Compositions for digestive health

Abstract

In particular, provided herein are compositions of short-chain fatty acid (SCFA)-producing microorganisms, and methods of making and using these compositions to inhibit pathogenic bacterial populations in the gastrointestinal tract of animals and additionally promote improvement in one or more parameters of the animals, such as increased weight gain, reduced feed conversion ratio (FCR), improved gut barrier integrity, reduced mortality, reduced pathogen infection, and reduced pathogen shedding in feces.

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Patent Application No. 62 / 923,781 filed on October 21, 2019, the disclosure of which is incorporated herein in its entirety. Technical Field

[0003] Provided herein, inter alia, are multi-strain direct-fed microbial bacterial consortia that can be used to improve digestive tract health and / or performance of animals and methods of making and using the multi-strain direct-fed microbial bacterial consortia. Background Art

[0004] In monogastric animal species such as poultry, the gastrointestinal tract and the intestinal associated microflora are not only involved in digestion and absorption, but also interact with the immune and central nervous systems to regulate health. The inside of the intestine is coated with a thin layer of sticky mucus, and millions of bacteria and other microorganisms are embedded in the mucus layer. When the intestinal bacteria are in balance (that is, the number of beneficial bacteria exceeds that of harmful bacteria), the digestive tract can be said to be in a healthy state. Healthy microbiota provides a variety of benefits to the host, including resistance to colonization of a wide spectrum of pathogens, biosynthesis and absorption of essential nutrients, and immune stimulation to maintain healthy digestive epithelium and properly controlled systemic immunity. In the case of "microecological imbalance" or symbiosis being destroyed, the function of the microbiota may be lost or disordered, resulting in increased susceptibility to pathogens, changes in metabolic characteristics, or induction of pro-inflammatory signals, which may cause local or systemic inflammation or autoimmunity. Therefore, the intestinal microbiota of poultry plays an important role in the pathogenesis of many diseases and disorders, including various pathogenic infections of the digestive tract such as coccidiosis or necrotic enteritis.

[0005] Over the past few years, there has been increasing pressure on the animal feed industry from governments and consumers to reduce or scale back the use of antibiotics as a component of animal nutritional feeding regimens. This pressure is largely due to the recognition that the use of such antibiotics has led to an increase in antibiotic-resistant pathogenic microorganisms. However, this "never use antibiotics" consumer trend, especially in the poultry industry, has led to the re-emergence of bacterial diseases, particularly necrotic enteritis (Poultry Science, Vol. 97, No. 6, June 1, 2018, 1929-1933). Necrotic enteritis is caused by certain toxin-producing strains of Clostridium perfringens. Under certain conditions, the toxins produced by Clostridium perfringens can cause lesions in the small intestine and ultimately lead to reduced growth or death of infected birds. Accordingly, there is a recognized need for products and methods that can reduce pathogenic bacterial populations in the digestive tract of domestic animals such as poultry without the use of traditionally used antibiotics.

[0006] The subject matter disclosed herein addresses these needs and provides additional benefits as well. Summary of the invention

[0007] In particular, provided herein are multi-strain direct-fed microbial bacterial consortia of short-chain fatty acid (SCFA)-producing microorganisms, and methods of making and using these consortia to suppress pathogenic bacterial populations in the gastrointestinal tract of animals (such as poultry, e.g., chickens) and otherwise promote improvement in one or more parameters of the animals, such as increased weight gain, reduced feed conversion ratio (FCR), improved gut barrier integrity, reduced mortality, reduced pathogen infection, and reduced pathogen shedding in feces.

[0008] Accordingly, in some aspects, provided herein are feed additive compositions comprising direct-fed microorganisms (DFM), which include one or more biologically pure strains of human colon anaerobic rod-shaped bacteria (Anaerotruncus colihominis). In some embodiments, the feed additive composition includes one, two, three or four strains of human colon anaerobic rod-shaped bacteria. In some embodiments of any of the embodiments disclosed herein, the feed additive composition comprises a) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W1, which is deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS146120; b) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W2, which is deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS 146122; c) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W3, which is deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS146123; and d) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W4, which is deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS 146121.In some embodiments of any of the embodiments disclosed herein, the feed additive composition comprises a) human colon anaerobic coryneform bacteria strain W1 (CBS 146120) or a live strain having all the identification characteristics of human colon anaerobic coryneform bacteria strain W1 (CBS 146120); b) human colon anaerobic coryneform bacteria strain W2 (CBS 146122) or a live strain having all the identification characteristics of human colon anaerobic coryneform bacteria strain W2 (CBS 146122); c) human colon anaerobic coryneform bacteria strain W3 (CBS 146123) or a live strain having all the identification characteristics of human colon anaerobic coryneform bacteria strain W3 (CBS 146123); and d) human colon anaerobic coryneform bacteria strain W4 (CBS 146121) or a live strain having all the identification characteristics of human colon anaerobic coryneform bacteria strain W4 (CBS 146122). 146121), these strains (i) alone; or (ii) in combination with culture supernatants derived from each of these strains. In some embodiments, the feed additive composition further comprises biologically pure a) Coprococcus sp. bacterial strains; b) Clostridium lactatifermentans bacterial strains; and c) Pseudoflavonifractorcapillosus bacterial strains. In some embodiments, the feed additive composition comprises a) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of Coprococcus species strain M1, which is deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS 146125; b) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of human colon anaerobic cocci strain M2, which is deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS 146119; c) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of Clostridium lactic acid fermentation strain M3, which is deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the deposit number CBS 146124; and d) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of Pseudomonas aeruginosa strain M4.In some embodiments of any of the embodiments disclosed herein, the feed additive composition comprises a) Coprococcus sp. strain M1 (CBS 146125) or a live strain having all the identifying characteristics of Coprococcus sp. strain M1 (CBS 146125); b) Human colon anaerobic cocci strain M2 (CBS 146119) or a live strain having all the identifying characteristics of Human colon anaerobic cocci strain M2 (CBS 146119); c) Lactobacillus lactis strain M3 (CBS 146124) or a live strain having all the identifying characteristics of Lactobacillus lactis strain M3 (CBS 146124); and d) a Pseudomonas aeruginosa strain, (i) alone; or (ii) in combination with a culture supernatant derived from each of these strains.

[0009] In other aspects, provided herein is a feed additive composition comprising a direct fed microbial (DFM), the feed additive composition comprising one or more biologically pure bacterial strains of short chain fatty acid (SCFA) producing bacterial strains and one or more biologically pure lactic acid producing bacterial strains. In some embodiments, the feed additive composition comprises a) a biologically pure lactic acid fermenting Clostridium strain; and b) two biologically pure lactic acid producing bacterial strains. In some embodiments of any of the embodiments disclosed herein, the two biologically pure lactic acid producing bacterial strains are Lactobacillus salivarius and Lactobacillus reuteri. In some embodiments of any of the embodiments disclosed herein, the feed additive composition comprises a) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of Clostridium lactofermentum strain 2F1, which is deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with accession number 146124; b) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of Lactobacillus salivarius strain 2F2, which is deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with accession number CBS 146126; and c) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of Lactobacillus reuteri strain 2F3, which is deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS 145921. In some embodiments of any of the embodiments disclosed herein, the feed additive composition comprises a) Clostridium lactofermentans strain 2F1 (CBS146124) or a live strain having all the identifying characteristics of Clostridium lactofermentans strain 2F1 (CBS 146124); b) Lactobacillus salivarius strain 2F2 (CBS 146126) or a live strain having all the identifying characteristics of Lactobacillus salivarius strain 2F2 (CBS 146126); and c) Lactobacillus reuteri strain 2F3 (CBS 145921) or a live strain having all the identifying characteristics of Lactobacillus reuteri strain 2F3 (CBS 145921), these strains (i) alone; or (ii) in combination with a culture supernatant derived from each of these strains.In some embodiments of any of the embodiments disclosed herein, a) the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W1 comprises the nucleotide sequence of SEQ ID NO: 1; b) the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W2 comprises the nucleotide sequence of SEQ ID NO: 2; c) the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W3 comprises the nucleotide sequence of SEQ ID NO: 3; and d) the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W4 comprises the nucleotide sequence of SEQ ID NO: 4. In some embodiments of any of the embodiments disclosed herein, a) the 16S ribosomal RNA sequence of Coprococcus sp. strain M1 comprises the nucleotide sequence of SEQ ID NO: 5; b) the 16S ribosomal RNA sequence of anaerobic coryneformis strain M2 comprises the nucleotide sequence of SEQ ID NO: 6; c) the 16S ribosomal RNA sequence of lactic acid fermentation Clostridium strain M3 comprises the nucleotide sequence of SEQ ID NO: 7; and d) the 16S ribosomal RNA sequence of pseudotrichophyton strain M4 comprises the nucleotide sequence of SEQ ID NO: 8. In some embodiments of any of the embodiments disclosed herein, a) the 16S ribosomal RNA sequence of lactic acid fermentation Clostridium strain 2F1 comprises the nucleotide sequence of SEQ ID NO: 9; b) the 16S ribosomal RNA sequence of Lactobacillus salivarius strain 2F2 comprises the nucleotide sequence of SEQ ID NO: 10; and c) the 16S ribosomal RNA sequence of Lactobacillus reuteri strain 2F3 comprises the nucleotide sequence of SEQ ID NO: 11. In some embodiments of any of the embodiments disclosed herein, the composition produces one or more short-chain fatty acids selected from the group consisting of butyric acid, isobutyric acid, propionic acid, acetic acid, isovaleric acid and valeric acid. In some embodiments of any of the embodiments disclosed herein, the feed additive composition further comprises one or more enzymes. In some embodiments, the one or more enzymes are selected from the group consisting of phytase, protease, amylase, xylanase and beta-glucanase. In some embodiments of any of the embodiments disclosed herein, each strain is at least about 1x10. 3 CFU / g feed additive composition to at least about 1x10 9 In some embodiments of any of the embodiments disclosed herein, the composition inhibits at least one pathogen selected from avian pathogenic Salmonella sp., Escherichia coli, Clostridium perfringens, and Enterobacteriaceae in the gastrointestinal tract of poultry that have ingested an effective amount of the direct-fed microbial composition.

[0010] In other aspects, a premix is ​​provided herein, comprising any one of the feed additive compositions disclosed herein and at least one mineral and / or at least one vitamin. In still other aspects, a feed or feedstuff is provided herein, comprising any one of the feed additive compositions disclosed herein or any one of the premixes disclosed herein.

[0011] In another aspect, provided herein is a kit comprising a) any one of the feed additive compositions disclosed herein; and b) written instructions for administration to an animal. In some embodiments, the kit further comprises one or more enzymes. In some embodiments, the one or more enzymes are selected from the group consisting of: phytase, protease, amylase, xylanase, and beta-glucanase.

[0012] In other aspects, there is provided herein a method for improving one or more indicators of an animal, the one or more indicators being selected from the group consisting of: increased weight gain, intestinal health, reduced feed conversion ratio (FCR), improved digestive tract barrier integrity, reduced mortality, reduced pathogen infection, and reduced pathogen shedding in feces, the method comprising administering to the animal an effective amount of any of the feed additive compositions disclosed herein, any of the premixes disclosed herein, or any of the feed or feed materials disclosed herein, thereby improving one or more indicators of the animal. In some embodiments, the feed additive composition increases the content of one or more of acetic acid, isobutyric acid, butyric acid, isovaleric acid, and / or valeric acid in the gastrointestinal tract of the animal. In some embodiments of any embodiments disclosed herein, the feed additive composition increases the butyric acid content of the gastrointestinal tract of the animal. In some embodiments of any embodiments disclosed herein, the pathogen is one or more of Clostridium perfringens, Campylobacter jejuni, Enterobacteriaceae, Salmonella species, and / or Escherichia coli. In some embodiments of any of the embodiments disclosed herein, the method further treats, prevents, or reduces the incidence of necrotic enteritis. In some embodiments of any of the embodiments disclosed herein, the animal is a domestic poultry. In some embodiments, the domestic poultry is selected from the group consisting of chickens, turkeys, ducks, geese, quails, emus, ostriches, and pheasants. In some embodiments, the chicken is a broiler or laying hen.

[0013] In other aspects, the present invention provides a method for preparing a feed additive composition, which comprises combining the following: a) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W1, which is deposited in CBS with the accession number CBS 146120; b) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W2, which is deposited in CBS with the accession number CBS 146122; c) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W3, which is deposited in CBS with the accession number CBS 146123; and d) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of a human colon anaerobic rod-shaped bacteria strain W4, which is deposited in CBS with the accession number CBS 146121. In some embodiments, a) the human colon anaerobic coryneform bacteria strain W1 is a human colon anaerobic coryneform bacteria strain W1 (CBS 146120) or a live strain having all the identification characteristics of the human colon anaerobic coryneform bacteria strain W1 (CBS 146120); b) the human colon anaerobic coryneform bacteria strain W2 is a human colon anaerobic coryneform bacteria strain W2 (CBS146122) or a live strain having all the identification characteristics of the human colon anaerobic coryneform bacteria strain W2 (CBS 146122); c) the human colon anaerobic coryneform bacteria strain W3 is a human colon anaerobic coryneform bacteria strain W3 (CBS 146123) or a live strain having all the identification characteristics of the human colon anaerobic coryneform bacteria strain W3 (CBS 146123); and d) the human colon anaerobic coryneform bacteria strain W4 is a human colon anaerobic coryneform bacteria strain W4 (CBS 146121) or a live strain having all the identifying characteristics of Anaerobic Coryneformis of Human Colon Strain W4 (CBS 146121), either (i) alone; or (ii) in combination with a culture supernatant derived from each of these strains.

[0014] In still other aspects, the present invention provides a method for preparing a feed additive composition, which comprises combining the following: a) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of a Coprococcus species strain M1, which is deposited in CBS with the accession number CBS146125; b) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of a human colon anaerobic cocci strain M2, which is deposited in CBS with the accession number CBS146125. 146119; c) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of Clostridium lactic acid fermentation strain M3, which is deposited in CBS with the accession number CBS146124; and d) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of Pseudomonas aeruginosa strain M4. In some embodiments, a) the Coprococcus species strain M1 is a live strain of Coprococcus species strain M1 (CBS 146125) or having all the identification characteristics of Coprococcus species strain M1 (CBS 146125); b) the human colon anaerobic stick bacteria strain M2 is a live strain of human colon anaerobic stick bacteria strain M2 (CBS 146119) or having all the identification characteristics of human colon anaerobic stick bacteria strain M2 (CBS 146119); and c) the lactic acid fermentation Clostridium strain M3 is a live strain of lactic acid fermentation Clostridium strain M3 (CBS 146124) or having all the identification characteristics of lactic acid fermentation Clostridium strain M3 (CBS 146124), and these strains (i) are alone; or (ii) are combined with the culture supernatant derived from each of these strains.

[0015] In still other aspects, the present invention provides a method for preparing a feed additive composition, which comprises combining the following: a) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of Clostridium lactic acid fermentation strain 2F1, which is deposited in CBS with the accession number CBS146124; b) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of Lactobacillus salivarius strain 2F2, which is deposited in CBS with the accession number CBS146126; and c) a bacterial strain having a 16S ribosomal RNA sequence that exhibits at least 97.0% sequence similarity to the 16S ribosomal RNA sequence of Lactobacillus reuteri strain 2F3, which is deposited in CBS with the accession number CBS145921. In some embodiments, a) the lactic acid fermentation Clostridium strain 2F1 is a live strain of lactic acid fermentation Clostridium strain W1 (CBS 146124) or having all the identification characteristics of lactic acid fermentation Clostridium strain 2F1 (CBS 146124); b) the Lactobacillus salivarius strain 2F2 is a live strain of Lactobacillus salivarius strain 2F2 (CBS 146126) or having all the identification characteristics of Lactobacillus salivarius strain 2F2 (CBS 146126); and c) the Lactobacillus reuteri strain 2F3 is a live strain of Lactobacillus reuteri strain 2F3 (CBS 145921) or having all the identification characteristics of Lactobacillus reuteri strain 2F3 (CBS 145921), these strains (i) alone; or (ii) in combination with a culture supernatant derived from each of these strains. In some embodiments of any of the embodiments disclosed herein, the method further comprises combining one or more enzymes with the feed additive composition. In some embodiments, the one or more enzymes are selected from the group consisting of phytases, proteases, amylases, xylanases, and beta-glucanases. In some embodiments of any of the embodiments disclosed herein, at least about 1 x 10 3 CFU / g feed additive composition to at least about 1x10 9 CFU / g feed additive composition are combined to form the feed additive composition. In some embodiments of any of the embodiments disclosed herein, the method further comprises packaging the feed additive composition.

[0016] In another aspect, the present invention provides a method for preparing a premix, the method comprising combining any one of the feed additive compositions disclosed herein with at least one mineral and / or at least one vitamin. In some embodiments, the method further comprises packaging the premix.

[0017] Each of the aspects and embodiments described herein can be used together unless explicitly or clearly excluded from the context of an embodiment or aspect.

[0018] Throughout the specification, various patents, patent applications, and other types of publications (e.g., journal articles, electronic database entries, etc.) are cited. The disclosures of all patents, patent applications, and other publications cited herein are hereby incorporated by reference in their entirety for all purposes. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1A Depicted are bar graphs showing short chain fatty acid (SCFA) production by human colonic anaerobic coryneform bacteria at 24 and 48 hours of cultivation. Figure 1B Depicted are bar graphs showing SCFA production by lactic acid fermenting Clostridium at 24 hours and 48 hours of cultivation.

[0020] Figure 2 Depicted are bar graphs showing SCFA production when bacteria are cultured alone and in co-culture. Rl = Coprococcus sp. strain M1; Ac = Anaerobic Coryneformis human colon strain M2; Cl = Clostridium lactofermentum strain M3; and Pc = Pseudomonas aeruginosa strain M4. DETAILED DESCRIPTION

[0021] A variety of microbial species have been shown to have some degree of efficacy against digestive tract pathogens in vitro or in vivo. Commonly studied organisms have included Bacillus or Lactobacillus. Another group of potential microorganisms of interest are obligate anaerobes that can produce short-chain fatty acids (SCFAs). It is speculated that SCFAs, such as propionate and butyrate (i.e., the conjugate bases of propionic acid and butyric acid, respectively), have many beneficial properties for digestive tract health (see, e.g., Adv Immunol [Advances in Immunology]. 2014; 121: 91-119; Eur J Pharmacol [European Journal of Pharmacology]. 2018 July 15; 831: 52-59; Adv Nutr [Advances in Nutrition]. 2019 January 1; 10(Suppl 1): S49-S66).

[0022] As described in more detail herein, the inventors surprisingly discovered that administering specific species of SCFA-producing microorganisms to animals (e.g., domestic poultry, e.g., chickens) can improve the performance of one or more indicators, including increased weight gain, intestinal health, reduced feed conversion ratio (FCR), improved gut barrier integrity, reduced mortality, reduced pathogen infection (such as, but not limited to, Clostridium perfringens infection), and reduced pathogen shedding in feces. Without being bound by theory, it is believed that SCFAs play an important role in preventing intestinal inflammation and maintaining intestinal homeostasis. Although many obligate anaerobes have the ability to produce SCFAs, not all species can provide benefits to animals when administered as a feed additive or as part of a feed. However, as will be described in the Examples section, it was found that administering specific combinations of microorganisms was unexpectedly effective in preventing and / or treating animal digestive tract pathogenesis and maintaining overall health.

[0023] I. Definitions

[0024] As used herein, short chain fatty acids (SCFAs) (also referred to as volatile fatty acids (VFAs)) are fatty acids with less than six carbon atoms. Non-limiting examples of SCFAs include formic acid (methanoic acid), acetic acid (ethanoic acid), propionic acid (propanoic acid), butanoic acid (butyric acid), isobutyric acid (2-methylpropionic acid), valeric acid (pentanoic acid) and isovaleric acid (3-methylbutyric acid). This definition of SCFA also includes the conjugate base of SCFA, including but not limited to formate, acetate, propionate, butyrate, isobutyrate, valerate, and isovalerate.

[0025] As used herein, "microorganism" or "microbe" refers to bacteria, fungi, viruses, protozoa, and other microorganisms or microscopic organisms.

[0026] As used herein, the term "direct-fed microbial" refers to a composition for consumption by an animal (i.e., as animal feed or as a component of an animal feed) that contains viable microorganisms, i.e., microorganisms that are capable of survival and reproduction. See, e.g., U.S. Pat. No. 8,420,074. The direct-fed microbial can contain one or more (e.g., any 1, 2, 3, 4, 5, or 6 or more) of any microbial strain described herein.

[0027] As used herein, a bacterial "strain" refers to a bacterium that remains genetically unchanged when grown or reproduced, including a plurality of identical bacteria.

[0028] "At least one strain" means a single strain, but also refers to a strain mixture comprising at least two microbial strains. "A mixture of at least two strains" means a mixture of two, three, four, five, six or even more strains. In some embodiments of the strain mixture, the ratio may vary between 1% and 99%. When the mixture comprises more than two strains, the strains may be present in the mixture in substantially equal proportions or in different proportions.

[0029] For the purposes of this disclosure, "biologically pure strains" means strains that do not contain other bacterial strains that are sufficient to interfere with the replication of the strain or that can be detected by normal bacteriological techniques. When used in combination with organisms as described herein and cultures, "separation" not only includes biologically pure strains, but also includes any culture of the organism grown or maintained except those found in nature. In certain embodiments, the strain is a mutant, variant or derivative of strain W1, W2, W3, W4, M1, M2, M3, M4, 2F1, 2F2 and 2F3, which also provide benefits comparable to the benefits provided by W1, W2, W3, W4, M1, M2, M3, M4, 2F1, 2F2 and 2F3. In certain embodiments, the strain is a strain with all identification characteristics of strains W1, W2, W3, W4, M1, M2, M3, M4, 2F1, 2F2 and 2F3. In addition, each individual strain (W1, W2, W3, W4, M1, M2, M3, M4, 2F1, 2F2 and 2F3) or any combination of these strains may also provide one or more benefits described herein. It will also be clear that the addition of other microbial strains, carriers, additives, enzymes, yeasts, etc. will also provide one or more benefits or improve one or more parameters in animals and will not constitute a substantially different DFM.

[0030] The term "16S rRNA" or "16S ribosomal RNA" means the rRNA that constitutes the small subunit of the ribosome in prokaryotes. In bacteria, this sequence can be used to identify and characterize operational taxa.

[0031] As used herein, the term "sequence identity" or "sequence similarity" means that two polynucleotide sequences (candidate sequence and reference sequence) are identical (i.e., 100% sequence identity) or similar (i.e., on a nucleotide-by-nucleotide basis) over the length of the candidate sequence. When comparing a candidate sequence to a reference sequence, the candidate sequence may contain additions or deletions (i.e., gaps) as compared to a reference sequence for optimal alignment of the two sequences (which does not contain additions or deletions). The optimal sequence alignment for determining sequence identity can be performed using any number of publicly available local alignment algorithms known in the art (e.g., ALIGN or Megalign (DNASTAR Corporation)), or by inspection.

[0032] The terms "percent (%) sequence identity" or "percent (%) sequence similarity" as used herein with respect to a reference sequence are defined as the percentage of nucleotide residues in a candidate sequence that are identical with the residues in a reference polynucleotide sequence, after the sequences have been optimally aligned and introducing gaps, if necessary, to achieve the maximum percent sequence identity.

[0033] As used herein, "prevent," "preventing," "prevention" and grammatical variations thereof refer to a method of partially or completely delaying or impeding the onset or recurrence of one or more of a disorder or condition (e.g., necrotic enterocolitis) and / or its attendant symptoms, or preventing an animal from acquiring or reacquiring a disorder or condition or reducing the risk of an animal acquiring or reacquiring a disorder or condition or its attendant symptoms.

[0034] As used herein, the term "reduce" with respect to a particular trait, feature, characteristic, biological process, or phenomenon refers to a reduction in a particular trait, feature, characteristic, biological process, or phenomenon. A trait, feature, characteristic, biological process, or phenomenon can be reduced by 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, or more than 100%.

[0035] The term "poultry" as used herein means domesticated birds raised by humans for their eggs, their meat or their feathers. These birds are most typically members of the order Galloanserae, particularly the order Galliformes including, but not limited to, chickens, quail, ducks, geese, emus, ostriches, pheasants and turkeys.

[0036] As used herein, "administer" or "administering" means the act of introducing one or more microbial strains, exogenous feed enzymes and / or strains and exogenous feed enzymes into an animal, such as by feeding or by gavage.

[0037] As used herein, "effective amount" means the amount of DFM and / or exogenous enzyme that improves one or more parameters of an animal. The improvement in one or more parameters of an animal (such as, but not limited to, any of increased weight gain, intestinal health, reduced feed conversion ratio (FCR), improved digestive tract barrier integrity, reduced mortality, reduced pathogen infection, and reduced pathogen shedding in feces) can be measured as described herein or by other methods known in the art. An effective amount can be administered to an animal by providing a feed containing DFM and exogenous enzymes ad libitum. DFM and exogenous enzymes can also be administered in one or more doses.

[0038] The term "gut health status" refers to the state of the digestive tract wall structure and morphology that may be affected, for example, by infectious agents or non-infectious causes such as a suboptimally formulated diet. "Digestive tract wall structure and morphology" or "digestive tract barrier integrity" may refer to, but is not limited to, epithelial damage and epithelial permeability characterized by shortened villi, elongated crypts, and infiltration of inflammatory cells such as, but not limited to, CD3+ cells. The latter damage and inflammatory markers may also be associated with a "severe" macroscopic appearance of the digestive tract compared to a "normal" appearance when assessed using a scoring system such as that described by Teirlynck et al. (2011).

[0039] As used herein, the term "feed" is used synonymously with "feeding material" in this article. Feed refers broadly to liquid or solid materials used to nourish animals and to maintain normal or accelerated growth of animals (including newborn or young and developing animals). The term includes compounds, preparations, mixtures, or compositions suitable for animal (such as, for example, poultry such as quail, duck, turkey, and chicken) intake. In certain embodiments, feed or feed composition comprises a basic food composition and one or more feed additives or feed additive compositions. As used herein, the term "feed additive" refers to a component included for the purpose of strengthening basic feed with other components to promote feed intake, treat or prevent diseases, or change metabolism. Feed additives include premixes.

[0040] As referred to herein, a "premix" may be a composition consisting of minor ingredients such as, but not limited to, one or more of vitamins, minerals, chemical preservatives, antibiotics, fermentation products, and other essential ingredients. A premix is ​​typically a composition suitable for blending into a commercial ration.

[0041] As used herein, "improvement in one or more indicators of an animal" refers to an improvement in a measurement associated with growth and / or health of an animal (e.g., a domesticated poultry, e.g., chicken), measured by one or more of the following parameters: average daily gain (ADG), total weight, mortality, feed conversion (which includes both feed: weight gain and weight gain: feed), feed intake, intestinal health, reduced feed conversion ratio (FCR), improved gut barrier integrity, reduced mortality, reduced pathogen infection, and reduced pathogen shedding in feces. As used herein, "improvement of an indicator" or "improved indicator" refers to an improvement in at least one parameter listed under an indicator in the definition of an animal.

[0042] As used herein, the term "feed conversion ratio" refers to the amount of feed fed to an animal to increase the animal's weight by a specified amount. An improved feed conversion ratio means a lower feed conversion ratio. "Lower feed conversion ratio" or "improved feed conversion ratio" means that the amount of feed required to feed the animal to increase the animal's weight by a specified amount using a feed additive composition in a feed is less than the amount of feed required to increase the animal's weight by the same amount if the feed did not contain the feed additive composition.

[0043] Certain ranges are presented herein with numerical values ​​preceded by the term "about". The term "about" is used herein to provide literal support for the exact number that follows it, as well as numbers that are close to or approximately the number that follows the term. In determining whether a number is close to or approximately a specifically stated number, the close or approximately unstated number may be a number that provides a substantial equivalent of the specifically stated number in the context in which it is presented. For example, with respect to numerical values, the term "about" refers to a range of -10% to +10% of the numerical value, unless the term is otherwise specifically defined in context.

[0044] As used herein, the singular terms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0045] It is also noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as an antecedent basis for use of exclusive terminology such as "solely," "only" and the like in connection with the recitation of claim elements, or use of a "negative" limitation.

[0046] It should still be noted that the term "consisting essentially of" as used herein refers to a composition wherein the component or components following the term, in the presence of other known component or components, is a total amount of less than 30% by weight of the total composition and does not affect or interfere with the action or activity of the component or components.

[0047] It is further noted that the term "comprising" as used herein is intended to include but is not limited to one or more components following the term "comprising". The one or more components following the term "comprising" are required or mandatory, but the composition comprising the one or more components may further include other non-mandatory or optional one or more components.

[0048] It is also noted that the term "consisting of" as used herein is meant to include and be limited to the component(s) following the term "consisting of." Thus, the component(s) following the term "consisting of" are required or mandatory, and one or more other components are not present in the composition.

[0049] Each maximum numerical limit given throughout this specification is intended to include each lower numerical limit, as if such lower numerical limits were expressly written herein. Each minimum numerical limit given throughout this specification will include each higher numerical limit, as if such higher numerical limits were expressly written herein. Each numerical range given throughout this specification will include each narrower numerical range that falls within such wider numerical range, as if such narrower numerical ranges were all expressly written herein.

[0050] Unless otherwise defined herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0051] Additional definitions of terms may appear throughout this specification.

[0052] II. Composition

[0053] A. strain

[0054] Direct-fed microorganisms (DFM) refer to beneficial microorganisms fed to animals when they are in a stressful period (disease, ration change, environmental or production challenge) or as part of a daily nutritional regimen to prevent disease and promote nutrient utilization during digestion. Probiotics are another term for this type of feed additive. Probiotics or DFM have been shown to improve the performance of animals in controlled studies. In some embodiments, DFM includes both directly fed bacteria and / or yeast-based products, and in specific embodiments, includes viable microorganisms. The term "viable microorganism" means a microorganism that is metabolically active or capable of differentiation.

[0055] In one embodiment, the DFM may be a spore-forming bacterium and thus the term DFM may refer to a composition consisting of or comprising spores (e.g. bacterial spores). Thus, in one embodiment, the term "viable microorganism" as used herein may include microbial spores, such as endospores or conidia. In another embodiment, the DFM in the feed additive composition according to the invention does not consist of or comprise microbial spores, such as endospores or conidia (i.e., the DFM does not form spores).

[0056] The strains provided herein include human colon anaerobic cocci strain W1, human colon anaerobic cocci strain W2, human colon anaerobic cocci strain W3, human colon anaerobic cocci strain W4, Coprococcus species strain M1, human colon anaerobic cocci strain M2, lactic acid fermentation Clostridium strain M3, Pseudomonas aeruginosa strain M4, lactic acid fermentation Clostridium strain 2F1, Lactobacillus salivarius strain 2F2, and Lactobacillus reuteri strain 2F3, which are also referred to herein as W1, W2, W3, W4, M1, M2, M3, M4, 2F1, 2F2 and 2F3, respectively.

[0057] Human colon anaerobic stick bacteria strain W1, human colon anaerobic stick bacteria strain W2, human colon anaerobic stick bacteria strain W3 and human colon anaerobic stick bacteria strain W4 were deposited in Westerdijk Fungal Biodiversity Research Institute (WFDB) on October 9, 2019, Uppsalalaan 8,3584 CT, Utrecht, The Netherlands, and given accession numbers CBS 146120, CBS 146122, CBS 146123 and CBS 146121, respectively. Preservation is carried out according to the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedures for the international recognition of the deposit of microorganisms for the purpose of patent procedures. One or more strains provided herein can be used as direct feeding microorganisms (DFM).

[0058] Coprococcus species strain M1, human colon anaerobic stick bacteria strain M2, and lactic acid fermentation Clostridium strain M3 were deposited at the Westerdijk Fungal Biodiversity Institute (WFDB), Uppsalalaan 8, 3584CT, Utrecht, The Netherlands on October 9, 2019, and given accession numbers CBS 146125, CBS 146119, and CBS 146124, respectively. The deposit is made in accordance with the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for Patent Procedure Purposes. One or more strains provided herein can be used as direct feeding microorganisms (DFM).

[0059] Lactobacillus lactofermentans strain 2F1, Lactobacillus salivarius strain 2F2, and Lactobacillus reuteri strain 2F3 were deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) on July 24, 2019 and October 9, 2019, Uppsalalaan 8, 3584 CT, Utrecht, The Netherlands, and given accession numbers CBS 146124, CBS 146126, and CBS 145921, respectively. Deposits are made in accordance with the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for Patent Procedure Purposes. One or more strains provided herein can be used as direct-feed microorganisms (DFM). A variety of direct-feed microbial strains can be combined into a single composition (e.g., a feed additive composition or feed) to form a multi-strain DFM.

[0060] DFM compositions may include those containing one or more (such as any about 1, 2, 3, 4, 5, 6, 7 or 8 or more strains) strains of human colonic anaerobic coryneform bacteria. The microorganisms are gram-positive, non-spore-forming, rod-shaped and anaerobic bacteria from the genus Anaerotruncus that have been observed to be present in human feces (Lau et al., J Clin Pathol. 2006 Jul;59(7):748-752).

[0061] The DFM composition may include one or more of the human colon anaerobic coryneform bacteria strains W1, W2, W3 and / or W4, or one or more microorganisms having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (e.g., about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of one or more of the human colon anaerobic coryneform bacteria strains W1 (SEQ ID NO: 1), W2 (SEQ ID NO: 2), W3 (SEQ ID NO: 3), and / or W4 (SEQ ID NO: 4). In some embodiments, the DFM composition includes only human colon anaerobic coryneform bacteria strains W1, W2, W3 or W4. In another embodiment, the DFM composition includes human colon anaerobic coryneform bacteria strains W1 and W2; human colon anaerobic coryneform bacteria strains W1 and W3; human colon anaerobic coryneform bacteria strains W1 and W4; human colon anaerobic coryneform bacteria strains W2 and W3; human colon anaerobic coryneform bacteria strains W2 and W4; human colon anaerobic coryneform bacteria strains W3 and W4; human colon anaerobic coryneform bacteria strains W1, W2, and W3; human colon anaerobic coryneform bacteria strains W1, W3, and W4; human colon anaerobic coryneform bacteria strains W2, W3, and W4; or human colon anaerobic coryneform bacteria strains W1, W2, W3, and W4. In addition, when cultured together, one or more human colon anaerobic coryneform bacteria strains W1, W2, W3, and / or W4 have one or more physiological or metabolic characteristics that are lacking in human colon anaerobic coryneform bacteria strains cultured alone. These properties may include, but are not limited to, changes in the amount and / or type of short chain fatty acids produced, changes in metabolic profiles, and / or changes in the composition of the medium (eg, butyrate) in which the bacteria are cultured.

[0062] The DFM compositions provided herein may include one or more of the human colonic anaerobic coryneform bacteria strains W1, W2, W3 and / or W4 (i.e., the compositions include true bacteria from these strains) and / or one or more culture supernatants derived from the cultivation (alone or co-cultivation) of these strains.

[0063] DFM compositions may additionally include those containing one or more of Coprococcus species, human colonic anaerobic rod-shaped microorganisms, lactic acid fermenting Clostridium microorganisms, and / or Pseudotrichophyton microorganisms. Coprococcus is a genus of Gram-positive anaerobic cocci that have been observed in human fecal flora. The genus is closely related to Ruminococcus biochemically and to Lachnospira phylogenetically. Lactic acid fermenting Clostridium is a Gram-positive rod-shaped bacterium with a tapered end, no motility, and no spore formation (van der Wielen et al., Int J Syst Evol Microbiol. 2002 May; 52(Part 3): 921-5). Pseudotrichophyton is a normal Gram-negative resident bacterium of the healthy human digestive tract. In a comprehensive 16S rDNA sequence-based enumeration of the colonic microbiota of three healthy adults, it accounted for an average of 0.008% of all 16S rDNA sequences and 0.016% of the sequences in its clade (Eckburg et al., Science 2005 Jun 10;308(5728):1635-8). It is also associated with human cysts and wounds and is known to cause sepsis in neonates.

[0064] The DFM composition may include one or more of Coprococcus sp. strain M1, human colon anaerobic cocci strain M2, lactic acid fermentation Clostridium strain M3, and / or Pseudomonas strain (such as Pseudomonas strain M4), or one or more microorganisms having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (such as about any of 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of one or more of Coprococcus sp. strain M1 (SEQ ID NO: 5), human colon anaerobic cocci strain M2 (SEQ ID NO: 6), lactic acid fermentation Clostridium strain M3 (SEQ ID NO: 7), and / or Pseudomonas strain M4 (SEQ ID NO: 8). In some embodiments, the DFM composition includes only Coprococcus species strain M1, human colon anaerobic cocci strain M2, lactic acid fermentation Clostridium strain M3 or Pseudo-Trichophyton strain (such as Pseudo-Trichophyton strain M4). In another embodiment, the DFM composition includes Coprococcus species strain M1 and human colon anaerobic cocci strain M2; Coprococcus species strain M1 and lactic acid fermentation Clostridium strain M3; Coprococcus species strain M1 and Pseudo-Trichophyton strain (such as Pseudo-Trichophyton strain M4); human colon anaerobic cocci strain M2 and lactic acid fermentation Clostridium strain M3; human colon anaerobic cocci strain M2 and Pseudo-Trichophyton strain (such as Pseudo-Trichophyton strain M4); lactic acid fermentation Clostridium strain M3 and Pseudo-Trichophyton strain (such as Pseudo-Trichophyton strain M4) ; Coprococcus species M1, human colon anaerobic stick bacteria strain M2 and lactic acid fermentation clostridium strain M3; Coprococcus species strain M1, lactic acid fermentation clostridium strain M3 and pseudotrichophyton strain (such as pseudotrichophyton strain M4); Human colon anaerobic stick bacteria strain M2, lactic acid fermentation clostridium strain M3 and pseudotrichophyton strain a (such as pseudotrichophyton strain M4); Or Coprococcus species strain M1, human colon anaerobic stick bacteria strain M2, lactic acid fermentation clostridium strain M3 and pseudotrichophyton strain (such as pseudotrichophyton strain M4). In addition, when cultivating together, one or more Coprococcus species strain M1, human colon anaerobic stick bacteria strain M2, lactic acid fermentation clostridium strain M3 and / or pseudotrichophyton strain (such as pseudotrichophyton strain M4) have one or more physiological or metabolic characteristics lacked by the bacterial strain cultivated alone. These characteristics may include, but are not limited to, changes in the amount and / or type of short-chain fatty acid production (eg, production of valeric acid that is only observed when these microorganisms are cultured together).

[0065] The DFM compositions provided herein may include one or more Coprococcus sp. strain M1, Anaerobic Coxsporinum hominis strain M2, Lactofermenting Clostridium strain M3, and / or Pseudotrichophyton strain (such as Pseudotrichophyton strain M4) (i.e., the compositions include true bacteria from these strains) and / or one or more culture supernatants derived from the culture (alone or co-culture) of these strains.

[0066] The DFM compositions provided herein may additionally include those containing one or more of a Clostridium lactis fermenting microorganism, a Lactobacillus salivarius microorganism, and / or a Lactobacillus reuteri microorganism. Clostridium lactis fermenting is a Gram-positive rod-shaped bacterium with a tapered end, non-motile, and non-spore forming (van der Wielen et al., Int J Syst Evol Microbiol. [International Journal of Systematic and Evolutionary Microbiology] May 2002; 52(Part 3): 921-5). Lactobacillus salivarius is a lactic acid bacterium that is part of the indigenous microbiota of humans and hamsters (Raftis et al., Appl. Environ. Microbiol. [Applied and Environmental Microbiology], January 2011, 77(3) 954-965). Recently, there has been an increasing number of studies exploring the probiotic utility of different strains of Lactobacillus salivarius (Neville & O'Toole, Future Microbiol. [Future Microbiology] 2010, 5: 759-774). Lactobacillus reuteri is a Gram-positive bacterium that naturally inhabits the digestive tract of mammals and birds.

[0067] The DFM composition may include one or more of Clostridium lactis strain 2F1, Lactobacillus salivarius strain 2F2, and / or Lactobacillus reuteri strain 2F3, or one or more microorganisms having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (such as about any of 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of one or more of Clostridium lactis strain 2F1 (SEQ ID NO: 9), Lactobacillus salivarius strain 2F2 (SEQ ID NO: 10), and / or Lactobacillus reuteri strain 2F3 (SEQ ID NO: 11). In some embodiments, the DFM composition includes only Clostridium lactis strain 2F1, Lactobacillus salivarius strain 2F2, or Lactobacillus reuteri strain 2F3. In another embodiment, the DFM composition includes Clostridium lactobacillus strain 2F1 and Lactobacillus salivarius strain 2F2; Clostridium lactobacillus strain 2F1 and Lactobacillus reuteri strain 2F3; Lactobacillus salivarius strain 2F2 and Lactobacillus reuteri strain 2F3; Clostridium lactobacillus strain 2F1, Lactobacillus salivarius strain 2F2, and Lactobacillus reuteri strain 2F3. In addition, when cultured together, one or more of Clostridium lactobacillus strain 2F1, Lactobacillus salivarius strain 2F2, and / or Lactobacillus reuteri strain 2F3 have one or more physiological or metabolic properties that are lacking when cultured alone. These properties may include, but are not limited to, changes in the amount and / or type of short-chain fatty acids produced (such as the production of lactic acid that can only be observed when these microorganisms are cultured together), changes in metabolic characteristics, and / or changes in the composition of the medium in which the bacteria are cultured together.

[0068] The DFM compositions provided herein may include one or more of Clostridium lactofermentans strain 2F1, Lactobacillus salivarius strain 2F2, and Lactobacillus reuteri strain 2F3 (i.e., the compositions include true bacteria from these strains) and / or one or more culture supernatants derived from cultures of these strains (alone or co-culture).

[0069] B. Exogenous enzymes

[0070] Supplemental enzymes can be used as additives to animal feeds, particularly poultry and swine feeds, as a means of increasing nutrient utilization and improving performance characteristics.

[0071] In one embodiment, the present disclosure relates to a composition comprising one or more DFMs (such as DFMs containing any of the microbial strains disclosed herein) and one or more exogenous feed enzymes. In another embodiment, the present disclosure relates to a composition comprising, consisting of, or consisting essentially of a multi-strain DFM (such as any multi-strain DFM composition disclosed herein) and one or more exogenous feed enzymes. In one embodiment, the exogenous feed enzymes include, but are not limited to, xylanases, amylases, phytases, beta-glucanases, and proteases. In yet another embodiment, the composition comprises a feed additive.

[0072] 1. Xylanase

[0073] Xylanase is the name given to a class of enzymes that degrade the linear polysaccharide β-1,4-xylan into xylose, thereby breaking down hemicellulose, one of the main components of plant cell walls. Xylanases, such as endo-β-xylanases (EC 3.2.1.8), hydrolyze the xylan backbone. In one embodiment, provided herein is a composition comprising a multi-strain DFM (such as any multi-strain DFM composition disclosed herein) and one or more xylanases.

[0074] In one embodiment, the xylanase may be any commercially available xylanase. Suitably, the xylanase may be an endo-1,4-Pd-xylanase (classified as EG3.2.1.8) or a 1,4β-xylosidase (classified as EG3.2.1.37). In one embodiment, the present disclosure relates to a DFM in combination with an endo-1,4-Pd-xylanase (e.g., an endo-1,4-Pd-xylanase) and another enzyme. All EC enzyme classifications referred to herein relate to the classification provided in the Enzyme Nomenclature-Recommendations (1992)-ISBN 0-12-226164-3 of the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology, which is incorporated herein

[0075] In another embodiment, the xylanase may be a xylanase from Bacillus, Trichodermna, Therinomyces, Aspergillus, and Penicillium. In yet another embodiment, the xylanase may be a xylanase from Axtra or Avizyme In one embodiment, the xylanase may be a mixture of two or more xylanases. In another embodiment, the xylanase is an endo-1,4-β-xylanase or a 1,4-β-xylosidase. In another embodiment, the xylanase is from an organism selected from the group consisting of Bacillus, Trichoderma, Thermomyces, Aspergillus, Penicillium, and Humicola. In another embodiment, the xylanase may be one or more xylanases cited in Table 1 or one or more commercial products.

[0076] Table 1: Representative commercial xylanases

[0077]

[0078] In one embodiment, the disclosure relates to a composition comprising a multi-strain DFM (such as any multi-strain DFM composition disclosed herein) and a xylanase. In one embodiment, the composition comprises 10-50, 50-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750 and greater than 750 xylanase units / g composition.

[0079] In one embodiment, the composition comprises 500-1000, 1000-1500, 1500-2000, 2000-2500, 2500-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000-5500, 5500-6000, 6000-6500, 6500-7000, 7000-7500, 7500-8000, and greater than 8000 xylanase units / g composition.

[0080] It is understood that one xylanase unit (XU) is the amount of enzyme which releases 0.5 μmol of reducing sugar equivalents (as xylose, as determined by the dinitrosalicylic acid (DNS)-reducing sugar method) per minute from an oat-spelt-xylan substrate at pH 5.3 and 50° C. (Bailey et al., Journal of Biotechnology, Vol. 23, (3), May 1992, 257-270).

[0081] 2. Amylase

[0082] Amylases are a class of enzymes that can hydrolyze starch into shorter chain oligosaccharides (e.g., maltose). Then, the glucose moiety can be transferred from maltose to monoglycerides or glycosyl monoglycerides more easily than from the original starch molecule. The term amylase includes alpha-amylases (EG 3.2.1.1), G4-forming amylases (EG 3.2.1.60), beta-amylases (EG 3.2.1.2), and gamma-amylases (EC 3.2.1.3). Amylases may be of bacterial or fungal origin, or chemically modified or protein engineered mutants. In one embodiment, provided herein is a composition comprising a multi-strain DFM (such as any multi-strain DFM composition disclosed herein) and one or more amylases.

[0083] In one embodiment, the amylase can be a mixture of two or more amylases. In another embodiment, the amylase can be an amylase such as an α-amylase from Bacillus licheniformis and an amylase such as an α-amylase from Bacillus amyloliquefaciens. In one embodiment, the α-amylase can be Axtra or Avizyme In another embodiment, the amylase may be a pepsin-resistant alpha-amylase, such as a pepsin-resistant Trichoderma (e.g., Trichoderma reesei) alpha-amylase. Suitable pepsin-resistant alpha-amylases are taught in UK Application No. 101 1513.7 (incorporated herein by reference) and PCT / IB2011 / 053018 (incorporated herein by reference).

[0084] In one embodiment, the amylase used in the present invention can be one or more amylases in one or more commercial products cited in Table 2.

[0085] Table 2: Representative commercial amylases

[0086]

[0087] It will be appreciated that one amylase unit (AU) is the amount of enzyme that releases 1 mmol of glycosidic bonds per minute from a water-insoluble cross-linked starch polymer substrate at pH 6.5 and 37° C. (This may be referred to herein as the assay for determining 1 AU).

[0088] In one embodiment, the present disclosure relates to a composition comprising a multi-strain DFM (such as any multi-strain DFM composition disclosed herein) and an amylase. In one embodiment, the present disclosure relates to a composition comprising a multi-strain DFM, a xylanase and an amylase. In one embodiment, the composition comprises 10-50, 50-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750 and greater than 750 amylase units / g composition.

[0089] In one embodiment, the composition comprises 500-1000, 1000-1500, 1500-2000, 2000-2500, 2500-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000-5500, 5500-6000, 6000-6500, 6500-700 -15,000, 18,000-20,000, 19,000-30,000, 20,000-40,000, 25,000-50,000, 30,000-60,000, 30,000-70,000, 30,000-80,000, 30,000-90,000, 30,000-10,000, 30,000-11,000, 30,000-12,000, 30,000-13,000, 30,000-14,000, 30,000-15,000, and more than 15,000 amylase units / g of the composition.

[0090] 3. Protease

[0091] The term protease as used herein is synonymous with peptidase or proteinase. Protease may be subtilisin (EG3.4.21.62) or bacillus lysin (EG3.4.24.28) or alkaline serine protease (EG3.4.21.x) or keratinase (EG3.4.XX). In one embodiment, the protease is subtilisin. Suitable proteases include those of animal, plant or microbial origin. Chemically modified or protein engineered mutants are also suitable. Protease may be a serine protease or a metalloprotease, such as an alkaline microbial protease or a trypsin-like protease. In one embodiment, a composition is provided herein comprising a multi-strain DFM (such as any multi-strain DFM composition disclosed herein) and one or more proteases.

[0092] Examples of alkaline proteases are subtilisins, especially those derived from Bacillus species, such as subtilisin Novo, subtilisin Carlsberg, subtilisin 309 (see, e.g., U.S. Pat. No. 6,287,841), subtilisin 147, and subtilisin 168 (see, e.g., WO 89 / 06279). Examples of trypsin-like proteases are trypsin (e.g., of porcine or bovine origin) and Fusarium proteases (see, e.g., WO 89 / 06270 and WO 94 / 25583). Examples of useful proteases also include, but are not limited to, variants described in WO 92 / 19729 and WO 98 / 20115.

[0093] In another embodiment, the protease can be one or more proteases in one or more of the commercial products cited in Table 3.

[0094] Table 3: Representative commercial proteases

[0095] Representative examples of commercial proteases

[0096]

[0097] In one embodiment the protease is selected from the group consisting of a subtilisin, a bacillilysin, an alkaline serine protease, a keratinase and a Nocardiopsis protease.

[0098] It is understood that one protease unit (PU) is the amount of enzyme that releases one microgram of phenolic compounds (expressed as tyrosine equivalents) from a substrate (0.6% casein solution) in one minute at pH 7.5 (40 mM Na2PO4 / lactate buffer) and 40° C. This can be referred to as an assay for determining 1 PU.

[0099] In one embodiment, the present disclosure relates to a composition comprising a multi-strain DFM (such as any multi-strain DFM composition disclosed herein) and a protease. In another embodiment, the present disclosure relates to a composition comprising a multi-strain DFM (such as any multi-strain DFM composition disclosed herein) and a xylanase and a protease. In still another embodiment, the present disclosure relates to a composition comprising a multi-strain DFM (such as any multi-strain DFM composition disclosed herein) and an amylase and a protease. In yet another embodiment, the present disclosure relates to a composition comprising a multi-strain DFM (such as any multi-strain DFM composition disclosed herein) and a xylanase, an amylase and a protease.

[0100] In one embodiment, the composition comprises 10-50, 50-100, 100-150, 150-200, 200-250, 250-300, 300-350, 350-400, 400-450, 450-500, 500-550, 550-600, 600-650, 650-700, 700-750 and more than 750 protease units / g composition.

[0101] In one embodiment, the composition comprises 500-1000, 1000-1500, 1500-2000, 2000-2500, 2500-3000, 3000-3500, 3500-4000, 4000-4500, 4500-5000, 5000-5500, 5500-6000, 6000-6500, 6500-700 -15000, 15000-16000, 16000-17000, 17000-18000, 18000-20000 and more than 15000 protease units / g of composition.

[0102] 4. Phytase

[0103] In one embodiment, provided herein is a composition comprising a multi-strain DFM (such as any multi-strain DFM composition disclosed herein) and one or more phytases. The phytases used in the present invention may be classified as 6-phytases (classified as EC 3.1.3.26) or 3-phytases (classified as EC 3.1.3.8). In one embodiment, the phytases used in the present invention may be one or more phytases in one or more commercial products in Table 4 below:

[0104] Table 4: Representative commercial phytases

[0105]

[0106] In one embodiment the phytase is a Citrobacter phytase derived from, for example, Citrobacter freundii, preferably, for example, Citrobacter freundii NCIMB 41247 and variants thereof as disclosed in WO 2006 / 038062 (incorporated herein by reference) and WO 2006 / 038128 (incorporated herein by reference), Citrobacter braakii YH-15 as disclosed in WO 2004 / 085638, Citrobacter braakii ATCC 51113 as disclosed in WO 2006 / 037328 (incorporated herein by reference), and for example, Citrobacter freundii NCIMB 41247 and variants thereof as disclosed in WO 2007 / 112739 (incorporated herein by reference) and WO 2008 / 114394 (incorporated herein by reference). 2011 / 117396 (incorporated herein by reference) thereof; Citrobacter amalonaticus, preferably Citrobacter amalonaticus ATCC 25405 or malonate-negative Citrobacter ATCC 25407 as disclosed in WO 2006037327 (incorporated herein by reference); Citrobacter gillenii, preferably Citrobacter gillenii DSM 13694 as disclosed in WO 2006037327 (incorporated herein by reference); or Citrobacter intermedius, Citrobacter koseri, Citrobacter murliniae, Citrobacter rodentium, Citrobacter seri. sedlakii), Citrobacter werkmanii, Citrobacter youngae; Citrobacter species polypeptides or variants thereof.

[0107] In some embodiments, the phytase is Danisco Phyzyme XP TMcoli phytase sold under the name of phytase. Alternatively, the phytase may be a Buttiauxella phytase, such as a Buttiauxella agrestis phytase, such as the phytase taught in WO 2006 / 043178, WO 2008 / 097619, WO 2009 / 129489, WO 2008 / 092901, PCT / US 2009 / 41011 or PCT / IB 2010 / 051804, all of which are incorporated herein by reference.

[0108] In one embodiment, the phytase may be a phytase from the genus Hafnia (e.g., from Hafnia alvei), such as one or more of the phytases taught in US 2008263688, which is incorporated herein by reference. In one embodiment, the phytase may be a phytase from the genus Aspergillus (e.g., from Apergillus orzyae). In one embodiment, the phytase may be a phytase from the genus Penicillium (e.g., from Penicillium funiculosum).

[0109] Preferably, the phytase is present in the feed in the range of about 200 FTU / kg to about 1000 FTU / kg feed, more preferably about 300 FTU / kg feed to about 750 FTU / kg feed, more preferably about 400 FTU / kg feed to about 500 FTU / kg feed. In one embodiment, the phytase is present in the feed in an amount of more than about 200 FTU / kg feed, suitably more than about 300 FTU / kg feed, suitably more than about 400 FTU / kg feed. In one embodiment, the phytase is present in the feed in an amount of less than about 1000 FTU / kg feed, suitably less than about 750 FTU / kg feed. Preferably, the phytase is present in the feed additive composition in an amount ranging from about 40 FTU / g to about 40,000 FTU / g composition, more preferably from about 80 FTU / g composition to about 20,000 FTU / g composition, and even more preferably from about 100 FTU / g composition to about 10,000 FTU / g composition, and even more preferably from about 200 FTU / g composition to about 10,000 FTU / g composition. In one embodiment, the phytase is present in the feed additive composition in an amount greater than about 40 FTU / g composition, suitably greater than about 60 FTU / g composition, suitably greater than about 100 FTU / g composition, suitably greater than about 150 FTU / g composition, suitably greater than about 200 FTU / g composition. In one embodiment the phytase is present in the feed additive composition in an amount of less than about 40,000 FTU / g of the composition, suitably less than about 20,000 FTU / g of the composition, suitably less than about 15,000 FTU / g of the composition, suitably less than about 10,000 FTU / g of the composition.

[0110] It should be understood that as used herein, 1 FTU (phytase unit) is defined as the amount of enzyme required to release 1 μmol of inorganic orthophosphate from a substrate in one minute under the reaction conditions defined in the ISO 2009 phytase assay (a standard assay for determining phytase activity), and 1 FTU can be found in the international standard ISO / DIS 30024:1-17, 2009. In one embodiment, the enzyme is classified using the above EC classification, and when tested in the assay for determining 1 FTU taught herein, the EC classification designates an enzyme having that activity.

[0111] C. DFM Formulations

[0112] In one embodiment, the DFM (such as any multi-strain DFM composition disclosed herein) and optionally exogenous enzymes can be formulated as liquids, dry powders or granules. In one embodiment, these DFMs and exogenous enzymes can be formulated as a single mixture. In another embodiment, these DFMs and exogenous enzymes can be formulated as separate mixtures. In still another embodiment, the separate mixtures of DFMs and exogenous enzymes can be applied simultaneously or at different times. In still another embodiment, the separate mixtures of DFMs and exogenous enzymes can be applied simultaneously or sequentially. In yet another embodiment, a first mixture comprising a DFM can be applied, followed by a second mixture comprising an exogenous enzyme. In still another embodiment, a first mixture comprising an exogenous enzyme can be applied, followed by a second mixture comprising a DFM.

[0113] The dry powders or granules can be prepared by means known to the person skilled in the art, for example in a top-spray fluidized bed coater, in a Wurster-type bottom-spray fluidized bed or by drum granulation (eg high-shear granulation), extrusion, pan coating or in a micro-ingredient mixer.

[0114] In another embodiment, the DFM and / or one or more enzymes may be coated, e.g., encapsulated. Suitably, the DFM and the enzyme may be formulated in the same coating or encapsulated in the same capsule. Alternatively, the one or more enzymes may be formulated in the same coating or encapsulated in the same capsule, while the DFM may be formulated in a coating separate from the enzymes.

[0115] In some embodiments, such as in the case of a DFM capable of producing endospores, the DFM may be provided without any coating. In such cases, the DFM endospores may simply be mixed with one or more enzymes. In the latter case, the enzymes may be coated, e.g. encapsulated, e.g. one or more of all the enzymes may be coated, e.g. encapsulated. The enzymes may be encapsulated as a mixture (i.e. comprising one or more, two or more, three or more or all) of the enzymes, or they may be encapsulated individually (e.g. as a single enzyme). In a preferred embodiment, all enzymes may be coated (e.g. encapsulated) together. In one embodiment, the coating protects the enzymes from heat and may be considered a heat protectant.

[0116] In another embodiment, these DFMs and exogenous feed enzymes can be mixed with feed or administered in drinking water. In one embodiment, the dosage range for inclusion in water is about 1×10 3 CFU / animal / day is about 1×10 10 CFU / animal / day, e.g., about 1×10 7 CFU / animal / day.

[0117] D. Feed additive composition

[0118] In one embodiment, provided herein is a feed additive composition comprising one or more DFMs (such as any multi-strain DFM disclosed herein) and optionally one or more exogenous feed enzymes. In one embodiment, the feed additive composition can be formulated in any suitable manner to ensure that the formulation contains viable DFMs and optionally active enzymes.

[0119] In one embodiment, the feed additive composition can be used in the form of solid or liquid preparations or their substitutes. Examples of solid preparations include powders, pastes, macropellets, capsules, ovules, pills, pellets, tablets, dusts and granules, which can be wettable, spray-dried or freeze-dried. Examples of liquid preparations include, but are not limited to, aqueous, organic or aqueous-organic solutions, suspensions and emulsions.

[0120] In another embodiment, the feed additive composition can be used in solid form. In one embodiment, the solid form is a pellet form. The feed additive composition in solid form may also contain one or more of the following: excipients, such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, calcium hydrogen phosphate, and glycine; disintegrants, such as starch (preferably corn, potato or tapioca starch), sodium starch glycolate, cross-linked sodium carboxymethyl cellulose, and certain complex silicates; granulation binders, such as polyvinyl pyrrolidone, hydroxypropyl methylcellulose (HPMC), hydroxypropyl cellulose (HPC), sucrose, gelatin, and gum arabic; lubricants, such as magnesium stearate, stearic acid, glyceryl behenate, and talc may be included.

[0121] Examples of nutritionally acceptable carriers for preparing these forms include, for example, water, saline solutions, alcohol, silicone, waxes, petrolatum, vegetable oils, polyethylene glycol, propylene glycol, liposomes, sugars, gelatin, lactose, amylose, magnesium stearate, talc, surfactants, silicic acid, viscous paraffin, essential oils, fatty acid monoglycerides and diglycerides, petroethral fatty acid esters, hydroxymethyl-cellulose, polyvinylpyrrolidone, and the like.

[0122] In one embodiment the feed additive composition is formulated as a dry powder or granules as described in WO 2007 / 044968 (referred to as TPT granules) or WO 1997 / 016076 or WO 1992 / 012645 (each of which is incorporated herein by reference).

[0123] In one embodiment, the feed additive composition may be formulated as a granular feed composition comprising an active agent comprising one or more DFMs (such as any multi-strain DFM composition disclosed herein) and optionally one or more exogenous feed enzymes and at least one coating. In one embodiment, the active agent of the granules retains activity after processing. In one embodiment, the active agent of the granules retains an activity level selected from the group consisting of 50%-60% active, 60%-70% active, 70%-80% active, 80%-85% active, 85%-90% active, and 90%-95% active after processing.

[0124] In another embodiment, the granules may contain one coating. The coating may comprise a moisture hydrated material constituting at least 55% w / w of the granules. In another embodiment, the granules may contain two coatings. The two coatings may be a moisture hydrated coating and a moisture barrier coating. In some embodiments, the moisture hydrated coating may be 25% w / w to 60% w / w of the granules and the moisture barrier coating may be 2% w / w to 15% w / w of the granules. The moisture hydrated coating may be selected from inorganic salts, sucrose, starch and maltodextrin, and the moisture barrier coating may be selected from polymers, gums, whey and starch.

[0125] In yet another embodiment, the pellets may be produced using a feed pelleting process and the feed pretreatment process may be performed at between 70° C. and 95° C., such as between 85° C. and 95° C. for up to several minutes. In another embodiment, the pellets may be produced using a steam heating pelleting process, which may be performed at between 85° C. and 95° C. for up to several minutes.

[0126] In one embodiment, the particle may have a moisture barrier coating selected from polymers and gums and the moisture hydrating material may be an inorganic salt. The moisture hydrating coating may be between 25% and 45% w / w of the particle and the moisture barrier coating may be between 2% and 20% w / w of the particle.

[0127] In one embodiment, the active agent retains activity after one or more conditions selected from the group consisting of: (a) a feed pelleting process; (b) a steam heated feed pretreatment process; (c) storage; (d) storage as an ingredient in an unpelleted mixture; and (e) storage as an ingredient in a feed base mixture or feed premix comprising at least one compound selected from the group consisting of trace minerals, organic acids, reducing sugars, vitamins, choline chloride, and compounds that result in an acidic or alkaline feed base mixture or feed premix.

[0128] In some embodiments, the DFM (e.g., DFM endospores) may be diluted with a diluent such as starch powder, limestone, etc. In one embodiment, the DFM and enzyme may be in a liquid formulation suitable for consumption, preferably such liquid food comprises one or more of the following: a buffer, a salt, sorbitol and / or glycerol. In another embodiment, the feed additive composition may be formulated by applying (e.g., spraying) one or more enzymes onto a carrier substrate (e.g., ground wheat).

[0129] In one embodiment, the feed additive composition may be formulated as a premix. By way of example only, the premix may include one or more feed components, such as one or more minerals and / or one or more vitamins.

[0130] In one embodiment, the DFM and exogenous feed enzymes may be formulated with at least one physiologically acceptable carrier selected from at least one of the following: maltodextrin, limestone (calcium carbonate), cyclodextrin, wheat or wheat components, sucrose, starch, Na2SO4, talc, PVA, sorbitol, benzoate, sorbate, glycerol, sucrose, propylene glycol, 1,3-propanediol, glucose, parabens, sodium chloride, citrate, acetate, phosphate, calcium, metabisulfite, formate, and mixtures thereof.

[0131] In another embodiment, the feed additive composition can be delivered as an aqueous suspension and / or elixir. The feed additive composition can be combined with different sweeteners or flavorings, coloring substances or dyes, with emulsions and / or suspending agents, and with diluents such as water, propylene glycol and glycerol, and combinations thereof.

[0132] E. Feed

[0133] In another embodiment, provided herein is a feed additive composition containing any of the multi-strain DFM compositions disclosed herein, which can be used as feed or for preparing feed. The feed can be in the form of a solution or as a solid, depending on the use and / or mode of application and / or mode of administration. When used as feed or for preparing feed (such as functional feed), the feed additive composition can be used in combination with one or more of the following: a nutritionally acceptable carrier, a nutritionally acceptable diluent, a nutritionally acceptable excipient, a nutritionally acceptable adjuvant, a nutritionally active ingredient.

[0134] In one embodiment, the feed additive composition disclosed herein is mixed with a feed component to form a feed. In one embodiment, the feed can be a fodder or a premix thereof, a compound feed or a premix thereof. In one embodiment, the feed additive composition disclosed herein can be mixed with a compound feed, a compound feed component, or a premix of a compound feed, or mixed into a fodder, a fodder component, or a premix of a fodder.

[0135] In one embodiment, the fodder can be obtained from one or more plants selected from the group consisting of alfalfa (Medicago sativa), barley, Lotus japonica, brassicas, Chau moellier, kale, rapeseed (Canola), rutabaga (Swede), radish, clover, hybrid clover, red clover, underground clover, white clover, grass, oat grass, fescue grass, triproot, brome grass, heath grass, bluegrass (from naturally mixed prairie grass), wild grass, ryegrass, timothy grass, corn (Zea mays), millet, oats, sorghum, soybeans, trees (tree clippings for tree-hay), wheat, and legumes.

[0136] Compound feeds can be complete feeds that provide all the daily nutrients required, concentrates that provide part of the ration (protein, energy), or supplements that provide only additional micronutrients (such as minerals and vitamins). The main ingredients used in compound feeds are feed grains, which include corn, soybeans, sorghum, oats, and barley.

[0137] As referred to herein, a "premix" may be a composition consisting of minor ingredients such as vitamins, minerals, chemical preservatives, antibiotics, fermentation products and other essential ingredients. A premix is ​​typically a composition suitable for blending into a commercial ration.

[0138] In one embodiment, a feed as disclosed herein may comprise one or more feed materials selected from the group comprising: cereals, such as small grains (e.g., wheat, barley, rye, oats, and combinations thereof) and / or large grains such as maize or sorghum; by-products from cereals, such as corn gluten meal, Distillers Dried Grain Soluble (DDGS), wheat bran, semolina, wheat flour, rice bran, rice hulls, oat hulls, palm kernels, and citrus pulp; proteins obtained from sources such as soybeans, sunflowers, peanuts, lupines, peas, beans, cotton, canola, fish meal, dried plasma protein, meat and bone meal, potato protein, whey, copra, sesame; oils and fats obtained from plant and animal sources; and minerals and vitamins.

[0139] In yet another embodiment, the feed may include at least one high fiber feed material and / or at least one byproduct of at least one high fiber feed material to provide a high fiber feed. Examples of high fiber feed materials include: wheat, barley, rye, oats, byproducts from cereals such as corn gluten meal, distillers dried grains with solubles (DDGS), wheat bran, semolina, wheat flour, rice bran, rice hulls, oat hulls, palm kernels and citrus pulp. Some protein sources may also be considered high fiber: proteins obtained from sources such as sunflower, lupin, broad bean and cotton.

[0140] In still another embodiment, the feed may be one or more of the following: compound feeds and premixes, including pellets, nuts or cakes (for livestock); crops or crop residues: corn, soybeans, sorghum, oats, barley, corn stover, copra, straw, husks, beet residues; fish meal; freshly cut grass and other forage plants; meat meal and bone meal; molasses; oil cakes and filter cakes; oligosaccharides; sugared forage plants: hay and silage; seaweed; seeds and grains, whole or prepared by crushing, grinding, etc.; sprouted grains and legumes; yeast extract.

[0141] In one embodiment, the feed additive composition disclosed herein is mixed with a product (e.g., a feed). Alternatively, the feed additive composition may be included in an emulsion or an original component of the feed. In another embodiment, the feed additive composition is made available or available on the surface of the product to be affected / treated. In yet another embodiment, the feed additive composition disclosed herein may be applied, spread, coated and / or impregnated with a controlled amount of a DFM and optionally an enzyme to a product (e.g., a feed or an original component of a feed).

[0142] In yet another embodiment, the DFM and optional enzyme may be used simultaneously (eg when they are mixed together or even when they are delivered by different routes) or sequentially (eg they may be delivered by different routes).

[0143] In one embodiment, the DFM and optional enzymes are applied to the feed simultaneously. In yet another embodiment, the DFM and optional enzymes are mixed before being delivered to the feed or the original ingredients of the feed.

[0144] In one embodiment, the DFM in the feed additive composition disclosed herein can be added at a suitable concentration, including but not limited to providing about 2×10 3 CFU is about 2×10 11 CFU, about 2×10 6 About 1×10 10 , and about 3.75×10 7 CFU is about 1×1010 The concentration of the daily dose of CFU.

[0145] III. Methods

[0146] A. Methods for improving performance indicators in animals

[0147] Further provided herein are methods for improving performance indicators of animals. In another embodiment, the present disclosure relates to methods for improving performance indicators of poultry. In still another embodiment, the present disclosure relates to methods for improving performance indicators of poultry (which includes but is not limited to broilers, chickens and turkeys).

[0148] In yet another embodiment, the present disclosure relates to a method comprising administering to an animal a composition comprising a DFM (such as any multi-strain DFM disclosed herein) and optionally an exogenous feed enzyme. In yet another embodiment, the present disclosure relates to a method comprising administering to an animal an effective amount of a composition comprising a DFM and optionally an exogenous feed enzyme to improve the performance of the animal. The effective amount can be administered to the animal in one or more doses. In one embodiment, the animal is poultry. In yet another embodiment, the animal is a broiler chicken.

[0149] In another embodiment, the disclosure relates to a method comprising administering to an animal (e.g., domestic poultry, e.g., chicken) an effective amount of a composition comprising a DFM (e.g., any multi-strain DFM disclosed herein) and optionally an exogenous feed enzyme to increase average daily feed intake. In some embodiments, the average daily feed intake is increased by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, or 110% relative to an animal not administered one or more multi-strain DFM compositions disclosed herein, including all values ​​falling between these percentages. In some embodiments, the composition is a feed additive composition. In other embodiments, the composition is a feed or feedstuff.

[0150] In another embodiment, the disclosure relates to a method comprising administering to an animal (e.g., domestic poultry, e.g., chicken) an effective amount of a composition comprising a DFM (e.g., any multi-strain DFM disclosed herein) and optionally an exogenous feed enzyme to increase average daily weight gain. In some embodiments, the average daily weight gain is increased by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, or 110% relative to an animal not administered one or more multi-strain DFM compositions disclosed herein, including all values ​​falling between these percentages. In some embodiments, the composition is a feed additive composition. In other embodiments, the composition is a feed or feedstuff.

[0151] In another embodiment, the disclosure relates to a method comprising administering to an animal (e.g., domestic poultry, e.g., chicken) an effective amount of a composition comprising a DFM (e.g., any multi-strain DFM disclosed herein) and optionally an exogenous feed enzyme to increase total weight gain. In some embodiments, total weight gain is increased by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, or 110% relative to an animal not administered one or more multi-strain DFM compositions disclosed herein, including all values ​​falling between these percentages. In some embodiments, the composition is a feed additive composition. In other embodiments, the composition is a feed or feedstuff.

[0152] In another embodiment, the disclosure relates to a method comprising administering to an animal (e.g., domestic poultry, e.g., chicken) an effective amount of a composition comprising a DFM (e.g., any multi-strain DFM disclosed herein) and optionally an exogenous feed enzyme to increase feed conversion ratio, which can be measured by feed:weight gain or weight gain:feed. In some embodiments, feed conversion ratio is increased by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, or 110% relative to an animal not administered one or more multi-strain DFM compositions disclosed herein, including all values ​​falling between these percentages. In some embodiments, the composition is a feed additive composition. In other embodiments, the composition is a feed or feedstuff.

[0153] In another embodiment, the disclosure relates to a method comprising administering to an animal (e.g., domestic poultry, e.g., chicken) an effective amount of a composition comprising a DFM (e.g., any multi-strain DFM disclosed herein) and optionally an exogenous feed enzyme to increase feed efficiency. In some embodiments, feed efficiency is increased by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, or 110% relative to an animal not administered one or more multi-strain DFM compositions disclosed herein, including all values ​​falling between these percentages. In some embodiments, the composition is a feed additive composition. In other embodiments, the composition is a feed or feedstuff.

[0154] In another embodiment, the disclosure relates to a method comprising administering to an animal (e.g., domestic poultry, e.g., chicken) an effective amount of a composition comprising a DFM (e.g., any multi-strain DFM disclosed herein) and optionally an exogenous feed enzyme to reduce mortality. In some embodiments, mortality is reduced by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, including all values ​​falling between these percentages, relative to animals not administered one or more multi-strain DFM compositions disclosed herein. In some embodiments, the composition is a feed additive composition. In other embodiments, the composition is a feed or feedstuff.

[0155] In another embodiment, the disclosure relates to a method comprising administering to an animal (e.g., domestic poultry, e.g., chicken) an effective amount of a composition comprising a DFM (e.g., any multi-strain DFM disclosed herein) and optionally an exogenous feed enzyme to reduce feed conversion ratio (FCR). In some embodiments, the FCR is reduced by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, including all values ​​falling between these percentages, relative to an animal not administered one or more multi-strain DFM compositions disclosed herein. In some embodiments, the composition is a feed additive composition. In other embodiments, the composition is a feed or feedstuff.

[0156] In another embodiment, the present disclosure relates to a method comprising administering to an animal (e.g., domestic poultry, e.g., chicken) an effective amount of a composition comprising a DFM (e.g., any multi-strain DFM disclosed herein) and optionally an exogenous feed enzyme to increase digestive tract barrier integrity. In some embodiments, the digestive tract barrier integrity is increased by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 105%, or 110% relative to an animal not administered one or more multi-strain DFM compositions disclosed herein, including all values ​​falling between these percentages. "Digestive tract barrier integrity" may refer to, but is not limited to, epithelial damage and epithelial permeability characterized by shortened villi, elongated crypts, and infiltration of inflammatory cells (e.g., but not limited to CD3+ cells). The latter injury and inflammatory markers may also be associated with a "severe" macroscopic appearance of the digestive tract compared to a "normal" appearance when assessed using a scoring system such as that described by Teirlynck et al. (2011). In some embodiments, the composition is a feed additive composition. In other embodiments, the composition is a feed or feedstuff.

[0157] In another embodiment, the present disclosure relates to a method comprising administering to an animal (e.g., domestic poultry, e.g., chicken) an effective amount of a composition comprising a DFM (e.g., any multi-strain DFM disclosed herein) and optionally an exogenous feed enzyme to reduce or prevent pathogen infection (e.g., but not limited to, infection with Clostridium perfringens, Campylobacter jejuni, Salmonella species, and / or Escherichia coli). In some embodiments, the pathogen infection is reduced by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, including all values ​​falling between these percentages, relative to an animal not administered one or more multi-strain DFM compositions disclosed herein. In some embodiments, the composition is a feed additive composition. In other embodiments, the composition is a feed or feed. In some embodiments, the composition is a feed additive composition. In other embodiments, the composition is a feed or feed.

[0158] In another embodiment, the present disclosure is directed to a method comprising administering to an animal (e.g., domestic poultry, e.g., chicken) an effective amount of a composition comprising a DFM (e.g., any multi-strain DFM disclosed herein) and optionally an exogenous feed enzyme to reduce or prevent pathogen shedding in feces (e.g., but not limited to, shedding of Clostridium perfringens, Campylobacter jejuni, Salmonella species, and / or Escherichia coli). In some embodiments, pathogen shedding in feces is reduced by about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, including all values ​​falling between these percentages, relative to animals not administered one or more multi-strain DFM compositions disclosed herein. In some embodiments, the composition is a feed additive composition. In other embodiments, the composition is a feed or feedstuff.

[0159] In yet another embodiment, the DFM composition (e.g., feed or feed additive composition) administered to an animal (e.g., domestic poultry, e.g., chicken) is a multi-strain DFM comprising one or more of: human colon anaerobic coryneformis strain W1 (CBS 146120), or a strain having all the identifying characteristics of human colon anaerobic coryneformis strain W1, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (e.g., any of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of human colon anaerobic coryneformis strain W1 (SEQ ID NO: 1); human colon anaerobic coryneformis strain W2 (CBS 146122), or a strain having all the identifying characteristics of human colon anaerobic coryneformis strain W2, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (e.g., any of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of human colon anaerobic coryneformis strain W2 (SEQ ID NO: 2); NO:2) with a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (e.g., any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity); human colon anaerobic coryneform bacteria strain W3 (CBS 146123), or a strain having all the identification characteristics of human colon anaerobic coryneform bacteria strain W3, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (e.g., any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) with a 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W3 (SEQ ID NO:3); and / or human colon anaerobic coryneform bacteria strain W4 (CBS 146123). 146121), or a strain having all the identification characteristics of human colon anaerobic coryneform bacteria strain W4, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (such as about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W4 (SEQ ID NO: 4). In another embodiment, the DFM composition includes human colon anaerobic coryneform bacteria strains W1 and W2; human colon anaerobic coryneform bacteria strains W1 and W3; human colon anaerobic coryneform bacteria strains W1 and W4; human colon anaerobic coryneform bacteria strains W2 and W3; human colon anaerobic coryneform bacteria strains W2 and W4; human colon anaerobic coryneform bacteria strains W3 and W4; human colon anaerobic coryneform bacteria strains W1, W2, and W3; human colon anaerobic coryneform bacteria strains W1, W3, and W4; human colon anaerobic coryneform bacteria strains W2, W3, and W4; or human colon anaerobic coryneform bacteria strains W1, W2, W3, and W4. In some embodiments, the one or more human colon anaerobic coryneform bacteria strains are at least 1×104 CFU / animal / day. For poultry, according to one non-limiting example, the one or more human colonic anaerobic coryneform bacteria strains may be administered at a rate of about 1×10 5 CFU / g feed is about 1×10 10 CFU / g feed. In at least some embodiments, the one or more human colon anaerobic coryneform bacteria strains are fed at a concentration of about 1×10 5 CFU / bird / day or about 1×10 8 CFU / bird / day fed.

[0160] In yet another embodiment, the DFM composition (e.g., feed or feed additive composition) administered to an animal (e.g., domestic poultry, e.g., chicken) is a multi-strain DFM comprising one or more of the following: Coprococcus sp. strain M1 (CBS 146125), or a strain having all the identifying characteristics of Coprococcus sp. strain M1, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (e.g., any of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of Coprococcus sp. strain M1 (SEQ ID NO: 5); Homo sapiens coli strain M2 (CBS 146119), or a strain having all the identifying characteristics of Homo sapiens coli strain M2, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (e.g., any of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of Coprococcus sp. strain M1 (SEQ ID NO: 5); NO:6) exhibits at least about 97.0% sequence similarity (such as any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of Clostridium lactic acid fermentation strain M3 (CBS146124), or a strain having all the identification characteristics of Clostridium lactic acid fermentation strain M3, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (such as any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of Clostridium lactic acid fermentation strain M3 (SEQ ID NO:7); and / or a strain of Pseudomonas aeruginosa (such as Pseudomonas aeruginosa strain M4), or a strain having all the identification characteristics of Clostridium lactic acid fermentation strain M3 IDNO: 8) exhibits at least about 97.0% sequence similarity (such as about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) in the 16S ribosomal RNA sequence. In some embodiments, the DFM composition includes only Coprococcus sp. strain M1, human colon anaerobic coryneformis strain M2, lactic acid fermentation Clostridium strain M3, or Pseudomonas aeruginosa strain (such as Pseudomonas aeruginosa strain M4).In another embodiment, the DFM composition includes Coprococcus species strain M1 and human colon anaerobic cocci strain M2; Coprococcus species strain M1 and lactoferment Clostridium strain M3; Coprococcus species strain M1 and Pseudotrichopyrmax strain (such as Pseudotrichopyrmax strain M4); human colon anaerobic cocci strain M2 and lactoferment Clostridium strain M3; human colon anaerobic cocci strain M2 and Pseudotrichopyrmax strain (such as Pseudotrichopyrmax strain M4); lactoferment Clostridium strain M3 and Pseudotrichopyrmax strain (such as Pseudotrichopyrmax strain M4). strain M4); Coprococcus species M1, human colon anaerobic stick bacteria strain M2, and lactic acid fermentation Clostridium strain M3; Coprococcus species strain M1, lactic acid fermentation Clostridium strain M3, and pseudo-trichophyton strain (such as pseudo-trichophyton strain M4); human colon anaerobic stick bacteria strain M2, lactic acid fermentation Clostridium strain M3, and pseudo-trichophyton strain M4; or Coprococcus species strain M1, human colon anaerobic stick bacteria strain M2, lactic acid fermentation Clostridium strain M3, and pseudo-trichophyton strain (such as pseudo-trichophyton strain M4). In some embodiments, the one or more M1, M2, M3 and / or M4 strains are at least 1×10. 4 CFU / animal / day. For poultry, according to a non-limiting example, the one or more M1, M2, M3 and / or M4 strains may be administered to animals at a rate of about 1×10 5 CFU / g feed is about 1×10 10 CFU / g feed. In at least some embodiments, the one or more M1, M2, M3 and / or M4 strains are fed at about 1×10 5 CFU / bird / day or about 1×10 8 CFU / bird / day fed.

[0161] In yet another embodiment, the DFM composition (e.g., feed or feed additive composition) administered to an animal (e.g., domestic poultry, e.g., chicken) is a multi-strain DFM comprising one or more of: Clostridium lactofermentum strain 2F1 (CBS146124), or a strain having all the identifying characteristics of Clostridium lactofermentum strain 2F1, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (e.g., any of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of Clostridium lactofermentum strain 2F1 (SEQ ID NO:9); Lactobacillus salivarius strain 2F2 (CBS 146126), or a strain having all the identifying characteristics of Lactobacillus salivarius strain 2F2, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (e.g., any of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of Clostridium lactofermentum strain 2F1 (SEQ ID NO:9); NO:10) exhibits at least about 97.0% sequence similarity (such as any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to a 16S ribosomal RNA sequence of Lactobacillus reuteri strain 2F3 (CBS 145921), or a strain having all the identification characteristics of Lactobacillus reuteri strain 2F3, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (such as any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to a 16S ribosomal RNA sequence of Lactobacillus reuteri strain 2F3 (SEQ ID NO:11). In some embodiments, Lactobacillus reuteri strain 2F3 produces reuterin (3-hydroxypropionaldehyde). In other embodiments, Lactobacillus reuteri strain 2F3 does not produce reuterin (3-hydroxypropionaldehyde). In some embodiments, the DFM composition includes only Clostridium lactofermentum strain 2F1, Lactobacillus salivarius strain 2F2, or Lactobacillus reuteri strain 2F3. In another embodiment, the DFM composition includes Clostridium lactofermentum strain 2F1 and Lactobacillus salivarius strain 2F2; Clostridium lactofermentum strain 2F1 and Lactobacillus reuteri strain 2F3; Lactobacillus salivarius strain 2F2 and Lactobacillus reuteri strain 2F3; or Clostridium lactofermentum strain 2F1, Lactobacillus salivarius strain 2F2, and Lactobacillus reuteri strain 2F3. In some embodiments, the one or more 2F1, 2F2 and / or 2F3 strains are present in an amount of at least 1×10 4 CFU / animal / day. For poultry, according to a non-limiting example, the one or more 2F1, 2F2 and / or 2F3 strains may be administered to animals at a rate of about 1×10 5 CFU / g feed is about 1×10 10In at least some embodiments, the one or more 2F1, 2F2 and / or 2F3 strains are fed at about 1×10 5 CFU / bird / day or about 1×10 8 CFU / bird / day fed.

[0162] The DFM compositions provided herein can be administered, for example, as a culture solution containing the strain, a supernatant containing the strain, or a bacterial product of the culture solution. The composition comprising the DFM provided herein and optionally an exogenous feed enzyme administered to an animal can improve the performance of the animal. In one embodiment, the administration of the DFM provided herein to an animal can increase the average daily feed intake (ADFI), average daily gain (ADG), or feed efficiency (gain: feed; G: F) (collectively referred to as "performance indicators"). One or more of these performance indicators can be improved.

[0163] The composition comprising a DFM and an exogenous feed enzyme can be administered to an animal in one of a variety of ways. For example, the composition can be administered as a veterinary drug in solid form, can be distributed in an excipient, preferably water, and fed directly to an animal, can be physically mixed with a feed material in dry form, or the composition can be formed into a solution and then sprayed onto the feed material. Methods of administering the compositions disclosed herein to an animal are deemed to be within the skill of the skilled artisan.

[0164] When used in combination with feed materials, the feed materials may include corn, soybean meal, by-products like distillers dried grains with solubles (DDGS), and vitamin / mineral supplements. Other feed materials may also be used.

[0165] Thus, in at least some embodiments, an effective amount of a composition comprising a DFM and optionally an exogenous feed enzyme is administered to an animal by supplementing the feed intended for the animal. As used herein, "supplementation" refers to the act of incorporating an effective amount of the bacteria provided herein directly into the feed intended for the animal. Thus, the animal ingests the bacteria provided herein when fed.

[0166] B. Method for preparing feed additive composition

[0167] Also provided herein are methods for preparing feed additive compositions, which methods include combining two or more DFMs disclosed herein. In some embodiments, the method includes combining two or more (e.g., any one of 2, 3, or 4) of the following: human colon anaerobic coryneform bacteria strain W1 (CBS 146120), or a strain having all the identification characteristics of human colon anaerobic coryneform bacteria strain W1, or a microorganism having a 16S ribosomal RNA sequence with a human colon anaerobic coryneform bacteria strain W1 (SEQ ID NO: 1) that exhibits at least about 97.0% sequence similarity (e.g., any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity); human colon anaerobic coryneform bacteria strain W2 (CBS 146122), or a strain having all the identification characteristics of human colon anaerobic coryneform bacteria strain W2, or a microorganism having a 16S ribosomal RNA sequence with a human colon anaerobic coryneform bacteria strain W2 (SEQ ID NO: 1); NO:2) with a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (e.g., any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity); human colon anaerobic coryneform bacteria strain W3 (CBS 146123), or a strain having all the identification characteristics of human colon anaerobic coryneform bacteria strain W3, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (e.g., any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) with a 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W3 (SEQ ID NO:3); and / or human colon anaerobic coryneform bacteria strain W4 (CBS 146123). 146121), or a strain having all the identification characteristics of human colon anaerobic coryneform bacteria strain W4, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (such as about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of human colon anaerobic coryneform bacteria strain W4 (SEQ ID NO:4).In another embodiment, human colon anaerobic stick bacteria strains W1 and W2 are combined; human colon anaerobic stick bacteria strains W1 and W3 are combined; human colon anaerobic stick bacteria strains W1 and W4 are combined; human colon anaerobic stick bacteria strains W2 and W3 are combined; human colon anaerobic stick bacteria strains W2 and W4 are combined; human colon anaerobic stick bacteria strains W3 and W4 are combined; human colon anaerobic stick bacteria strains W1, W2 and W3 are combined; human colon anaerobic stick bacteria strains W1, W3 and W4 are combined; human colon anaerobic stick bacteria strains W2, W3 and W4 are combined; or human colon anaerobic stick bacteria strains W1, W2, W3 and W4 are combined.

[0168] In yet another embodiment, the method comprises combining two or more (such as any of 2, 3, or 4) of the following: Coprococcus sp. strain M1 (CBS 146125), or a strain having all the identification characteristics of Coprococcus sp. strain M1, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (such as any of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of Coprococcus sp. strain M1 (SEQ ID NO: 5); human colon anaerobic coryneform bacteria strain M2 (CBS 146119), or a strain having all the identification characteristics of human colon anaerobic coryneform bacteria strain M2, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (such as any of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of Coprococcus sp. strain M1 (SEQ ID NO: 5); NO:6) exhibits at least about 97.0% sequence similarity (such as about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) in the 16S ribosomal RNA sequence; lactic acid fermentation Clostridium strain M3 (CBS146124), or a strain having all the identification characteristics of lactic acid fermentation Clostridium strain M3, or having a 16S ribosomal RNA sequence that is similar to lactic acid fermentation Clostridium strain M3 (SEQ ID NO:7) exhibits at least about 97.0% sequence similarity (such as any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to a 16S ribosomal RNA sequence of Pseudotrichophyton strain M4; and / or a strain having all the identification characteristics of a Pseudotrichophyton strain (such as Pseudotrichophyton strain M4), or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (such as any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to a 16S ribosomal RNA sequence of Pseudotrichophyton strain M4 (SEQ ID NO:8).In another embodiment, the Coprococcus species strain M1 and the human colon anaerobic stick bacteria strain M2 are combined; the Coprococcus species strain M1 and the lactic acid fermentation Clostridium strain M3 are combined; the Coprococcus species strain M1 and the pseudo-trichophyton strain M4 are combined; the human colon anaerobic stick bacteria strain M2 and the lactic acid fermentation Clostridium strain M3 are combined; the human colon anaerobic stick bacteria strain M2 and the pseudo-trichophyton strain M4 are combined; the lactic acid fermentation Clostridium strain M3 and the pseudo-trichophyton strain M4 are combined; Combine Coprococcus species strain M1, human colon anaerobic stick bacteria strain M2, and lactic acid fermentation Clostridium strain M3; combine Coprococcus species strain M1, lactic acid fermentation Clostridium strain M3, and Pseudomonas aeruginosa strain M4; combine human colon anaerobic stick bacteria strain M2, lactic acid fermentation Clostridium strain M3, and Pseudomonas aeruginosa strain M4; or combine Coprococcus species strain M1, human colon anaerobic stick bacteria strain M2, lactic acid fermentation Clostridium strain M3, and Pseudomonas aeruginosa strain M4.

[0169] In further embodiments, the method comprises combining two or more (such as any of 2 or 3) of the following: Clostridium lactofermentum strain 2F1 (CBS 146124), or a strain having all the identifying characteristics of Clostridium lactofermentum strain 2F1, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (such as any of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of Clostridium lactofermentum strain 2F1 (SEQ ID NO:9); Lactobacillus salivarius strain 2F2 (CBS 146126), or a strain having all the identifying characteristics of Lactobacillus salivarius strain 2F2, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (such as any of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to the 16S ribosomal RNA sequence of Clostridium lactofermentum strain 2F1 (SEQ ID NO:9); NO:10) exhibits at least about 97.0% sequence similarity (such as any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to a 16S ribosomal RNA sequence of Lactobacillus reuteri strain 2F3 (CBS 145921), or a strain having all of the identifying characteristics of Lactobacillus reuteri strain 2F3, or a microorganism having a 16S ribosomal RNA sequence that exhibits at least about 97.0% sequence similarity (such as any one of about 97%, 97.5%, 98%, 98.5%, 99%, 99.5%, or 100% sequence similarity) to a 16S ribosomal RNA sequence of Lactobacillus reuteri strain 2F3 (SEQ ID NO:11). In another embodiment, Clostridium lactate fermentation strain 2F1 and Lactobacillus salivarius strain 2F2 are combined; Clostridium lactate fermentation strain 2F1 and Lactobacillus reuteri strain 2F3 are combined; Lactobacillus salivarius strain 2F2 and Lactobacillus reuteri strain 2F3 are combined; or Clostridium lactate fermentation strain 2F1, Lactobacillus salivarius strain 2F2, and Lactobacillus reuteri strain 2F3 are combined.

[0170] In addition, the method for preparing the feed additive composition may further include combining the feed additive composition with one or more of the exogenous enzymes disclosed herein (e.g., one or more of phytases, proteases, amylases, xylanases, or beta-glucanases). The method may further include the additional step of packaging the feed additive composition for storage or transportation.

[0171] IV. Kit

[0172] Further provided herein are kits containing one or more DFMs disclosed herein (e.g., one or more multi-strain DFMs). These kits may include strains provided herein (these strains include human colon anaerobic coryneform bacteria strain W1 (CBS 146120), human colon anaerobic coryneform bacteria strain W2 (CBS 146122), human colon anaerobic coryneform bacteria strain W3 (CBS 146123), human colon anaerobic coryneform bacteria strain W4 (CBS 146121), Coprococcus species strain M1 (CBS 146125), human colon anaerobic coryneform bacteria strain M2 (CBS 146119), lactofermentation clostridium strain M3 (CBS 146124), pseudotrichophyton strains (e.g., pseudotrichophyton strain M4), lactofermentation clostridium strain 2F1 (CBS 146124), Lactobacillus salivarius strain 2F2 (CBS 146126), and Lactobacillus reuteri strain 2F3 (CBS 146124). 145921)) together with instructions for proper storage, maintenance, and administration to animals to improve one or more performance indicators. In one embodiment, the kit may include strains W1, W2, W3, and / or W4. In another embodiment, the kit may include strains M1, M2, M3, and / or M4. In further embodiments, the kit may include strains 2F1, 2F2, and / or 2F3. These kits may additionally include one or more of the exogenous enzymes disclosed herein (e.g., one or more of phytases, proteases, amylases, xylanases, or β-glucanases).

[0173] The invention may be further understood by reference to the following examples, which are provided by way of illustration and not limitation.

[0174] Examples

[0175] Example 1: Methods and assays

[0176] In the following examples, for ease of reading, various methods and assays were used as described below. Any deviations from the protocols provided below are noted in the relevant section.

[0177] Isolation of Anaerobic Microorganisms from Chicken Intestinal Tract: To isolate strict anaerobes, transfer field dissected GIT samples to anaerobic transport media as quickly as possible. Once the intestinal samples arrive at the laboratory, strain isolation begins. Dissect the cecum, ileum, jejunum, or duodenum samples using sterile technique in an anaerobic chamber. Discard the digesta and scrape the mucosa-bound material using a loop. This material is then transferred to sterile culture medium or buffer and serially diluted. Use plating beads to dilute the sample from 10 -1 Up to 10 -6Serial dilutions of the strain were plated onto petri dishes or omni plates of various media types. The plates were then incubated under anaerobic conditions until colonies became visible. For obligate anaerobes, brain heart infusion (BHI) medium was used.

[0178] Once colonies are visible on the agar plates, the colonies are picked into liquid medium in 96 deep well plates in an anaerobic chamber. Some plates are initially picked into a small amount of liquid medium (i.e. 200 μl), and then medium is added to 800 μl after 1-4 days to promote growth. Colonies can be picked at multiple time points for the same plate. For example, large colonies may be picked on day 2, and very small colonies or new colonies may be picked on day 5.

[0179] Sample preparation and analysis of short-chain fatty acid production: Short-chain fatty acid (SCFA) production in the supernatant of bacterial culture was evaluated by GC method. Cell culture was centrifuged at 4100RPM at 4°C, and 300μl of supernatant was removed by filtration through a 0.2um filter porous plate filtration unit (Pall Corporation, product ID 8119). 150μl of filtered supernatant was added to 150μl of 0.5% H3PO4 solution and filtered again through a 0.2μm filter plate. 140μl of prepared supernatant samples were transferred to a GC vial with a volume insert for GC-FID analysis.

[0180] GC separation of SCFA on FFAP column has been previously reported (Zhao et al. 2005). The GC instrumental method was modified to reduce the sample run time to about 8 minutes. SCFA chromatographic analysis was performed using an Agilent 7890A GC system equipped with an FID detector. A fused silica capillary column (Agilent P / N 122-3232DB-FFAP, 30m x 0.25mm diameter, 0.25μm film thickness) with a free fatty acid phase was used. Helium was used as a carrier gas. In order to extend the analysis time, the GC instrumental method was optimized. The inlet temperature was 250°C, with an inlet pressure of 22.192psi. The method was run at a constant flow of 1.8mL / min carrier gas flow rate. The initial oven temperature was 100°C, maintained for 0.3min, and increased to 240°C at 17.5°C / min, with no holding time at the final 240°C temperature. The average gas velocity using these parameters was >42cm / sec. The temperature of the FID was 300°C. The instrument parameters reduced the run time to approximately 8 minutes. GC grade standards were used for external calibration.

[0181] Analysis of microbial composition of the small intestinal mucosal region by 16S sequencing and netB qPCR: To evaluate the microbial composition of the small intestine, chicken swabs from the small intestinal mucosal region were analyzed by 16S sequencing. The gastrointestinal tract (GIT) of chickens was removed and divided into four parts: duodenum, jejunum, ileum, and cecum. Each part was squeezed to remove the digesta contents and then cut longitudinally to expose the inner surface. The inner surface of each part was swabbed using FLOQSwab (Copan Mfgr, Murrieta, CA). The swabs were added directly to the wells of a 96-well Qiagen MagAttract PowerSoil kit (Qiagen, Hilden, Germany). The swabs were processed for bacterial DNA isolation using the KingFisher Flex automated platform according to the manufacturer's instructions. The isolated metagenomic DNA was then used for NGS sample preparation.

[0182] Metagenomic DNA purified from chicken GIT swabs was prepared for 16S community sequencing as follows: DNA was diluted 1:5 by adding 20 μl molecular biology grade water to 5 μl purified DNA at 0.1-10 ng / μl. 2 μl of diluted DNA was then added to the PCR reaction with 25 ul ABI Universal TaqMan Reaction mix (ThermoFisher #4326614) without UNG, 0.1 μl of 100 uM of each PCR primer, and 24.8 μl molecular biology grade water in a total volume of 50 ul. The PCR primers used were Illumina-V4-515F-RJ: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGCCAGCMGCCGCGGTAA and Illumina-V4-806R-RJ: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT. The PCR reaction was: 95°C for 10 min, then 95°C for 15 seconds + 55°C for 30 seconds + 72°C for 2 min for 35 cycles. The amplification reaction was purified using Ampure XP magnetic beads (Beckman Coulter A63881) using an Agilent Bravo automated robotic workstation according to the manufacturer's instructions. Then in the second PCR reaction, IlluminaXT Index Primers (Illumina XT v2.0#FC-131-2001-2004) were used to perform 15 cycles under the same conditions as above to index each amplicon pool of 2 μl. The indexed amplicons were then pooled and purified using AmPure XP magnetic beads on an Agilent Bravo automated robotic workstation. According to the manufacturer's instructions, the pooled, indexed amplicons were quantified using a Kapa Illumina Library Quantification Kit (KAPA#KK4835). The purified, quantitative, indexed pool was loaded onto an Illumina MiSeq with 15% Illumina PhiX (Illumina FC-110-3001) at a final concentration of 8 pM. The sequencing was run for 2x250 paired end cycles.

[0183] 16S amplicon data from Illumina Miseq sequencing were analyzed. Paired-end reads were first merged by Flash (Mogoc et al., Bioinformatics. [Bioinformatics] 2011; 27: 2957-63). Forward and reverse primers were removed from the merged reads, and reads with an overall quality score below 20 were discarded by the RDP Initial Process tool (Fish et al., Front Microbiol. [Microbial Frontier] 2013; 4: 291). Since the reads from chicken mitochondria were shorter than 200 bp in length, these reads were also removed in this step. In the next step, the reads were assigned to bacterial and archaeal taxonomy by the RDP classifier (Wang et al., Appl Environ Microbiol. [Applied and Environmental Microbiology] 73 (16): 5261-5267). The reads that passed the above quality processing steps were clustered at 98% by CD-HIT (Li and Godzik, Bioinformatics [Bioinformatics], 2006; 22: 1658-9) to obtain operational taxonomic units (OTUs). Representative sequences from each OTU were assigned to the nearest species by the RDP pairwise alignment tool (Fish et al., Front Microbiol. [Microbiology Frontier] 2013; 4: 291) against a reviewed 16S reference database, which mainly contains 16S genes from model strains and public genomes. The relative abundance of an OTU in a sample is the fraction of reads assigned to that OTU. If an OTU has at least 98% identity with a species in the reference database, the OTU is assigned to that species. The average abundance of a species in the consortium in the small intestine was calculated as the average relative abundance of that species from DUO, JEJ and ILL samples of each treatment.

[0184] The same DNA preparation of the netB gene was also quantified using qPCR. NetB is an important virulence factor of Clostridium perfringens. Each assay was run using 1.5 μl of DNA along with 10 μl of TaqMan Universal Master Mix, 0.2 μl of 100uM forward and reverse primers, 0.05 μl of TaqMan probe, and 9.55 μl of molecular biology grade water. The qPCR reaction conditions were as follows: 95°C 10 min + 40 cycles of the following: 95°C 15 seconds + 60°C 60 seconds on an ABI Quant Studio qPCR instrument. The sample data was quantified using genomic DNA from netB positive Clostridium perfringens. The primer and probe sequences used are in Table 5 below.

[0185] Table 5: qPCR primers and probes

[0186]

[0187]

[0188] Example 2: Production of short-chain fatty acids by obligate anaerobic bacteria from broiler chickens

[0189] Based on the method described in Example 1, a variety of obligate anaerobes producing SCFAs were identified, including Gram-positive and Gram-negative bacteria. Table 6 lists the production of butyrate and propionate by non-limiting examples of bacteria isolated from the chicken intestine. Most of them produce butyrate as the main SCFA ( Figure 1A On the other hand, one strain, Clostridium lactofermentum M3, produced propionate as the main SCFA ( Figure 1B ).

[0190] Table 6: Production of short-chain fatty acids by some obligate anaerobes (mM)

[0191]

[0192] To evaluate the potential interactions between SCFA-producing microorganisms, four SCFA-producing microorganisms were mixed in BHI medium for co-culture. As listed in Table 6, the four organisms are Coprococcus species M1, human colon anaerobic rod-shaped bacteria M2, lactic acid fermentation Clostridium M3, and Pseudomonas aeruginosa M4. The content of SCFA in the supernatant was analyzed. As shown in Table 7, the amount of propionic acid from the co-culture was proportional to the amount produced by lactic acid fermentation Clostridium measured in a single culture. However, the amount of butyrate produced in the co-culture was higher than that produced by any single strain, indicating the presence of an additive effect. For valeric acid production, valeric acid was not detected in any single strain cultured alone. On the other hand, the co-culture produced valeric acid, indicating the presence of a synergistic effect ( Figure 2 Valeric acid has been shown to reduce the incidence of necrotic enteritis (Poult Sci. 2018 Jul 1;97(7):2303-2311).

[0193] Table 7: Comparison of SCFA profiles by individual and mixed cultures.

[0194]

[0195] Example 3: Animal studies evaluating the prevention of necrotic enteritis by SCFA-producing bacteria

[0196] The challenge model for broiler chickens has been widely used (Front Microbiol. 2016, 7:1416; J Anim Sci Biotechnol. 2018, 9:25; Poult Sci. 2018, November 18). In this experiment, chickens were first challenged with a live 1x Eimeria vaccine ( Coccidiosis vaccine, Huvepharma, Inc., Lincoln, NE 68528, was used for challenge. There were seventeen (17) birds in each experimental and control groups. The vaccine was diluted with water, and each bird received 1 ml orally. On day 11, each bird received 1 ml of a pathogen mixture orally. The pathogen mixture consisted of five strains of Clostridium perfringens isolated from diseased tissue. Based on genomic analysis, all strains contained the netB and Tpel genes. These strains were grown individually overnight in cooked meat medium (Sigma), and fresh cultures were mixed in equal volumes in a glove box to make a mixture. The mixture was used on the same day to induce necrotic enteritis.

[0197] Using this disease model, the efficacy of DFM candidates against Clostridium perfringens infection was evaluated. For anaerobic bacteria, DFM candidates were grown in BHI medium under anaerobic conditions and fresh cultures were mixed in equal volumes in a glove box to make the specified consortium for animal testing. The mixed cell suspension of each consortium was aliquoted into serum bottles under anaerobic conditions in the glove box. The serum bottles were stored at 80°C and thawed before use. Starting from day 1, each chicken was fed the DFM consortium daily by gavage. On day 15, the chicken intestines were collected for histopathological analysis and mucosal samples were used for DNA isolation as described in Example 1.

[0198] The DFM consortia and their strain composition are listed in Table 8. For the first animal trial, consortia K and N consisted of anaerobic microorganisms that did not produce SCFAs. Only consortium M consisted of strains that could produce SCFAs. For the control group of chickens, no DFM candidates were used. For the second animal trial, all consortia consisted of microorganisms that could produce SCFAs.

[0199] Table 8: List of consortia and their strain composition used in animal testing

[0200]

[0201] As described in Example 1, the abundance of Clostridium perfringens based on 16S analysis using samples from day 15 is summarized in Table 9. Consortia K and N include different anaerobic bacteria (Table 8). These microorganisms do not produce SCFAs. Based on 16S analysis, chickens fed with these two consortia showed similar abundance of Clostridium perfringens as chickens in the disease model group. The results of qPCR analysis of the netB gene showed similar trends. This indicates that these two DFM consortia did not show efficacy against pathogen expansion in animal trials. Consistent with this observation, histopathological analysis showed the presence of necrotic enteritis in these samples. On the other hand, the abundance of Clostridium perfringens in consortium M was much lower. This consortium consists of four different anaerobic strains that produce SCFAs, as described in Example 2. Interestingly, as shown in Example 2, when these four strains were mixed as a co-culture, the SCFA profile was different compared to when these strains were cultured alone. Histopathology showed no signs of necrotic enteritis. This suggests that consortium M has efficacy in preventing C. perfringens infection.

[0202] To further investigate whether other SCFA-producing microorganisms isolated from chickens had a similar effect on reducing the incidence of necrotic enteritis, consortia 2A, Z and W were designed and used in another animal experiment (Table 8; Experiment 2). Consortia 2A and Z showed a high abundance of Clostridium perfringens in the small intestine based on 16S analysis and netB qPCR (Table 9). Histopathological analysis showed that necrotic enteritis was exactly similar to the disease model. This result suggests that the two SCFA-producing consortia had no effect. On the other hand, the new consortium W was found to be effective against pathogens. This consortium consists of isolates from anaerobic coryneform species of the human colon.

[0203] Table 9: Results of animal experiments

[0204]

[0205] 1- CP abundance = 16S CP sequence reads / total 16S sequence reads (Example 1)

[0206] 2- netB qPCR =qPCR netB copy number / qPCR total 16S

[0207] Example 4: Combination of SCFA-producing microorganisms with Lactobacillus species

[0208] To investigate the combination of SCFA-producing microorganisms with other potential DFM candidates that do not produce SCFAs, another animal study was conducted with consortium 2F (Table 10). Consortium 2F consisted of the SCFA producer Clostridium lactis M3 from consortium M (Table 6) and two different Lactobacillus isolates.

[0209] Table 10: Combined SCFA producers and Lactobacillus consortia and strain composition used in the trial

[0210]

[0211] As shown in Table 11, feeding the consortium to the animals greatly reduced CP counts based on both 16S analysis and netB PCR quantification compared to a model in which no DFM candidate was used. In addition, no necrotic enteritis was detected in the small intestine of chickens treated with the 2F consortium. The results suggest that the combination of SCFA producers and Lactobacillus species present in the 2F consortium has efficacy in preventing CP infection.

[0212] Table 11: Results of animal experiments

[0213]

[0214] sequence

[0215] Human colon anaerobic coccobacillus strain W1 16S rRNA

[0216]

[0217] Human colon anaerobic coccobacillus strain W2 16S rRNA

[0218]

[0219] Human colon anaerobic coccobacillus strain W3 16S rRNA

[0220]

[0221] Human colon anaerobic coccobacillus strain W4 16S rRNA

[0222]

[0223] Coprococcus species strain M1 16S rRNA

[0224]

[0225] Human colon anaerobic coryneformis strain M2 16S rRNA

[0226]

[0227] Lactobacillus lactis strain M3 16S rRNA

[0228]

[0229] Pseudotrichophyton strain M4 16S rRNA

[0230]

[0231] Lactobacillus lactis strain 2F1 16S rRNA

[0232]

[0233] Lactobacillus salivarius strain 2F2 16S rRNA

[0234]

[0235] Lactobacillus reuteri strain 2F3 16S rRNA

[0236]

Claims

1. A feed additive composition comprising a direct fed microbial (DFM), wherein the composition comprises: a) anaerobic coryneform bacteria strain W1 deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS146120; b) anaerobic coryneformis strain W2 deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS146122; c) anaerobic coryneformis strain W3 deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with accession number CBS146123; and d) the anaerobic coryneform bacteria strain W4 deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS146121, or a combination of these strains and a culture supernatant derived from each of these strains.

2. A feed additive composition comprising a direct fed microbial (DFM), wherein the composition comprises: a) Coprococcus sp. strain M1 deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with accession number CBS146125; b) anaerobic coryneformis strain M2 deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS146119; c) a strain of Clostridium lactis deposited at the Westerdiger Fungal Biodiversity Institute (WFDB) with accession number CBS146124; and d) strains of Pseudotrichophyton, or a combination of these strains and a culture supernatant derived from each of these strains.

3. A feed additive composition comprising a direct fed microbial (DFM), wherein the composition comprises: a) a lactic acid fermenting Clostridium strain deposited at the Westerdiger Fungal Biodiversity Institute (WFDB) with the accession number CBS146124; b) Lactobacillus salivarius strain 2F2 deposited at the Westerdiger Fungal Biodiversity Institute (WFDB) with accession number CBS146126; and c) Lactobacillus reuteri strain 2F3 deposited at the Westerdiger Fungal Biodiversity Institute (WFDB) with the accession number CBS145921, or a combination of these strains and a culture supernatant derived from each of these strains.

4. The feed additive composition as claimed in claim 1, wherein a) the 16S ribosomal RNA sequence of the human colon anaerobic coryneform bacteria strain W1 comprises the nucleotide sequence of SEQ ID NO: 1; b) the 16S ribosomal RNA sequence of the human colon anaerobic coryneform bacteria strain W2 comprises the nucleotide sequence of SEQ ID NO: 2; c) the 16S ribosomal RNA sequence of the human colon anaerobic coryneform bacteria strain W3 comprises the nucleotide sequence of SEQ ID NO: 3; and d) the 16S ribosomal RNA sequence of the human colon anaerobic coryneform bacteria strain W4 comprises the nucleotide sequence of SEQ ID NO:

4.

5. The feed additive composition of claim 2, wherein a) the 16S ribosomal RNA sequence of the Coprococcus sp. strain M1 comprises the nucleotide sequence of SEQ ID NO: 5; b) the 16S ribosomal RNA sequence of the human colon anaerobic coryneformis strain M2 comprises the nucleotide sequence of SEQ ID NO: 6; c) the 16S ribosomal RNA sequence of the lactic acid fermentation Clostridium strain comprises the nucleotide sequence of SEQ ID NO: 7; and d) the 16S ribosomal RNA sequence of the Pseudomonas aeruginosa strain comprises the nucleotide sequence of SEQ ID NO:

8.

6. The feed additive composition of claim 3, wherein a) the 16S ribosomal RNA sequence of the lactic acid fermentation Clostridium strain comprises the nucleotide sequence of SEQ ID NO: 9; b) the 16S ribosomal RNA sequence of the Lactobacillus salivarius strain 2F2 comprises the nucleotide sequence of SEQ ID NO: 10; and c) the 16S ribosomal RNA sequence of the Lactobacillus reuteri strain 2F3 comprises the nucleotide sequence of SEQ ID NO:

11.

7. The feed additive composition of any one of claims 1-6, wherein the composition produces one or more short chain fatty acids selected from the group consisting of butyric acid, isobutyric acid, propionic acid, acetic acid, isovaleric acid and valeric acid.

8. The feed additive composition according to any one of claims 1 to 6, further comprising one or more enzymes.

9. The feed additive composition of claim 8, wherein the one or more enzymes are selected from the group consisting of phytases, proteases, amylases, xylanases and beta-glucanases.

10. The feed additive composition according to any one of claims 1 to 6, wherein each strain is present at 1 x 10 3 CFU / g feed additive composition to 1x 10 9 The concentration is present in CFU / g feed additive composition.

11. The feed additive composition of any one of claims 1 to 6, wherein the composition inhibits at least one pathogen of the Enterobacteriaceae family in the gastrointestinal tract of birds that have ingested an effective amount of the direct-fed microbial composition.

12. The feed additive composition of any one of claims 1 to 6, wherein the composition inhibits at least one pathogen selected from the group consisting of avian pathogenic Salmonella sp., Escherichia coli, and Clostridium perfringens in the gastrointestinal tract of poultry that has ingested an effective amount of the direct-fed microbial composition.

13. A premix comprising the feed additive composition according to any one of claims 1 to 12 and at least one mineral and / or at least one vitamin.

14. A feed comprising the feed additive composition according to any one of claims 1 to 12 or the premix according to claim 13.

15. A kit comprising a) a feed additive composition according to any one of claims 1 to 12; and b) written instructions for administration to an animal.

16. Use of the feed additive composition of any one of claims 1 to 12, the premix of claim 13, or the feed of claim 14 in the preparation of a composition for improving one or more parameters of an animal, wherein the one or more parameters are selected from the group consisting of: increased weight gain, improved feed conversion ratio (FCR), improved digestive tract barrier integrity, reduced mortality, reduced pathogen infection and reduced pathogen shedding in feces.

17. Use of the feed additive composition according to any one of claims 1 to 12, the premix according to claim 13, or the feed according to claim 14 in the preparation of a composition for improving the intestinal health of an animal.

18. The use according to claim 16 or claim 17, wherein the feed additive composition increases the level of one or more of acetic acid, isobutyric acid, butyric acid, isovaleric acid and / or valeric acid in the gastrointestinal tract of the animal.

19. The use according to claim 18, wherein the feed additive composition increases the butyrate content of the gastrointestinal tract of the animal.

20. The use according to claim 16, wherein the pathogen is one or more pathogens in the Enterobacteriaceae family.

21. The use according to claim 16, wherein the pathogen is one or more of Clostridium perfringens, Campylobacter jejuni, Salmonella species and / or Escherichia coli.

22. The use according to claim 16, wherein the composition is used to further treat, prevent or reduce the incidence of necrotizing enterocolitis.

23. The use according to claim 16 or claim 17, wherein the animal is domestic poultry.

24. The use according to claim 23, wherein the domesticated poultry is selected from the group consisting of turkey, duck, goose, quail, emu, ostrich and pheasant.

25. The use according to claim 23, wherein the domesticated poultry is chicken.

26. The use according to claim 25, wherein the chicken is a broiler chicken or a laying hen.

27. A method for preparing a feed additive composition, the method comprising combining: a) anaerobic coryneform bacteria strain W1 deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS146120; b) anaerobic coryneformis strain W2 deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS146122; c) anaerobic coryneformis strain W3 deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with accession number CBS146123; and d) the anaerobic coryneform bacteria strain W4 deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with the accession number CBS146121, Or these strains were combined with the culture supernatant derived from each of these strains.

28. A method for preparing a feed additive composition, the method comprising combining the following bacterial strains: a) Coprococcus sp. strain M1 deposited at the Westerdijk Fungal Biodiversity Institute (WFDB) with accession number CBS 146125; b) the anaerobic coryneform bacteria strain M2 deposited at the Westerdiger Fungal Biodiversity Institute (WFDB) with the accession number CBS 146119; c) a strain of Clostridium lactic acid fermentans deposited at the Westerdiger Fungal Biodiversity Institute (WFDB) with the accession number CBS 146124; and d) strains of Pseudotrichophyton, Or these strains were combined with the culture supernatant derived from each of these strains.

29. A method for preparing a feed additive composition, the method comprising combining: a) a lactic acid fermenting Clostridium strain deposited at the Westerdiger Fungal Biodiversity Institute (WFDB) with the accession number CBS146124; b) Lactobacillus salivarius strain 2F2 deposited at the Westerdiger Fungal Biodiversity Institute (WFDB) with accession number CBS146126; and c) Lactobacillus reuteri strain 2F3 deposited at the Westerdiger Fungal Biodiversity Institute (WFDB) with the accession number CBS145921, Or these strains were combined with the culture supernatant derived from each of these strains.

30. The method of any one of claims 27-29, further comprising combining one or more enzymes with the feed additive composition.

31. The method of claim 30, wherein the one or more enzymes are selected from the group consisting of phytases, proteases, amylases, xylanases, and beta-glucanases.

32. The method of any one of claims 27 to 29, wherein 1 x 10 3 CFU / g feed additive composition to 1x10 9 CFU / g of feed additive composition for each strain was combined to form the feed additive composition.

33. The method of any one of claims 27-29, further comprising packaging the feed additive composition.

34. A method for preparing a premix, the method comprising combining a feed additive composition as claimed in any one of claims 1 to 12 with at least one mineral and / or at least one vitamin.

35. The method of claim 34, further comprising packaging the premix.

Images