159] Figure 1 This is a schematic diagram of the structure of the transgenic insertion sequence and the junction of the soybean genome in the present invention for detecting the nucleic acid sequence of soybean plant DBN8205 and its detection method, and a schematic diagram of the relative position of the nucleic acid sequence for detecting soybean plant DBN8205 (the relative position diagram is referenced from Wm82.a4 RefGen).

[0160] Figure 2 This is a schematic diagram of the recombinant expression vector pDBN4031 used in the present invention for detecting the nucleic acid sequence of soybean plant DBN8205 and the detection method thereof;

[0161] Figure 3 This is a schematic diagram of the structure of the recombinant expression vector pDBN4032 of the present invention;

[0162] Figure 4 This is a field image showing the effects of the genetically modified soybean DBN8205 under natural bollworm occurrence conditions.

[0163] Figure 5 This is a field image showing the effects of the genetically modified soybean DBN8205 under natural occurrence conditions of the beet armyworm.

[0164] Figure 6 This is a field image showing the effects of the genetically modified soybean DBN8205 under natural occurrence conditions of the silver-striped armyworm.

[0165] Figure 7 This is a field image showing the effects of the genetically modified soybean DBN8205 in Region 1 under natural occurrence of the soybean pod borer. Detailed Implementation

[0166] The technical solution of the present invention for detecting the nucleic acid sequence of soybean plant DBN8205 and its detection method is further illustrated below through specific embodiments.

[0167] First Implementation Example: Cloning and Transformation

[0168] 1.1 Vector Cloning

[0169] The recombinant expression vector pDBN4031 was constructed using standard gene cloning techniques. Figure 2 (As shown). The vector pDBN4031 contains three tandem transgenic expression cassettes. The first expression cassette consists of the Arabidopsis ACT2 promoter (prAtAct2-01), operably linked to the Arabidopsis chloroplast transport peptide gene (spAtCTP2), operably linked to the Bacillus thuringiensis insect resistance cCry2Ab gene, and operably linked to the terminator (tPsE9) of the pea RbcS gene. The second expression cassette consists of the Arabidopsis ribulose 1,5-bisphosphate carboxylase small subunit gene promoter (prAtRbcS4), operably linked to the Arabidopsis thuringiensis gene. The first expression cassette consists of a ribulose-1,5-bisphosphate carboxylase small subunit gene chloroplast transport peptide gene (spAtRbcS4) operably linked to the insect resistance cCry1Ac gene of Bacillus thuringiensis and operably linked to the transcription terminator (tNos) of the carmine synthase gene. The second expression cassette consists of a cauliflower mosaic virus 35S promoter (pr35S) operably linked to the streptomyces glufosinate-resistant phosphatidylin N-acetyltransferase gene (cPAT) and operably linked to the cauliflower mosaic virus 35S terminator (t35S).

[0170] The recombinant expression vector pDBN4032 was constructed using standard gene cloning techniques. Figure 3(As shown). The vector pDBN4032 contains three tandem transgenic expression cassettes. The first expression cassette is operatively linked to the Arabidopsis thaliana ACT2 promoter (prAtAct2-02) (SEQ ID NO:36) to the Arabidopsis thaliana chloroplast transport peptide gene (spAtCTP2), operatively linked to the Bacillus thuringiensis insect resistance cCry2Ab gene, and operatively linked to the metallothionein-like protein gene transcription terminator (tOsMth) (SEQ ID NO:36). The first expression cassette consists of the following components: the first cassette consists of the Arabidopsis ribulose 1,5-bisphosphate carboxylase small subunit gene promoter (prAtRbcS4), operably linked to the Arabidopsis ribulose 1,5-bisphosphate carboxylase small subunit gene chloroplast transport peptide gene (spAtRbcS4), operably linked to the Bacillus thuringiensis insect resistance cCry1Ac gene, and operably linked to the alfalfa phosphate transporter 1 gene transcription terminator (tMtPt1) (SEQ ID NO:38); the second expression cassette consists of the following components: the first cassette consists of the Arabidopsis thuringiensis ribulose 1,5-bisphosphate carboxylase small subunit gene promoter (prAtRbcS4), operably linked to the Arabidopsis thuringiensis ribulose 1,5-bisphosphate carboxylase small subunit gene chloroplast transport peptide gene (spAtRbcS4), operably linked to the Bacillus thuringiensis insect resistance cCry1Ac gene, and operably linked to the alfalfa phosphate transporter 1 gene transcription terminator (tMtPt1) (SEQ ID NO:38); the third expression cassette consists of the following components: the third expression cassette consists of the following components: the third expression cassette consists of the following components: the fourth expression cassette consists of the following components: the fifth expression cassette consists of the following components: the sixth expression cassette consists of the following components: the seventh expression cassette consists of the following components: the eighth ...

[0171] The vectors pDBN4031 and pDBN4032 were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) using liquid nitrogen, and the transformed cells were screened using 4-[hydroxy(methyl)phosphono]-DL-hoalanine as a selectable marker.

[0172] 1.2 Plant Transformation

[0173] Transformation was performed using the conventional Agrobacterium infection method. Aseptically cultured soybean cotyledonary tissue was co-cultured with Agrobacterium containing the vector pDBN4031 described in Example 1.1 to transfer the T-DNA in the constructed recombinant expression vector pDBN4031 into the soybean chromosome, thereby generating transgenic soybean containing the recombinant expression vector pDBN4031.

[0174] Following the above method, aseptically cultured soybean cotyledonary node tissue was co-cultured with Agrobacterium containing the vector pDBN4032 in Example 1.1 to transfer the T-DNA in the constructed recombinant expression vector pDBN4032 into the soybean chromosome, thereby generating transgenic soybean containing the recombinant expression vector pDBN4032.

[0175] For Agrobacterium-mediated soybean transformation, in brief, mature soybean seeds (Jack variety) were germinated in soybean germination medium (3.1 g / L B5 salt, B5 vitamin, 20 g / L sucrose, 8 g / L agar, pH 5.6). Seeds were inoculated onto the germination medium and cultured under the following conditions: temperature 25 ± 1℃; photoperiod (light / dark) 16 / 8 h. After 4-6 days of germination, fresh, green, swollen, sterile soybean seedlings were harvested. The hypocotyl was removed 3-4 mm below the cotyledon node, the cotyledons were longitudinally cut open, and the terminal bud, lateral buds, and seed roots were removed. A wound is made at the cotyledonary node using the back of a scalpel. The wounded cotyledonary node tissue is then contacted with an Agrobacterium suspension. Agrobacterium can deliver the nucleotide sequences of the cCry2Ab, cCry1Ac, and cPAT genes from pDBN4031 (or the cCry2Ab, cCry1Ac, and cPAT genes from pDBN4032) to the wounded cotyledonary node tissue (Step 1: Infection Step). In this step, the cotyledonary node tissue is preferably immersed in an Agrobacterium suspension (OD). 660=0.5-0.8, infection was initiated in an infection medium (MS salt 2.15 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, acetylsuccinone (AS) 40 mg / L, 2-morpholinoethanesulfonic acid (MES) 4 g / L, zeatin (ZT) 2 mg / L, pH 5.3). The cotyledonary tissue was co-cultured with Agrobacterium for a period (3 days) (step 2: co-culture step). Preferably, after the infection step, the cotyledonary tissue was cultured on a solid medium (MS salt 4.3 g / L, vitamin B5, sucrose 20 g / L, glucose 10 g / L, MES 4 g / L, ZT 2 mg / L, agar 8 g / L, pH 5.6). Following this co-culture phase, a selective "recovery" step was performed. In the "recovery" step, the recovery medium (3.1 g / L B5 salt, B5 vitamin, 1 g / L MES, 30 g / L sucrose, 2 mg / L ZT, 8 g / L agar, 150 mg / L cephalosporin, 100 mg / L glutamate, 100 mg / L aspartic acid, pH 5.6) contains at least one known antibiotic that inhibits the growth of Agrobacterium (cephalosporin 150-250 mg / L), without adding a selector for plant transformants (Step 3: Recovery Step). Preferably, the cotyledonary node regenerated tissue blocks are cultured on a solid medium containing antibiotics but without a selector to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the cotyledonary node regenerated tissue blocks are cultured on a medium containing a selector (4-[hydroxy(methyl)phosphono]-DL-homoalanine) and the growing transformed callus is selected (Step 4: Selection Step). Preferably, the cotyledonary regenerated tissue blocks are cultured on a selection solid medium containing a selector (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, 6-benzyladenine (6-BAP) 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamate 100 mg / L, aspartic acid 100 mg / L, 4-[hydroxy(methyl)phosphono]-DL-homoalanine 10 mg / L, pH 5.6), allowing the transformed cells to continue growing. The transformed cells then regenerate into plants (step 5: regeneration step). Preferably, the cotyledonary regenerated tissue blocks grown on the selector-containing medium are cultured on solid media (B5 differentiation medium and B5 rooting medium) to regenerate plants.

[0176] The selected resistant tissue blocks were transferred to the B5 differentiation medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, ZT 1 mg / L, agar 8 g / L, cephalosporin 150 mg / L, glutamic acid 50 mg / L, aspartic acid 50 mg / L, gibberellin 1 mg / L, auxin 1 mg / L, 4-[hydroxy(methyl)phosphono]-DL-homoalanine 5 mg / L, pH 5.6) and cultured for differentiation at 25℃. The differentiated seedlings were transferred to the B5 rooting medium (B5 salt 3.1 g / L, B5 vitamin, MES 1 g / L, sucrose 30 g / L, agar 8 g / L, cephalosporin 150 mg / L, indole-3-butyric acid (IBA) 1 mg / L) and cultured at 25℃ until approximately 10 cm tall, then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the plants were cultured at 26°C for 16 hours each day, followed by 20°C for 8 hours each day.

[0177] 1.3 Identification and Screening of Genetically Modified Organisms

[0178] The vector pDBN4031 produced a total of 1037 independent transgenic T0 plants. In order to select the best-performing transgenic events, the above 1037 independent transgenic T0 plants were transplanted into a greenhouse for cultivation and propagation to obtain transgenic T1 plants.

[0179] Because soybean genetic transformation using mature soybean seeds and glufosinate as a selection agent is prone to false-positive transgenic events, glufosinate was sprayed during the T1 generation to identify positive transgenic events, resulting in 137 positive transgenic plants. These were then analyzed using TaqMan. TMAnalysis of the 137 transgenic soybean plants revealed the presence of single copies of the cCry2Ab, cCry1Ac, and cPAT genes, without the vector backbone sequence, yielding 84 transgenic plants. Through transgenic insertion site analysis, 30 transgenic plants with intact flanking sequences for their T-DNA, without T-DNA insertion into important genes in the soybean genome, and without generating large open reading frames (ORFs) were selected. Resistance evaluation and comparison against major target insects (cotton bollworm, beet armyworm, cutworm) identified 25 transgenic plants with good insect resistance. Since genetic transformation and gene insertion can both affect agronomic traits of soybean plants (e.g., [example needed]), [further details needed]. (e.g., seedling vigor, growth period, plant height, or lodging). Therefore, the above 25 transgenic T2 generation single plants were planted in the field to identify the agronomic traits of transgenic T2 single plants at different stages (seedling stage-full flowering stage, initial grain stage-maturity stage). Then, through self-pollination and backcrossing, under different generations, different geographical environments, and / or different background materials, the agronomic traits, molecular biology, target insect resistance, glufosinate tolerance, etc. of transgenic soybean plants were screened to determine whether they could be stably inherited. Three superior transgenic soybean events, DBN8205, pDBN4031-1, and pDBN4031-2, were selected. Among them, the transgenic soybean event DBN8205 had the best traits (see Examples 6 to 9).

[0180] Following the method described above for screening superior transgenic soybean events DBN8205, pDBN4031-1, and pDBN4031-2 using the pDBN4031 vector, three superior transgenic soybean events pDBN4032-1, pDBN4032-2, and pDBN4032-3 were screened from the constructed recombinant expression vector pDBN4032, all of which possess single-copy transgenes.

[0181] By comparing the resistance of transgenic soybean events DBN8205, pDBN4031-1, and pDBN4031-2 selected from vector pDBN4031 with that of transgenic soybean events pDBN4032-1, pDBN4032-2, and pDBN4032-3 selected from vector pDBN4032 to the main target insects (Spodoptera litura and Spodoptera litura) (see Example 6), it is shown that the design of vector pDBN4031 is superior. It is an excellent vector obtained by fully considering and analyzing the combination and interaction of regulatory elements. At the same time, it is shown that transgenic soybean event DBN8205 has the best resistance to the main target insects (Spodoptera litura and Spodoptera litura).

[0182] Second embodiment: Detection of the genetically modified soybean event DBN8205 using TaqMan.

[0183] Approximately 100 mg of leaf samples from the transgenic soybean DBN8205 were collected. Genomic DNA was extracted using a plant DNA extraction kit (DNeasy Plant Maxi Kit, Qiagen). The copy numbers of the cCry2Ab, cCry1Ac, and cPAT genes were detected using TaqMan probe-based quantitative PCR. Wild-type soybean plants were used as controls, and the same analysis was performed. The experiment was conducted in triplicate, and the average value was used.

[0184] The specific method is as follows:

[0185] Step 1: Take 100 mg of leaves from the genetically modified soybean event DBN8205, grind them into a homogenate in a mortar using liquid nitrogen, and take 3 replicates for each sample;

[0186] Step 2: Extract genomic DNA from the above samples using the Plant DNA Extraction Kit (DNeasy Plant Maxi Kit, Qiagen). Refer to the product instructions for specific methods.

[0187] Step 3: Determine the genomic DNA concentration of the above samples using a NanoDrop 2000 spectrophotometer (Thermo Scientific);

[0188] Step 4: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μL;

[0189] Step 5: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type soybean plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:

[0190] The following primers and probes are used to detect the cCry2Ab gene sequence:

[0191] Primer 1: gtccacgagaatggatcaatga is shown in SEQ ID NO:16 in the sequence listing;

[0192] Primer 2: gtgtggcgtgaataggtgaaatag is shown in SEQ ID NO:17 in the sequence listing;

[0193] Probe 1: ctggctcccaacgactataccgggttt is shown as SEQ ID NO:18 in the sequence listing;

[0194] The following primers and probes are used to detect the cCry1Ac gene sequence:

[0195] Primer 3: gacacaggtttctgctcagcgag is shown in SEQ ID NO:19 in the sequence listing;

[0196] Primer 4: cccagatgatgtcaactagtccg as shown in SEQ ID NO:20 in the sequence listing;

[0197] Probe 2: cgtgccaggtgctgggttcgttc is shown as SEQ ID NO:21 in the sequence listing;

[0198] The following primers and probes are used to detect the cPAT gene sequence:

[0199] Primer 5: gagggtgttgtggctggtattg is shown in SEQ ID NO:22 in the sequence listing;

[0200] Primer 6: tctcaactgtccaatcgtaagcg is shown in SEQ ID NO:23 in the sequence listing;

[0201] Probe 3: cttacgctgggccctggaaggctag is shown in SEQ ID NO:24 in the sequence listing;

[0202] The PCR reaction system is as follows:

[0203]

[0204] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0), and is stored in amber tubes at 4°C.

[0205] The PCR reaction conditions are as follows:

[0206]

[0207] Data analysis using the Fast Real-Time PCR System software (Applied Biosystems 7900HT Fast Real-Time PCR System SDS v2.3, Applied Biosystems) showed that the obtained transgenic soybean event DBN8205 was a single copy.

[0208] Third embodiment: Analysis of the insertion site of DBN8205 in the transgenic soybean event.

[0209] 3.1 Genomic DNA Extraction

[0210] DNA extraction was performed using the conventional CTAB (hexadecyltrimethylammonium bromide) method: 2g of young leaves from the transgenic soybean event DBN8205 were ground into powder in liquid nitrogen, and then 0.5mL of DNA extraction CTAB buffer (20g / L CTAB, 1.4M NaCl, 100mM Tris-HCl, 20mM...) preheated at 65℃ was added. EDTA (ethylenediaminetetraacetic acid), pH adjusted to 8.0 with NaOH, was thoroughly mixed and extracted at 65℃ for 90 min. 0.5 volumes of phenol and chloroform were added, and the mixture was inverted and mixed. The mixture was centrifuged at 12000 rpm for 10 min. The supernatant was collected, and 2 volumes of anhydrous ethanol were added. The centrifuge tube was gently shaken and incubated at 4℃ for 30 min. The mixture was then centrifuged again at 12000 rpm for 10 min. The DNA was collected at the bottom of the tube. The supernatant was discarded, and the precipitate was washed with 1 mL of 70% ethanol. The mixture was centrifuged at 12000 rpm for 5 min. The precipitate was vacuum dried or air-dried in a clean bench. The DNA precipitate was dissolved in an appropriate amount of TE buffer and stored at -20℃.

[0211] 3.2 Analysis of flanking DNA sequences

[0212] The concentration of the extracted DNA samples was determined to be between 80-100 ng / μL. Genomic DNA was digested with restriction endonucleases EcoRI (5' end analysis) and EcoRI V (3' end analysis), respectively. Each digestion system contained 26.5 μL of genomic DNA, 0.5 μL of the aforementioned restriction endonuclease, and 3 μL of digestion buffer (all restriction enzymes used were from NEB and their compatible buffers or universal buffers, now known as NEB CutSmart), and digestion was carried out for 1 hour. After enzyme digestion, add 70 μL of anhydrous ethanol to the digestion system, incubate on ice for 30 min, centrifuge at 12000 rpm for 7 min, discard the supernatant, and dry. Then add 8.5 μL of double-distilled water (dd H2O), 1 μL of 10×T4-DNA ligase buffer (NEB T4 DNA Ligase Reaction Buffer; the specific formula can be found on the NEB website or at https: / / www.neb.com / products / restriction-endonucleases, https: / / www.neb.com / products / b0202-t4-dna-ligase-reaction-buffer), and 0.5 μL of T4-DNA ligase. Incubate overnight at 4°C. Perform PCR amplification using a series of nested primers to separate the 5' and 3' genomic DNA ends. Specifically, the primer combination for isolating 5' end genomic DNA includes SEQ ID NO:13 and SEQ ID NO:30 as the first primer, SEQ ID NO:32 and SEQ ID NO:33 as the second primer, and SEQ ID NO:13 as the sequencing primer. The primer combination for isolating 3' end genomic DNA includes SEQ ID NO:15 and SEQ ID NO:31 as the first primer, SEQ ID NO:34 and SEQ ID NO:35 as the second primer, and SEQ ID NO:15 as the sequencing primer. The PCR reaction conditions are shown in Table 3.

[0213] The amplification products obtained from the above PCR amplification reaction were separated by electrophoresis on a 2.0% agarose gel. The target fragment was then isolated from the agarose matrix using a gel extraction kit (QIAquick Gel Extraction Kit, catalog #28704, Qiagen Inc., Valencia, CA). The purified PCR amplification products were then sequenced (e.g., using an ABI Prism™ 377, PE Biosystems, Foster City, CA) and analyzed (e.g., using DNASTAR sequence analysis software, DNASTAR Inc., Madison, WI).

[0214] The 5' and 3' flanking sequences and conjugate sequences were confirmed using standard PCR methods. The 5' flanking sequences and conjugate sequences could be confirmed using SEQ ID NO:8 or SEQ ID NO:12, in combination with SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:30. The 3' flanking sequences and conjugate sequences could be confirmed using SEQ ID NO:11 or SEQ ID NO:14, in combination with SEQ ID NO:10, SEQ ID NO:15, or SEQ ID NO:31. The PCR reaction system and amplification conditions are shown in Tables 2 and 3. Those skilled in the art will understand that other primer sequences can also be used to confirm the flanking sequences and conjugate sequences.

[0215] DNA sequencing of PCR amplification products provides DNA that can be used to design other DNA molecules, which can be used as primers and probes to identify soybean plants or seeds derived from the transgenic soybean event DBN8205.

[0216] Nucleotide positions 1-481 of SEQ ID NO:5 show the right flanking (5' flanking sequence) of the soybean genome sequence in the DBN8205 transgenic soybean insertion event, and nucleotide positions 12397-12813 of SEQ ID NO:5 show the left flanking (3' flanking sequence) of the soybean genome sequence in the DBN8205 transgenic soybean insertion event. The 5' conjugation sequence is listed in SEQ ID NO:1, and the 3' conjugation sequence is listed in SEQ ID NO:2.

[0217] 3.3 PCR Conjugation Assay

[0218] The conjugate sequences are relatively short polynucleotide molecules that are novel DNA sequences that are diagnostic for the DNA of the transgenic soybean event DBN8205 when detected in polynucleotide assays. The conjugate sequences in SEQ ID NO:1 and SEQ ID NO:2 are 11 polynucleotides on each side of the insertion site of the transgenic fragment in the transgenic soybean event DBN8205 and the soybean genomic DNA. Longer or shorter polynucleotide conjugate sequences can be selected from SEQ ID NO:3 or SEQ ID NO:4. The conjugate sequences (5' linker region SEQ ID NO:1 and 3' linker region SEQ ID NO:2) are useful as DNA probes or as DNA primer molecules in DNA detection methods. The conjugate sequences SEQ ID NO:6 and SEQ ID NO:7 are also novel DNA sequences from the transgenic soybean event DBN8205 and can also be used as DNA probes or as DNA primer molecules to detect the presence of the transgenic soybean event DBN8205 DNA. SEQ ID NO:6 spans the pDBN4031 construct DNA sequence and the prAtAct2-01 transcription initiation sequence, and SEQ ID NO:7 spans the t35S transcription termination sequence and the pDBN4031 construct DNA sequence.

[0219] In addition, amplicon is generated by using at least one primer from SEQ ID NO:3 or SEQ ID NO:4, which, when used in a PCR method, produces a diagnostic amplicon for the transgenic soybean event DBN8205.

[0220] Specifically, a PCR amplification product was generated from the 5' end of the transgenic insertion sequence. This PCR amplification product contained a portion of genomic DNA flanking the 5' end of the T-DNA insertion sequence from the genome of plant material derived from the transgenic soybean event DBN8205. This PCR amplification product contained SEQ ID NO:3. For PCR amplification, primer 7 (SEQ ID NO:8) was designed to hybridize with the genomic DNA sequence flanking the 5' end of the transgenic insertion sequence, and primer 8 (SEQ ID NO:9) was designed to pair with it, located at the prAtAct2-01 transcription initiation sequence within the T-DNA insertion sequence.

[0221] A PCR amplification product was generated from the 3' end of the transgenic insert sequence. This PCR amplification product is a portion of genomic DNA flanking the 3' end of the T-DNA insert sequence from the genome of plant material derived from the transgenic soybean event DBN8205. This PCR amplification product contains SEQ ID NO:4. For PCR amplification, primer 9 (SEQ ID NO:10) located at the t35S transcription termination sequence in the T-DNA insert sequence was designed, and primer 10 (SEQ ID NO:11) was paired with it to hybridize with the genomic DNA sequence flanking the 3' end of the transgenic insert sequence.

[0222] The DNA amplification conditions described in Tables 2 and 3 can be used for the above-described PCR conjugation assays to generate diagnostic amplicones for the transgenic soybean event DBN8205. Detection of the amplicones can be performed using a Stratagene Robocycler, MJEngine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermal cycler, or by methods and equipment known to those skilled in the art.

[0223] Table 2. PCR steps and reaction mixture conditions for identifying the 5' end transgenic insert / genome conjugation region of transgenic soybean event DBN8205.

[0224]

[0225]

[0226] Table 3. Thermal Cyclist Amplification Conditions

[0227]

[0228] Mix gently. If the thermal cycler does not have an insulation cap, add 1-2 drops of mineral oil above each reaction mixture. Perform PCR reactions using the cycling parameters in Table 3 on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. For the Perkin-Elmer 9700 thermal cycler, set the ramp speed to its maximum value.

[0229] The experimental results showed that primers 7 and 8 (SEQ ID NO: 8 and 9) produced a 634 bp amplified product when used in the PCR reaction of transgenic soybean event DBN8205 genomic DNA, but no fragment was amplified when used in the PCR reaction of untransformed soybean genomic DNA and non-DBN8205 soybean genomic DNA; primers 9 and 10 (SEQ ID NO: 10 and 11) produced a 642 bp amplified product when used in the PCR reaction of transgenic soybean event DBN8205 genomic DNA, but no fragment was amplified when used in the PCR reaction of untransformed soybean genomic DNA and non-DBN8205 soybean genomic DNA.

[0230] PCR conjugation assays can also be used to identify whether materials derived from the transgenic soybean event DBN8205 are homozygous or heterozygous. Primers 11 (SEQ ID NO:12), 12 (SEQ ID NO:13), and 13 (SEQ ID NO:14) were used in the amplification reaction to generate diagnostic amplicones for the transgenic soybean event DBN8205. The DNA amplification conditions described in Tables 4 and 5 can be used for the above conjugation assays to generate diagnostic amplicones for the transgenic soybean event DBN8205.

[0231] Table 4. Reaction solution for bonding test

[0232]

[0233]

[0234] Table 5. Thermal cycling amplification conditions for binding assays

[0235]

[0236] Perform PCR reactions using the cycling parameters in Table 5 on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJ R-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. For the Perkin-Elmer 9700 thermal cycler, the ramp speed should be set to its maximum value.

[0237] In the amplification reaction, the biological sample containing template DNA contains DNA that diagnoses the presence of the transgenic soybean event DBN8205 in the sample. Alternatively, the amplification reaction will generate two distinct DNA amplicones from a biological sample containing DNA derived from the soybean genome, wherein the soybean genome DNA is heterozygous relative to the allele corresponding to the inserted DNA present in the transgenic soybean event DBN8205. These two distinct amplicones will correspond to a first amplicon (SEQ ID NO:12 and SEQ ID NO:14) derived from a wild-type soybean genomic locus and a second amplicon (SEQ ID NO:12 and SEQ ID NO:13) diagnosing the presence of the transgenic soybean event DBN8205 DNA. A soybean DNA sample that produces only a single amplicon corresponding to the second amplicon described for a heterozygous genome can diagnose the presence of the transgenic soybean event DBN8205 in the sample, and this sample is produced from soybean seeds that are homozygous relative to the allele corresponding to the inserted DNA present in the transgenic soybean plant DBN8205.

[0238] It should be noted that the primer pairs for the transgenic soybean event DBN8205 were used to generate diagnostic amplicones for the genomic DNA of the transgenic soybean event DBN8205. These primer pairs include, but are not limited to, primers 7 and 8 (SEQ ID NO: 8 and 9), and primers 9 and 10 (SEQ ID NO: 10 and 11), used in the DNA amplification method described above. Additionally, a control primer set 14 and 15 (SEQ ID NO: 25 and 26) for amplifying endogenous soybean genes is included as an intrinsic standard for the reaction conditions. Analysis of DNA extracts from the transgenic soybean event DBN8205 should include a positive tissue DNA extract control from the transgenic soybean event DBN8205, a negative DNA extract control from a non-transgenic soybean event DBN8205, and a negative control containing no template soybean DNA. In addition to these primer pairs, any primer pairs from SEQ ID NO:3 or its complementary sequence, or SEQ ID NO:4 or its complementary sequence, can be used to generate, when used in a DNA amplification reaction, diagnostic amplicon containing SEQ ID NO:1 or SEQ ID NO:2 for tissues derived from the transgenic soybean plant DBN8205. The DNA amplification conditions described in Tables 2-5 can be used with appropriate primer pairs to generate diagnostic amplicon for the transgenic soybean event DBN8205. Extracts of soybean plant or seed DNA presumed to contain the transgenic soybean event DBN8205, or products derived from the transgenic soybean event DBN8205, that produce diagnostic amplicones for the transgenic soybean event DBN8205 during testing in the DNA amplification method, can be used as templates for amplification to determine the presence of the transgenic soybean event DBN8205.

[0239] Fourth embodiment: Detection of transgenic soybean event DBN8205 using Southern blot hybridization.

[0240] 4.1 DNA Extraction for Southern Blot Hybridization

[0241] Using a mortar and pestle, grind approximately 5-10 g of plant tissue in liquid nitrogen. Resuspend 4-5 g of the ground plant tissue in 20 mL of CTAB lysis buffer (100 mM Tris-HCl pH 8.0, 20 mM EDTA pH 8.0, 1.4 M NaCl, 0.2% v / v β-mercaptoethanol, 2% w / v CTAB) and incubate at 65°C for 60 min. During incubation, invert the sample every 10 min to mix. After incubation, add an equal volume of phenol / chloroform / isoamyl alcohol (25:24:1), gently invert to mix, and extract. Centrifuge at 4000 rpm for 20 min. Repeat the extraction once with an equal volume of chloroform / isoamyl alcohol (24:1). After collecting the aqueous phase again, an equal volume of isopropanol was added, mixed, and incubated at -20°C for 1 hour to precipitate DNA. The DNA precipitate was then obtained by centrifugation at 4000 rpm for 5 minutes and resuspended in 1 mL of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0). To degrade any present RNA, the DNA was incubated with 40 μL of 10 mg / mL RNase A at 37°C for 30 minutes, centrifuged at 4000 rpm for 5 minutes, and then centrifuged at 12000 rpm for 10 minutes in the presence of 0.1 volume of 3 M sodium acetate (pH 5.2) and 2 volumes of anhydrous ethanol to precipitate the DNA. After discarding the supernatant, the precipitate was washed with 1 mL of 70% (v / v) ethanol, dried at room temperature, and then redissolved in 1 mL of TE buffer.

[0242] 4.2 Restriction enzyme digestion

[0243] The concentration of genomic DNA in the above samples was determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific).

[0244] In a 100 μL reaction system, 5 μg of DNA was digested each time, using restriction endonucleases Mfe I, Spe I, Hind III, and Sph I to digest genomic DNA, respectively. Partial sequences of the cCry2Ab, cCry1Ac, and cPAT genes on T-DNA were used as probes. For each enzyme, the digest was incubated overnight at an appropriate temperature. The sample was then rotated using a speedvacuum (Thermo Scientific) to reduce the volume to 20 μL.

[0245] 4.3 Gel electrophoresis

[0246] Bromophenol blue was added to each sample derived from Example 4.2, and each sample was loaded onto a 0.7% agarose gel containing ethidium bromide. The gel was separated by electrophoresis in TAE buffer (40 mM Tris-acetic acid, 2 mM EDTA, pH 8.5) and the gel was incubated overnight at 20 V.

[0247] After electrophoresis, the gel was treated with 0.25M HCl for 10 min to depurify the DNA. Then, the gel was treated with denaturing solution (1.5M NaCl, 0.5M NaOH) and neutralizing solution (1.5M NaCl, 0.5M Tris-HCl, pH 7.2) for 30 min each. 5×SSC (3M NaCl, 0.3M sodium citrate, pH 7.0) was poured into a porcelain dish, a glass plate was placed on top, and then a moistened filter paper bridge, gel, positively charged nylon membrane (Roche, Cat. No. 11417240001), three sheets of filter paper, a paper tower, and a weight were placed on top. After overnight transfer at room temperature, the nylon membrane was rinsed twice in deionized water, and the DNA was immobilized on the membrane using a UV crosslinker (UVP, UV Crosslinker CL-1000).

[0248] 4.4 Hybridization

[0249] Suitable DNA sequences were amplified by PCR for probe preparation. The DNA probes were SEQ ID NO:27, SEQ ID NO:28, or SEQ ID NO:29, or partially homologous to or complementary to the sequences described above. DIG labeling, Southern blotting, and membrane washing of the probes were performed using the DNA Labeling and Detection Starter Kit II (Roche, Cat. No. 11585614910), following the instructions in the product manual. Finally, the probe binding sites were detected using X-ray film (Roche, Cat. No. 11666916001).

[0250] Each Southern sample includes two control samples: (1) DNA from negative (untransformed) isolates, used to identify any endogenous soybean sequence that can hybridize with the element-specific probe; and (2) DNA from negative isolates incorporating Hind III-digested pDBN4031 plasmid in an amount equivalent to one copy number based on probe length, which serves as a positive control to illustrate the sensitivity of the experiment when detecting single gene copies within the soybean genome.

[0251] Hybridization data provided confirmatory evidence supporting TaqMan. TMPCR analysis revealed that soybean plant DBN8205 contains single copies of the cCry2Ab, cCry1Ac, and cPAT genes. Using the cCry2Ab gene probe, digestion with Mfe I and Spe I produced single bands of approximately 8.0 kb and 6.0 kb, respectively; using the cCry1Ac gene probe, digestion with Hind III and Sph I produced single bands of approximately 13 kb and 7.5 kb, respectively; and using the cPAT gene probe, digestion with Mfe I and Spe I produced single bands of approximately 9.5 kb and 13 kb, respectively. This indicates that one copy each of the cCry2Ab, cCry1Ac, and cPAT genes exists in soybean plant DBN8205. Furthermore, no hybridization bands were obtained for the backbone probe, indicating that no pDBN4031 vector backbone sequence was introduced into the soybean plant DBN8205 genome during transformation.

[0252] Fifth Example: Detection of protein expression levels in transgenic soybean event DBN8205 using ELISA.

[0253] The expression range of Cry1Ac protein in the transgenic soybean event DBN8205 can be detected by ELISA.

[0254] Leaves at stage V5, stems and flowers at stage R2, and roots, stems and seeds at stage R6 of the transgenic soybean event DBN8205 were extracted. Different soybean tissues at different growth stages were freeze-dried and used as samples. 20 mg of each sample was weighed and ground in liquid nitrogen. Then, 1 mL of extraction buffer (8 g / L NaCl, 0.27 g / L KH2PO4, 1.42 g / L Na2HPO4, 0.2 g / L KCl, 5.5 mL / L Tween-20, pH 7.4) was added, mixed, and allowed to stand at 4℃ for 30 min. The mixture was then centrifuged at 12000 rpm for 10 min. The supernatant was diluted with the extraction buffer to an appropriate concentration, and 80 μL of the diluted supernatant was used for ELISA detection.

[0255] The proportion of Cry1Ac protein in the dry weight of different soybean tissues was analyzed using an ELISA (Enzyme-Linked Immunosorbent Assay) kit (ENVIROLOGIX, Cry1Ac Kit (AP003)). Specific methods were described in the product instructions. Simultaneously, corresponding tissues from wild-type soybean plants (non-GMO, NGM) were used as controls, and the analysis was performed using the same method, with six replicates per plant.

[0256] The experimental results of Cry1Ac protein content in the transgenic soybean event DBN8205 are shown in Table 6. The average expression level of Cry1Ac protein in different tissues at different growth stages of the transgenic soybean event DBN8205 was measured to be 1.11 to 342.05 (μg / g) of the corresponding tissue dry weight.

[0257] Table 6. Results of Cry1Ac protein expression (μg / g) determination in transgenic soybean event DBN8205

[0258]

[0259] The results in Table 6 show that, in the transgenic soybean event DBN8205, the average expression level of Cry1Ac protein in soybean V5 stage leaves was 342.05 μg / g of the dry weight of V5 stage leaves, the average expression level of Cry1Ac protein in soybean R2 stage stems was 5.3 μg / g of the dry weight of R2 stage stems, the average expression level of Cry1Ac protein in soybean R2 stage flowers was 12.45 μg / g of the dry weight of R2 stage flowers, the average expression level of Cry1Ac protein in soybean R6 stage roots was 1.11 μg / g of the dry weight of R6 stage roots, and the average expression level of Cry1Ac protein in soybean R6 stage seeds was 8.44 μg / g of the dry weight of R6 stage seeds. Table 6 fully demonstrates that the Cry1Ac protein in the transgenic soybean event DBN8205 is expressed in different soybean tissues at different growth stages, especially in leaves, flowers and seeds, where the expression level is relatively high. It can show good resistance to lepidopteran insects, and at the same time, it shows that the design of the vector pDBN4031 is excellent.

[0260] Sixth embodiment: Evaluation of insect resistance levels of carriers pDBN4031 and pDBN4032

[0261] Bioassays were performed on seven soybean plants—three superior transgenic soybean plants (DBN8205, pDBN4031-1, and pDBN4031-2) selected from vector pDBN4031, three superior transgenic soybean plants (pDBN4032-1, pDBN4032-2, and pDBN4032-3) selected from vector pDBN4032, and a wild-type soybean plant (non-transgenic, NGM)—to detect major pests in China (Spodoptera exigua (BAW) and Spodoptera litura (TCW)) using the following methods:

[0262] Take the second leaf from the bottom at stage V3 of the above-mentioned transgenic soybean plants and wild-type soybean plants (non-transgenic, NGM), rinse them with sterile water and dry them with gauze. Then remove the veins and cut them into shapes of about 2.5cm × 3cm. Take 1-3 leaves (the number of leaves is determined according to the insect's feeding amount) and place them on the filter paper at the bottom of a round plastic petri dish. The filter paper is moistened with distilled water. Place 10 newly hatched artificially raised larvae in each petri dish. After covering the insect test petri dishes, place them under the conditions of temperature 26-28℃, relative humidity 70%-80%, and photoperiod (light / dark) 16:8 for 3 days and then count the results. The resistance score (out of 300 points) was calculated by statistically analyzing three indicators: larval development progress, insect mortality rate, and leaf damage rate. The total resistance score is calculated as follows: Total Resistance Score = 100 × Mortality Rate + [100 × Mortality Rate + 90 × (Number of Newly Hatched Larvae / Total Number of Infested Larvae) + 60 × (Number of Larvae Larger than Newly Hatched Larvae to Smaller than Negative Control Larvae / Total Number of Infested Larvae) + 10 × (Number of Negative Control Larvae / Total Number of Infested Larvae)] + 100 × (1 - Leaf Damage Rate). Here, the total number of infested larvae refers to the total number of infested larvae, i.e., 10 larvae per dish; the larval development progress is already reflected in the resistance score formula; and the leaf damage rate refers to the proportion of leaf area consumed by pests out of the total leaf area. For each pest, five plants were selected from each of the transgenic soybean plants DBN8205, pDBN4031-1, pDBN4031-2, pDBN4032-1, pDBN4032-2, pDBN4032-3, and wild-type soybean plants (non-transgenic, NGM) for testing, with each plant tested in triplicate. The results are shown in Table 7.

[0263] Table 7. Insect resistance bioassay results of transgenic soybean plants DBN8205, pDBN4031-1, pDBN4031-2, pDBN4032-1, pDBN4032-2, and pDBN4032-3 - mortality rate (%) and total resistance score (points)

[0264]

[0265]

[0266] The results in Table 7 show that (1) the transgenic soybean events (DBN8205, pDBN4031-1, pDBN4031-2) screened by vector pDBN4031 and the transgenic soybean events (pDBN4032-1, pDBN4032-2, pDBN4032-3) screened by vector pDBN4032 all showed significantly better resistance to beet armyworm and cotton bollworm than NGM; (2) the transgenic soybean events (DBN8205, pDBN4031-1, pDBN4031-2) screened by vector pDBN4031 showed significantly better resistance to beet armyworm and cotton bollworm than NGM; 5. pDBN4031-1 and pDBN4031-2 showed better resistance to beet armyworm and cotton bollworm than transgenic soybean events (pDBN4032-1, pDBN4032-2, pDBN4032-3) screened by vector pDBN4032, indicating that the design of vector pDBN4031 is superior and it is an excellent vector obtained by fully considering and analyzing the combination and interaction of regulatory elements; (3) Transgenic soybean event DBN8205 showed the best resistance to beet armyworm and cotton bollworm.

[0267] Seventh embodiment: Detection of insect resistance to the DBN8205 event.

[0268] To further verify the effect of the DBN8205 event on insect resistance, bioassays and field efficacy experiments were conducted on major pests in China and South America (Argentina and Brazil).

[0269] 7.1 Bioassay of soybean plant DBN8205 against major pests in China

[0270] Bioassays were performed on two soybean plants, DBN8205 (genetically modified) and wild-type soybean (non-genetically modified, NGM), against the cotton bollworm [Helicoverpa armigera (CBW)], cutworm [Agrotis ypsilon (BCW)], bean hawk moth [Clanis bilineata (BHM)], and fall armyworm [Spodoptera frugiperda (FAW)], respectively, using the following methods:

[0271] The second leaf from the bottom at stage V3 of two plants, namely the genetically modified soybean DBN8205 and the wild-type soybean plant (non-genetically modified, NGM), were taken. The leaves were rinsed with sterile water and dried with gauze. The veins were removed, and the leaves were cut into shapes of about 2.5cm × 3cm. One to three leaves (the number of leaves was determined according to the insects' feeding needs) were placed on filter paper at the bottom of a round plastic petri dish. The filter paper was moistened with distilled water. Ten newly hatched larvae raised in captivity were placed in each petri dish. After the insect test petri dishes were covered, they were placed under the conditions of 26-28℃, 70%-80% relative humidity, and a photoperiod (light / dark) of 16:8 for 3 days before the results were collected. Three indicators—larval development progress, insect mortality rate, and leaf damage rate—were statistically analyzed to obtain a total resistance score (out of 300): Total Resistance Score = 100 × Mortality Rate + [100 × Mortality Rate + 90 × (Number of Newly Hatched Larvae / Total Number of Infested Larvae) + 60 × (Number of Larvae Larger than Newly Hatched Larvae to Smaller than Negative Controls / Total Number of Infested Larvae) + 10 × (Number of Negative Controls / Total Number of Infested Larvae)] + 100 × (1 - Leaf Damage Rate). Here, the total number of infested larvae refers to the total number of infested larvae, i.e., 10 per dish; larval development progress is already reflected in the resistance score formula; leaf damage rate refers to the proportion of leaf area consumed by pests to the total leaf area. For each pest, 5 plants were selected from both the transgenic soybean event DBN8205 and wild-type soybean plants (non-transgenic, NGM) for testing, with each plant tested 6 times. The experimental results are shown in Table 8.

[0272] Table 8. Results of bioassays on insect resistance of the genetically modified soybean DBN8205 to major pests in China - mortality rate (%) and total resistance score (points).

[0273]

[0274] The results showed that the mortality rate and total resistance score of the transgenic soybean event DBN8205 against the above-mentioned pests were significantly higher than those of NGM, indicating that the transgenic soybean event DBN8205 has good resistance to cotton bollworm, cutworm, soybean hawk moth and fall armyworm.

[0275] 7.2. The Genetically Modified Soybean Incident: Field Testing of DBN8205 in China

[0276] Genetically modified soybean species DBN8205 and wild-type soybean plants (non-genetically modified, NGM) were planted in the field: a randomized block design with 3 replicates and a plot size of 30m². 2 (5m×6m), row spacing 60cm, plant spacing 10cm, conventional cultivation and management, no targeted insecticides are sprayed throughout the entire growth period.

[0277] (1)Bollworm

[0278] Natural infestation was only conducted in areas where the cotton bollworm infestation was relatively severe (natural pest occurrence conditions: peak infestation period in June-July, optimal development temperature in 20-30℃). When soybean plants reached the V2 stage, the feeding of cotton bollworm larvae on NGM leaves was monitored. When the second and third leaves from the bottom of the NGM plant were no longer being fed, the area of ​​damage to soybean plants by cotton bollworms was investigated on a plant-by-plant basis (damage area rate = sum of damaged leaf area of ​​all individual plants / total leaf area of ​​the plant × 100%). The resistance results of the transgenic soybean event DBN8205 to cotton bollworm are shown in Table 9.

[0279] Table 9. Resistance results of transgenic soybean DBN8205 to cotton bollworm under naturally susceptible conditions.

[0280]

[0281] The results showed that under natural bollworm occurrence conditions, compared with NGM, the area affected by the bollworm on the transgenic soybean event DBN8205 was 0%, indicating that the bollworm caused virtually no damage to the leaves of the transgenic soybean event DBN8205. This also demonstrates that the transgenic soybean event DBN8205 exhibits good resistance to the bollworm. The field effect of the transgenic soybean event DBN8205 under natural bollworm occurrence conditions was as follows: Figure 4 As shown.

[0282] (2) Beet armyworm

[0283] Natural pest infestation was only conducted in areas where the beet armyworm infestation was relatively severe (natural pest occurrence conditions: peak infestation period in June-July, optimal development temperature in 20-30℃). When soybean plants reached the V2 stage, the feeding of beet armyworm larvae on NGM leaves was monitored. When the second and third leaves from the bottom of the NGM plant were no longer being fed, the area of ​​damage to soybean plants by beet armyworms was investigated on a plant-by-plant basis (damage area rate = sum of damaged leaf area of ​​all individual plants / total leaf area of ​​the plant × 100%). The resistance results of the transgenic soybean event DBN8205 to beet armyworm are shown in Table 10.

[0284] Table 10. Resistance results of transgenic soybean DBN8205 to beet armyworm under naturally susceptible conditions.

[0285]

[0286] The results showed that under natural beet armyworm occurrence conditions, the area affected by the beet armyworm on the transgenic soybean event DBN8205 was significantly lower than that on NGM soybeans. This indicates that the transgenic soybean event DBN8205 has good resistance to the beet armyworm. The field effect of the transgenic soybean event DBN8205 on the beet armyworm under natural occurrence conditions is as follows: Figure 5 As shown.

[0287] (3) Silver-striped Noctuid moth

[0288] Natural infestation was only conducted in areas where the silver-striped armyworm (S. spp.) was prevalent (natural infestation conditions: peak infestation period from June to September, optimal development temperature 20-30℃). When soybean plants reached the V2 stage, the feeding of NGM leaves by silver-striped armyworm larvae was monitored. When the second and third leaves from the bottom of the NGM plant were no longer being fed, the area of ​​damage to soybean plants by silver-striped armyworm was investigated on a plant-by-plant basis (damage area rate = sum of damaged leaf area of ​​all individual plants / total leaf area of ​​the plant × 100%). The resistance results of the transgenic soybean DBN8205 to silver-striped armyworm are shown in Table 11.

[0289] Table 11. Resistance results of transgenic soybean DBN8205 to the silver-striped armyworm under naturally susceptible insect conditions.

[0290]

[0291] The results showed that under natural occurrence conditions of the silver-striped armyworm, the area affected by the silver-striped armyworm in transgenic soybean event DBN8205 was significantly lower than that in NGM soybeans, indicating that transgenic soybean event DBN8205 exhibits good resistance to the silver-striped armyworm. Figure 6 This is a comparison of the effects of genetically modified soybeans DBN8205 and NGM under natural occurrence conditions of the silver-striped armyworm.

[0292] (4) Soybean pod borer

[0293] Natural infestation was conducted only in three regions within China where the soybean pod borer infestation was relatively severe (natural pest occurrence conditions: peak infestation period in August-September, optimal development temperature in 20-25℃). When soybean plants reached the R6 stage, the feeding of soybean pods by soybean pod borer larvae on NGM soybeans was monitored. When the plants were fully mature, the percentage of eaten seeds in each soybean pod was investigated (percentage of eaten seeds = total number of damaged seeds in all individual pods / total number of seeds in all pods per plant × 100%). The resistance results of the transgenic soybean event DBN8205 to the soybean pod borer are shown in Table 12.

[0294] Table 12. Resistance results of transgenic soybean DBN8205 to soybean pod borer under naturally susceptible insect conditions.

[0295]

[0296]

[0297] The results showed that under natural occurrence conditions of the soybean pod borer, compared with NGM, the pod-eating rate of the soybean pod borer on the transgenic soybean event DBN8205 was 0, indicating that the soybean pod borer caused virtually no damage to the pods of the transgenic soybean event DBN8205, and also demonstrating that the transgenic soybean event DBN8205 has good resistance to the soybean pod borer. The field performance of the transgenic soybean event DBN8205 under natural occurrence conditions of the soybean pod borer in Region 1 was as follows: Figure 7 As shown.

[0298] 7.3 Bioassay of soybean plant DBN8205 against major pests in South America (Argentina and Brazil)

[0299] (1) Bioassay of soybean plant DBN8205 against major leaf-eating pests in South America (Argentina and Brazil)

[0300] Bioassays were performed on two soybean plants, DBN8205 (genetically modified) and wild-type soybean (non-genetically modified, NGM), against the following moths: Rachiplusia nu (SFL), Anticarpa gemmatalis (VBC), Soybean armyworm (SBL), Helicoverpa gelotopoeon (SABW), Chloridea virescens (TBW), Spodoptera frugiperda (FAW), Spodoptera cosmioides (BLAW), Helicoverpa zea (SPW), Spodoptera eridania (SAW), and Spodoptera albula (GSAW), using the following methods:

[0301] The second leaf from the bottom at stage V3 was taken from both the transgenic soybean (DBN8205) and wild-type soybean (non-transgenic, NGM) plants. The leaves were rinsed with sterile water and dried with gauze, then the veins were removed. The leaves were then cut into circles approximately 1.6 cm in diameter. One to three of these circular leaves (the number determined by insect consumption) were placed on round plastic petri dishes containing 2 mL of agar. One newly hatched larva was placed on each dish. The dishes were then covered and incubated for three days at 26-28℃, 60%-80% relative humidity, and a photoperiod (light / dark) of 14:10. Results were then collected. The mortality rate of the tested insects and the leaf damage rate (leaf damage rate refers to the proportion of leaf area consumed by the pests to the total leaf area) were recorded. For each pest, six plants of similar growth were selected from both the transgenic soybean (DBN8205) and wild-type soybean (non-transgenic, NGM) plants for testing, with 32 replicates per plant. The experimental results are shown in Table 13.

[0302] Table 13. Bioassays of the genetically modified soybean DBN8205 against major pests in South America (Argentina and Brazil)

[0303]

[0304]

[0305] The results showed that the mortality rate of the transgenic soybean event DBN8205 against the above-mentioned pests was significantly higher than that against NGM, while the leaf damage rate was lower than that against NGM. This indicates that the transgenic soybean event DBN8205 has good resistance to the peppermint bollworm, soybean looper, soybean cutworm, cotton bollworm, tobacco leafminer, fall armyworm, black moth, grain cutworm, southern gray-winged cutworm, and Albula cutworm.

[0306] (2) Resistance effect of soybean plant DBN8205 to soybean stem-boring pests in South America (Argentina and Brazil)

[0307] The mortality rate, plant damage rate, and plant mortality rate of corn stem borer [Elasmopalpus lignosellus, LSCB] were determined for two types of soybean seedlings: the transgenic soybean DBN8205 and the wild-type soybean (non-transgenic, NGM). The following methods were used to determine the mortality rate of corn stem borer [Elasmopalpus lignosellus, LSCB].

[0308] Method for determining the mortality rate of the test insects: 32 transgenic soybean seedlings (DBN8205) and 32 wild-type soybean seedlings (non-transgenic, NGM) (3 days after germination under greenhouse conditions) were removed by roots and placed separately in individual small plastic boxes. The bottom of each plastic box contained 2% agar to support normal plant development. One corn borer larva hatched 12 hours prior was then placed on each plant. The plastic boxes were sealed with plastic lids and kept under conditions of 23-27℃, 60%-80% relative humidity, and a photoperiod (light / dark) of 14:10 for 5 days. The mortality rate of the test insects was then recorded. Each plant was tested six times.

[0309] Methods for determining plant damage rate and plant mortality rate: Thirty-two transgenic soybean seedlings (DBN8205) and 32 wild-type soybean seedlings (non-transgenic, NGM) were taken from seedlings grown for 7 days under greenhouse conditions. PVC pipes were placed around the pots containing these soybean seedlings to increase physical barriers and prevent insect migration. Two corn stem borer larvae, hatched for 12 hours, were then placed at the base of the stem of each plant. Fifteen days after inoculation, the plant damage rate (the proportion of surviving plants damaged by pests out of the total number of tested plants) and plant mortality rate (the proportion of plants that died from pest damage out of the total number of tested plants) were recorded. Each plant was tested six times. The experimental results are shown in Table 14.

[0310] Table 14. Resistance of the genetically modified soybean DBN8205 to corn borer.

[0311]

[0312] The results showed that the transgenic soybean event DBN8205 had a significantly higher mortality rate from corn borers than NGM, while the plant damage rate and mortality rate were significantly lower than those of NGM, indicating that the transgenic soybean event DBN8205 has good resistance to corn borers.

[0313] Eighth Example: Herbicide Tolerance Testing of the Event

[0314] This experiment used Basta herbicide (18% glufosinate-ammonium salt solution) for spraying. A randomized block design with three replicates was employed. The plot area was 15m². 2(5m×3m), row spacing 60cm, plant spacing 10cm, conventional cultivation management, with a 1m wide isolation strip between plots. The transgenic soybean event DBN8205 was treated in the following two ways: (1) no herbicide was sprayed, and weeds were controlled manually to remove the influence of weeds on soybean growth; (2) the herbicide basil was sprayed at a dose of 800g ai / ha (ai / ha refers to "active ingredient per hectare") during the V2-V3 period. A parallel control experiment was conducted using wild-type soybean plants (non-transgenic, NGM). It should be noted that glufosinate herbicide (such as Basta) is a contact herbicide. If the field application is not handled properly, such as excessive accumulation of herbicide in a local area, phytotoxicity may occur. This does not mean that the transgenic soybean event DBN8205 has a tolerance problem. The following conclusions apply to glufosinate herbicide with different contents and formulations converted to the above equivalent amount of active ingredient glufosinate.

[0315] Herbicide damage symptoms were investigated 1 week and 2 weeks after application, and the yield of each plot was measured at harvest. The symptom grading is shown in Table 15. Herbicide damage rate was used as an indicator to evaluate herbicide tolerance in the transformation event. Specifically, herbicide damage rate (%) = ∑(number of plants with the same damage level × number of levels) / (total number of plants × highest level); where the herbicide damage rate refers to the glufosinate damage rate, which was determined based on the herbicide damage survey results 2 weeks after glufosinate treatment. The herbicide (glufosinate) damage rate was used to determine the soybean's herbicide tolerance level. Soybean yield in each plot was calculated by weighing the total soybean grain yield (weight) of the middle three rows of plants in each plot. Yield differences between different treatments were measured as a percentage of yield, yield percentage (%) = sprayed yield / unsprayed yield. The results of herbicide tolerance and soybean yield for the transgenic soybean event DBN8205 are shown in Table 16.

[0316] Table 15. Grading Standards for the Severity of Herbicide Damage to Soybeans from Glufosinate-Ammonium

[0317] Phytotoxicity level Symptom description 1 The plant is growing normally and shows no signs of damage. 2 Minor pesticide damage, less than 10% of the plant's output. 3 Moderate pesticide damage; it can recover later and will not affect yield. 4 Severe pesticide damage, difficult to recover from, resulting in reduced yield. 5 Severe pesticide damage that cannot be reversed, resulting in significant yield reduction or complete crop failure.

[0318] Table 16. Results of tolerance to glufosinate herbicide and soybean yield of the transgenic soybean event DBN8205.

[0319]

[0320] The results show that, regarding the damage rate from glufosinate herbicide, the damage rate of the transgenic soybean event DBN8205 was 0 under the treatment with glufosinate herbicide (800 g ai / ha); therefore, the transgenic soybean event DBN8205 has good tolerance to glufosinate herbicide.

[0321] Regarding yield: there was no significant difference in yield between the treatment with 800g ai / ha glufosinate and the treatment without spraying. This further indicates that the genetically modified soybean DBN8205 has good tolerance to glufosinate herbicide and has no impact on yield.

[0322] Ninth Example: Insect Resistance Effect of Genetically Modified Soybean DBN8205 under Different Backgrounds

[0323] The transgenic soybean event DBN8205 with a transformation background of soybean Jack plants in the first embodiment was backcrossed into soybean plants with parental backgrounds of Heihe 43 and Zhonghuang 35, respectively. After 5 generations of backcrossing and 3 generations of self-crossing, transgenic soybean event DBN8205 with a transformation background of Heihe 43 and transgenic soybean event DBN8205 with a transformation background of Zhonghuang 35 were obtained, respectively. The integrity of transgenic soybean event DBN8205 was detected by PCR in each generation (see the third embodiment).

[0324] The soybean transformation event DBN8205, with transformation backgrounds of Jack, Heihe 43, and Zhonghuang 35, along with six plants—wild-type soybean Jack, wild-type soybean Heihe 43, and wild-type soybean Zhonghuang 35 (non-transgenic, NGM)—were subjected to bioassays against the cotton bollworm [Helicoverpa armigera (CBW)] using the bioassay method described in Example 7.1. Each plant was replicated six times. The experimental results are shown in Table 17.

[0325] Table 17. Insect resistance bioassay results of transgenic soybean event DBN8205 under different transformation backgrounds - mortality rate (%) and total resistance score (points)

[0326]

[0327] The results in Table 17 show that the transgenic soybean event DBN8205 exhibits good resistance to cotton bollworm under different transformation backgrounds, indicating that the resistance effect of the transgenic soybean event DBN8205 to the target pest is stable under different transformation backgrounds.

[0328] Example 10: Insect resistance detection of superimposed transgenic soybean events DBN8205 x DBN8002 x DBN9004.

[0329] 1. Obtain the superimposed genetically modified soybean events DBN8205 x DBN8002 x DBN9004

[0330] The transgenic soybean event DBN9004 (CN106086011A) (male parent) was crossed with the transgenic soybean event DBN8002 (female parent) to obtain heterozygous plants superimposed with transgenic soybean events DBN8002 x DBN9004. After two generations of self-pollination, the homozygous heterozygosity of the target gene copy number was detected by TaqMan (refer to the second embodiment) and the homozygous heterozygosity of the conjugation site was detected by PCR (refer to the third embodiment) to obtain homozygous plants superimposed with transgenic soybean events DBN8002 x DBN9004. These homozygous plants were then used as male parents and crossed with the transgenic soybean event DBN8205 (female parent) to obtain plants superimposed with transgenic soybean events DBN8205 x DBN8002 x DBN9004.

[0331] 2. Bioassay of major pests in China based on the combined genetically modified soybean events DBN8205 x DBN8002 x DBN9004

[0332] Bioassays were performed on two soybean plants—DBN8205 x DBN8002 x DBN9004 (superimposed transgenic soybean events) and wild-type soybean plants (non-transgenic, NGM)—for bollworm (Helicoverpa armigera, CBW), beet armyworm (Spodopteraexigua, BAW), and fall armyworm (Spodoptera frugiperda, FAW)—according to the method described in Example 7.1. The experimental results are shown in Table 18.

[0333] Table 18. Bioassay results of major pests in China from superimposed genetically modified soybean events DBN8205 x DBN8002 x DBN9004 - Mortality rate (%) and total resistance score (points)

[0334]

[0335] The results showed that the combined transgenic soybean events DBN8205 x DBN8002 x DBN9004 exhibited significantly higher insect mortality and total resistance scores against the above-mentioned pests than NGM, indicating that the combined transgenic soybean events DBN8205 x DBN8002 x DBN9004 demonstrated good resistance to cotton bollworm, beet armyworm, and fall armyworm.

[0336] 3. Bioassay of DBN8205 x DBN8002 x DBN9004 against major pests in South America (Argentina and Brazil) in conjunction with genetically modified soybean events.

[0337] Bioassays were performed on two soybean plants, DBN8205 x DBN8002 x DBN9004 (superimposed transgenic soybean events) and wild-type soybean plants (non-transgenic, NGM), against the following moths: Rachiplusia nu (SFL), Anticarpa mmatalis (VBC), Chrisiodexys includens (SBL), Helicoverpagelotopoeon (SABW), Spodoptera frugiperda (FAW), Spodoptera cosmioides (BLAW), and Helicoverpa zea (SPW), according to the method described in Example 7.3(1). The results are shown in Table 19.

[0338] Table 19. Bioassays of major pests in South America (Argentina and Brazil) by superimposed genetically modified soybean events DBN8205 x DBN8002 x DBN9004

[0339]

[0340]

[0341] The results showed that the combined transgenic soybean events DBN8205 x DBN8002 x DBN9004 exhibited significantly higher insect mortality rates and lower leaf damage rates compared to NGM compared to the combined transgenic soybean events DBN8205 x DBN8002 x DBN9004. This indicates that the combined transgenic soybean events DBN8205 x DBN8002 x DBN9004 demonstrated good resistance to the peppermint bollworm, the soybean looper, the South American cotton bollworm, the fall armyworm, the black tussock moth, and the grain looper.

[0342] Example 10: Herbicide tolerance testing of superimposed genetically modified soybean events DBN8205 x DBN8002 x DBN9004

[0343] This experiment used Roundup herbicide (41% glyphosate isopropylammonium salt solution) and Basta herbicide (18% glyphosate ammonium salt solution) for spraying. A randomized block design was used with three replicates. The plot area was 15m². 2(5m×3m), row spacing 60cm, plant spacing 25cm, conventional cultivation and management, with a 1m wide isolation strip between plots. The superimposed transgenic soybean events DBN8205 x DBN8002 x DBN9004 were subjected to the following two treatments: 1) No herbicide application, manual weed control to eliminate the impact of weeds on soybean growth; 2) Roundup herbicide was sprayed at the V3 leaf stage at a dose of 1680 g ae / ha (ae / ha refers to "active ingredient equivalent acid per hectare"), and then sprayed again at the same dose at the R2 stage (full bloom stage); 3) Promethazine herbicide was sprayed at the V3 leaf stage at a dose of 800 g ai / ha (ai / ha refers to "active ingredient per hectare"), and then sprayed again at the same dose at the V6 stage; 4) Promethazine herbicide was sprayed at the V3 leaf stage at a dose of 800 g a.i. / ha, and then Roundup herbicide was sprayed at the R2 stage at a dose of 1680 g ae / ha. A parallel control experiment was conducted using wild-type soybean plants (non-transgenic, NGM). It should be noted that the following conclusions apply to the conversion of glyphosate herbicides of different contents and formulations into the equivalent amount of glyphosate acid, as well as the conversion of glufosinate solutions of different concentrations into the equivalent amount of the aforementioned active ingredient, glufosinate.

[0344] Herbicide damage symptoms were investigated 1 week and 2 weeks after application, and soybean yield in each plot was measured at harvest. The grading of herbicide damage symptoms is shown in Table 14 of Example 7. Herbicide damage rate was used as an indicator to evaluate herbicide tolerance in the transformation event. Specifically, herbicide damage rate (%) = ∑(number of plants with the same damage level × number of levels) / (total number of plants × highest level); where the herbicide damage rate includes glyphosate damage rate and glufosinate damage rate, determined based on the herbicide damage survey results 2 weeks after glyphosate or glufosinate treatment. Soybean yield in each plot was the total yield (weight) of the middle three rows of soybeans in each plot. Yield differences between different treatments were measured as a percentage of yield, yield percentage (%) = sprayed yield / unsprayed yield. The results of herbicide tolerance and soybean yield for the superimposed transgenic soybean events DBN8205 x DBN8002 x DBN9004 are shown in Table 20.

[0345] Table 20. Results of herbicide tolerance and yield tests of the superimposed transgenic soybean events DBN8205 x DBN8002 x DBN9004.

[0346]

[0347] The results show that, regarding the herbicide (glyphosate and glufosinate) damage rate: 1) The damage rate of DBN8205 x DBN8002 x DBN9004 under the superimposed transgenic soybean event was basically 0 under the glyphosate herbicide (1680 g ae / ha) treatment; 2) The damage rate of DBN8205 x DBN8002 x DBN9004 under the superimposed transgenic soybean event was also basically 0 under the glufosinate herbicide (800 g ai / ha) treatment; 3) The damage rate of DBN8205 x DBN8002 x DBN9004 under the superimposed transgenic soybean event was also basically 0 under the glufosinate herbicide (800 g ai / ha) and glyphosate herbicide (1680 g ae / ha) treatments. Therefore, DBN8205 x DBN8002 x DBN9004 under the superimposed transgenic soybean event exhibits good herbicide (glyphosate and glufosinate) tolerance.

[0348] In terms of yield: The superimposed genetically modified soybean event DBN8205 x DBN8002 x DBN9004 showed no significant difference in yield compared with the no-application treatment under the three treatments of glyphosate herbicide (1680 g ae / ha), glufosinate herbicide (800 g ai / ha), and glufosinate herbicide (800 g ai / ha) + glyphosate herbicide (1680 g ae / ha). This further indicates that the superimposed genetically modified soybean event DBN8205 x DBN8002 x DBN9004 has good tolerance to herbicides (glyphosate and glufosinate).

[0349] Eleventh Embodiment

[0350] Agricultural products or commodities can be produced from soybean plants containing the genetically modified soybean event DBN8205 or soybean plants containing the genetically modified soybean event DBN8205 and at least one other genetically modified soybean event different from DBN8205. If sufficient expression levels are detected in said agricultural product or commodity, it is expected to contain a nucleotide sequence capable of diagnosing the presence of the genetically modified soybean event DBN8205 material in said agricultural product or commodity. The agricultural product or commodity includes, but is not limited to, soybean meal, flour, and oil, specifically lecithin, fatty acids, glycerol, sterols, edible oils, defatted soybean flakes, including defatted and roasted soybean flour, soy milk curds, tofu, soy protein concentrate, isolated soy protein, hydrolyzed vegetable protein, textured soy protein, and soy protein fiber, as well as any other food intended as a food source for animal consumption. Nucleic acid detection methods and / or kits based on probes or primer pairs can be developed to detect nucleotide sequences from the transgenic soybean event DBN8205, such as those shown in SEQ ID NO:1 or SEQ ID NO:2, wherein the probe or primer sequences are selected from sequences or portions thereof shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5, to diagnose the presence of the transgenic soybean event DBN8205.

[0351] In summary, the transgenic soybean event DBN8205 of this invention exhibits good resistance to lepidopteran insects and high tolerance to glufosinate-ammonium herbicide, without affecting other agronomic traits and yield of the plant. Furthermore, the detection method can accurately and rapidly identify whether biological samples contain DNA molecules of the transgenic soybean event DBN8205.

[0352] Seeds corresponding to the genetically modified soybean event DBN8205 were deposited on December 27, 2021, under the Budapest Treaty at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China). The classification is: soybean (Glycine max), the preservation status is: viable, and the accession number is CGMCC No. 45071. The deposit will be held at the collection for 30 years.

[0353] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention. sequence list <110> Beijing Dabeinong Biotechnology Co., Ltd. <120> Nucleic acid sequence for detecting DBN8205 in soybean and its detection method <130> DBNBC162 <160> 38 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty two <212> DNA <213> The artificial sequence DBN8205 contains a 22-nucleotide sequence located near the insertion junction at the 5' end of the insert sequence. <400> 1 gagccacgtt gtcaaacact ga 22 <210> 2 <211> twenty two <212> DNA <213> The artificial sequence DBN8205 contains a 22-nucleotide sequence located near the insertion junction at the 3' end of the insert sequence. <400> 2 acaccacaat attggttctt at 22 <210> 3 <211> 634 <212> DNA <213> The artificial sequence DBN8205 contains a 634-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence. <400> 3 gcctcatgtt gttgcttcga ggcctccaaa tcaacctcta ttttctttcg taactattcc 60 atctattctt gaatttccag tatggatgat gttttggctt gtgtggagcg cacaaatgaa 120 ttaggatcgc ctctccttgt tgctaccatt ttgggtccat aagagaattt tccacgaccc 180 cacgatgggc accaaatgtt cctactgagt ttcaacaatg ttcttgttga gttatgataa 240 ggttcgactg aactatctgg tcctctcctt cttagcggaa tctctgatgt tgaagtgagg 300 ggaggtactg caaaagggac tccaacgagc aagtcagtgg tgctttgagg tgtttatgtg 360 tctataactg gtatgagtaa aatgtgctta gggatctcct ctctaggtct atatatacat 420 gtccagtgtt gagggggtta cgcaatgttc ggagccacgt tgtcaaacac tgatagttta 480 aactgaaggc gggaaacgac aatctgatca agagcggaga attaagggag tcacgttatg 540 accccccgccg atgacgcggg acaagccgtt ttacgtttgg aactgacaga accgcaacgc 600 tgcaggaatt ggccgcaggt ggatttgtat taaa 634 <210> 4 <211> 642 <212> DNA <213> The artificial sequence DBN8205 contains a 642-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence. <400> 4 cctaaaacca aaatccagtg gcctgcaggg aattcttaat taagtgcacg cggccgccta 60 cttagtcaag agcctcgcac gcgactgtca cgcggccagg atcgcctcgt gagcctcgca 120 atctgtacct agtttagcta gttaggacgt taacagggac gcgcctggcc gtatccgcaa 180 tgtgttatta agttgtctaa gcgtcaattt gtttacacca caatattggt tcttataagt 240 ttttttattt atttttaatc tttataaatt tgtgtttttt caattttaat ccctttaaaa 300 ttttaatttt tattttaat ccttataagt tcatgtttat aaggatcaaa attaaaaaat 360 aaatatttat agggactaaa aataaacaaa atatcttata cagaccaaat ttataaaagc 420 attaacttac aaagactaaa attaaaaaat aaacttacaa gaaaaaaata ctaatttatt 480 agaacaaaaa tatatttaac ccgcgttattattattt atatgttttt gaatcctggc 540 tcctgattga tctaactaga ggctcatatc tgactgtttt cttttttttg aaacactata 600 ctgtttgttt ggagaacttt gcaaataaat tggagggtta ca 642 <210> 5 <211> 12813 <212> DNA <213> Artificial sequences – the entire T-DNA sequence, and flanking sequences of the soybean genome at the 5' and 3' ends. <400> 5 ccttaatggt tgcatgtctg cctcatgttg ttgcttcgag gcctccaaat caacctctat 60 tttctttcgt aactattcca tctattcttg aatttccagt atggatgatg ttttggcttg 120 tgtggagcgc acaaatgaat taggatcgcc tctccttgtt gctaccattt tgggtccata 180 agagaatttt ccacgacccc acgatgggca ccaaatgttc ctactgagtt tcaacaatgt 240 tcttgttgag ttatgataag gttcgactga actatctggt cctctccttc ttagcggaat 300 ctctgatgtt gaagtgaggg gaggtactgc aaaagggact ccaacgagca agtcagtggt 360 gctttgaggt gtttatgtgt ctataactgg tatgagtaaa atgtgcttag ggatctcctc 420 tctaggtcta tatatacatg tccagtgttg aggggggttac gcaatgttcg gagccacgtt 480 gtcaaacact gatagtttaa actgaaggcg ggaaacgaca atctgatcaa gagcggagaa 540 ttaagggagt cacgttatga cccccgccga tgacgcggga caagccgttt tacgtttgga 600 actgacagaa ccgcaacgct gcaggaattg gccgcaggtg gatttgtatt aaactaatga 660 ctaattagtg gcactagcct caccgacttc gcagacgagg ccgctaagtc gcagctacgc 720 tctcaacggc actgactagg tagtttaaac gtgcacttaa ttaaggtacc gggaatttaa 780 atcccgggag gtctcgcaga cctagctagt tagaatcccg agacctaagt gactagggtc acgtgaccct agtcacttaa agcttgtcga caaaatttag aacgaactta attatgatct caaatacatt gatacatatc tcatctagat ctaggttatc attatgtaag aaagttttga cgaatatggc acgacaaaat ggctagactc gatgtaattg gtatctcaac tcaacattat acttatacca aacattagtt agacaaaatt taaacaacta ttttttatgt atgcaagagt cagcatatgt ataattgatt cagaatcgtt ttgacgagtt cggatgtagt agtagccatt atttaatgta catactaatc gtgaatagtg aatatgatga aacattgtat cttattgtat aaatatccat aaacacatca tgaaagacac tttctttcac ggtctgaatt aattatgata caattctaat agaaaacgaa ttaattacg ttgaattgta tgaatctaa ttgaacaagc 1380. gttgcctgga ttgactcggt ttaagttaac cactaaaaaa acggagctgt catgtaacac gcggatcgag caggtcacag tcatgaagcc atcaaagcaa aagaactat ccaagggctg agatgattaa ttagtttaa aattagttaa cacgaggga aaggctgtct gacagccagg tcacgttatc tttacctgtg gtcgaaatga ttcgtgtctg 1560 tcgattttaa ttatttttt gaaaggccga aaataaaagtt gtaagagata aacccgccta 1620 tataaattca tatattttcc tctccgcttt gaattgtctc gttgtcctcc tcactttcat 1680 cagccgtttt gaatctccgg cgacttgaca gagaagaaca aggaagaaga ctaagagaga 1740 aagtaagaga taatccagga gattcattct ccgttttgaa tcttcctcaa tctcatcttc 1800 ttccgctctt tctttccaag gtaataggaa ctttctggat ctactttatt tgctggatct 1860 cgatcttgtt ttctcaattt ccttgagatc tggaattcgt ttaatttgga tctgtgaacc 1920 tccactaaat cttttggttt tactagaatc gatctaagtt gaccgatcag ttagctcgat 1980 tatagctacc agaatttggc ttgaccttga tggagagatc catgttcatg ttacctggga 2040 aatgatttgt atatgtgaat tgaaatctga actgttgaag ttagattgaa tctgaacact 2100 gtcaatgtta gattgaatct gaacactgtt taaggttaga tgaagtttgt gtatagattc 2160 ttcgaaactt taggatttgt agtgtcgtac gttgaacaga aagctatttc tgattcaatc 2220 agggtttatt tgactgtatt gaactctttt tgtgtgtttg cagctcataa aaaggcgcgc 2280. catggcgcaa gttagcagaa tctgcaatgg tgtgcagaac ccatctctta tctccaatct ctcgaatcc agtcaacgca aatctccctt atcggtttct ctgaagacgc agcagcatcc acgagcttat ccgatttcgt cgtcgtgggg attgaagaag agtgggatga cgttaattgg ctctgagctt cgtcctctta aggtcatgtc ttctgtttcc acggcgtgca tgcttgccat 2520 ggataactca gttttgaaca gtggggagaac tacaatctgt gatgcttata acgtggcagc tcatgaccct ttttcttttc agcacagag tcttgatact gtccaaaagg agcacagag 2640 atggaaaaag aataaccact ctctttactt ggaccctatt gtgggtactg tcgcctcctt cctccttaaa aaagttggat cactcgttgg aaagagaatt ttgagtgagt tgagaaatct tattttccct tcaggatcta ccaatttgat gcaagacatt ctcaggggaga ctgaaaatt tctcaaccag aggcttaaca ctgacaccct cgccagagtg aatgctgagc ttactggctt gcaagctaat gttgaggagt ttaacaggca agtcgataaat ttcctcaatc caaacagaaa cgctgtgccc ctcagcataa cttcatcagt gaacactatg caacaactgt ttttgaatag 3000 attgccccag tttcagatgc aaggttacca actcctcttg cttccactct tcgcccaggc 3060 tgctaacctg catctcagtt ttatcaggga tgtgattttg aatgctgatg agtgggggat 3120 ttcagctgcc acccttagga cctaccgcga ttatctcaaa aactacacta gggactactc 3180 taattactgc attaacactt atcagagcgc tttcaaggga cttaatacca gactgcacga 3240 catgctcgag tttaggactt acatgtttct gaatgttttc gagtacgtca gtatttggag 3300 tcttttcaag tatcagtcac tccttgttag cagcggtgct aacttgtacg cttctgggtc 3360 agggccccag cagactcaga gctttacaag ccaggattgg cccttcctgt attctctgtt 3420 tcaagtgaat agtaattacg tgttgaacgg tttctccggg gctaggctgt caaatacctt 3480 tcccaacatt gtgggacttc ctggatctac taccactcac gctctcctgg cagctagggt 3540 taattattct ggcggcatta gtagcggaga tattggggct tctccattca atcagaattt 3600 caactgttct actttcttc ctccactcct tactcccttc gttagatcct ggttggatag 3660 tgggtctgat agagagggcg tcgccaccgt tacaaactgg caaaccgaat cctttgaaac aacactcgga cttaggtctg gcgctttcac agctagagga aattccaatt actttcctga 3780 ttattttatt aggregate gtggcgttcc actcgttgtt aggregate acctgaggag 3840 acctcttcat tacaacgaa tagcctctcca tcaggcaccc ctggcggagc tagggcttat atggtttccg tgcataatag aaagaacaac attcatgctg tccacgagaa tggatcaatg attcacctgg ctcccaacga ctataccggg tttactattt cacctattca cgccacacaa gtcaacaatc agacaaggac cttcatttcc gagaaattcg gaaatcaggg ggacagtctg agattcgagc agaatacac taccgcaaga tatactctta gaggaaatgg aaattcttac aacttgtact tgagggtgag ctcaatcggc aattcaacaa tcagagttac fathercggc agggtgtata ctgcaacaaa cgtcaacact actacaaaca atgatggcgt 4320. 4320. 4320. 4320. 4320. 4320. 4320. 4320. 4320. 4320 ttcagatgtg ccccttgata ttaacgtgac acttaattca ggcacccaat ttgacttgat gaacataatg ctggtgccca caaatatctc accactctac tatacgtac agctttcgtt 4440 cgtatcatcg gttcgacaa cgttcgtcaa gttcaatgca tcagtttcat tgcgcacaca 4500 ccagaatcct actgagtttg agtattatgg cattgggaaa actgtttttc ttgtaccatt 4560 tgttgtgctt gtaatttact gtgtttttta ttcggttttc gctatcgaac tgtgaaatgg 4620 aaatggatgg agaagagtta atgaatgata tggtcctttt gttcattctc aaattaatat 4680 tatttgtttt ttctcttatt tgttgtgtgt tgaatttgaa attataagag atatgcaaac 4740 atttgtttt gagtaaaaat gtgtcaaatc gtggcctcta atgaccgaag ttaatatgag 4800 gagtaaaaca cttgtagttg taccattatg cttattcact aggcaacaaa tatattttca 4860 gacctagaaa agctgcaaat gttactgaat acaagtatgt cctcttgtgt tttagacatt 4920 tatgaacttt cctttatgta atttccaga atccttgtca gattctaatc attgctttat 4980 aattatagtt atactcatgg atttgtagtt gagtatgaaa atatttttta atgcatttta 5040 tgacttgcca attgattgac aacatgcatc aatggatccc aaatttatta tgtgtttttt 5100 ttccgtggtc gagattgtgt attattctt agttattaca agactttag ctaaaatttg 5160 aaagaattta ctttaagaaa attacktacat ctgagataat ttcagcaata gattatattt 5220 ttcattactc tagcagtatt ttcattactc aatcgcaaca tatatggttg ttagaaaaaa 5280 tgcactatat atatatatat tattttttca attaaagtg catgatatat atatata 5340 tatatata tgtgtgtgtg tatatgtca aagaaatttct tatacaata tacacgaaca 5400 catatattg aaaaatca agtattacac taaacaatga gttggtgcat ggccaaaaca 5460 atatgtaga ttaaaaatttc cagcctccaa aaaaaatcc aagtgttgta aagcattata 5520 tatatatagt agatcccaaa tttgtaca attccacact gatcgaattt ttaaagttga 5580 atatctgacg taggatttt ttaatgtctt acctgaccat ttactaataa cattcatacg 5640 ttttcattg aaatatccctc tataattata ttgaatttg cacatataa gaaacctaat 5700 tggtgattta tttactagt aaatttctgg tgatggctt tcactagaa agctctcgga 5760 aaatcttgga ccaatccat attccatgac ttcgattgtt aaccctatta gtttcacaa 5820 acatactatc atatcattg caacggaaaa ggtacaagta aacattca tccgataggg 5880 aagtgatgta ggaggttggg aagacaggcc cagaagaga tttactgac ttgttttgtg 5940 tatagttttc aatgttcata aaggagatg gagacttgag aagtttttt tggactttgt 6000 ttagctttgt tggcgtttt tttttgat caataacttt gttgggct tgatttgtaa 6060 tattttcgtg gactctttag tttatttaga cgtgctaact tgttgggct tatgacttgt 6120 tgtaacatat tgtacagat gacttgatgt gcgactaatc tttacacatt aacatagtt 6180 ctgtttttg aaagttctta ttcatttt tatttgaatg tattatattt ttctatattt 6240 aatattctag taaaaggcaa atttgcttt taaatgaaa aaatatatat tccacagtttt 6300 cacctaatct tatgcattta gcagtacaa ttcaaaatt tcccatttt attcatgaat 6360 cataccatta tatattaact aaatccaagg taaaaaaaag gtatgaaagc tctatagtaa 6420 gtaaaatata aattccccat aaggaaaggg ccaagtccac caggcaagta aaatgagcaa 6480 gcaccactcc accatcacac aatttcactc atagataacg atagattca tggaattatc 6540 ttccacgtgg cattattcca gcggttcaag ccgataaggg tctcaacacc tctccttagg 6600 cctttgtggc cgttaccaag taaaattaac ctcacacata tccacactca aaatccaacg 6660 gtgtagatcc tagtccactt gaatctcatg tatcctagac cctccgatca ctccaaagct 6720 tgttctcatt gttgttatca ttatatatag atgaccaaag cactagacca aacctcagtc 6780 acacaaagag taaagaagaa caatggcttc ctctatgctc tcttccgcta ctatggttgc 6840 ctctccggct caggccacta tggtcgctcc tttcaacgga cttaagtcct ccgctgcctt 6900 cccagccacc cgcaaggcta acaacgacat tacttccatc acaagcaacg gcggaagagt 6960 taactgcatg caggtgtggc ctccgattgg aaagaagaag tttgagactc tctcttacct 7020 tcctgacctt accgattccg gtggtcgcgt caactgcatg caggccatgg acaacaaccc 7080 aaacatcaac gaatgcattc catacaactg cttgagtaac ccagaagttg aagtacttgg 7140 tggagaacgc attgaaaccg gttacactcc catcgacatc tccttgtcct tgacacagtt 7200 tctgctcagc gagttcgtgc caggtgctgg gttcgttctc ggactagttg acatcatctg 7260 gggtatcttt ggtccatctc aatgggatgc attcctggtg caaattgagc agttgatcaa 7320 ccagaggatc gaagagttcg ccaggaacca ggccatctct aggttggaag gattgagcaa 7380 tctctaccaa atctatgcag agagcttcag agagtgggaa gccgatccta ctaacccagc 7440 tctccgcgag gaaatgcgta ttcaattcaa cgacatgaac agcgccttga ccacagctat 7500 cccattgttc gcagtccaga actaccaagt tcctctcttg tccgtgtacg ttcaagcagc 7560 taatcttcac ctcagcgtgc ttcgagacgt tagcgtgttt gggcaaaggt ggggattcga 7620 tgctgcaacc atcaatagcc gttacaacga ccttactagg ctgattggaa actacaccga 7680 ccacgctgtt cgttggtaca acactggctt ggagcgtgtc tggggtcctg attctagaga 7740 ttggattaga tacaaccagt tcaggagaga attgaccctc acagttttgg acattgtgtc 7800 tctcttcccg aactatgact ccagaaccta ccctatccgt acagtgtccc aacttaccag 7860 agaaatctat actaacccag ttcttgagaa cttcgacggt agcttccgtg gttctgccca 7920 aggtatcgaa ggctccatca ggagcccaca cttgatggac atcttgaaca gcatactat 7980 ctacaccgat gctcacagag gagagtatta ctggtctgga caccagatca tggcctctcc 8040 agttggattc agcgggcccg agtttacctt tcctctctat ggaactatgg gaaacgccgc 8100 tccacaacaa cgtatcgttg ctcaactagg tcagggtgtc tacagaacct tgtcttccac 8160 cttgtacaga agacccttca atatcggtat caacaaccag caactttccg ttcttgacgg 8220 aacagagttc gcctatggaa cctcttctaa cttgccatcc gctgtttaca gaaagagcgg 8280 aaccgttgat tccttggacg aaatcccacc acagaacaac aatgtgccac ccaggcaagg 8340 attctcccac aggttgagcc acgtgtccat gttccgttcc ggattcagca acagttccgt 8400 gagcatcatc agagctccta tgttctcttg gatacatcgt agtgctgagt tcaacaacat 8460 catcgcatcc gatagtatta ctcaaatccc tgcagtgaag ggaaactttc tcttcaacgg 8520 ttctgtcatt tcaggaccag gattcactgg tggagacctc gttagactca acagcagtgg 8580 aaataacatt cagaatagag ggtatattga agttccaatt cacttcccat ccacatctac 8640 cagatataga gttcgtgtga ggtatgcttc tgtgacccct attcacctca acgttaattg 8700 gggtaattca tccatcttct ccaatacagt tccagctaca gctacctcct tggataatct 8760 ccaatccagc gatttcggtt actttgaaag tgccaatgct tttacatctt cactcggtaa 8820 catcgtgggt gttagaaact ttagtgggac tgcaggagtg attatcgaca gattcgagtt 8880 tattccagtt actgcaacac tcgaggctga gtacaacctt gagagagccc agaaggctgt 8940 gaacgccctc tttacctcca ccaatcagct tggcttgaaa actaacgtta ctgactatca 9000 cattgaccaa gtgtccaact tggtcaccta ccttagcgat gagttctgcc tcgacgagaa 9060 gcgtgaactc tccgagaaag ttaaacacgc caagcgtctc agcgacgaga ggaatctctt 9120 gcaagactcc aacttcaaag acatcaacag gcagccagaa cgtggttggg gtggaagcac 9180 cgggataacc atccaaggag gcgacgatgt gttcaaggag aactacgtca ccctctccgg 9240 aactttcgac gagtgctacc ctacctactt gtaccagaag atcgatgagt ccaaactcaa 9300 agccttcacc aggtatcaac ttagaggcta catcgaagac agccaagacc ttgaaatcta 9360 ctcgatcagg tacaatgcca agcacgagac cgtgaatgtc ccaggtactg gttccctctg 9420 gccactttct gcccaatctc ccattgggaa gtgtggagag cctaacagat gcgctccaca 9480 ccttgagtgg aatcctgact tggactgctc ctgcagggat ggcgagaagt gtgcccacca 9540 ttctcatcac ttctccttgg acatcgatgt gggatgtact gacctgaatg aggacctcgg 9600 agtctgggtc atcttcaaga tcaagaccca agacggacac gcaagacttg gcaaccttga 9660 gtttctcgaa gagaaaccat tggtcggtga agctctcgct cgtgtgaaga gagcagagaa 9720 gaagtggagg gacaaacgtg agaaactcga atgggaaact aacatcgttt acaaggaggc 9780 caaagagtcc gtggatgctt tgttcgtgaa ctcccaatat gatcagttgc aagccgacac 9840 caacatcgcc atgatccacg ccgcagacaa acgtgtgcac agcattcgtg aggcttactt 9900 gcctgagttg tccgtgatcc ctggtgtgaa cgctgccatc ttcgaggaac ttgagggacg 9960 tatctttacc gcattctcct tgtacgatgc cagaaacgtc atcaagaacg gtgacttcaa 10020 caatggcctc agctgctgga atgtgaaagg tcatgtggac gtggaggaac agaacaatca 10080 gcgttccgtc ctggttgtgc ctgagtggga agctgaagtg tcccaagagg ttagagtctg 10140 tccaggtaga gctacattc tccgtgtgac cgcttacaag gagggatacg gtgaggttg 10200 cgtgaccatc cacgagatcg agacacac cgacgagctt aagttctcca actgcgtcga 10260 ggaagaaatc tatcccaca acaccgttac ttgcaacgac tacactgtga atcaggaga 10320 gtacggaggt gcctacacta gccgtacag agttacac gaagctcctt ccgttccctgc 10380 tgactatgcc tccgtgtacg aggagaatc ctacacagat ggcagacgtg agaacccttg 10440 cgagttcaac agaggttaca gggactacac accactcca gttggctatg ttaccaagga 10500 gcttgagtac tttcctgaga ccgacaagt gtggatcgag atcggtgaaa ccgagggaac 10560 cttcatcgtg gatagcgtgg agcttctctt gatggaggaa taaggcgccg atcgttcaa 10620 catttggcaa taaagttct taagattgaa tcctgttgcc ggtcttgcga tgattcat 10680 ataatttctg ttgaattacg ttaagcatgt ataattac atgtaatgca tgacgttatt 10740 tatgagatgg gtttttag ttagagtccc gcaattatac attatacg cgatagaaaa 10800 haaaatag cgcgcaact aggaataatt atcgcgcgcg gtgtcatcta tgttactaga 10860 tcggcgcgcc agtaagtgac tagatcacg tgaccctgt cacttaaatc ctaggccatg 10920 gagtcaaga ttcaataga ggacctaca gaactcgccg windowgactgg cgacagttc 10980 atacagagtc tcttacgact caatgacaag aagaaaatct tcgtcacat ggtggagcac 11040 gandacgcttg tctactccaa aaatatcaa gatacagtct cagaagacca aagggcaatt 11100 gagactttc aaaaagggt atatccgga aacctccctcg gattccattg cccagctatc 11160 tgtcacttta ttgtgaagat agtggaaag gaaggtggct cctacaaatg ccatcattgc 11220 gataaaggaa agccatcgt tgagatgcc tctgccgaca gtggtccca agatggaccc 11280 ccacccacga ggagcatcgt ggaaaaagaa gacgttccaa ccacgtctc aaagcaagtg 11340 gattgatgtg atatctccac tgacgtagg gatgacgcac atcccacta tccttcgcaa 11400 gaccctcct ctatatagg aagttcattt cattggaga ggacaatgtc tccggagg 11460 agaccagttg agattaggcc agctacagca gctgatatgg ccgcggttg tgatatcgtt 11520 aaccattaca ttgagacgtc tacagtgaac tttaggacag agccacaaac accacaagag 11580 tggattgatg atctagagag gttgcaagat agataccctt ggttggttgc tgaggttgag 11640 ggtgttgtgg ctggtattgc ttacgctggg ccctggaagg ctaggaacgc ttacgattgg 11700 acagttgaga gtactgttta cgtgtcacat aggcatcaaa ggttgggcct aggatccaca 11760 ttgtacacac atttgcttaa gtctatggag gcgcaaggtt ttaagtctgt ggttgctgtt 11820 ataggccttc caaacgatcc atctgttagg ttgcatgagg ctttgggata cacagcccgg 11880 ggtacattgc gcgcagctgg atacaagcat ggtggatggc atgatgttgg tttttggcaa 11940 agggattttg agttgccagc tcctccaagg ccagttaggc cagttaccca gatctgactg 12000 aaatcaccag tctctctcta caaatctatc tctctctata ataatgtgtg agtagttccc 12060 agataaggga attagggttc ttatagggtt tcgctcatgt gttgagcata taagaaaccc 12120 ttagtatgta tttgtatttg taaaatactt ctatcaataa aatttctaat tcctaaaacc 12180 aaaatccagt ggcctgcagg gaattcttaa ttaagtgcac gcggccgcct acttagtcaa 12240 gagcctcgca cgcgactgtc acgcggccag gatcgcctcg tgagcctcgc aatctgtacc 12300 tagtttagct agttaggacg ttaacaggga cgcgcctggc cgtatccgca atgtgttatt 12360 aagttgtcta agcgtcaatt tgtttacacc acaatattgg ttcttataag ttttttatt 12420 tatttttaat ctttataaat ttgtgttttt tcaattttaa tccctttaaa attttaattt 12480 ttatttataa tccttataag ttcatgttta tagagatcaa attaaaaaa taatattta 12540 tagggactaa aaataaacaa aatatcttat acagaccaaa tttataaaag cattaactta 12600 caaagactaa attaaaaaa taaacttaca agaaaaaaat actaatttat tagaacaaaa 12660 atatatttaa cccgcgttat tattactatt tatatgtttt tgaatcctgg ctcctgattg 12720 atctaactag aggctcatat ctgactgttt tcttttttt gaaactat actgtttgtt 12780 tggagaactt tgcaaataaa ttggagggtt aca 12813 <210> 6 <211> 300 <212> DNA <213> pDBN4031 pDBN4031 DNA sequencing prAtAct2‐01 sequence (Artificial Sequence) <400> 6 tacgtttgga actgacagaa ccgcaacgct gcaggaattg gccgcaggtg gatttgtatt 60 aaactaatga ctaattagtg gcactagcct caccgacttc gcagacgagg ccgctaagtc 120 gcagctacgc tctcaacggc actgactagg tagtttaaac gtgcacttaa ttaaggtacc 180 gggaatttaa atcccgggag gtctcgcaga cctagctagt tagaatcccg agacctaagt 240 gactagggtc acgtgaccct agtcacttaa agcttgtcga caaaatttag aacgaactta 300 <210> 7 <211> 280 <212> DNA <213> Artificial Sequence - spanning the t35S transcriptional terminator sequence and the pDBN4031 construct DNA sequence <400> 7 gttgagcata taagaaaccc ttagtatgta tttgtatttg taaaatactt ctatcaataa 60 aatttctaat tcctaaaacc aaaatccagt ggcctgcagg gaattcttaa ttaagtgcac 120 gcggccgcct acttagtcaa gagcctcgca cgcgactgtc acgcggccag gatcgcctcg 180 tgagcctcgc aatctgtacc tagtttagct agttaggacg ttaacaggga cgcgcctggc 240 cgtatccgca atgtgttatt aagttgtcta agcgtcaatt 280 <210> 8 <211> 21 <212> DNA <213> Artificial Sequence - Amplification of the First Primer of SEQ ID NO:3 <400> 8 gcctcatgtt gttgcttcga g 21 <210> 9 <211> twenty one <212> DNA <213> Artificial Sequence - Amplification of the Second Primer for SEQ ID NO:3 <400> 9 tttaatacaa atccacctgc g 21 <210> 10 <211> twenty one <212> DNA <213> Artificial Sequence - Amplification of the First Primer of SEQ ID NO:4 <400> 10 cctaaaacca aaatccagtg g 21 <210> 11 <211> twenty two <212> DNA <213> Artificial Sequence - Amplification of the Second Primer for SEQ ID NO:4 <400> 11 tgtaaccctc caatttattt gc 22 <210> 12 <211> 20 <212> DNA <213> Artificial Sequence - Primer on the 5' flanking genome sequence <400> 12 aagggactcc aacgagcaag 20 <210> 13 <211> 20 <212> DNA <213> Artificial Sequence – A primer located on T-DNA that pairs with SEQ ID NO:12. <400> 13 agattgtcgt ttcccgcctt 20 <210> 14 <211> twenty two <212> DNA <213> Primers on the 3' flanking genome sequence of the artificial sequence, when paired with SEQ ID NO:12, can detect whether the transgene is homozygous or heterozygous (Artificial Sequence). <400> 14 tcaatcagga gccaggattc aa 22 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence – A primer located on T-DNA that pairs with SEQ ID NO:14. <400> 15 cgtgagcctc gcaatctgta 20 <210> 16 <211> twenty two <212> DNA <213> Artificial Sequence - Taqman First Primer for Detecting the cCry2Ab Gene <400> 16 gtccacgaga atggatcaat ga 22 <210> 17 <211> twenty four <212> DNA <213> Artificial Sequence - Taqman Second Primer for Detecting the cCry2Ab Gene <400> 17 gtgtggcgtg aataggtgaa atag 24 <210> 18 <211> 27 <212> DNA <213> Artificial Sequence - TaqMan probe for detecting the cCry2Ab gene. <400> 18 ctggctccca acgactatac cgggttt 27 <210> 19 <211> twenty two <212> DNA <213> Artificial Sequence - TaqMan First Primer for Detecting the cCry1Ac Gene <400> 19 gacacagttt ctgctcagcg ag 22 <210> 20 <211> twenty three <212> DNA <213> Artificial Sequence - Taqman Second Primer for Detecting the cCry1Ac Gene <400> 20 cccagatgat gtcaactagt ccg 23 <210> twenty one <211> twenty three <212> DNA <213> Artificial Sequence - TaqMan probe for detecting the cCry1Ac gene. <400> twenty one cgtgccaggt gctgggttcg ttc 23 <210> twenty two <211> twenty two <212> DNA <213> Artificial Sequence – TaqMan first primer for detecting the cPAT gene. <400> twenty two gagggtgttg tggctggtat tg 22 <210> twenty three <211> twenty three <212> DNA <213> Artificial Sequence – TaqMan second primer for detecting the cPAT gene. <400> twenty three tctcaactgt ccaatcgtaa gcg 23 <210> twenty four <211> 25 <212> DNA <213> Artificial Sequence - TaqMan probe for detecting the cPAT gene. <400> twenty four cttacgctgg gccctggaag gctag 25 <210> 25 <211> 25 <212> DNA <213> Artificial Sequence – First primer of the soybean endogenous gene lectin <400> 25 tgccgaagca accaaacatg atcct 25 <210> 26 <211> 25 <212> DNA <213> Artificial Sequence – Second primer for the soybean endogenous gene lectin <400> 26 tgatggatct gatagsattg acgtt 25 <210> 27 <211> 370 <212> DNA <213> Artificial Sequence for Detecting the cCry2Ab Gene using Southern Hybridization <400> 27 tcagagcgct ttcaagggac ttaataccag actgcacgac atgctcgagt ttaggactta 60 catgtttctg aatgttttcg agtacgtcag tatttggagt cttttcaagt atcagtcact 120 ccttgttagc agcggtgcta acttgtacgc ttctgggtca gggccccagc agactcagag 180 ctttacaagc caggattggc ccttcctgta ttctctgttt caagtgaata gtaattacgt 240 gttgaacggt ttctccgggg ctaggctgtc aaataccttt cccaacattg tgggacttcc 300 tggatctact accactcacg ctctcctggc agctagggtt aattattctg gcggcattag 360 tagcggagat 370 <210> 28 <211> 364 <212> DNA <213> Probe for cCry1Ac gene in Southern hybridization detection (Artificial Sequence) <400> 28 caccagatca tggcctctcc agttggattc agcgggcccg agtttacctt tcctctctat 60 ggaactatgg gaaacgccgc tccacaacaa cgtatcgttg ctcaactagg tcagggtgtc 120 tacagaacct tgtcttccac cttgtacaga agacccttca atatcggtat caacaaccag 180 caactttccg ttcttgacgg aacagagttc gcctatggaa cctcttctaa cttgccatcc 240 gctgtttaca gaaagagcgg aaccgttgat tccttggacg aaatcccacc acagaacaac 300 aatgtgccac ccaggcaagg attctcccac aggttgagcc acgtgtccat gttccgttcc 360 ggat 364 <210> 29 <211> 310 <212> DNA <213> Artificial Sequence for cPAT Gene Detection in Southern Hybridization <400> 29 cagacttaaa accttgcgcc tccatagact taagcaaatg tgtgtacaat gtggatccta 60 ggcccaacct ttgatgccta tgtgacacgt aaacagtact ctcaactgtc caatcgtaag 120 cgttcctagc cttccagggc ccagcgtaag caataccagc cacaacaccc tcaacctcag 180 caaccaacca agggtatcta tcttgcaacc tctctagatc atcaatccac tcttgtggtg 240 tttgtggctc tgtcctaaag ttcactgtag acgtctcaat gtaatggtta acgatatcac 300 aaaccgcggc 310 <210> 30 <211> 20 <212> DNA <213> Artificial Sequence – A primer located on T-DNA, aligned with the orientation of SEQ ID NO:13. <400> 30 cgtgacccta gtcacttagg 20 <210> 31 <211> 20 <212> DNA <213> Artificial Sequence – A primer located on T-DNA, aligned with the orientation of SEQ ID NO:15. <400> 31 ttaggccagt tacccagatc 20 <210> 32 <211> twenty one <212> DNA <213> Artificial Sequence – A primer located on T-DNA, in the opposite direction to SEQ ID NO:13. <400> 32 cgttatcttt acctgtggtc g 21 <210> 33 <211> 19 <212> DNA <213> Artificial Sequence – A primer located on T-DNA, in the opposite direction to SEQ ID NO:13. <400> 33 cgctctttct ttccaaggt 19 <210> 34 <211> twenty two <212> DNA <213> Artificial Sequence – A primer located on T-DNA, in the opposite direction to SEQ ID NO:15. <400> 34 aaccttgcgc ctccatagac tt 22 <210> 35 <211> 20 <212> DNA <213> Artificial Sequence – A primer located on T-DNA, in the opposite direction to SEQ ID NO:15. <400> 35 ccagccacaa caccctcaac 20 <210> 36 <211> 1208 <212> DNA <213> Artificial Sequence (Artificial Sequence) <400> 36 aactattttt atgtatgcaa gagtcagcat atgtataatt gattcagaat cgttttgacg 60 agttcggatg tagtaggc cattatttaa tgtacatact aatcgtgaat agtgaatatg 120 atgaaacatt gtatcttatt gtataaatat ccataaacac atcatgaaag acactttctt 180 tcacggtctg aattaattat gatacaattc tatagaaaa cgaattaaat tacgttgaat 240 tgtatgaaat ctaattgaac aagccaacca cgacgacgac taacgttgcc tggattgact 300 cggtttaagt taaccactaa aaaaacggag ctgtcatgta acacgcggat cgagcaggtc 360 acagtcatga agccatcaaa gcaaaagaac taatccaagg gctgagatga ttaattagtt 420 taaaaattag ttaacacgag ggaaaaggct gtctgacagc caggtcacgt tatctttacc 480 tgtggtcgaa atgattcgtg tctgtcgatt ttaattattt ttttgaaagg ccgaaaataa 540 agttgtaaga gataaacccg cctatataaa ttcatatatt ttctctccgc tttgaattgt 600 ctcgttgtcc tcctcacttt catcggccgt ttttgaatct ccggcgactt gacagagaag 660 aacaaggaag aagactaaga gagaaagtaa gagataatcc aggagattca ttctccgttt 720 tgaatcttcc tcaatctcat cttcttccgc tctttctttc caaggtaata ggaactttct 780 ggatctactt tatttgctgg atctcgatct tgttttctca atttccttga gatttggaat 840 tcgtttaatt tggatctgtg aacctccact aaatcttttg gttttactag aatcgatcta 900 agttgaccga tcagttagct cgattatagc taccagaatt tggcttgacc ttgatggaga 960 gatccatgtt catgttacct gggaaatgat ttgtatatgt gaattgaaat ctgaactgtt 1020 gaagttagat tgaatctgaa cactgtcaat gttagattga atctgaacac tgtttaaggt 1080 tagatgaagt ttgtgtatag attcttcgaa actttaggat ttgtagtgtc gtacgttgaa 1140 cagaaagcta tttctgattc aatcagggtt tatttgactg tattgaactc tttttgtgtg 1200 tttgcagc 1208 <210> 37 <211> 300 <212> DNA <213> Nucleotide sequence of tOsMth (Oryza sativa) <400> 37 ggccaaggcg atctatgact gaattgccaa tgcaccagcc tgtctacatg atgaataaat 60 aaagagtcca tccagtgtga tggctcatgc ctgtgtgagt gtgactgaat ccatcagtgt 120 gtgtgtgtgt ttgtgtcaac catgtgtgaa tcaggtgtca aaaatcgtgg ctggaaatcc 180 atgtggtttc tagctttatg taaatgttgt ttgtgaaata taaatattgt tttgtgtatg 240 tgaattttac tctctcattt ttctcttgca ctcaccattc tattatagta atttttttaa 300 <210> 38 <211> 400 <212> DNA <213> Nucleotide sequence of tMtPt1 (Medicago truncatula) <400> 38 gcaaggagga tcatgaacat cacaaagtga atttatttta tgtttgcacc atatattatt 60 atttgtgaca cattttagaa ctcttaaacc atttttctgt ttgcatttta gctactggtt 120 gttgtattca caataatgat gcagtcctat gcttcttggt gtaagattca atactatgta 180 aagtgtatgt ctttggttgt atactattta aaatctattc ttgtattgta taatttattt 240 tagcctttgt ttgagattga ggttacttgt tctgttgcat ttaatcacaa gttttcattt 300 tgttatacgt acgtgttata ccctgttttt ggacctaaaa atactgggcc caatttcatt 360 tcaaactttg tcaattatca aatttcaact gcacagttca 400

Claims

1. A nucleic acid molecule having the following nucleic acid sequence, characterized in that, The nucleic acid molecule contains SEQ ID NO:1 or its complete complementary sequence, and / or SEQ ID NO:2 or its complete complementary sequence; the nucleic acid molecule is derived from the transgenic soybean event DBN8205, which is deposited in seed form at the China General Microbiological Culture Collection Center with accession number CGMCCNo.45071.

2. The nucleic acid molecule according to claim 1, characterized in that, The nucleic acid molecule contains SEQ ID NO:3 or its completely complementary sequence, and / or SEQ ID NO:4 or its completely complementary sequence.

3. The nucleic acid molecule according to claim 1 or 2, characterized in that, The nucleic acid molecule contains SEQ ID NO:5 or its complete complementary sequence.

4. A method for detecting the presence of DNA from the transgenic soybean event DBN8205 in a sample, characterized in that, include: The sample to be tested is brought into contact with at least two primers used to amplify the target amplification product during the nucleic acid amplification reaction; Perform nucleic acid amplification reaction; and Detect the presence of the target amplification product; The target amplification product comprises the nucleic acid molecule described in any one of claims 1-3; The genetically modified soybean event DBN8205 is deposited in seed form at the China General Microbiological Culture Collection Center under the accession number CGMCC No. 45071.

5. The method for detecting the presence of DNA from the transgenic soybean event DBN8205 in a sample according to claim 4, characterized in that, The target amplified product comprises SEQ ID NO:1 or its completely complementary sequence, SEQ ID NO:2 or its completely complementary sequence, SEQ ID NO:6 or its completely complementary sequence, and / or SEQ ID NO:7 or its completely complementary sequence.

6. The method for detecting the presence of DNA from the transgenic soybean event DBN8205 in a sample according to claim 4 or 5, characterized in that, The two primers include SEQ ID NO:8 and SEQ ID NO:9, or SEQ ID NO:10 and SEQ ID NO:

11.

7. A method for detecting the presence of DNA from the transgenic soybean event DBN8205 in a sample, characterized in that, include: The sample to be tested is brought into contact with the probe, wherein the probe comprises a nucleic acid molecule as described in any one of claims 1-3; and The sample to be tested and the probe are hybridized under strict hybridization conditions; and The hybridization between the sample to be tested and the probe is detected; The genetically modified soybean event DBN8205 is deposited in seed form at the China General Microbiological Culture Collection Center under the accession number CGMCC No. 45071.

8. The method for detecting the presence of DNA from the transgenic soybean event DBN8205 in a sample according to claim 7, characterized in that, The probe comprises SEQ ID NO:1 or its complete complementary sequence, SEQ ID NO:2 or its complete complementary sequence, SEQ ID NO:6 or its complete complementary sequence, and / or SEQ ID NO:7 or its complete complementary sequence.

9. The method for detecting the presence of DNA from the transgenic soybean event DBN8205 in a sample according to claim 7 or 8, characterized in that, At least one of the probes is labeled with at least one fluorescent group.

10. A method for detecting the presence of DNA from the transgenic soybean event DBN8205 in a sample, characterized in that, include: The sample to be tested is brought into contact with a labeled nucleic acid molecule, wherein the labeled nucleic acid molecule includes the nucleic acid molecule described in any one of claims 1-3; The sample to be tested and the labeled nucleic acid molecules are hybridized under strict hybridization conditions; The hybridization of the sample to be tested and the marker nucleic acid molecule is detected, and then marker-assisted breeding analysis is used to determine whether insect resistance and / or herbicide tolerance are genetically linked to the marker nucleic acid molecule; The genetically modified soybean event DBN8205 is deposited in seed form at the China General Microbiological Culture Collection Center under the accession number CGMCC No. 45071.

11. The method for detecting the presence of DNA from the transgenic soybean event DBN8205 in a sample according to claim 10, characterized in that, The labeled nucleic acid molecule further includes at least one selected from: SEQ ID NO:1 or its completely complementary sequence, SEQ ID NO:2 or its completely complementary sequence, and SEQ ID NO:6-11 or its completely complementary sequence.

12. A DNA detection kit, characterized in that, It includes at least one DNA molecule, said DNA molecule comprising the nucleic acid molecule of any one of claims 1-3, which serves as one of the DNA primers or probes specific to the transgenic soybean event DBN8205 or its progeny; The genetically modified soybean event DBN8205 is deposited in seed form at the China General Microbiological Culture Collection Center under the accession number CGMCC No. 45071.

13. The DNA detection kit according to claim 12, characterized in that, The DNA molecule contains SEQ ID NO:1 or its complete complementary sequence, SEQ ID NO:2 or its complete complementary sequence, SEQ ID NO:6 or its complete complementary sequence, and / or SEQ ID NO:7 or its complete complementary sequence.

14. A plant cell or part thereof, characterized in that, The plant cells or portions thereof contain nucleic acid molecules as described in any one of claims 1-3.

15. The plant cell or part according to claim 14, characterized in that, The plant cells or portions thereof contain nucleic acid sequences encoding insect resistance Cry2Ab protein, insect resistance Cry1Ac protein, glufosinate tolerance PAT protein, and specific regions of nucleic acid sequences.

16. The plant cell or part according to claim 14 or 15, characterized in that, The plant cells or portions contain genetically modified soybean event DBN8205; The genetically modified soybean event DBN8205 is deposited in seed form at the China General Microbiological Culture Collection Center under the accession number CGMCC No. 45071.

17. The plant cell or part according to claim 16, characterized in that, The plant cells or portions may also contain at least one other genetically modified soybean event different from the genetically modified soybean event DBN8205.

18. The plant cell or part according to claim 17, characterized in that, The other genetically modified soybean events mentioned are genetically modified soybean event DBN9004 and / or genetically modified soybean event DBN8002.

19. A method for protecting soybean plants from insect infestation, characterized in that, The invention includes providing at least one transgenic soybean plant cell in the diet of a target insect, the transgenic soybean plant cell containing in its genome SEQ ID NO:1 or its complete complementary sequence, and / or SEQ ID NO:2 or its complete complementary sequence, the target insect that ingests the transgenic soybean plant cell being inhibited from further ingesting the transgenic soybean plant; The sequence is derived from the transgenic soybean event DBN8205, which is deposited in seed form at the China General Microbiological Culture Collection Center with accession number CGMCC No. 45071.

20. The method for protecting soybean plants from insect infestation according to claim 19, characterized in that, The transgenic soybean plant cells contain SEQ ID NO:3 or its complete complementary sequence, and / or SEQ ID NO:4 or its complete complementary sequence in their genome.

21. The method for protecting soybean plants from insect infestation according to claim 19 or 20, characterized in that, The transgenic soybean plant cells contain, in their genome, the nucleic acid sequences of positions 866-12192 of SEQ ID NO:1 and SEQ ID NO:5, and SEQ ID NO:2, or the sequence shown in SEQ ID NO:

5.

22. A method for protecting soybean plants from damage caused by herbicides or controlling weeds in fields where soybean plants are grown, characterized in that, The invention includes applying an effective dose of glufosinate herbicide to a field in which at least one transgenic soybean plant is grown, the transgenic soybean plant containing SEQ ID NO:1 or its complete complementary sequence, and / or SEQ ID NO:2 or its complete complementary sequence in its genome, the transgenic soybean plant being tolerant to glufosinate herbicide; The sequence is derived from the transgenic soybean event DBN8205, which is deposited in seed form at the China General Microbiological Culture Collection Center with accession number CGMCC No. 45071.

23. The method for protecting soybean plants from damage caused by herbicides or controlling weeds in fields where soybean plants are grown, as described in claim 22, is characterized in that... The genetically modified soybean plant contains SEQ ID NO:3 or its complete complementary sequence, and / or SEQ ID NO:4 or its complete complementary sequence in its genome.

24. The method for protecting soybean plants from damage caused by herbicides or controlling weeds in fields where soybean plants are grown, as described in claim 22 or 23, is characterized in that... The genetically modified soybean plant contains, in sequence, the nucleic acid sequences of SEQ ID NO:1, SEQ ID NO:5 positions 866-12192 and SEQ ID NO:2 in its genome, or contains the sequence shown in SEQ ID NO:

5.

25. A method for cultivating soybean plants resistant to and / or tolerant of insect-specific glufosinate herbicides, characterized in that, include: Plant at least one soybean seed, wherein the genome of the soybean seed contains a nucleic acid sequence encoding an insect resistance Cry2Ab protein and / or an insect resistance Cry1Ac protein and / or an encoder of a glufosinate-ammonium herbicide tolerance PAT protein, and a nucleic acid sequence of a specific region, or the genome of the soybean seed contains the nucleic acid molecule shown in SEQ ID NO:5; The soybean seeds are then allowed to grow into soybean plants. The soybean plants were attacked with target insects and / or sprayed with an effective dose of glufosinate herbicide, and the plants with reduced plant damage compared to other plants that do not have a specific region of nucleic acid sequence were harvested. The nucleic acid molecule in the specific region contains SEQ ID NO:1 or its complete complementary sequence, and / or SEQ ID NO:2 or its complete complementary sequence; The sequence is derived from the transgenic soybean event DBN8205, which is deposited in seed form at the China General Microbiological Culture Collection Center with accession number CGMCC No. 45071.

26. The method for cultivating soybean plants resistant to and / or tolerant of glufosinate-ammonium herbicide according to claim 25, characterized in that, The nucleic acid molecule in the specific region contains SEQ ID NO:3 or its complete complementary sequence, and / or SEQ ID NO:4 or its complete complementary sequence.

27. A method for producing soybean plants that are resistant to insects and / or tolerant to glufosinate-ammonium herbicide, characterized in that, The method includes introducing nucleic acid sequences encoding insect resistance Cry2Ab protein and / or insect resistance Cry1Ac protein and / or glufosinate tolerance PAT protein contained in the genome of a first soybean plant, and nucleic acid sequences of a specific region, or introducing the nucleic acid molecule shown in SEQ ID NO:5 contained in the genome of the first soybean plant into a second soybean plant, thereby producing a large number of progeny plants; selecting the progeny plants having the nucleic acid molecule of the specific region, and the progeny plants being resistant to insects and / or resistant to glufosinate herbicide; the nucleic acid molecule of the specific region contains SEQ ID NO:1 or its completely complementary sequence, and / or SEQ ID NO:2 or its completely complementary sequence; The sequence is derived from the transgenic soybean event DBN8205, which is deposited in seed form at the China General Microbiological Culture Collection Center with accession number CGMCC No. 45071.

28. The method for producing soybean plants resistant to insects and / or tolerant to glufosinate herbicide according to claim 27, characterized in that, The nucleic acid molecule in the specific region contains SEQ ID NO:3 or its complete complementary sequence, and / or SEQ ID NO:4 or its complete complementary sequence.

29. The method for producing soybean plants resistant to insects and / or tolerant to glufosinate herbicide according to claim 27 or 28, characterized in that, The method includes sexually hybridizing a first soybean plant containing the transgenic soybean event DBN8205 with a second soybean plant to produce a large number of progeny plants, and selecting the progeny plants that have nucleic acid molecules with the specific region. The progeny plants were attacked with target insects and / or treated with glufosinate-ammonium; Select the progeny plants that are resistant to the target insects and / or tolerant to glufosinate herbicides.

30. An agricultural product or commodity derived from a soybean plant containing the genetically modified soybean event DBN8205, characterized in that, The agricultural products or commodities mentioned are lecithin, fatty acids, glycerol, sterols, soybean flakes, soybean flour, soybean protein or its concentrate, soybean oil, soybean protein fiber, soy milk curd or tofu containing the genetically modified soybean event DBN8205; and the genetically modified soybean event DBN8205 is deposited in the form of seeds at the China General Microbiological Culture Collection Center with the accession number CGMCC No. 45071.

31. The agricultural product or commodity derived from soybean plants containing the transgenic soybean event DBN8205 according to claim 30, characterized in that, The soybean plant also includes at least one other genetically modified soybean event different from the genetically modified soybean event DBN8205.

32. The agricultural product or commodity derived from the soybean plant containing the transgenic soybean event DBN8205 according to claim 31, characterized in that, The other genetically modified soybean events mentioned are genetically modified soybean event DBN9004 and / or genetically modified soybean event DBN8002.

33. A method for expanding the spectrum of insect resistance and / or the range of herbicides tolerated by plants, characterized in that, The transgenic soybean event DBN8205 was expressed in plants along with at least one other transgenic soybean event different from DBN8205. The genetically modified soybean event DBN8205 is deposited in seed form at the China General Microbiological Culture Collection Center under the accession number CGMCC No. 45071.

34. The method for expanding the spectrum of plant insect resistance and / or the range of herbicides tolerated according to claim 33, characterized in that, The other genetically modified soybean events mentioned are genetically modified soybean event DBN9004 and / or genetically modified soybean event DBN8002.

Images