Modification of gene expression in CART cells and their uses

Abstract

The present invention relates to changing gene expression in CAR T cells and its use. The present invention relates to using nucleic acids capable of downregulating endogenous gene expression, which are selected from TCR alpha chains, TCR beta chains, beta-2 microglobulins, HLA molecules, CTLA-4, PD1 and FAS, to generate compositions and methods of modified T cells, which further include nucleic acids encoding modified T cell receptors (TCRs) including affinity for surface antigens on target cells or nucleic acids encoding electroporation of chimeric antigen receptors (CARs). Also included are methods for adoptive therapy and treatment of conditions such as autoimmune diseases and pharmaceutical compositions comprising modified T cells.

Description

[0001] This application is a divisional application. The application date of the original application is October 15, 2015, the application number is 201580071634.9, and the name of the invention is “Altering gene expression in CAR T cells and its use”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority under 35 USC §119(e) to US Provisional Patent Application No. 62 / 073,651, filed on October 31, 2014, which is hereby incorporated by reference in its entirety.

[0004] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0005] This invention was made with government support under Grant CA120409 from the National Institutes of Health. The government has certain rights in this invention. Technical Field

[0006] The present application relates to altering gene expression in CAR T cells and uses thereof. Background Art

[0007] Adoptive cell transfer (ACT) using chimeric antigen receptor (CAR)-modified T cells has been shown to be a promising strategy for cancer treatment (Louis et al., 2011, Blood 118:6050-6056; Kochenderfer et al., 2010, Blood 116:3875-3886 and Porter et al., 2011, N Engl J Med 365:725-733).

[0008] The safety concerns associated with the integration of lentiviral or retroviral vectors are the main concerns for cell modification for ACT. Some progress has been made to avoid the harmful side effects of on-target or off-target, such as using T cell receptor (TCR) or CAR RNA electroporation to carry out RNA transfection of T cells (Zhao, 2006, Mol Ther 13: 151-159; Mitchell et al., Smits et al., 2004, Leukemia 18: 1898-1902). By minimizing the dose of both RNA and T cells, such methods efficiently allow a variety of genes to be introduced into cells. However, the main constraint for CAR transient expression is the sub-suitable effector activity and function of RNA-transfected T cells. Multiple T cell infusions and / or significant use of low-dose chemotherapy have been used to improve CAR function (Barrett et al., 2013, Hum Gene Ther 24 (8): 717-27).

[0009] Multiple attempts have been made to improve the effector activity and function of CAR, while in order to avoid the need for combined therapy and additional treatment. During the transfection process, RNA is increased to negatively affect T cell function, especially anti-tumor activity in vivo (Barrett et al., 2011, Hum Gene Ther 22: 1575-1586). Optional constructs (Bargou et al., 2008, Science 321: 974-977, Klinger et al., 2012, Blood 119: 6226-6233.) have also been tested in clinical trials for cancer treatment by fusion of anti-CD3 antigen antibody fragments with anti-tumor antigen antibody fragments. Unfortunately, these constructs are severely functionally limited due to short half-life, poor accessibility to target cell sites and lack of appropriate long-term signal transduction function.

[0010] Clinical TCR research has been hampered by low expression levels of transduced TCRs, as well as mispairing of α and β chains. Because four TCRs can potentially be expressed at the cell surface when T cells transcribe two different chains of TCRs (native α / β, exogenous α / β, and native / exogenous "mispaired" heterodimers), significant obstacles to using this approach are apparent. In studies conducted to date, preclinical studies have clearly demonstrated the potential for TCR mispairing to induce deleterious recognition of self-antigens.

[0011] Although early TCR and CAR T cell clinical data obtained in the treatment of cancer have shown promising results, the risk to patients is high, and some patients' T cells are not effective enough for effective treatment even after TCR or CAR redirection, which prompts the modification of allogeneic donor-derived T cells. However, the endogenous αβT cell receptors on the infused allogeneic T cells can recognize the major and minor histocompatibility antigens in the recipient, which leads to graft-versus-host disease (GVHD). As a result, most current clinical trials using autologous CAR T cell infusions rely on immune tolerance to prevent harmful recognition of normal tissues mediated by TCR after adoptive cell transfer. This method has achieved early clinical success, but is limited by the time and cost of manufacturing patient-specific T cell products. Therefore, there is a need for a safer method to modify T cells while avoiding the time and cost of manufacturing patient-specific T cell products. Summary of the invention

[0012] As described herein, the present invention relates to compositions and methods for generating modified T cells, which have nucleic acids capable of altering gene expression of endogenous genes selected from the group consisting of TCR alpha chain, TCR beta chain, beta-2 microglobulin, HLA molecules, CTLA-4, PD1 and FAS, and further comprise a nucleic acid encoding a chimeric antigen receptor (CAR).

[0013] One aspect of the present invention includes a modified T cell comprising a nucleic acid capable of downregulating gene expression of an endogenous gene selected from the group consisting of a TCR alpha chain, a TCR beta chain, a beta-2 microglobulin, an HLA molecule, CTLA-4, PD1, and FAS; and a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular domain of a co-stimulatory molecule.

[0014] In another aspect, the present invention includes a method for generating modified T cells, comprising introducing into T cells a nucleic acid capable of downregulating gene expression of an endogenous gene selected from the group consisting of TCR α chain, TCR β chain, β-2 microglobulin, HLA molecule, CTLA-4, PD1 and FAS; and introducing into T cells a nucleic acid encoding a chimeric antigen receptor (CAR), wherein the chimeric antigen receptor (CAR) comprises an antigen binding domain and a transmembrane domain.

[0015] In yet another aspect, the invention includes a method of treating a disease or disorder associated with enhanced immunity in a subject, comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition comprising the modified T cells described herein.

[0016] In yet another aspect, the invention includes a method of treating a disorder in a subject comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising the modified T cells described herein.

[0017] In another aspect, the invention includes a method for stimulating a T cell-mediated immune response to a target cell or tissue in a subject, comprising administering to the subject an effective amount of a pharmaceutical composition comprising the modified T cells described herein.

[0018] In yet another aspect, the invention includes a method for adoptive cell transfer therapy comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition comprising the modified T cells described herein to prevent or treat an immune response adverse to the subject.

[0019] In yet another aspect, the invention includes use of the modified T cells described herein in the manufacture of a medicament for treating an immune response in a subject in need thereof.

[0020] In another aspect, the invention includes a composition comprising a modified T cell generated according to the methods described herein.

[0021] In yet another aspect, the invention includes a pharmaceutical composition comprising a modified T cell generated according to the methods described herein.

[0022] In various embodiments of the above aspects or any other aspects of the invention described herein, the nucleic acid capable of downregulating gene expression is selected from antisense RNA, antigomer RNA, siRNA, shRNA, and CRISPR system, such as pAd5 / F35-CRISPR vector.

[0023] In one embodiment, the antigen binding domain of CAR includes an antibody selected from a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a single domain antibody, a single chain variable fragment, and an antigen binding fragment thereof. In another embodiment, the antigen binding domain of CAR specifically binds to an antigen on a target cell. In yet another embodiment, the intracellular domain of CAR includes a dual signaling domain.

[0024] In another embodiment, the modified T cells described herein further include exogenous nucleic acids encoding costimulatory molecules such as CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1 and PD1L. In one embodiment, the method for generating modified T cells described herein further includes electroporating RNA encoding costimulatory molecules into T cells. In some embodiments in which the costimulatory molecule is CD3, CD3 includes at least two different CD3 chains, such as CD3ζ and CD3ε chains.

[0025] In another embodiment, T cells are obtained from peripheral blood mononuclear cells, umbilical cord blood cells, purified T cell populations, and T cell lines.

[0026] In yet another embodiment, the method of generating modified T cells as described herein further comprises expanding the T cells. In one embodiment, expanding the T cells comprises culturing the T cells using a factor selected from flt3-L, IL-1, IL-3, and c-kit ligand.

[0027] In yet another embodiment, the method of generating modified T cells as described herein further comprises cryopreserving the T cells. In another embodiment, the method described herein further comprises thawing the cryopreserved T cells prior to introducing the nucleic acid into the T cells.

[0028] In one embodiment, the introducing nucleic acid is selected from the group consisting of transduction-expanded T cells, transfection-expanded T cells, and electroporation-expanded T cells.

[0029] In yet another embodiment, the methods described herein further comprise expressing Klf4, Oct3 / 4 and Sox2 in T cells to induce pluripotency of the T cells.

[0030] In various embodiments of the above aspects or any other aspects of the invention described herein, the invention comprises administering modified T cells to a subject. In one embodiment, the subject has a condition, such as an autoimmune disease. In some embodiments, the autoimmune disease is selected from acquired immunodeficiency syndrome (AIDS), alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune lymphoproliferative syndrome (ALPS), autoimmune thrombocytopenic purpura (ATP), Behcet's disease, cardiomyopathy, celiac disease (celiac sprue)-dermatitis herpetiformis, chronic fatigue immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy (CIPD), scarring pemphigoid, cold agglutinin disease, CREST syndrome, Crohn's disease, Degos' disease, dermatomyositis-juvenile, discoid lupus, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease, Guillain-Barre syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, insulin-dependent diabetes mellitus, chronic juvenile arthritis (Still's disease), juvenile rheumatoid arthritis, Meniere's disease, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, pernicious anemia (pernacious anemia), polyarthritis nodularis, polychondritis, polyglandular syndromes, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma (progressive systemic sclerosis (PSS), also known as systemic sclerosis (SS)), Sjogren's syndrome, rigid body syndrome, systemic lupus erythematosus, Takayasu's arteritis, temporal arteritis / giant cell arteritis, ulcerative colitis, uveitis, vitiligo, Wegener's granulomatosis, and any combination thereof.

[0031] In another embodiment, the disorder is cancer, such as a cancer selected from breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, and any combination thereof.

[0032] In another embodiment, the methods described herein further comprise inducing lysis of target cells or tissues, such as antibody-dependent cell-mediated cytotoxicity (ADCC). BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The following detailed description of the preferred embodiments of the present invention will be better understood when read in conjunction with the accompanying drawings. For the purpose of illustrating the present invention, there are shown in the accompanying drawings currently preferred embodiments. However, it should be understood that the present invention is not limited to the precise arrangements and means of the embodiments shown in the accompanying drawings.

[0034] Figure 1, including Figures 1A-1C , is a schematic representation of CRISPR design and targeting of the TCRαβ-CD3 complex in 293T cells. Figure 1A CRISPR gRNA targeting sites within the genomic loci of the TCR-α and β constant regions are shown. Each exon is shown by a block. Black blocks represent coding regions. Gray columns represent noncoding regions. Thirteen gRNAs were designed to target exon 1 of the TCRα constant region (TRAC), 10 gRNAs targeted conserved sequences on exon 1 of TCRβ constant regions 1 (TRBC1) and 2 (TRBC2), and 10 gRNAs targeted exon 1 of the β-2 microglobin gene. Figure 1B A typical gRNA scaffold sequence is shown. The gRNA PCR product was generated by overlapping PCR and cloned into the MSGV vector with a T7 promoter. Figure 1C Sanger sequencing results are shown, which show the presence of multiple peaks in 293TTCR TRAC and TRBC genomic PCR products after transfection of CAS9 mRNA and gRNA into cells.

[0035] Figure 2, including Figure 2A-2E , showing disruption of the TCRαβ-CD3 complex in primary T cells. Figure 2A TABLE 1 is a table showing the parameters used to electroporate CAS9 mRNA and gRNA into primary T cells using the BTX830. 360V 1ms and 2mm cuvette produced the best mean fluorescence intensity (MFI) and efficiency for electroporation of day 3 bead-stimulated primary T cells. Figure 2B The figure shows that the normal 37℃ 5% CO 2 Compared to conditions at 32°C with 5% CO 2 T cells cultured under RT had a much higher MFI. Figure 2C Schematic diagram of CRISPR system transfer into primary T cells. Three days after bead stimulation of primary T cells, CAS9 mRNA and gRNA were electroporated into T cells. T cells were then cultured with 100 IU / mL of IL-2, and some cells were incubated at 32°C with 5% CO. 2 Incubate at 4 °C for 1 day and then for another 7 to 9 days. CD3 expression was analyzed by flow cytometry on days 7-9 after electroporation. Figure 2Dis a panel of graphs showing that the targeting efficiency at 37°C is approximately 2.5 times higher than that at 32°C. Figure 2E is a graph group, which shows the downregulation of CD3 on day 6 after electrotransfer of different amounts and ratios of CAS9 and gRNA targeting TCRβ. CD3 expression was analyzed by staining CD3. Representative flow cytometry data at day 6 after electroporation are shown. The quadrants represent the percentage of CD3 negative cells in the T cell population.

[0036] Figure 3, including Figures 3A-3D , showing TCR in T cells neg α or β knockout can be achieved by depleting TCR pos T cells are enriched. Figure 3A is a group of figures showing TCR in T cells neg CD3 expression before and after bead depletion of α or β knockout. Flow cytometry illustrates CD3 expression. Numbers in the lower right quadrant represent the percentage of CD3 negative cells in the T cell population. Figure 3B is a sequencing panel showing that CD3 neg Multiple peaks were observed in the PCR products of the enriched T cell genome. Figure 3C is a panel of graphs showing the analysis of CD4 and CD8 T cell repertoires after CD3 microbead enrichment in single α chain, β chain, and αβ double knockout T cells modified using CRISPR. The data show that the ratio of CD8 T cell populations is enriched by CRISPR modification, suggesting that CD8 T cells may be more susceptible to modification than CD4 T cells. Figure 3D Shown are the sequencing results of deletions and insertions introduced into the TCR α and β loci after CRISPR modification.

[0037] Figure 4, including Figures 4A-4C , showing that multiple electrotransfer of gRNAs greatly improved the targeting efficiency of the CRISPR system in primary T cells. Figure 4A is a group of graphs showing that multiple electroporation of gRNA greatly improves targeting efficiency. Electroporation of T cells up to three times within 24 hours gave the highest targeting efficiency, almost 80%. In initial experiments, only 15% TCR targeting efficiency was achieved in T cells. Sustained expression of CAS9 was observed after electrotransfer of CAS9 mRNA into T cells. A possible reason for the low cutting efficiency may be due to rapid degradation of gRNA. A higher CD3 negative population was obtained. Figure 4B is a set of graphs showing that capping impairs gRNA function, while early introduction of gRNA in the second round results in higher efficiency. Figure 4C is a set of graphs showing that multiple electrotransfers of gRNAs targeting TRAC and TRBC in ND221 gave approximately 64.5% and 57.5% cleavage rates, respectively.

[0038] Figure 5, including Figure 5A and 5B , showing TCR neg T cells can be expanded under different stimulation conditions. Figure 5A is a set of figures showing reintroduction of TCR α and β chains into TCR neg After T cells, TCR neg T cells restore CD3 expression. neg CD3 and Vb13.1 were detected after T cells. CD3 expression levels were comparable to TCR pos T cells. Figure 5B is a set of graphs showing different conditions for stimulating TCR neg Expansion fold after T cell. PBMC REP yielded approximately 500-fold expansion, whereas CD3 / CD28 beads, or K562 aAPC restimulation yielded approximately 25-58-fold expansion.

[0039] Figure 6, including Fig. 6A and 6B , showing the TCR after expansion under different conditions neg T cell characteristics. Fig. 6A is a set of graphs showing TCR after expansion under different conditions neg T cell phenotypic characteristics. Figure 6B is a set of graphs showing TCR after expansion under different conditions neg T cell phenotypic characteristics.

[0040] Figure 7, including Figures 7A-7C , showing an expanded TCR with potent anti-tumor activity after in vitro redirection neg T cells. Fig. 7A is a graph group that shows TCR neg T cells can be redirected by introducing anti-NY-ESO 1G4 TCR into cells. Compared with the CAS9 blank control group (MOCK group), when redirected by 1G4 TCR, TCR neg T cells showed higher levels of Vb13.1 expression due to fewer mispairings of exogenous and endogenous TCR α and β chains. Figure 7B is a panel of graphs showing TCR redirected using 1G4 TCR when co-cultured with a tumor (Nalm6-ESO) cell line neg T cells have high degranulation activity. Figure 7C It is the TCR that is redirected using 1G4 TCR. neg T cells have a high cytotoxic profile against tumor cell lines.

[0041] Figure 8 is a set of diagrams showing the directional TCR neg T cells controlled tumor growth in NSG mice after redirection.

[0042] Figure 9, including Figures 9A-9D , showing that HLA-CLASS I elimination is achieved through disruption of β-2 microglobin. Fig.9A Sequencing data showing CRISPR capable of disrupting the β-2 microglobin locus in HEK293 cells. Fig. 9B is a panel of graphs showing generation of a bHLA-I class negative T cell population by disruption of beta-2 microglobin. Fig. 9C is a panel of graphs showing that cIFNg enhances the targeting efficiency of beta-2 microglobin in primary T cells. Fig.9D is a graph group that shows HLA-I classes neg T cells were enriched by bead depletion.

[0043] Fig.10 It is a group of figures, which shows the simultaneous knockout of HLA-I class and TCR in primary T cells.CD4 and CD8 T cells are stimulated using CD3 / CD28 immunomagnetic beads (dynabead).Three days after stimulation, the expanded T cells are electroporated with CAS9mRNA together with TCRβ constant region (TRBC) and the gRNA targeting β-2 microglobin.Six days after electroporation, anti-CD3 monoclonal antibody (mAb) and anti-β-2 microglobin mAb are used to assess TCR expression and β-2 microglobin expression.Numbers represent the percentage of groups in each quadrant.

[0044] Figure 11, including Figures 11A-11D , showing triple knockout of HLA-I class and TCR α and β chains in primary T cells. Fig.11A It is a group of figures, which shows CD4 and CD8 T cells stimulated using CD3 / CD28 immunomagnetic beads. Three days after stimulation, the expanded T cells were electroporated with CAS9 mRNA, together with TCRα, β constant region (TRAC, TRBC) and the gRNA targeting β-2 microglobin. Six days after electroporation, anti-CD3 monoclonal antibody (mAb) and anti-β-2 microglobin mAb were used to assess TCR expression and HLA-I class expression. Numbers represent the percentage of groups in each quadrant. Fig. 11B is a schematic diagram illustrating the separation of HLA-I class and TCR α and β chain triple knockout T cells. Fig. 11C is a panel of graphs showing electroporation efficiency tested by GFP expression. Fig.11D is a panel of graphs showing reintroduction of TCR α and β chains into the TCR as measured by flow cytometry neg T cells. In total TCR negApproximately 64% alpha negative and approximately 14% beta negative populations were observed in T cells.

[0045] Figure 12, including Figures 12A-12D , showing the knockdown of FAS in 293T cells. Fig. 12A are images showing Sanger sequencing results of multiple peaks when FAS was knocked down in 293T cells. Fig. 12B is a panel of figures showing FACS data revealing that surface expression of FAS protein was disrupted by CRISPR. Fig. 12C is a panel of images showing that the FAS protein was replaced with GFP after homologous recombination with CRISPR. Fig.12D is a panel of graphs of FACS data showing the percentage of homologous recombination with CRISPR.

[0046] Fig.13 Knockout of FAS in primary T cells is shown. FACS data illustrates that surface FAS protein expression was abolished by CRISPR.

[0047] Figure 14, including Fig.14A and 14B , showing knockout of PD1 in 293T and primary T cells. Fig.14A are images showing Sanger sequencing results of multiple peaks when PD1 is targeted in 293T cells. Fig. 14B is a panel of figures showing FACS data of surface expression of PD1 protein disrupted by CRISPR.

[0048] Figure 15, including Fig.15A and 15B , showing knockout of CTLA4 in 293T and primary cells such as CCD1079-SK. Fig.15A are images showing Sanger sequencing results of multiple peaks when CTLA4 is targeted in 293T cells. Fig. 15B is an image showing sequence data after limiting dilution and single cell expansion. Sanger sequencing results confirmed deletions and insertions at the CTLA4 genomic locus.

[0049] Fig.16 Knockout of PPP2r2d in 293T is shown. Sanger sequencing data indicated that PPP2r2d was targeted by CRISPR in 293T cells.

[0050] Figure 17, including Fig.17A and 17B , showing the generation of iPSCs from FAS knockout T cells. Fig.17A is a set of images showing the negMorphological changes during the process of T cell reprogramming to iPSC. Typical embryonic stem cell morphogenesis indicates FAS neg T cells can be induced to a pluripotent state. Fig. 17B Is to display FAS neg Figure 3. T cells are reprogrammed to iPSCs at approximately 5-fold higher efficiency than their wild-type counterparts. p53-deficient cell lines have been reported to be susceptible to reprogramming due to blockage of apoptotic pathways. FAS knockout may promote the reprogramming process through a similar mechanism.

[0051] Figure 18, including Fig.18A and 18B , showing from CD3 neg T cell generation of iPSCs. Fig.18A is a panel of images showing the expression of CD3 neg ES-like morphology formed by TCRα or β chain knockout T cells. The morphology remained constant after several passages. Fig.18B is a series of graphs showing that reprogrammed CD3 neg T cells were approximately 5-fold more efficient, suggesting that TCR knockout could play a role in T cell reprogramming or affect cell viability after Sendai virus infection.

[0052] Fig.19 is a diagram showing knockdown of endogenous T cell receptor (TCR) using siRNA and addition of a second disulfide bond and de-N-glycosylation to the β chain.

[0053] Figure 20, including Fig. 20A and 20B , shows TCR knockout by Cas9 RNA and gRNA. Six days after electroporation, cells were analyzed for TCR expression by evaluating CD3.

[0054] Fig.21 is a graphic representation showing the results of PCR sequencing after CD3 microbead depletion.

[0055] Fig. 22 is a panel of graphs showing re-expression of CD3 four hours after NY-ESO-1 TCR RNA electroporation.

[0056] Figure 23, including Figures 23A-23D , is a set of graphs showing that knocking down endogenous TCR enhances both transgene expression and function of T cells electroporated with TCR RNA. Fig.23A Shown are TCR expression of T cells electroporated with TCR siRNA (solid open bars), control siRNA (dashed open bars), and T cells without any siRNA (solid bars). Fig. 23BTransgene (TCR vb13.1) expression of T cells electroporated with wild-type NY-ESO-1 TCR (wt) or modified TCR (SD) RNA with TCR siRNA, control siRNA, or without siRNA is shown. Fig.23C Shown are NY-ESO-1 tetramer staining of T cells electroporated with wild-type NY-ESO-1 TCR (wt) or modified TCR (SD) RNA with TCR siRNA, control siRNA, or without siRNA. Fig.23D Specific lysis of HLA-A2 / NY-ESO-1 positive tumor lines knocked down by TCR siRNA and electroporated with wild-type NY-ESO-1 TCR RNA is shown.

[0057] Fig.24 is a graph showing the fluorescence of tumor cells after T cells were injected into a mouse model. Ten million Nalm6-CBG-ESO-GFP (click beetle green) tumor cells expressing both NY-ESO-1 and GFP were injected intravenously into NOD / SCID mice. Five days after tumor inoculation, T cells transduced with CBR and electroporated with RNA were injected as indicated in the different groups, and tumor cells were detected by fluorescence.

[0058] Fig.25 is a panel of images showing the fluorescence of injected tumors and hybrid TCR T cells over time in a mouse model.

[0059] Fig.26 is a group of images showing the generation of universal CAR19 T cells. The top of the figure is a diagram of the scheme for generating universal CAR19 T cells. The figure on the left shows the percentage of CAR19 positive T cells after lentiviral-CAR19 gene transduction. The right group of figures shows the percentage of TCR single negative and TCR / HLA-A double negative T cells before and after sorting.

[0060] Fig. 27 is a set of graphs and a table showing the fold expansion of CD19 positive cells after stimulation with irradiated CD19 presenting K562 cells.

[0061] Fig.28A is a panel of graphs showing endogenous gene expression and transgene expression of K562-CD19 expanded cells.

[0062] Fig.28B is a panel of graphs showing that after expansion of K562-CD19 stimulation, endogenous TCR expression remains negative in TCR single negative cells, while TCR and HLA-A expression remain negative in TCR / HLA-A double negative T cells.

[0063] Fig.29A is a panel of graphs showing that the majority of expanded universal CAR19 T cells were CD45RO positive and expressed moderate levels of CD28 expression.

[0064] Fig.29B is a panel of graphs showing that most of the expanded universal CAR19 T cells retain high levels of CD62L expression and low levels of CCR7 expression.

[0065] Fig. 30A is a graph showing that CRISPR gene editing does not affect the in vitro anti-tumor activity of universal CAR19 T cells.

[0066] Fig. 30B is a panel of figures showing that TCR single negative and TCR / HLA-A double negative CAR19 T cells exhibited robust lytic capacity when challenged with Nalm6 tumor cells.

[0067] Fig. 30C is a panel of graphs showing cytokine secretion as part of the potent anti-tumor activity of these cells.

[0068] Fig.30D is a panel of graphs showing TCR single ablation or TCR and HLA-A double ablation in CAR19 T cells exhibiting similar proliferation kinetics after challenge with Nalm6 tumor cells.

[0069] Fig.31 This is a panel of images showing that CRISPR gene editing does not affect the anti-tumor activity of universal CAR19 T cells in vivo. All mice receiving unmanipulated T cells and mice infused with wild-type T cells transduced with lentiviral GFP died within 3 weeks of tumor cell infusion. Target tumor regression was observed in mice receiving CAR19 T cells. CRISPR-edited TCR single-negative or TCR / HLA-A double-negative universal CAR19 T cells showed the same anti-tumor activity.

[0070] Fig.32A is a panel of graphs showing that TCR single ablation or TCR and HLA-A double ablation in T cells drastically reduces alloreactivity.

[0071] Fig.32B is a panel of graphs showing the elimination of HLA-A molecule-activated NK cells using long-term co-culture (5 days).

[0072] Fig.32C is a graph showing that no off-target activity was observed when cells were challenged with allogeneic whole blood PBMCs for 24 hours in the IFNr Eispot assay.

[0073] Fig.33 : is a panel of figures showing that FAS ablation enhances the anti-tumor activity of CAR19 T cells. FAS-negative CAR19 T cells were generated. FAS ablation was confirmed by flow cytometry analysis. CAR19 gene expression of FASneg T cells is comparable to wild type. Even after a short period of 4 hours of incubation with Nalm6 tumor cells, CD107a expression was greatly enhanced in FASneg CAR19 T cells compared to their wild type counterparts.

[0074] Fig.34A is a graph showing that FAS ablation in CAR19 T cells enhances CAR T cell survival and proliferation under in vitro antigen conditions. When cells were stimulated with high levels of CD19+K562 cells, FASneg CAR19 T cells expanded faster than wild-type CAR19 T cells.

[0075] Fig.34B is a panel of graphs showing that FASneg CAR19 T cells have reduced levels of apoptosis as measured by Annexin V staining.

[0076] Fig.35A is a graph showing that FAS ablation in CAR19 T cells enhances CAR T cell function in animal models. As has been observed in vitro, FASneg T cells showed enhanced proliferation compared to wild-type T cells.

[0077] Fig.35B is an image panel showing that the FASneg CAR19 group exhibited superior anti-tumor activity when compared with the wild-type group.

[0078] Fig.35C is a graph showing significant differences in bioluminescence data between the FASneg CAR19 group and the wild-type group.

[0079] Fig.36 is a panel of graphs showing the generation of PD1 negative PSCA-CAR T cells. PD1 ablation was confirmed by flow cytometry analysis. PD1 negative cells were enriched by bead depletion. Wild-type or PD1 negative PSCA-CAR T cells were expanded by stimulation with irradiated PSCA antigen presenting PC3 tumor cells. PSCA-CAR positive cells were enriched after expansion.

[0080] Fig.37 is a panel of figures showing that PD1 ablation and CD137 expression in PSCA-CAR T cells enhances CAR T cell activation under antigen conditions in vitro.

[0081] Fig.38Ais a panel of images showing PD1 ablation in the PC3-PSCA-PDL1 NSG model in vivo. PSCA-CAR T cells exhibited enhanced anti-tumor activity of CAR T cells in vivo compared to the wild-type group.

[0082] Fig.38B is a graph showing the difference in tumor burden between PD1 negative and wild type groups.

[0083] Fig.39 It is a group of histological images, which shows that T cells do not cause graft-versus-host disease (GVHD) when TCR or TCR / HLA-I are ablated. Mice treated with double knockout or triple knockout CAR T cells do not develop any signs of GVHD. In contrast, 3 of the 4 mice from the wild-type CD19 CAR T group developed GVHD by day 65, which was confirmed by histological examination of different organs.

[0084] Fig.40A is a graph showing the survival percentage of animals injected with T cells - TCR or TCR / HLA-I ablated. Mice were sublethally irradiated and injected. Four of the five mice that received wild-type T cells died of GVHD during the 60-day study period. The PBS-treated groups, TCR single-ablated and TCR / HLA-I double-ablated T cell-treated groups did not show any signs of GVHD.

[0085] Fig.40B is a panel of graphs showing body weight of mice receiving wild-type T cells, PBS-treated, TCR single-ablated, or TCR / HLA-I double-ablated T cells.

[0086] Fig.41A is a panel of images showing the improved anti-tumor activity of universal CAR T cells after blocking the PD1 and Fas pathways using CRISPR / Cas9. When injected into mice carrying Nalm6-PDL1, superior anti-tumor activity was detected in PD1 knockout universal CD19-CAR T cells.

[0087] Fig.41B is a graph showing quantitative bioluminescence data of mice receiving different CRISPR / Cas9-edited T cells.

[0088] Fig.42 is a diagram showing a one-shot system for generating universal CAR T cells. Since gRNA is prone to degradation, a simplified one-shot method was developed to constitutively express gRNA together with CAR in a single lentiviral vector.

[0089] Fig.43is a panel of graphs showing efficient gene ablation using a one-step system. Different amounts of CD3 ablation were observed after electrotransfer of Cas9 mRNA.

[0090] Fig.44A is a panel of images showing morphological changes during the process of reprogramming iPSCs from Fas knockout T cells. Typical embryonic stem cell morphogenesis indicates that FASneg T cells can be induced to a pluripotent state.

[0091] Fig.44B is a graph showing that FASneg T cells are reprogrammed to iPSCs at approximately 5 times the efficiency of their wild-type counterparts. p53-deficient cell lines have been reported to be susceptible to reprogramming due to blockage of the apoptotic pathway. FAS knockout may promote the reprogramming process using a similar mechanism.

[0092] Fig.45A is a panel of images showing the ES-like morphology of iPSCs derived from CD3neg TCR α or β chain knockout T cells under defined reprogramming conditions. The morphology remained constant after several passages.

[0093] Fig.45B is a graph showing that reprogramming of CD3neg T cells is approximately 5-fold less efficient than that of wild-type counterparts, suggesting that TCR knockout may play a role in the process of T cell reprogramming or affect cell viability after Sendai virus infection.

[0094] Fig.45C is a panel of images showing phosphatase staining of CD3neg iPSC cells.

[0095] Fig.46 is a panel of graphs showing the induction of endogenous pluripotent stem cell genes in different T-iPSC cell lines.

[0096] Fig.47A are panels of images showing immunostaining for Tra-1-60 and SSEA4 expression.

[0097] Fig.47B are images showing confirmation of Fas knockout in T-iPSCs by Sanger sequencing.

[0098] Fig.48A is a panel of graphs showing gene ablation in naive T cells using different versions of Cas9. CD3 was knocked out using dCas9 and FokI-Cas9.

[0099] Fig.48B is a panel of figures showing that gene ablation by dCas9 and FokI-Cas9 requires two gRNAs.

[0100] Fig.48CAn image showing rare off-target events in T cells genetically modified using CRISPR / cas9.

[0101] Fig.49 is a panel of images showing the strategy for introducing CRISPR / Cas9 into T cells. A schematic diagram of gRNA driven by the T7 promoter is shown on the left. A schematic diagram of the generation of gene-edited antigen-specific T cells using the CRISPR system is shown on the right. Three days after CD3 / CD28 bead stimulation, T cells were electroporated with Cas9 mRNA and gRNA targeting a specific gene, and then cultured at 32°C for 24 hours in the presence of IL2, followed by return to normal 37°C culture conditions. Specific gene-disrupted T cells were sorted on day 8 and redirected using CAR or TCR by lentiviral transduction or mRNA electroporation gene transfer.

[0102] Fig.50A is a panel of graphs showing efficient CRISPR / Cas9-mediated TCR disruption in T cells. CD3 expression of CRISPR / Cas9-edited T cells cultured at 37°C or 32°C is shown.

[0103] Fig.50B is a panel of graphs showing CD3 expression in cultured CRISPR / Cas9-edited T cells following sequential CRISPR RNA electroporation.

[0104] Fig.51A is a panel of graphs showing efficient CRISPR gene disruption in T cells. CD3 expression of CRISPR-transferred T cells using different Cas9:gRNA ratios (upper and middle panels) and amounts of total CRISPR RNA (lower panel) is shown.

[0105] Fig.51B is a table showing targeting efficiency calculated by both flow cytometry and clonal sequencing.

[0106] Fig.52 is an image showing the amount of TCR-targeted gene disruption measured by mismatch-selective T7 surveyor nuclease assay on DNA amplified from cells. The calculated amount of targeted gene disruption in TRAC and TRBC is shown at the bottom. Arrows indicate expected bands.

[0107] Fig.53A Figure 2 is an image of indels (in gene disruption) observed by clonal sequence analysis of PCR amplicons following CRISPR-mediated recombination of the TCR α and β loci.

[0108] Fig.53BIs an image of a diagram of the human loci of TCR α and β CRISPR gRNA targeting sites within the genomic loci encoding the TCR α and β constant regions. Each exon is shown by a block. Arrows: sense strand gRNA targeting sites; blue arrows: antisense strand gRNA targeting sites. Multiple peaks in the Sanger sequencing results show CRISPR-mediated NHEJ events at the TRAC and TRBC genomic loci.

[0109] Fig.54 is a panel of graphs showing purified TCR neg CD3 expression in cells.

[0110] Fig.55 is a panel of graphs showing redirection of TCR / CD3 via electrotransfer of 1G4 TCR (α and β) or CAR19 mRNA neg cell.

[0111] Fig.56 Figure 2 shows TCR / CD3 after 10 days using different stimulation conditions. neg Diagram of cell expansion.

[0112] Fig.57 is a panel of figures showing that CRISPR / Cas9 editing does not impair the anti-tumor efficacy of primary T cells. neg Phenotypes of cells after four different expansion techniques.

[0113] Fig.58 is a panel of graphs showing the electroporation of CD19-CAR RNA into Cas9 blank control and TCR / CD3 neg Relative CD19-CAR expression after 48h.

[0114] Fig.59A is a panel of graphs showing the CD19-CAR redirected Cas9 blank control and TCR / CD3 neg No significant functional differences were observed between the cells, as confirmed by CD107 release assay after incubation with Nalm6 target cells. Representative data from 3 independent experiments are shown. Error bars (Bar), standard error.

[0115] Fig.59B It is shown that the Cas9 blank control and TCR / CD3 in CD19-CAR redirection neg Figure 1. No significant functional differences were observed between cells, as confirmed by cytotoxicity assays following incubation with Nalm6 target cells. Representative data from 3 independent experiments are shown. Error bars, SE = standard error.

[0116] Fig.59C is a panel of graphs showing the CD19-CAR redirected Cas9 blank control and TCR / CD3 neg No significant functional differences were observed between the cells, as confirmed by IL2 and IFNγ secretion after incubation with Nalm6 target cells. Representative data from 3 independent experiments are shown. Error bars, SE = standard error.

[0117] Fig.59D The injection has 1×10 6 Figure 2. Image set of NOD / scid / γc(- / -) mice (n=12) with Nalm6 tumor cells (iv). The mice were randomly divided into three groups. After electroporation, Cas9 blank control and TCR / CD3 expressing CD19-CAR were injected intravenously every 4 days. neg T cells (10×10 6 ), for a total of three injections (arrows). Mice treated with T cells not electroporated with RNA served as controls. Images were obtained from surviving animals as indicated. Imaging began 1 day before starting T cell treatment. Error bars, SE = standard error, EP = electroporation; E:T = effector: tumor ratio; arrows, time points of T cell infusion; ns, not significant. ****P < 0.0001, ns by two-way ANOVA with Bonferroni post hoc test.

[0118] Fig.59E is a graph showing the radiance of fluorescent cells.

[0119] Fig.60 is a panel of graphs showing double and triple gene ablation by CRISPR / Cas9 to generate universal effector cells. HLA-I disruption was performed using gRNA targeting B2M.

[0120] Fig.61 is a flow chart of a protocol for generating universal effector cells as described herein.

[0121] Fig.62 Is a panel of graphs showing that TCR ablation abolished nonspecific killing activity. 624mel-CBG and PC3-CBG tumor cell lines were cultured with T cells—with or without PHA pretreatment—at an effector: target ratio of 20:1 for 24 hours, and cytotoxicity was calculated based on luciferase assay. Data are mean ± SD; n = 3.

[0122] Fig.63Is a panel of graphs showing IFNγ Elispot assays to measure alloreactivity of TCR and TCR / HLA disruption by challenging genetically ablated T cells with irradiated allogeneic PBMCs (left panel) or co-culturing allogeneic PBMCs with irradiated genetically ablated T cells. Specific points are shown on the y-axis as points generated in the presence of stimulator minus points generated by effector alone. **P<0.01 by Mann-Whitney test.

[0123] Fig.64 is a panel of graphs showing that disruption of endogenous TCR by CRISPR / Cas9 improves TCR-redirected T cell function. T cells transfected with Cas9 mRNA alone (Cas9 blank control) or CD3 neg Vb13.1 and CD3 expression was shown in T cells with disruption of endogenous TCR α alone (αKO), β alone (βKO), and both α and β (α+βKO).

[0124] Fig.65A is a panel of graphs showing CD107a upregulation of TCR α or β single knockout or α+β double knockout T cells electroporated with TCR (1G4) α / β RNA stimulated with HLA-A2 / NY-ESO-1-positive cell line (Nalm6-ESO) or control cell line Nalm6.

[0125] Fig.65B is a graph showing the lytic capacity of TCRα or β single knockout or α+β double knockout T cells electroporated with TCRα+β RNA (1G4 TCR), as shown in a luciferase-based CTL assay against Nalm6-ESO.

[0126] Fig.66 is a panel of graphs showing the effect of electroporation of two different NY-ESO-1 TCR RNAs (1G4 TCR, 10 μg or 8F TCR, 10 μg) on ​​TCRα+β dual-disrupted T cells (TCR neg Vβ and CD3 expression in T cells).

[0127] Fig.67A is a panel of graphs showing the expression of TCR double knockout CD8 TCR (1G4 TCR or 8F TCR) RNA electroporated with HLA-A2 / NY-ESO-1-positive cell lines Nalm6-ESO, 624-mel or U266.+ CD107a was upregulated in T cells. Nalm6 was used as a negative control.

[0128] Fig.67B is a panel of graphs showing cytokine production (IL-2 and TNF-α) by TCR double knockout T cells electroporated with NY-ESO-1 TCR (1G4 TCR or 8F TCR) RNA after stimulation with HLA-A2 / NY-ESO-1-positive cell lines Nalm6-ESO or U266; 888mel melanoma cells were used as negative controls. *P<0.05, **P<0.01 ****P<0.0001, by two-way ANOVA with Bonferroni post hoc test.

[0129] Fig.68 is a panel of images showing the generation of universal CAR T cells using a combination of lentiviral gene transfer and CRISPR / Cas9 electroporation. A flow chart for the generation of universal CD19-CAR T cells is shown. T cells were transduced with lentiviral CD19-CAR on day 1 after stimulation, and Cas9 mRNA and gRNA targeting TCRα and TCRβ chains and B2M were electroporated in T cells 2 days later. The TCR and HLA-I double negative cell population was enriched before restimulation for expansion.

[0130] Fig.69 is a panel of graphs showing CD19-CAR expression in gene-modified lentivirus-CD19-CAR T cells expanded by CD3 / CD28 bead stimulation after 1G4 TCR electroporation.

[0131] Fig.70 is a panel of graphs showing the phenotype of CD19-CAR T cells.

[0132] Fig.71 is a graph showing CD107a release in TCR-negative and TCR / HLA-I double negative CD19-CAR T cells. Representative data from 3 independent experiments are shown. Error bars, SE = standard error.

[0133] Fig.72 is a panel of graphs showing cytokine secretion by TCR-negative and TCR / HLA-I double negative CD19-CAR T cells. Representative data from 3 independent experiments are shown. Error bars, SE = standard error.

[0134] Fig.73 is a graph showing the tumor lysis capacity of TCR-negative and TCR / HLA-I double negative CD19-CAR T cells. Representative data from 3 independent experiments are shown. Error bars, SE = standard error.

[0135] Fig.74 is a panel of graphs showing CFSE-labeled CD19-CAR and non-transduced T cells cultured with K562 and target K562-CD19 tumor cells at a ratio of 1:10 for 72 hours.

[0136] Fig.75A is a graph showing BLI from mice treated with a single injection on day 7 using a lentiviral vector expressing CD19-CAR and GFP. ns, no difference by two-way ANOVA with Bonferroni post hoc test. 1×10 6 Nalm6 cells were used to establish tumors in NSG mice (n=4 / group). Starting on day 7, T cells (1×10 7 T cells expressing LV GFP protein were injected as a control.

[0137] Fig.75B Is to show acceptance of LV-GFP, LV-CD19-CAR, LV-CD19-CAR-TCR / CD3 neg and LV-CD19-CAR-TCR / HLA-I neg Figure 3 Overall survival of mice expressing WT T cells. ns, no difference by log-rank Mantel-Cox test.

[0138] Fig.76 is an image panel showing that gene-modified CAR T cells retain antitumor efficacy and do not induce GVHD. 1 × 10 6 Nalm6 cells were used to establish tumors in NSG mice (n=4 / group). Starting on day 7, T cells expressing LV-CD19-CAR (2×10 7 =(100,000). T cells expressing LV GFP protein were injected as a control. Imaging began 1 day before T cell treatment. Organs from randomly selected mice from different treatment groups were collected on day 65 and used for CD3 immunohistochemical staining. Fig.77 Schematic diagram of a series of vectors showing the design of pAd5F35-CRISPR targeting PD1, Fas and TCRα chain.

[0139] Fig.78 is a diagram showing the design of penton-modified pAd5F35-CRISPR with anti-CD3 ScFv, and schematic delivery of pAd5F35-CRISPR for knock-in / knock-out of chimeric antigen receptors into T cells in vitro and in vivo.

[0140] Fig.79A is a diagram showing Sanger sequencing of PCR products flanking the PD1-gRNA targeting site. Adenovirus-pAd5F35-CRISPR-PD1 virus was transduced into MD231 cells. After 3 days, genomic DNA was extracted and PCR was performed.

[0141] Fig.79B The sequence of the targeting event in MDA231 cells after adenovirus-CRISPR manipulation is shown. The PD1 PCR product was cloned into a TOPO vector and sequenced.

[0142] Fig.80 is a graph showing that reduction in gRNA usage increases T cell expansion fold and only slightly decreases knockout efficiency.

[0143] Fig.81 It is a chart showing the parameters for optimizing electroporation conditions to obtain high CD3 / B2M knockout efficiency and improved T cell expansion multiples. Compared with the standard electroporation (EP) conditions in 2mm cuvettes (EP#10-13) or 4mm cuvettes. High CD3 / B2M knockout efficiency was observed, with improved T cell expansion multiples (EP#1 and 5).

[0144] Fig.82 is a graph showing optimization of EP conditions to achieve maximum expansion fold and allowable knockout efficiency.

[0145] Fig.83 is a graph showing additional optimization of EP conditions to achieve maximum expansion fold and allowable knockout efficiency.

[0146] Fig.84 T cell stimulation, lentiviral transduction, and CRISPR electroporation procedures are illustrated.

[0147] Fig.85 are graphs showing T cell numbers (upper graph) and expansion folds (lower graph) after electroporation and culture procedures.

[0148] Fig.86 Is a graph group, which shows the average expansion of T cells. Shown are the expansion folds of T cells transduced with a single CD19 CAR (single TD) or transduced with CD19 CAR and edited using CRISPR (TD / KO) (left figure). The expansion folds of T cells at day 10 are shown in the right figure.

[0149] Fig.87 is a panel of flow cytometry graphs showing CD3 / B2M / CAR expression of expanded T cells at day 8.

[0150] Fig.88is a panel of graphs showing CD3 / B2M expression after CD3+ T cell depletion.

[0151] Fig.89 It is a graph group, which shows CD3 / B2M expression on day 11 in CD19 CAR TD (transduced) / electroporated CRISPR, T cells depleted of CD3; CD19 CAR TD / electroporated CRISPR T cells; and CD19 CAR TD T cells. Untransduced ND463 (NOTD) was used as a negative control. Fig.90 It is a graph group, which shows CD19CAR TD (transduced) / electroporated CRISPR, CD3-depleted T cells; CD19 CAR TD / electroporated CRISPR T cells; and CD19 CAR TD T cells at day 11 CD19 CAR expression. Untransduced ND463 (NOTD) is used as a negative control.

[0152] Fig.91 It is a graph group, which shows CD3 / B2M / CAR expression on day 11 in CD19 CAR TD (transduced) / electroporated CRISPR, T cells depleted of CD3; CD19 CAR TD / electroporated CRISPR T cells; and CD19 CAR TD T cells. Untransduced ND463 (NOTD) was used as a negative control.

[0153] Fig.92 is a graph summarizing CD3 / B2M / CAR expression in CD19 CAR TD (transduced) / CRISPR electroporated, CD3-depleted T cells; CD19CARTD / CRISPR electroporated T cells; and CD19 CAR TD T cells.

[0154] Fig.93 is a panel of graphs showing CD107a upregulation in CD19 CAR TD (transduced) / CRISPR electroporated, CD3-depleted T cells; CD19 CAR TD / CRISPR electroporated T cells; and CD19 CAR TD T cells.

[0155] Fig.94 is a panel of graphs showing the lytic activity of T cells on day 11.

[0156] Fig.95 is a panel of graphs showing cytokine production by T cells on day 11.

[0157] Fig.96 Is a panel of graphs showing T cell expansion. No abnormal T cell growth was observed. DETAILED DESCRIPTION

[0158] definition

[0159] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art to which the present invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice of testing the present invention, preferred materials and methods are described herein. In describing and claiming the present invention, the following terms will be used.

[0160] It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0161] The articles "a" and "an" are used herein to refer to one or to more than one (ie, to at least one) of the grammatical object of the article. For example, "an element" means one element or more than one element.

[0162] As used herein, "about," when referring to a measurable value such as an amount, a time period, etc., is meant to include variations of ±20% or ±10%, more preferably ±5%, even more preferably ±1%, and still more preferably ±0.1% from the stated value, as such variations are appropriate for performing the disclosed methods.

[0163] As used herein, "activation" refers to the state of a T cell that has been sufficiently stimulated to induce detectable cell proliferation. Activation can also be associated with induced cytokine production and detectable effector function. The term "activated T cell" refers to a T cell that undergoes cell division, etc.

[0164] As used herein, the term "antibody" refers to an immunoglobulin molecule that specifically binds to an antigen. An antibody can be an intact immunoglobulin derived from a natural source or a recombinant source, and can be an immunoreactive portion of an intact immunoglobulin. Antibodies are typically tetramers of immunoglobulin molecules. The antibodies of the present invention can exist in a variety of forms, including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab, and F(ab) 2, as well as single-chain antibodies (scFv) and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989 In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).

[0165] The term "antibody fragment" refers to a portion of an intact antibody and refers to the antigen-determining variable region of an intact antibody. Examples of antibody fragments include, but are not limited to, Fab, Fab', F(ab') 2 , and Fv fragments, linear antibodies, scFv antibodies, and multispecific antibodies formed by antibody fragments.

[0166] As used herein, "antibody heavy chain" refers to the larger of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformation.

[0167] As used herein, "antibody light chain" refers to the smaller chain of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformation. Alpha and beta light chains refer to the two major antibody light chain isotypes.

[0168] The term "synthetic antibody" as used herein means an antibody produced using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage as described herein. The term should also be interpreted to mean an antibody that has been produced by the synthesis of a DNA molecule that encodes the antibody and that expresses the antibody protein or an amino acid sequence that specifies the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology available and well known in the art.

[0169] The term "antigen" or "Ag" as used herein is defined as a molecule that stimulates an immune response. This immune response can include antibody production, or activation of specific immunocompetent cells, or both. The skilled person will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. In addition, antigens can be derived from recombinant or genomic DNA. The skilled person will understand that any DNA, including a nucleotide sequence or partial nucleotide sequence encoding a protein that causes an immune response, therefore encodes the term "antigen" as used herein. In addition, those skilled in the art will understand that antigens do not necessarily have to be encoded solely by the full-length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene, and that these nucleotide sequences are arranged in different combinations to cause a desired immune response. Moreover, the skilled person will understand that antigens do not necessarily have to be encoded by a "gene" at all. It is readily apparent that antigens can be generated, synthesized, or can be derived from a biological sample. Such a biological sample can include, but is not limited to, a tissue sample, a tumor sample, a cell, or a biological fluid.

[0170] As used herein, the term "anti-tumor effect" refers to a biological effect that can be manifested by a reduction in tumor volume, a reduction in the number of tumor cells, a reduction in the number of metastases, an increase in life expectancy, or an improvement in various physiological symptoms associated with a cancerous condition. An "anti-tumor effect" can also be manifested by the ability of the peptides, polynucleotides, cells and antibodies of the invention to prevent tumors from occurring in the first place.

[0171] According to the present invention, the term "autoantigen" means any self-antigen that is recognized as foreign by the immune system.Autoantigens include, but are not limited to, cellular proteins, phosphoproteins, cell surface proteins, cellular lipids, nucleic acids, glycoproteins, including cell surface receptors.

[0172] As used herein, the term "autoimmune disease" is defined as a disorder caused by an autoimmune reaction. Autoimmune diseases are the result of inappropriate and excessive responses to self-antigens. Examples of autoimmune diseases include, but are not limited to, Addison's disease, alopecia areata, ankylosing spondylitis, autoimmune hepatitis, autoimmune parotitis, Crohn's disease, diabetes (type I), dystrophic epidermolysis bullosa, epididymitis, glomerulonephritis, Graves' disease, Guillain-Barre syndrome, Hashimoto's disease, hemolytic anemia, systemic lupus erythematosus, multiple sclerosis, myasthenia gravis, pemphigus vulgaris, psoriasis, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, spondyloarthropathies, thyroiditis, vasculitis, vitiligo, myxedema, pernicious anemia, ulcerative colitis, etc.

[0173] As used herein, the term "autologous" is meant to refer to any material derived from the same individual that is subsequently reintroduced into that individual.

[0174] "Allogeneic" refers to a graft derived from a different animal of the same species.

[0175] "Xenogeneic" refers to a graft that is derived from an animal of a different species.

[0176] The term "cancer" as used herein is defined as a disease characterized by the rapid and uncontrolled growth of abnormal cells. Cancer cells can spread locally or spread to other parts of the body through the bloodstream and lymphatic system. Examples of various cancers include, but are not limited to, breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, etc. In certain embodiments, the cancer is medullary thyroid cancer.

[0177] As used herein, the term "chimeric antigen receptor" or "CAR" refers to an artificial T cell receptor engineered to express and specifically bind to an antigen on an immune effector cell. CAR can be used as a therapy using adoptive cell transfer. T cells are removed from the patient and modified so that they express receptors specific to a specific form of antigen. For example, in some embodiments, CAR has been expressed specifically for tumor-associated antigens. CAR may also include an intracellular activation domain, a transmembrane domain, and an extracellular domain, which includes a tumor-associated antigen binding region. In some aspects, CAR includes a monoclonal antibody derived from a fusion single-chain variable fragment (scFv), which is fused to a CD3-ζ transmembrane and intracellular domain. The specificity of CAR design can be derived from a ligand (e.g., a peptide) of a receptor. In some embodiments, CAR can target cancer by redirecting the specificity of T cells expressing CARs specific to tumor-associated antigens.

[0178] The term "cleavage" refers to the breaking of a covalent bond, such as in the backbone of a nucleic acid molecule. Cutting can be initiated by a variety of methods, including but not limited to enzymatic or chemical hydrolysis of phosphodiester bonds. Both single-stranded and double-stranded cleavage are possible. Double-stranded cleavage can occur due to two different single-stranded cleavage events. DNA cleavage can result in blunt ends or staggered ends. In some embodiments, fusion polypeptides can be used for double-stranded DNA targeted for cleavage.

[0179] As used herein, the term "conservative sequence modification" is intended to refer to such amino acid modifications that do not significantly affect or change the binding properties of the antibody comprising the amino acid sequence. Such conservative modifications include amino acid substitutions, additions and deletions. Modifications can be introduced into the antibodies of the present invention by standard techniques known in the art such as site-directed mutagenesis and PCR-mediated mutagenesis. Conservative amino acid substitutions are substitutions in which the amino acid residue is replaced with an amino acid residue with a similar side chain. Families of amino acid residues with similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine, tryptophan), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). Thus, one or more amino acid residues within the CDR region of an antibody can be replaced with other amino acid residues from the same side chain family, and the altered antibody can be tested for its ability to bind to antigen using the functional assays described herein.

[0180] As used herein, the term "costimulatory ligand" includes molecules on antigen presenting cells (e.g., aAPCs, dendritic cells, B cells, etc.) that specifically bind to cognate costimulatory molecules on T cells, thereby providing signals that mediate T cell responses, including but not limited to proliferation, activation, differentiation, etc., in addition to the primary signal provided by, for example, binding of the TCR / CD3 complex to an MHC molecule loaded with a peptide. Costimulatory ligands may include, but are not limited to, CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible co-stimulatory ligand (ICOS-L), intercellular adhesion molecules (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, MICB, HVEM, lymphotoxin beta receptor, 3 / TR6, ILT3, ILT4, HVEM, agonists or antibodies that bind to Toll ligand receptors, and ligands that specifically bind to B7-H3. Co-stimulatory ligands also include, in particular, antibodies that specifically bind to co-stimulatory molecules present on T cells, such as, but not limited to, CD27, CD28, 4-1BB, OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and ligands that specifically bind to CD83.

[0181] "Costimulatory molecule" refers to a cognate binding partner on a T cell that specifically binds to a costimulatory ligand, thereby mediating a costimulatory response by the T cell, such as, but not limited to, proliferation. Costimulatory molecules include, but are not limited to, MHC class I molecules, BTLA, and Toll ligand receptors.

[0182] As used herein, "co-stimulatory signal" refers to a signal that, in combination with a primary signal such as TCR / CD3 ligation, results in T cell proliferation and / or up-regulation or down-regulation of key molecules.

[0183] The term "CRISPR / CAS", "clustered regularly interspaced short palindromic repeats system" or "CRISPR" refers to a DNA locus containing short repeats of base sequences. Each repeat is followed by a short segment of intervening DNA previously exposed to viruses. Bacteria and archaea have evolved an adaptive immune defense known as the CRISPR-CRISPR-associated (Cas) system, which uses short RNA to guide the degradation of foreign nucleic acids. In bacteria, the CRISPR system provides acquired immunity against invading foreign DNA via RNA-guided DNA cutting.

[0184] In the type II CRISPR / Cas system, a short segment of exogenous DNA called a "spacer" is integrated into the CRISPR genomic locus and transcribed and processed into a short CRISPR RNA (crRNA). These crRNAs are annealed with trans-activated crRNAs (tracrRNAs) and directed by Cas proteins to sequence-specific cutting and silencing of pathogenic DNA. Recent work has shown that target recognition by Cas9 proteins requires a "seed" sequence within crRNA and a protospacer sequence adjacent motif (PAM) sequence containing conserved dinucleotides upstream of the crRNA-binding region.

[0185] To guide Cas9 to cleave the sequence of interest, a crRNA-tracrRNA fusion transcript, hereinafter referred to as "guide RNA" or "gRNA", can be designed from the human U6 polymerase III promoter. CRISPR / CAS-mediated genome editing and regulation highlight its transformative potential for basic science, cell engineering, and therapy.

[0186] The term "CRISPRi" refers to the CRISPR system for sequence-specific gene repression or inhibition of gene expression, such as at the transcriptional level.

[0187] A "disease" is a health state in an animal in which the animal is unable to maintain homeostasis, and in which the animal's health continues to deteriorate if the disease is not ameliorated. In contrast, a "disorder" in an animal is a health state in which the animal is able to maintain homeostasis, but in which the animal's health state is less favorable than it would be if it did not have the disorder. Remaining untreated, the disorder does not necessarily cause a further deterioration in the animal's health state.

[0188] As used herein, the term "downregulate" refers to the reduction or elimination of gene expression of one or more genes.

[0189] "Effective amount" or "therapeutically effective amount" are used interchangeably herein and refer to an amount of a compound, formulation, material, or composition as described herein that is effective to achieve a specific biological result or provide a therapeutic or preventive benefit. Such results may include, but are not limited to, anti-tumor activity, as determined by any means suitable in the art.

[0190] "Encoding" refers to the inherent properties of other polymers and macromolecules in polynucleotides such as genes, cDNAs or mRNAs that serve as templates for synthesizing biological processes, and the polymers and macromolecules have any of the defined sequences of nucleotides (i.e., rRNA, tRNA and mRNA) or the defined sequences of amino acids and the biological properties produced therefrom. Thus, if the transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, the gene encodes a protein. The coding strand whose nucleotide sequence is identical to the mRNA sequence and is usually provided in the sequence table, and the non-coding strand used as a template for transcription of a gene or cDNA, can be referred to as a protein or other product encoding the gene or cDNA.

[0191] As used herein, "endogenous" refers to any substance that originates from or is produced within an organism, cell, tissue, or system.

[0192] As used herein, the term "exogenous" refers to any substance that is introduced from or produced outside of an organism, cell, tissue, or system.

[0193] As used herein, the term "expansion" refers to an increase in number, such as an increase in the number of T cells. In one embodiment, the number of T cells expanded in vitro increases relative to the number originally present in the culture. In another embodiment, the number of T cells expanded in vitro increases relative to the number of other cell types in the culture. As used herein, the term "ex vivo" refers to cells that have been removed from a living organism (e.g., a human) and propagated outside the organism (e.g., in a culture dish, a test tube, or a bioreactor).

[0194] The term "expression" as used herein is defined as the transcription and / or translation of a specific nucleotide sequence driven by its promoter.

[0195] "Expression vector" refers to a vector comprising a recombinant polynucleotide comprising an expression control sequence operably linked to a nucleotide sequence to be expressed. The expression vector comprises sufficient cis-acting elements for expression; other elements for expression may be supplied by the host cell or in an in vitro expression system. Expression vectors include all those known in the art that incorporate recombinant polynucleotides, such as cosmids, plasmids (e.g., naked or contained in liposomes), and viruses (e.g., Sendai virus, lentivirus, retrovirus, adenovirus, and adeno-associated virus).

[0196] As used herein, "homologous" refers to the subunit sequence identity between two polymer molecules, for example, between two nucleic acid molecules, such as two DNA molecules or two RNA molecules, or between two polypeptide molecules. When a subunit position in both of the two molecules is occupied by the same monomer subunit; for example, if a position in each of the two DNA molecules is occupied by adenine, they are homologous at that position. The homology between two sequences is a direct function of the number of matching or homologous positions; for example, if half of the positions in the two sequences (e.g., five positions in a polymer of ten subunits in length) are homologous, the two sequences are 50% homologous; if 90% of the positions (e.g., 9 out of 10) are matched or homologous, the two sequences are 90% homologous.

[0197] "Humanized" forms of non-human (e.g., mouse) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) that contain minimal sequences derived from non-human immunoglobulins. For the most part, humanized antibodies are human immunoglobulins (recipient antibodies) in which residues from the complementary determining regions (CDRs) of the recipient are replaced by residues from the CDRs of non-human species (donor antibodies) such as mice, rats or rabbits, which have the desired specificity, affinity and ability. In some cases, the Fv framework region (FR) residues of human immunoglobulins are replaced by corresponding non-human residues. In addition, humanized antibodies can include residues that are neither found in the recipient antibodies nor in the imported CDR or framework sequences. These modifications are made to further improve and optimize antibody performance. In general, a humanized antibody will include substantially all of at least one and typically two variable domains, wherein all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin sequence. The humanized antibody will optimally also include at least a portion of an immunoglobulin constant region (Fc), typically at least a portion of a human immunoglobulin. For further details, see Jones et al., Nature, 321: 522-525, 1986; Reichmann et al., Nature, 332: 323-329, 1988; Presta, Curr. Op. Struct. Biol., 2: 593-596, 1992.

[0198] "Fully human" refers to an immunoglobulin, such as an antibody, wherein the entire molecule is of human origin or is composed of an amino acid sequence identical to the human form of the antibody.

[0199] As used herein, "identity" refers to the subunit sequence identity between two polymer molecules, in particular between two amino acid molecules, such as between two polypeptide molecules. When two amino acid sequences have the same residue at the same position; for example, if the position in each of the two polypeptide molecules is occupied by arginine, they are identical at that position. In an alignment, the identity or degree to which two amino acid sequences have the same residue at the same position is often expressed as a percentage. The identity between two amino acid sequences is a direct function of the number of matching or identical positions; for example, if half of the positions in the two sequences (e.g., five positions in a polymer of ten amino acids in length) are identical, the two sequences are 50% identical; if 90% of the positions (e.g., 9 out of 10) are matched or identical, the two amino acid sequences are 90% identical.

[0200] As used herein, the term "immunoglobulin" or "Ig" is defined as a class of proteins that act as antibodies. Antibodies expressed by B cells are sometimes referred to as BCRs (B cell receptors) or antigen receptors. The five members included in this class of proteins are IgA, IgG, IgM, IgD, and IgE. IgA is the primary antibody present in body secretions, such as saliva, tears, breast milk, gastrointestinal secretions, and mucous secretions of the respiratory and genitourinary tracts. IgG is the most common circulating antibody. IgM is the main immunoglobulin produced in the primary immune response in most subjects. It is the most effective immunoglobulin in agglutination, complement fixation, and other antibody responses, and is important in resisting bacteria and viruses. IgD is an immunoglobulin that does not have known antibody functions, but can act as an antigen receptor. IgE is an immunoglobulin that mediates immediate allergy by causing the release of mediators from mast cells and basophils after exposure to allergens.

[0201] The term "immune response" as used herein is defined as a cellular response to an antigen that occurs when lymphocytes recognize the antigen molecule as a foreign substance and induce the formation of antibodies and / or activate lymphocytes to remove the antigen.

[0202] As used herein, "induced pluripotent stem cells" or "iPS cells" refer to pluripotent stem cells generated from adult cells such as T cells. Expression of reprogramming factors in adult cells, such as Klf4, Oct3 / 4, and Sox2, converts the cells into pluripotent cells that can multiply and differentiate into a variety of cell types.

[0203] As used herein, "instructional materials" include publications, records, charts, or any other medium of expression that can be used to convey the usefulness of the compositions and methods of the present invention. The instructional materials of the kit of the present invention can, for example, be attached to a container containing the nucleic acids, peptides, and / or compositions of the present invention, or be shipped together with a container containing the nucleic acids, peptides, and / or compositions. Alternatively, the instructional materials can be shipped separately from the container, with the purpose that the instructional materials and the compound are used in conjunction with the recipient.

[0204] "Isolated" means changed or removed from its natural state. For example, a nucleic acid or peptide naturally present in a living animal is not "isolated", but the same nucleic acid or peptide partially or completely separated from the coexisting materials of its natural state is "isolated". An isolated nucleic acid or protein can exist in a substantially purified form, or can exist in a non-natural environment such as, for example, a host cell.

[0205] As used herein, the term "knockdown" refers to a reduction in gene expression of one or more genes.

[0206] As used herein, the term "knockout" refers to the ablation of gene expression of one or more genes.

[0207] As used herein, "slow virus" refers to the genus of the Retroviridae family. Slow viruses are unique among retroviruses that can infect non-dividing cells; they can deliver significant amounts of genetic information into the DNA of host cells, so that they are one of the most effective methods of gene delivery vectors. HIV, SIV, and FIV are all examples of slow viruses. Vectors derived from slow viruses provide tools for achieving significant levels of in vivo gene transfer.

[0208] As used herein, the term "modified" means an altered state or structure of a molecule or cell of the invention. Molecules can be modified in many ways, including chemically, structurally, and functionally. Cells can be modified by the introduction of nucleic acids.

[0209] As used herein, the term "modulate" means mediating a detectable increase or decrease in the level of a response in a subject compared to the level of the response in a subject lacking a treatment or compound, and / or compared to the level of the response in an otherwise identical but untreated subject. The term includes perturbing and / or influencing a natural signal or response, thereby mediating a beneficial therapeutic response in a subject, preferably a human.

[0210] In the context of the present invention, the following abbreviations for common nucleic acid bases are used: "A" refers to adenosine, "C" refers to cytosine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.

[0211] Unless otherwise specified, "a nucleotide sequence encoding an amino acid sequence" includes all nucleotide sequences that are degenerate versions of each other and encode the same amino acid sequence. The phrase "a nucleotide sequence encoding a protein or RNA" may also include introns, to the extent that the nucleotide sequence encoding the protein may contain intron(s) in some versions.

[0212] The term "operably connected" refers to a functional connection between a regulatory sequence and a heterologous nucleic acid sequence that results in the expression of the heterologous nucleic acid sequence. For example, when a first nucleic acid sequence is in a functional relationship with a second nucleic acid sequence, the first nucleic acid sequence is operably connected to the second nucleic acid sequence. For example, if a promoter affects the transcription or expression of a coding sequence, the promoter is operably connected to the coding sequence. Typically, the DNA sequence dna that is operably connected is adjacent and, if necessary, joins two protein coding regions in the same reading frame.

[0213] The term "overexpressed" tumor antigen or "overexpression" of a tumor antigen is intended to indicate an abnormal level of tumor antigen expression in cells from a disease area, such as a solid tumor within a particular tissue or organ of a patient, relative to the level of expression in normal cells from the tissue or organ. Patients with solid tumors or hematological malignancies characterized by overexpression of a tumor antigen can be determined by standard assays known in the art.

[0214] "Parenteral" administration of the immunogenic composition includes, for example, subcutaneous (sc), intravenous (iv), intramuscular (im) or intrasternal injection, or infusion techniques.

[0215] The term "polynucleotide" as used herein is defined as a chain of nucleotides. In addition, a nucleic acid is a polymer of nucleotides. Thus, nucleic acid and polynucleotide as used herein are interchangeable. One skilled in the art has the general knowledge that nucleic acids are polynucleotides that can be hydrolyzed into monomeric "nucleotides". Monomeric nucleotides can be hydrolyzed into nucleosides. Polynucleotides as used herein include, but are not limited to, all nucleic acid sequences obtained by any means available in the art, including, but not limited to, recombinant means, i.e., using common cloning techniques and PCR. TM etc. by cloning nucleic acid sequences from recombinant libraries or cell genomes, and by synthetic means.

[0216] As used herein, the terms "peptide", "polypeptide" and "protein" are used interchangeably and refer to a compound consisting of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and there is no limit to the maximum number of amino acids that can constitute the sequence of a protein or peptide. Polypeptides include any peptide or protein that includes two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which are also commonly referred to in the art as, for example, peptides, oligopeptides and oligomers; and longer chains, which are commonly referred to in the art as proteins, which have many types. "Polypeptides" include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, etc. Polypeptides include natural peptides, recombinant peptides, synthetic peptides, or combinations thereof.

[0217] The term "promoter" as used herein is defined as a DNA sequence recognized by, or introduced by, the synthetic machinery of the cell required to initiate specific transcription of a polynucleotide sequence.

[0218] As used herein, the term "promoter / regulatory sequence" means a nucleic acid sequence required for the expression of a gene product that is operably connected to the promoter / regulatory sequence. In some cases, this sequence can be a core promoter sequence, and in other cases, this sequence can also include enhancer sequences and other regulatory elements required for the expression of the gene product. For example, the promoter / regulatory sequence can be a sequence that expresses the gene product in a tissue-specific manner.

[0219] A "constitutive" promoter is a nucleotide sequence that, when operably linked to a polynucleotide that encodes or specifies a gene product, causes the gene product to be produced in a cell under most or all physiological conditions of the cell.

[0220] An "inducible" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specifying a gene product, causes the gene product to be produced in a cell essentially only when an inducer corresponding to the promoter is present in the cell.

[0221] A "tissue-specific" promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or specified by a gene, causes the gene product to be produced in a cell substantially only if the cell is a cell of the tissue type corresponding to the promoter.

[0222] "Sendai virus" refers to the genus of the family Paramyxoviridae. Sendai virus is a negative-sense, single-stranded RNA virus that does not integrate into the host genome or alter the genetic information of host cells. Sendai virus has an unusually broad host range and is not pathogenic to humans. When used as a recombinant viral vector, Sendai virus is capable of transient but robust gene expression.

[0223] "Signal transduction pathway" refers to the biochemical relationship between various signal transduction molecules that play a role in transmitting a signal from one part of a cell to another part of the cell. The phrase "cell surface receptor" includes molecules and complexes of molecules that are capable of receiving signals and transmitting signals across the plasma membrane of a cell.

[0224] "Single-chain antibody" refers to an antibody formed by recombinant DNA technology in which immunoglobulin heavy and light chain fragments are linked to the Fv region via engineered spans of amino acids. A variety of methods for generating single-chain antibodies are known, including those described in U.S. Patent No. 4,694,778; Bird (1988) Science 242:423-442; Huston et al. (1988) Proc. Natl. Acad. Sci. USA 85:5879-5883; Ward et al. (1989) Nature 334:54454; Skerra et al. (1988) Science 242:1038-1041.

[0225] As used herein, the term "specifically binds" about an antibody means that the antibody recognizes a specific antigen but does not substantially recognize or bind to other molecules in the sample. For example, an antibody that specifically binds to an antigen from one species may also bind to an antigen from one or more species. However, such cross-species reactivity itself does not change the category of the antibody to specific. In another example, an antibody that specifically binds to an antigen may also bind to an antigen of different allele forms. However, such cross-reactivity itself does not change the category of the antibody to specific. In some cases, the term "specific binding" or "specifically binds" can be used with reference to the interaction of an antibody, protein or peptide with a second chemical species, meaning that the interaction depends on the presence of a specific structure (e.g., antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure, rather than generally recognizing and binding to a protein. If the antibody is specific to epitope "A", then the presence of a molecule comprising epitope A (or free, unlabeled A) in the reaction comprising labeled "A" and the antibody will reduce the amount of labeled A bound to the antibody.

[0226] The term "stimulation" means a primary response induced by binding of a stimulatory molecule (e.g., a TCR / CD3 complex) to its associated ligand, thereby mediating a signal transduction event, such as, but not limited to, signal transduction via the TCR / CD3 complex. Stimulation can mediate altered expression of certain molecules, such as downregulation of TGF-β, and / or reorganization of cytoskeletal structure, etc.

[0227] "Stimulatory molecule," as that term is used herein, means a molecule on a T cell that specifically binds to a cognate stimulatory ligand present on an antigen presenting cell.

[0228] As used herein, "stimulatory ligand" means a ligand that, when present on an antigen presenting cell (e.g., aAPC, dendritic cell, B-cell, etc.), can specifically bind to a cognate binding partner (referred to herein as a "stimulatory molecule") on a T cell, thereby mediating a primary response of the T cell, including but not limited to activation, initiation of an immune response, proliferation, etc. Stimulatory ligands are well known in the art and include, in particular, MHC class I molecules loaded with peptides, anti-CD3 antibodies, superagonist anti-CD28 antibodies, and superagonist anti-CD2 antibodies.

[0229] The term "subject" is intended to include living organisms (e.g., mammals) in which an immune response can be elicited. A "subject" or "patient" as used herein can be a human or a non-human mammal. Non-human mammals include, for example, livestock and pets, such as sheep, bovine, porcine, canine, feline, and murine mammals. Preferably, the subject is a human.

[0230] As used herein, "substantially purified" cells are cells that are substantially free of other cell types. Substantially purified cells also refer to cells that have been separated from other cell types with which they are normally associated in their naturally occurring state. In some cases, a substantially purified cell population refers to a homogeneous cell population. In other cases, the term simply refers to cells that have been separated from cells with which they are normally associated in their naturally occurring state. In some embodiments, the cells are cultured in vitro. In other embodiments, the cells are not cultured in vitro.

[0231] "Target site" or "target sequence" refers to a genomic nucleic acid sequence that defines a portion of the nucleic acid to which a binding molecule can specifically bind under conditions sufficient for binding to occur.

[0232] As used herein, the term "T cell receptor" or "TCR" refers to a complex of membrane proteins that participate in the activation of T cells in response to the presentation of antigens. TCR is responsible for recognizing antigens that are bound to major histocompatibility complex molecules. TCR is composed of a heterodimer of alpha (a) and beta (β) chains, but in some cells, TCR is composed of γ and δ (γ / δ) chains. TCR can exist in α / β and γ / δ forms, which are structurally similar, but have different anatomical locations and functions. Each chain consists of two extracellular domains, variable and constant domains. In some embodiments, TCR can be modified on any cell including TCR, including, for example, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells and γδT cells.

[0233] As used herein, the term "therapeutic" means treatment and / or prevention. A therapeutic effect is achieved by suppression, alleviation or eradication of the disease state.

[0234] As used herein, the term "transfected" or "transformed" or "transduced" refers to the process by which exogenous nucleic acid is transferred or introduced into a host cell. A "transfected" or "transformed" or "transduced" cell is a cell that has been transfected, transformed or transduced with exogenous nucleic acid. Cells include the primary subject cell and its progeny.

[0235] "Treating" a disease, as the term is used herein, means reducing the frequency or severity of at least one sign or symptom of the disease or disorder experienced by a subject.

[0236] As used herein, the phrase "under transcriptional control" or "operably linked" means that the promoter is in the correct location and orientation relative to the polynucleotide to control initiation of transcription by RNA polymerase and expression of the polynucleotide.

[0237] "Vector" is a composition of matter that includes an isolated nucleic acid, and it can be used to deliver the isolated nucleic acid to the interior of a cell. Numerous vectors are known in the art, including but not limited to linear polynucleotides, polynucleotides associated with ions or amphipathic compounds, plasmids and viruses. Thus, the term "vector" includes autonomously replicating plasmids or viruses. The term should also be interpreted as including non-plasmid and non-viral compounds that facilitate the transfer of nucleic acids into cells, such as, for example, polylysine compounds, liposomes, etc. Examples of viral vectors include but are not limited to Sendai virus vectors, adenovirus vectors, adeno-associated virus vectors, retroviral vectors, lentiviral vectors, etc.

[0238] Scope: Throughout this disclosure, various aspects of the invention may be presented in a range format. It should be understood that descriptions in range format are for convenience and brevity only, and should not be construed as rigid limitations on the scope of the invention. Therefore, descriptions of ranges should be considered to have specifically disclosed all possible subranges as well as individual numerical values ​​within the range. For example, a description of a range such as 1 to 6 should be considered to have specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numbers within the range, e.g., 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the width of the range.

[0239] describe

[0240] Universal T cells that avoid graft-versus-host disease (GVHD) are highly desirable in clinical settings. However, the use of allogeneic T cells is risky due to rejection by the host immune system through recognition of HLA-A molecules. Targeting strategies that manipulate multiple genes are complex and efforts have yielded low efficiency in T cells without simultaneously preventing GVHD and host-versus-graft reactions.

[0241] The FAS receptor / FAS ligand (FAS / FASL) apoptosis signaling pathway negatively regulates T cell function. PD1 and CTLA4 are two major inhibitory signaling pathways in T cells. The enhanced anti-tumor immunity caused by antibody-mediated blocking of CTLA-4, PD-1 or PD-L1 indicates the possibility of improving the efficiency of immunotherapy by inhibiting these pathways. The present invention includes the generation of modified T cells, wherein as a means, TCRα and β chain, β-2 microglobulin, HLA molecules, CTLA-4, PD-1 and / or FAS are depleted to generate modified T cells with reduced immunogenicity.

[0242] The present invention includes methods and compositions for generating modified T cells by knocking down endogenous gene expression and expressing modified T cell receptors or chimeric antigen receptors. In some embodiments, the present invention includes methods for generating modified T cells. Such modified T cells can be included in therapeutic compositions and administered to patients in need thereof.

[0243] Knockdown of endogenous gene expression

[0244] The present invention includes the downregulation of endogenous gene expression in T cells, such as downregulation of α and / or β chains, β-2 microglobulin, CTLA-4, FAS, PD1 or major histocompatibility complex proteins such as HLA molecules of T cell receptor (TCR). In one embodiment, T cells with downregulated gene expression have reduced immunogenicity in an allogeneic environment. In another embodiment, T cells with reduced immunogenicity express modified TCR or CAR for targeted effector activity.

[0245] In one aspect, the present invention includes a method for generating modified T cells, comprising introducing a nucleic acid into a T cell capable of down-regulating endogenous gene expression, wherein the gene is selected from TCR alpha chain, TCR beta chain, beta-2 microglobulin, HLA molecule, CTLA-4, PD1 and FAS. Down-regulating the expression of endogenous genes involved in generating an immune response to cells, such as TCR alpha chain, TCR beta chain, beta-2 microglobulin or HLA molecule, reduces immune-mediated rejection of modified T cells. For example, down-regulating the expression of endogenous TCR, MHC or beta-2 microglobulin genes removes surface presentation of allogeneic antigens on T cells, which may cause rejection by the host immune system. Moreover, when exposed to an immunosuppressive microenvironment, down-regulating endogenous genes that regulate inhibitory signaling pathways in T cells, such as CTLA-4, PD1 and / or FAS, enhances the anti-tumor efficacy of modified T cells.

[0246] On the one hand, nucleic acids capable of down-regulating endogenous gene expression are introduced into T cells, such as by electroporation, transfection, or lentivirus or other viral transduction. On the other hand, the present invention includes modified T cells, which include electroporated nucleic acids capable of down-regulating endogenous gene expression. On the other hand, modified T cells include electroporated nucleic acids capable of down-regulating endogenous TCR gene expression. On the other hand, compositions comprising modified T cells are generated according to the methods described herein. On the other hand, the present invention includes pharmaceutical compositions comprising modified T cells or modified T cells generated according to the methods described herein and pharmaceutically acceptable carriers.

[0247] The nucleic acid capable of regulating endogenous gene expression can downregulate endogenous gene expression. In one embodiment, the nucleic acid capable of downregulating endogenous gene expression is selected from antisense RNA, antigomer RNA, siRNA, shRNA and CRISPR system. Endogenous gene expression can be downregulated, knocked down, reduced and / or inhibited by, for example, antisense RNA, antigomer RNA, siRNA, shRNA, CRISPR system, etc.

[0248] CRISPR / Cas

[0249] The CRISPR / Cas system is a simple and efficient system for inducing targeted genetic changes. Target recognition by the Cas9 protein requires a 'seed' sequence within the guide RNA (gRNA) and a protospacer sequence adjacent motif (PAM) sequence containing a conserved dinucleotide upstream of the gRNA-binding region. Thus, the CRISPR / CAS system can be engineered to cut almost any DNA sequence by redesigning the gRNA in cell lines (such as 293T cells), primary cells, and CAR T cells. The CRISPR / CAS system can simultaneously target multiple genomic loci by co-expressing a single CAS9 protein with two or more gRNAs, making this system uniquely suitable for multiple gene editing or synergistic activation of target genes.

[0250] An example of a CRISPR / Cas system for inhibiting gene expression, CRISPRi, is described in U.S. Publication No. 2014 / 0068797. CRISPRi induces permanent gene disruption, which utilizes an RNA-guided Cas9 endonuclease to introduce DNA double-strand breaks, which triggers an error-prone repair pathway to cause frameshift mutations. Catalytically dead Cas9 lacks endonuclease activity. When co-expressed with a guide RNA, a DNA recognition complex is generated that specifically interferes with transcription elongation, RNA polymerase binding, or transcription factor binding. This CRISPRi system efficiently represses the expression of target genes.

[0251] CRISPR / Cas gene disruption occurs when a guide nucleic acid sequence and a Cas endonuclease specific for a target gene are introduced into a cell and form a complex that enables the Cas endonuclease to introduce a double-strand break at the target gene. In one embodiment, the CRISPR system includes an expression vector, such as, but not limited to, a pAd5F35-CRISPR vector. In one embodiment, modified T cells are generated by introducing a Cas expression vector and a guide nucleic acid sequence specific for a gene into T cells. In another embodiment, the Cas expression vector induces expression of a Cas9 endonuclease. Other endonucleases may also be used, including but not limited to T7, Cas3, Cas8a, Cas8b, Cas10d, Cse1, Csy1, Csn2, Cas4, Cas10, Csm2, Cmr5, Fok1, other nucleases known in the art, and any combination thereof.

[0252] In one embodiment, inducing the Cas expression vector includes exposing the T cell to an agent that activates an inducible promoter in the Cas expression vector. In such an embodiment, the Cas expression vector includes an inducible promoter, such as a promoter that can be induced by exposure to an antibiotic (e.g., tetracycline or a derivative of tetracycline, such as doxycycline). However, it should be appreciated that other inducible promoters can be used. The inducer can be a selective condition that causes the induction of the inducible promoter (e.g., exposure to an agent, such as an antibiotic). This results in the expression of the Cas expression vector.

[0253] The guide nucleic acid sequence is specific to a gene and targets the gene for Cas endonuclease-induced double-strand breaks. The sequence of the guide nucleic acid sequence can be within the locus of the gene. In one embodiment, the length of the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides.

[0254] The guide nucleic acid sequence can be specific to any gene, such as a gene that will reduce immunogenicity or reduce sensitivity to an immunosuppressive microenvironment. In one embodiment, the gene can include a sequence specific to a T cell receptor (TCR) chain (such as an α, β, γ, and / or δ chain), β-2 microglobulin, FAS, PD1, a major histocompatibility complex protein (such as an HLA class I molecule and / or an HLA class II molecule), CTLA-4, or any combination thereof.

[0255] The guide nucleic acid sequence includes an RNA sequence, a DNA sequence, a combination thereof (RNA-DNA combination sequence), or a sequence with synthetic nucleotides. The guide nucleic acid sequence can be a single molecule or a double molecule. In one embodiment, the guide nucleic acid sequence includes a single guide RNA.

[0256] T cell receptor

[0257] Adoptive immunotherapy using T cells that harbor antigen-specific TCRs has therapeutic potential in the treatment of cancer and certain chronic viral infections. Genetically engineering T cells using specific TCRs has the advantage of redirecting T cells to intracellular antigens. Given that most oncoproteins are intracellular, it is very attractive to develop a set of TCRs specific for oncogenic driver proteins.

[0258] The present invention also includes modified T cells having downregulated gene expression and exogenous T cell receptors (TCR) as described herein. On the one hand, the present invention includes methods for generating modified T cells, comprising introducing nucleic acids encoding modified T cell receptors (TCR) including affinity for surface antigens on target cells into T cells and introducing nucleic acids capable of regulating endogenous gene expression selected from TCR alpha chains, TCR beta chains, beta-2 microglobulin, PD1 and FAS, wherein T cells are capable of expressing modified TCRs.

[0259] In another aspect, the present invention includes modified T cells, which include an exogenous nucleic acid encoding a modified T cell receptor (TCR) including affinity for a surface antigen on a target cell and a nucleic acid capable of downregulating endogenous gene expression selected from the group consisting of TCR alpha chain, TCR beta chain, beta-2 microglobulin, PD1 and FAS, wherein the T cell expresses the modified TCR and wherein endogenous gene expression is downregulated in the T cell. The present invention also includes a cell population containing the modified T cells described herein.

[0260] The T cell receptor is a complex of membrane proteins that participate in the activation of T cells in response to the presentation of antigens. The stimulation of TCR is triggered by the major histocompatibility complex molecules (MHC) on antigen presenting cells, which present antigenic peptides to T cells and bind to the TCR complex to induce a series of intracellular signal transduction cascades.

[0261] TCR is usually composed of six different membrane-bound chains, which form TCR heterodimers responsible for ligand recognition. TCR exists in α / β and γ / δ forms, which are structurally similar but have different anatomical locations and functions. In one embodiment, TCR includes TCR α chain and TCR β chain, such as nucleic acid encoding TCR includes nucleic acid encoding TCR α chain and TCR β chain. In another embodiment, TCR α chain or TCR β chain or two chains include at least one N-deglycosylation.

[0262] Each chain consists of two extracellular domains, variable and constant domains. In one embodiment, TCR includes at least one mouse constant region. The constant domain is close to the cell membrane, followed by a transmembrane domain and a short cytoplasmic tail. In one embodiment, the modified TCR includes a cytoplasmic domain, which includes a co-stimulatory signaling domain, such as a 4-1BB co-stimulatory signaling domain. The variable domain helps to determine the specific antigen and MHC molecule to which the TCR has binding specificity. In turn, the specificity of the T cell to a unique antigen-MHC complex is retained in the specific TCR expressed by the T cell.

[0263] Each of the constant and variable domains can include an intrachain disulfide bond. In one embodiment, the TCR includes at least one disulfide bond. The variable domain includes a highly polymorphic loop similar to the complementary determining region (CDR) of an antibody. The diversity of the TCR sequence is generated via somatic rearrangement of the connected V gene (V), D gene (D), J gene (J), and C gene.

[0264] Functional α and γ chain polypeptides are formed by rearranged VJC regions, while β and δ chains consist of VDJC regions. The extracellular constant domain includes the membrane-proximal region and the immunoglobulin region.

[0265] In one embodiment, TCR includes wild-type TCR, high-affinity TCR and chimeric TCR. When TCR is modified, it can have a higher affinity for target cell surface antigens than wild-type TCR. In the embodiment in which TCR is a chimeric TCR, TCR may include a chimeric domain, such as TCR including a co-stimulatory signaling domain at the C' end of at least one chain. In other embodiments, TCR may include a modified chain, such as a modified α or β chain. Such modifications may include, but are not limited to, N-deglycosylation, a changed domain (such as an engineered variable region to target a specific antigen or increase affinity), the addition of one or more disulfide bonds, a whole chain or a fragment of a chain derived from different species, and any combination thereof.

[0266] In one embodiment, TCR includes specificity to target cell antigen.Target cell surface antigen can include any type of ligand that limits the surface of target cell.For example, target cell surface antigen can be selected to identify the ligand of cell surface marker on target cell that acts as being associated with specific disease state.Thus, the example of cell surface marker that can serve as the ligand of antigen binding domain of TCR includes those associated with virus, bacteria and parasitic infection, autoimmune disease and cancer cell.In one embodiment, target cell surface antigen includes any tumor associated antigen (TAA) and viral antigen, disease cell associated antigen or its any fragment.

[0267] Target cell antigens can include any protein that can be processed and presented by the major histocompatibility complex. For example, the target antigen can be associated with a specific disease state. Thus, examples of cell markers that can serve as targets of TCR include those associated with viruses, bacteria and parasitic infections, autoimmune diseases and cancer cells. In one embodiment, the target antigen includes any tumor-associated antigen (TAA) and viral antigens, or any fragment thereof.

[0268] In one aspect, the invention includes a population of modified T cells comprising a nucleic acid encoding a modified T cell receptor (TCR) comprising an affinity for a surface antigen on a target cell and a nucleic acid capable of downregulating endogenous gene expression selected from the group consisting of a TCR alpha chain, a TCR beta chain, beta-2 microglobulin, an HLA molecule, CTLA-4, PD1, and FAS, wherein the T cells are capable of expressing the modified TCR.

[0269] Techniques for engineering and expressing T cell receptors include, but are not limited to, the production of TCR heterodimers that include native disulfide bridges linking the respective subunits (Garboczi, et al., (1996), Nature 384(6605):134-41; Garboczi, et al., (1996), J Immunol 157(12):5403-10; Chang et al., (1994), PNAS USA 91:11408-11412; Davodeau et al., (1993), J. Biol. Chem. 268(21):15455-15460; Golden et al., (1997), J. Imm. Meth. 206:163-169; U.S. Pat. No. 6,080,840).

[0270] Chimeric Antigen Receptor (CAR)

[0271] The present invention also includes modified T cells having downregulated gene expression and CAR as described herein. Thus, the present invention encompasses modified T cells including CAR or nucleic acid encoding CAR, wherein CAR includes an antigen binding domain, a transmembrane domain, and an intracellular domain.

[0272] In one aspect, the present invention includes a method for generating modified T cells, comprising introducing a nucleic acid capable of downregulating endogenous gene expression selected from the group consisting of TCR alpha chain, TCR beta chain, beta-2 microglobulin, HLA molecules, CTLA-4, PD1 and FAS into T cells, and introducing a nucleic acid encoding a chimeric antigen receptor (CAR) into T cells, wherein the CAR comprises an antigen binding domain, a transmembrane domain and an intracellular domain of a co-stimulatory molecule.

[0273] On the other hand, the present invention includes modified T cells, which include nucleic acids capable of down-regulating endogenous gene expression and nucleic acids encoding chimeric antigen receptors (CARs), wherein the down-regulated gene expression is selected from TCR alpha chains, TCR beta chains, beta-2 microglobulins, HLA molecules, CTLA-4, PD1 and FAS, and wherein CAR includes an antigen binding domain, a transmembrane domain and an intracellular domain of a co-stimulatory molecule. In one embodiment, as described elsewhere herein, the modified T cells further include exogenous nucleic acids encoding modified TCRs, which include affinity for surface antigens on target cells. The present invention also includes cell populations containing modified T cells described herein.

[0274] One or more domains of CAR or a fragment of a domain may be human. In one embodiment, the present invention includes a fully human CAR. Nucleic acid sequences encoding desired domains can be obtained using recombinant methods known in the art, such as, for example, by screening from a library of cells expressing the gene using standard techniques, by deriving the gene from a vector known to include it, or by direct isolation from cells and tissues containing it. Alternatively, the gene of interest can be produced synthetically, rather than as a cloned molecule.

[0275] Examples of CARs are described in U.S. Patent Nos.: 8,911,993, 8,906,682, 8,975,071, 8,916,381, 9,102,760, 9,101,584, and 9,102,761, all of which are incorporated herein by reference in their entirety.

[0276] Antigen binding domain

[0277] In one embodiment, CAR includes an antigen binding domain that binds to an antigen on a target cell. Examples of cell surface markers that can serve as antigens bound to the antigen binding domains of CAR include those associated with viral, bacterial and parasitic infections, autoimmune diseases and cancer cells.

[0278] The choice of antigen binding domain depends on the type and number of antigens present on the surface of the target cell. For example, an antigen binding domain can be selected to recognize an antigen that serves as a cell surface marker on a target cell that is associated with a specific disease state.

[0279] In one embodiment, the antigen binding domain binds to a tumor antigen, such as an antigen specific for a tumor or cancer of interest. In one embodiment, the tumor antigens of the invention include one or more cancer antigen epitopes.

[0280] The antigen binding domain may include any domain that binds to an antigen and may include, but is not limited to, monoclonal antibodies, polyclonal antibodies, synthetic antibodies, human antibodies, humanized antibodies, non-human antibodies, and any fragments thereof. Thus, in one embodiment, the antigen binding domain portion includes a mammalian antibody or a fragment thereof.

[0281] The antigen binding domain can bind to one or more antigens, such as, but not limited to, CD19; CD123; CD22; CD30; CD171; CS-1 (also known as CD2 subset 1, CRACC, SLAMF7, CD319 and 19A24); C-type lectin-like molecule-1 (CLL-1 or CLECL1); CD33; epidermal growth factor receptor variant III (EGFRvIII); ganglioside G2 (GD2); ganglioside GD3 (aNeu5Ac(2-8)aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); TNF receptor family member B cell maturation (BCMA); Tn antigen ((Tn Ag) or (GalNAcα-Ser / Thr)); prostate-specific membrane antigen (PSMA); receptor tyrosine kinase-like orphan receptor 1 (ROR1); Fms-like tyrosine kinase 3 (FLT3); tumor-associated glycoprotein 72 (TAG72); CD38; CD44v6; carcinoembryonic antigen (CEA); epithelial cell adhesion molecule (EPCAM); B7H3 (CD276); KIT (CD117); interleukin-13 receptor subunit alpha-2 (IL-13Ra2 or CD213A2); interleukin 11 receptor alpha (IL-11Ra); prostate stem cell antigen (PSCA); serine protease 21 (testisin or PRSS21); vascular endothelial growth factor receptor 2 (VEGFR2); Lewis (Y) antigen; CD24; platelet-derived growth factor receptor beta (PDGFR-β); stage-specific embryonic antigen-4 (SSEA-4); CD20; folate receptor alpha; receptor tyrosine-protein kinase ERBB2 (Her2 / neu); cell surface-associated adhesion molecule MUC1; epidermal growth factor receptor (EGFR); neural cell adhesion molecule (NCAM); prostatic enzyme; prostatic acid phosphatase (PAP); mutated elongation factor 2 (ELF2M); ephrin B2; fibroblast activation protein alpha (FAP); insulin-like growth factor 1 receptor (IGF-I receptor); carbonic anhydrase IX (CAIX); proteasome (precursor, macropain) subunit, type B, 9 (LMP2); glycoprotein 100 (gp100); Oncogene fusion protein composed of breakpoint cluster region (BCR) and Abelson murine leukemia virus oncogene homolog 1 (Abl) (bcr-abl); tyrosinase; ephrin type A receptor 2 (EphA2); fucosyl GM1; sialylated Lewis adhesion molecule (sLe); ganglioside GM3 (aNeu5Ac(2-3)bDGalp(1-4)bDGlcp(1-1)Cer); transglutaminase 5 (TGS5); high molecular weight-melanoma-associated antigen (HMWMAA);o-Acetyl-GD2 ganglioside (OAcGD2); folate receptor beta; tumor endothelial marker 1 (TEM1 / CD248); tumor endothelial marker 7-related (TEM7R); claudin 6 (CLDN6); thyroid stimulating hormone receptor (TSHR); G protein-coupled receptor class C group 5, member D (GPRC5D); chromosome X open reading frame 61 (CXORF61); CD97; CD179a; anaplastic lymphoma kinase (ALK); polysialic acid; placenta-specific 1 (PLAC1); globoH GloboH, hexose moiety of glycoceramide; NY-BR-1, mammary gland differentiation antigen; uroplakin 2 (UPK2); hepatitis A virus cellular receptor 1 (HAVCR1); adrenergic receptor β3 (ADRB3); pannexin 3 (PANX3); G protein-coupled receptor 20 (GPR20); lymphocyte antigen 6 complex, locus K9 (LY6K); olfactory receptor 51E2 (OR5 1E2); TCR gamma alternate reading frame protein (TARP); Wilms tumor protein (WT1); cancer / testis antigen 1 (NY-ESO-1); cancer / testis antigen 2 (LAGE-1A); melanoma-associated antigen 1 (MAGE-A1); ETS translocation variant gene 6, located on chromosome 12p (ETV6-AML); sperm protein 17 (SPA17); X antigen family, member 1A (XAGE1); angiopoietin binding cell surface receptor 2 (Tie2); melanoma cancer testis melanoma cancer testis antigen-1 (MAD-CT-1); melanoma cancer testis antigen-2 (MAD-CT-2); FOS-related antigen 1; tumor protein p53 (p53); p53 mutant; prostein; survivin; telomerase; prostate cancer tumor antigen-1 (PCTA-1 or galectin 8); melanoma antigen recognized by T cells 1 (MelanA or MART1); rat sarcoma (Ras) mutant; human telomerase reverse transcriptase (hTERT); sarcoma translocation Breakpoints; melanoma inhibitor of apoptosis (ML-IAP); ERG (transmembrane protease, serine 2 (TMPRSS2) ETS fusion gene); N-acetylglucosaminyltransferase V (NA17); paired box protein Pax-3 (PAX3); androgen receptor; cyclin B1; v-myc avian myelocytomatosis viral oncogene neuroblastoma-derived homolog (MYCN); Ras homolog family member C (RhoC); tyrosinase-related protein 2 (TRP-2); cytochrome P450 1B1 (CYP1B1);CCCTC-binding factor (zinc finger protein)-like (BORIS or Brother of the Regulator of Imprinted Sites); squamous cell carcinoma antigen recognized by T cells 3 (SART3); paired box protein Pax-5 (PAX5); proacrosin-binding protein sp32 (OY-TES1); lymphocyte-specific protein tyrosine kinase (LCK); type A kinase anchoring protein 4 (AKAP-4); synovial sarcoma, breakpoint X 2 (SSX2); receptor for advanced glycation end products (RAGE-1); renal ubiquitous 1 (RU1); renal ubiquitous 2 (RU2); legumain; human papillomavirus E6 (HPV E6); human papillomavirus E7 (HPV E7); intestinal carboxylesterase; mutated heat shock protein 70-2 (mut hosp70-2); CD79a; CD79b; CD72; leukocyte-associated immunoglobulin-like receptor 1 (LAIR1); Fc fragment of IgA receptor (FCAR or CD89); leukocyte immunoglobulin-like receptor subfamily A member 2 (LILRA2); CD300 molecule-like family member f (CD300LF); C-type lectin domain family 12 member A (CLEC12A); bone marrow stromal cell antigen 2 (BST2); mucin-like hormone receptor-like 2 containing an EGF-like module (module) (EMR2); lymphocyte antigen 75 (LY75); phosphatidylinositol proteoglycan-3 (GPC3); Fc receptor-like 5 (FCRL5); and immunoglobulin lambda-like polypeptide 1 (IGLL1). ;

[0282] In some cases, it is advantageous for the antigen binding domain to be derived from the same species that the CAR will ultimately be used in. For example, for use in humans, it may be advantageous for the antigen binding domain of the CAR to comprise a human antibody, a humanized antibody as described elsewhere herein, or a fragment thereof.

[0283] It is also advantageous that the antigen binding domain is operably connected to another domain of the CAR, such as a transmembrane domain or an intracellular domain, which are described elsewhere herein for expression in a cell. In one embodiment, the nucleic acid encoding the antigen binding domain is operably connected to the nucleic acid encoding the transmembrane domain and the nucleic acid encoding the intracellular domain.

[0284] Transmembrane domain

[0285] For transmembrane domains, CAR can be designed to include a transmembrane domain that connects the antigen binding domain of CAR to the intracellular domain. In one embodiment, the transmembrane domain is naturally associated with one or more of the domains in CAR. In some cases, the transmembrane domain can be selected, or the transmembrane domain can be modified by amino acid replacement to avoid such a domain being bound to the transmembrane domain of the same or different surface membrane proteins, thereby minimizing the interaction with other members of the receptor complex.

[0286] The transmembrane domain can be derived from a natural source or a synthetic source. When the source is natural, the domain can be derived from any membrane-bound protein or transmembrane protein. The transmembrane region specifically used in the present invention can be derived from α, β or ζ chains of T cell receptors, CD28, CD3ε, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154 (i.e., at least including the transmembrane region (one or more) mentioned above). In some cases, various human hinges can also be used, including human Ig (immunoglobulin) hinges.

[0287] In one embodiment, the transmembrane domain may be synthetic, in which case it will include predominantly hydrophobic residues such as leucine and valine. Preferably, a triplet of phenylalanine, tryptophan and valine will be found at each end of the synthetic transmembrane domain.

[0288] Intracellular domain

[0289] The intracellular domain or another cytoplasmic domain of CAR is responsible for activating cells in which CAR is expressed. The term "intracellular domain" thus means any part of the intracellular domain that is sufficient to transduce an activation signal. In one embodiment, the intracellular domain includes a domain responsible for effector function. The term "effector function" refers to a proprietary function of a cell. For example, the effector function of a T cell can be a cytolytic activity or an auxiliary activity including secretion of cytokines.

[0290] In one embodiment, the intracellular domain of CAR includes a domain responsible for signal activation and / or transduction. The intracellular domain can send a signal activation to change the metabolism, shape, gene expression or other cellular responses of the activated chimeric intracellular signal transduction molecules via protein-protein interactions, biochemical changes or other responses.

[0291] Examples of intracellular domains for the present invention include, but are not limited to, cytoplasmic portions of T cell receptors (TCRs) and any co-stimulatory molecules, which work together to initiate signal transduction after antigen receptor engagement, and any derivatives or variants of any synthetic sequences of these elements and having the same functional capabilities. In one embodiment, the intracellular domain of CAR includes dual signaling domains. Dual signaling domains may include fragments or domains from any molecule described herein.

[0292] Examples of intracellular domains include fragments or domains from one or more molecules or receptors, including but not limited to TCR, CD3ζ, CD3γ, CD3δ, CD3ε, CD86, common FcRγ, FcRβ (FcεR1b), CD79a, CD79b, FcγRIIa, DAP10, DAP12, T cell receptor (TCR), CD27, CD28, 4-1BB (CD137), OX40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD 2. CD7, LIGHT, NKG2C, B7-H3, ligands specifically binding to CD83, CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), CD127, CD160, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CD 11d, ITGAE, CD103, ITGAL, CD11a, LFA-1, ITGAM, CD11b, ITGAX, CD11c, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, C D100 (SEMA4D), CD69, SLAMF6 (NTB-A, Ly108), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, ​​LAT, GADS, SLP-76, PAG / Cbp, NKp44, NKp30, NKp46, NKG2D, other costimulatory molecules described herein, any derivative, variant or fragment thereof, any synthetic sequence of a costimulatory molecule having the same functional ability, and any combination thereof.

[0293] In one embodiment, the intracellular domain of the CAR includes any portion of a co-stimulatory molecule, such as at least one signaling domain from CD3, CD27, CD28, ICOS, 4-1BB, PD-1, T cell receptor (TCR), any derivative or variant thereof, any synthetic sequence thereof having the same functional capability, and any combination thereof.

[0294] Between the antigen binding domain and the transmembrane domain of CAR, or between the intracellular domain and the transmembrane domain of CAR, a spacer domain can be incorporated. As used herein, the term "spacer domain" generally means any oligopeptide or polypeptide that acts to connect the transmembrane domain to the antigen binding domain or intracellular domain in the polypeptide chain. In one embodiment, the spacer domain may include up to 300 amino acids, preferably 10 to 100 amino acids, and more preferably 25 to 50 amino acids. In another embodiment, a short oligopeptide or polypeptide connector, preferably between 2 and 10 amino acids in length, can form a connection between the transmembrane domain and the intracellular domain of CAR. Examples of connectors include glycine-serine doublets.

[0295] Human Antibodies

[0296] When using the antigen binding domain of a bispecific antibody or CAR, a human antibody or a fragment thereof may be preferably used. Fully human antibodies are particularly desirable for therapeutic treatment of human subjects. Human antibodies can be manufactured by various methods known in the art, including phage display methods using antibody libraries derived from human immunoglobulin sequences, including improvements to these techniques. See also U.S. Patent Nos. 4,444,887 and 4,716,111; and PCT publications WO 98 / 46645, WO 98 / 50433, WO 98 / 24893, WO 98 / 16654, WO 96 / 34096, WO 96 / 33735, and WO 91 / 10741; each of which is incorporated herein by reference in its entirety. Bispecific antibodies may also include antibodies in which the heavy chain and light chain are encoded by nucleotide sequences derived from one or more human DNA sources.

[0297] Human antibodies can also be produced using transgenic mice that cannot express functional endogenous immunoglobulins but can express human immunoglobulin genes. For example, human heavy chain and light chain immunoglobulin gene complexes can be introduced into mouse embryonic stem cells randomly or by homologous recombination. Alternatively, in addition to human heavy chain and light chain genes, human variable regions, constant regions and diversity regions can also be introduced into mouse embryonic stem cells. Through homologous recombination, mouse heavy chain and light chain immunoglobulin genes can be made non-functional separately or simultaneously with the introduction of human immunoglobulin loci. For example, homozygous deletion of antibody heavy chain J region (JH) genes in chimeric and germline mutant mice has been described to cause complete inhibition of endogenous antibody production. Modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. Chimeric mice are then bred to produce homozygous offspring expressing human antibodies. Transgenic mice are immunized in a normal manner using selected antigens, such as all or part of the polypeptide of the present invention. Antibodies against selected targets can be obtained from immunized transgenic mice using conventional hybridoma technology. The human immunoglobulin transgenes harbored by transgenic mice rearrange during B cell differentiation and subsequently undergo class switching and somatic mutation. Thus, using such technology, it is possible to produce therapeutically useful IgG, IgA, IgM, and IgE antibodies, including but not limited to IgG1 (γ1) and IgG3. For a review of this technology for producing human antibodies, see Lonberg and Huszar (Int. Rev. Immunol., 13: 65-93 (1995)). For a detailed discussion of the techniques used to generate human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT Publication Nos. WO 98 / 24893, WO 96 / 34096, and WO 96 / 33735; and U.S. Patent Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; and 5,939,598, each of which is incorporated herein by reference in its entirety. In addition, contracts may be signed with companies such as Abgenix, Inc. (Freemont, Calif.) and Genpharm (San Jose, Calif.) to provide human antibodies to selected antigens using techniques similar to those described above.For a detailed discussion of how transfer of the human germ-line immunoglobulin gene array in germ-line mutant mice will result in the production of human antibodies following antigen challenge, see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551 (1993); Jakobovits et al., Nature, 362:255-258 (1993); Bruggermann et al., Year in Immunol., 7:33 (1993); and Duchosal et al., Nature, 355:258 (1992).

[0298] Human antibodies can also be derived from phage display libraries (Hoogenboom et al., J. Mol. Biol., 227: 381 (1991); Marks et al., J. Mol. Biol., 222: 581-597 (1991); Vaughan et al., Nature Biotech., 14: 309 (1996)). Phage display technology (McCafferty et al., Nature, 348: 552-553 (1990)) can be used to produce human antibodies and antibody fragments in vitro from all repertoires of immunoglobulin variable (V) domain genes from unimmunized donors. According to this technology, antibody V domain genes are cloned in frame into major or minor coat protein genes of filamentous phages such as M13 or fd, and displayed as functional antibody fragments on the surface of phage particles. Because filamentous particles contain a single-stranded DNA copy of the phage genome, selection based on the functional properties of the antibody also results in selection of genes encoding antibodies that display those properties. Thus, phages mimic some of the properties of B cells. Phage display can be performed in a variety of formats; for a review, see, e.g., Johnson, Kevin S, and Chiswell, David J., Current Opinion in Structural Biology 3:564-571 (1993). V gene segments from several sources can be used for phage display. Clackson et al., Nature, 352:624-628 (1991) isolated antibodies from a small random combinatorial library of V genes derived from the spleen of unimmunized mice. Diversified arrays of oxazolidinone antibodies. V gene repertoires from unimmunized human donors can be constructed, and antibodies to a diverse array of antigens (including self-antigens) can be isolated generally following the techniques described in Marks et al., J. Mol. Biol., 222: 581-597 (1991) or Griffith et al., EMBO J., 12: 725-734 (1993). See also U.S. Patent Nos. 5,565,332 and 5,573,905, each of which is incorporated herein by reference in its entirety.

[0299] Human antibodies can also be generated by in vitro activated B cells (see, U.S. Pat. Nos. 5,567,610 and 5,229,275, each of which is incorporated herein by reference in its entirety). Human antibodies can also be generated in vitro using hybridoma technology, such as, but not limited to, Roder et al. (Methods Enzymol., 121: 140-167 (1986)).

[0300] Humanized Antibodies

[0301] Alternatively, in some embodiments, non-human antibodies can be humanized, wherein the specific sequence or region of the antibody is modified to increase the similarity to the naturally occurring antibody in humans. For example, in the present invention, the antibody or its fragment can include a non-human mammal scFv. In one embodiment, the antigen binding domain portion is humanized.

[0302] Humanized antibodies can be produced using various techniques known in the art, including, but not limited to, CDR-grafting (see, e.g., European Patent No. EP 239,400; International Publication No. WO 91 / 09967; and U.S. Pat. Nos. 5,225,539, 5,530,101, and 5,585,089, each of which is incorporated herein by reference in its entirety), veneering or resurfacing (see, e.g., European Patent Nos. EP 592,106 and EP 519,596; Padlan, 1991, Molecular Immunology, 28(4 / 5):489-498; Studnicka et al., 1994, Protein Engineering, 7(6):805-814; and Roguska et al., 1994, PNAS, 91:969-973, each of which is incorporated herein by reference in its entirety), chain shuffling (see, e.g., U.S. Patent No. 5,565,332, which is incorporated herein by reference in its entirety), and techniques disclosed in, e.g., U.S. Patent Application Publication No. US2005 / 0042664, U.S. Patent Application Publication No. US2005 / 0048617, U.S. Patent No. 6,407,213, U.S. Patent No. 5,766,886, International Publication No. WO 9317105, Tan et al., J. Immunol., 169:1119-25 (2002), Caldas et al., Protein Eng., 13(5):353-60 (2000), Morea et al., Methods, 20(3):267-79 (2000), Baca et al., J. Biol. Chem., 272(16):10678-84 (1997), Roguska et al., Protein Eng., 9(10):895-904 (1996), Couto et al., Cancer Res., 55(23 Supp):5973s-5977s (1995), Couto et al., Cancer Res., 55(8):1717-22 (1995), Sandhu JS, Gene, 150(2):409-10 (1994), and Pedersen et al., J. Mol. Biol., 235(3):959-73 (1994), each of which is incorporated herein by reference in its entirety. Often, framework residues in the framework regions will be substituted with corresponding residues from the CDR donor antibody to alter, preferably improve, antigen binding.These framework substitutions are identified by methods well known in the art, for example, by modeling the interactions of the CDR and framework residues to identify framework residues important for antigen binding and by sequence comparison to identify unusual framework residues at specific positions (see, e.g., Queen et al., U.S. Pat. No. 5,585,089; and Riechmann et al., 1988, Nature, 332:323, which are incorporated herein by reference in their entireties).

[0303] Humanized antibodies have one or more amino acid residues introduced from non-human sources. These non-human amino acid residues are generally referred to as "import" residues, which are generally taken from the "import" variable domains. Thus, humanized antibodies include one or more CDRs from non-human immunoglobulin molecules and framework regions from people. Humanization of antibodies is well known in the art and can be generally performed following the method of Winter and coworkers (Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)), by replacing rodent CDRs or CDR sequences with corresponding human antibody sequences, i.e., CDR-grafting (EP 239,400; PCT Publication No. WO 91 / 09967; and U.S. Pat. Nos. 4,816,567; 6,331,415; 5,225,539; 5,530,101; 5,585,089; 6,548,640, the contents of which are incorporated herein by reference in their entireties). In such humanized chimeric antibodies, substantially less than the complete human variable domain has been replaced by the corresponding sequence from a non-human species. In fact, humanized antibodies are usually human antibodies in which some CDR residues and possible framework (FR) residues are replaced by residues from similar sites in rodent antibodies. The humanization of antibodies can also be achieved by veneer or surface reconstruction (EP 592,106; EP 519,596; Padlan, 1991, Molecular Immunology, 28 (4 / 5): 489-498; Studnicka et al., Protein Engineering, 7 (6): 805-814 (1994); and Roguska et al., PNAS, 91: 969-973 (1994)) or chain shuffling (U.S. Patent No. 5,565,332), the contents of which are incorporated herein by reference in their entirety.

[0304] The selection of the human variable domains, both light and heavy, used to make humanized antibodies is to reduce antigenicity. According to the so-called "best fit" method, the sequence of the variable domains of rodent antibodies is screened for the entire library of known human variable domain sequences. The human sequence closest to rodents is then accepted as the human framework (FR) for humanized antibodies (Sims et al., J.Immunol., 151: 2296 (1993); Chothia et al., J.Mol.Biol., 196: 901 (1987), the contents of which are incorporated herein by reference in their entirety). Another method uses a specific framework derived from the consensus sequence of all human antibodies of a specific light or heavy chain subgroup. The same framework can be used for several different humanized antibodies (Carter et al., Proc. Natl. Acad. Sci. USA, 89:4285 (1992); Presta et al., J. Immunol., 151:2623 (1993), the contents of which are incorporated herein by reference in their entirety).

[0305] Antibodies can be humanized, and retain high affinity to target antigen and other favorable biological properties. According to one aspect of the invention, humanized antibodies are prepared by using the three-dimensional model analysis of parental sequences and a variety of conceptual humanized products of parental and humanized sequences. The three-dimensional immunoglobulin model is generally available and is familiar to those skilled in the art. The computer program of the possible three-dimensional conformational structure of the candidate immunoglobulin sequence selected by diagramming and displaying is available. Checking these displays allows analysis of the possible effects of residues in the function of the candidate immunoglobulin sequence, that is, analyzing the residues that affect the ability of the candidate immunoglobulin to bind the target antigen. In this way, FR residues can be selected and combined from recipient and input sequence to achieve desired antibody characteristics, such as the increased affinity to the target antigen. Generally speaking, CDR residues directly and most substantially participate in affecting antigen binding.

[0306] Humanized antibodies retain antigenic specificity similar to the original antibody. However, using certain methods of humanization, the method of "directed evolution" can be used to increase the binding affinity and / or specificity of antibodies to the target antigen, as described by Wu et al., J. Mol. Biol., 294: 151 (1999), the contents of which are incorporated herein by reference in their entirety.

[0307] Other molecules

[0308] The present invention also includes the T cell of modification described herein, which further includes a costimulatory molecule or a nucleic acid encoding a costimulatory molecule. In one embodiment, the T cell of the modification of the present invention further includes an exogenous nucleic acid encoding a costimulatory molecule so that the T cell of modification expresses a costimulatory molecule. Nucleic acid can be introduced into T cells by transduction of T cells, transfection of T cells or electroporation of T cells. In another embodiment, the costimulatory molecule is selected from CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1 and PD1L. In another embodiment, the costimulatory molecule includes CD3 and includes at least two different CD3 chains, such as CD3ζ chains and CD3ε chains.

[0309] In another embodiment, the modified T cell further includes Klf4, Oct3 / 4 and / or Sox2 or nucleic acids encoding Klf4, Oct3 / 4 and / or Sox2 to induce the pluripotency of the T cell. T cells can be induced to pluripotency by expressing Klf4, Oct3 / 4 and Sox2. Klf4, Oct3 / 4 and Sox2 can be expressed from nucleic acids, viral vectors (one or more) or RNA molecules (one or more). In one embodiment, a viral vector encoding Klf4, Oct3 / 4 and Sox2 is introduced into T cells to induce pluripotency. In another embodiment, a Sendai virus vector is introduced into T cells to induce pluripotency, wherein the Sendai virus vector encodes Klf4, Oct3 / 4 and Sox2.

[0310] Introduction of nucleic acid

[0311] The method of introducing nucleic acid into cells includes physical, biological and chemical methods. Physical methods for introducing polynucleotides such as RNA into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, etc. RNA can be introduced into target cells using commercially available methods, including electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany)), ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendort, Hamburg Germany). RNA can also be introduced into cells by the following methods: using cationic liposome-mediated transfection, using lipofection, using polymer encapsulation, using peptide-mediated transfection, or using biolistic particle delivery systems such as "gene guns" (see, for example, Nishikawa et al. Hum Gene Ther., 12 (8): 861-70 (2001)).

[0312] Biological methods for introducing polynucleotides of interest into host cells include the use of DNA and RNA vectors. Viral vectors, especially retroviral vectors, have become the most widely used methods for inserting genes into mammals, e.g., human cells. Other viral vectors can be derived from slow viruses, poxviruses, herpes simplex virus type I, adenoviruses, and adeno-associated viruses, etc. See, e.g., U.S. Patent Nos. 5,350,674 and 5,585,362.

[0313] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system used as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0314] Lipids suitable for use can be obtained from commercial sources. For example, dimyristoylphosphatidylcholine ("DMPC") can be obtained from Sigma, St. Louis, MO; dicetyl phosphate ("DCP") can be obtained from K&K Laboratories (Plainview, NY); cholesterol ("Choi") can be obtained from Calbiochem-Behring; dimyristoylphosphatidylglycerol ("DMPG") and other lipids can be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about -20°C. Chloroform is used as the only solvent because it evaporates more easily than methanol. "Liposome" is a general term that includes a variety of monolayer and multilayer lipid vehicles formed by generating closed lipid bilayers or aggregates. Liposomes can be characterized as having a vesicle structure having a phospholipid bilayer membrane and an internal aqueous medium. Multilayer liposomes have multiple lipid layers separated by an aqueous medium. When phospholipids are suspended in an excess of aqueous solution, they form spontaneously. Before forming a closed structure and trapping water and dissolved solutes between the lipid bilayers, the lipid components undergo self-rearrangement (Ghosh et al., 1991 Glycobiology 5:505-10). However, compositions having different structures in solution compared to normal vesicle structures are also included. For example, lipids can present micellar structures or exist only as non-uniform aggregates of lipid molecules. Also considered are lipofectamine-nucleic acid complexes.

[0315] Regardless of the method used to introduce exogenous nucleic acid into host cells or otherwise expose cells to the inhibitors of the present invention, a variety of assays can be performed to confirm the presence of nucleic acid in host cells. Such assays include, for example, "molecular biology" assays well known to those skilled in the art, such as Southern and Northern blotting, RT-PCR and PCR; "biochemical" assays, such as detecting the presence or absence of specific peptides, for example, by immunological means (ELISA and Western blotting) or by assays using identification reagents described herein, which fall within the scope of the present invention.

[0316] In one embodiment, nucleic acid encoding T cell receptor (TCR)--it includes affinity to surface antigen on target cell--is introduced into expanded T cell.Nucleic acid encoding TCR can be identical or separate nucleic acid capable of lowering endogenous TCR gene expression.Nucleic acid encoding TCR can be introduced into T cell simultaneously or sequentially with nucleic acid capable of lowering endogenous TCR gene expression.In one embodiment, nucleic acid encoding TCR is introduced before nucleic acid capable of lowering endogenous TCR gene expression.

[0317] Moreover, nucleic acids can be introduced by any means, such as transduction of expanded T cells, transfection of expanded T cells, and electroporation of expanded T cells. One nucleic acid can be introduced into T cells by one method and another nucleic acid can be introduced into T cells by a different method.

[0318] RNA

[0319] In one embodiment, the nucleic acid introduced into the T cell is RNA. In another embodiment, RNA is mRNA including RNA transcribed in vitro or synthetic RNA. RNA is produced by in vitro transcription using a template generated by polymerase chain reaction (PCR). DNA of interest from any source can be directly converted into a template for in vitro mRNA synthesis using appropriate primers and RNA polymerase by PCR. The source of DNA can be, for example, genomic DNA, plasmid DNA, phage DNA, cDNA, a synthetic DNA sequence or any other appropriate DNA source. The desired template for in vitro transcription is a chimeric membrane protein. For example, the template encodes an antibody, a fragment of an antibody or a part of an antibody. For example, the template includes an extracellular domain, which includes a single-chain variable domain of an antibody such as anti-CD3; and an intracellular domain of a costimulatory molecule. In one embodiment, the template of the RNA chimeric membrane protein encodes a chimeric membrane protein, which includes an extracellular domain, which includes an antigen binding domain of an antibody derived from a costimulatory molecule; and an intracellular domain derived from a part of the intracellular domain of CD28 and 4-1BB.

[0320] PCR can be used to generate templates for in vitro transcribed mRNA, which is subsequently introduced into cells. Methods for performing PCR are well known in the art. Primers for PCR are designed to have regions that are substantially complementary to regions of DNA to be used as templates for PCR. "Substantially complementary" as used herein refers to sequences of nucleotides in which most or all of the bases in the primer sequence are complementary, or one or more bases are non-complementary or mismatched. Substantially complementary sequences can anneal or hybridize with the expected DNA target under annealing conditions for PCR. Primers can be designed to be substantially complementary to any part of the DNA template. For example, primers can be designed to amplify gene portions (open reading frames) that are normally transcribed in cells, including 5' and 3' UTRs. Primers can also be designed to amplify gene portions encoding specific domains of interest. In one embodiment, primers are designed to amplify coding regions of human cDNA including all or part of 5' and 3' UTRs. Primers that can be used for PCR are generated by synthetic methods well known in the art. "Forward primers" are primers that contain nucleotide regions that are substantially complementary to nucleotides on the DNA template upstream of the DNA sequence to be amplified. As used herein, "upstream" refers to the 5' position of the DNA sequence to be amplified relative to the coding strand. A "reverse primer" is a primer that contains a nucleotide region that is substantially complementary to the double-stranded DNA template downstream of the DNA sequence to be amplified. "Downstream" as used herein refers to the 3' position of the DNA sequence to be amplified relative to the coding strand.

[0321] Chemical structures with the ability to promote the stability and / or translation efficiency of RNA can also be used. RNA preferably has 5' and 3' UTR. In one embodiment, the length of 5' UTR is between zero and 3000 nucleotides. The length of 5' and 3' UTR sequences to be added to the coding region can be changed by different methods, including but not limited to primers designed for PCR, which anneal to different regions of UTR. Using this method, those of ordinary skill in the art can modify the 5' and 3' UTR lengths required for optimal translation efficiency after the RNA transcribed by transfection.

[0322] The 5' and 3' UTRs can be naturally occurring endogenous 5' and 3' UTRs of the gene of interest. Alternatively, a UTR sequence that is non-endogenous to the gene of interest can be added by incorporating the UTR sequence into the forward and reverse primers or by any other modification of the template. The use of a UTR sequence that is non-endogenous to the gene of interest can be useful for modifying the stability and / or translation efficiency of the RNA. For example, it is known that the AU-rich elements in the 3' UTR sequence can reduce the stability of the mRNA. Therefore, the 3' UTR can be selected or designed to increase the stability of the transcribed RNA based on the properties of the UTRs well known in the art.

[0323] In one embodiment, the 5'UTR may comprise a Kozak sequence of an endogenous gene. Alternatively, when a non-endogenous 5'UTR to a gene of interest is being added by PCR as described above, a common Kozak sequence can be redesigned by adding a 5'UTR sequence. The Kozak sequence can increase the translation efficiency of some RNA transcripts, but does not appear to be required for efficient translation of all RNAs. The requirements for Kozak sequences of many mRNAs are known in the art. In other embodiments, the 5'UTR may be derived from an RNA virus whose RNA genome is stable in a cell. In other embodiments, a variety of nucleotide analogs may be used in 3' or 5'UTR to hinder exonuclease degradation of mRNA.

[0324] In order to realize the synthesis of RNA from DNA template without the need for gene cloning, the promoter of transcription should be attached to the DNA template upstream of the sequence to be transcribed. When the sequence acting as the promoter of RNA polymerase is added to the 5 ' end of the forward primer, the RNA polymerase promoter is incorporated into the PCR product upstream of the open reading frame to be transcribed. In one embodiment, the promoter is a T7 polymerase promoter, as described elsewhere herein. Other useful promoters include but are not limited to T3 and SP6 RNA polymerase promoters. The shared nucleotide sequence of T7, T3 and SP6 promoters is known in the art.

[0325] In one embodiment, the mRNA has a cap on the 5' end and a 3' polyadenylated tail, which determines ribosome binding, initiation of translation, and stability of the mRNA in the cell. On a circular DNA template, e.g., plasmid DNA, RNA polymerase produces a long concatameric product that is not suitable for expression in eukaryotic cells. Transcription of plasmid DNA linearized at the end of the 3'UTR produces normal-sized mRNA, which is ineffective in eukaryotic transfection, even if it is polyadenylated after transcription.

[0326] On a linear DNA template, bacteriophage T7 RNA polymerase can extend the 3' end of the transcript beyond the last base of the template (Schenborn and Mierendorf, Nuc Acids Res., 13:6223-36 (1985); Nacheva and Berzal-Herranz, Eur. J. Biochem., 270:1485-65 (2003)).

[0327] The conventional method to integrate a poly A / T stretch into a DNA template is molecular cloning. However, poly A / T sequences integrated into plasmid DNA can cause plasmid instability, which is why plasmid DNA templates obtained from bacterial cells are often highly contaminated with deletions and other aberrations. This makes the cloning procedure not only laborious and time consuming, but also often unreliable. This is why a method that allows the construction of DNA templates with a poly A / T 3' stretch without cloning is highly desirable.

[0328] The poly A / T segment of the transcribed DNA template can be produced during PCR by using a reverse primer comprising a poly T tail, such as 100 T tails (size can be 50-5000 Ts), or produced by any other method after PCR, including but not limited to DNA connection or in vitro recombination. The poly A tail also provides stability to RNA and reduces their degradation. Generally, the length of the poly A tail is positively correlated with the stability of the transcribed RNA. In one embodiment, the poly A tail is between 100 and 5000 adenosines.

[0329] The poly (A) tail of RNA can be further extended after in vitro transcription using poly (A) polymerase, such as E. coli poly (A) polymerase (E-PAP). In one embodiment, increasing the length of the poly (A) tail from 100 nucleotides to between 300 and 400 nucleotides results in an increase in the translation efficiency of RNA by about two times. Additionally, different chemical groups attached to the 3' end can increase mRNA stability. Such attachment can include modified / artificial nucleotides, aptamers and other compounds. For example, ATP analogs can be incorporated into the poly (A) tail using poly (A) polymerase. ATP analogs can further increase the stability of RNA.

[0330] The 5' cap also provides stability to the RNA molecule. In a preferred embodiment, the RNA produced by the method disclosed herein includes a 5' cap. The 5' cap is provided using techniques known in the art and described herein (Cougot, et al., Trends in Biochem. Sci., 29: 436-444 (2001); Stepinski, et al., RNA, 7: 1468-95 (2001); Elango, et al., Biochim. Biophys. Res. Commun., 330: 958-966 (2005)).

[0331] The RNA produced by the method disclosed herein can also include an internal ribosome entry site (IRES) sequence. The IRES sequence can be any viral sequence, chromosomal sequence or artificially designed sequence that the initiation cap-independence ribosome binds to mRNA and promotes translation initiation. Any solute suitable for cell electroporation can be included, which can include factors that promote cell permeability and viability, such as sugars, peptides, lipids, proteins, antioxidants and surfactants.

[0332] RNA transfection

[0333] In some embodiments, RNA encoding the TCR is electroporated into cells. In one embodiment, the RNA encoding the TCR is an in vitro transcribed RNA.

[0334] The disclosed methods can be applied to modulating T cell activity in basic research and therapy in the areas of cancer, stem cells, acute and chronic infections, and autoimmune diseases, including evaluating the ability of genetically modified T cells to kill target cancer cells.

[0335] The method also provides the ability to control expression levels over a wide range by changing, for example, the amount of the promoter or input RNA, which makes it possible to individually regulate expression levels. In addition, PCR-based mRNA production technology greatly facilitates the design of mRNAs with different structures and their domain combinations.

[0336] An advantage of the RNA transfection method of the present invention is that RNA transfection is substantially instantaneous and carrier-free. RNA transgenes can be delivered to lymphocytes and expressed therein after brief in vitro cell activation, as a minimal expression cassette without any additional viral sequences. Under these conditions, integration of the transgene into the host cell genome is impossible. Due to the transfection efficiency of RNA and its ability to uniformly modify the entire lymphocyte population, cloning of cells is not necessary.

[0337] Genetic modification of T cells using in vitro-transcribed RNA (IVT-RNA) utilizes two different strategies that have both been successfully tested in a variety of animal models. Cells are transfected with in vitro-transcribed RNA by means of lipofection or electroporation. Stabilization of IVT-RNA using various modifications is desirable in order to achieve prolonged expression of the transferred IVT-RNA.

[0338] Some IVT vectors are known in the literature, which are used as templates for in vitro transcription in a standardized manner and which have been genetically modified so that stable RNA transcripts are produced. Current protocols used in the art are based on plasmid vectors with the following structure: a 5' RNA polymerase promoter enabling RNA transcription, followed by the gene of interest flanked at 3' and / or 5' by untranslated regions (UTRs), and a 3' polyadenylic cassette containing 50-70 A nucleotides. Prior to in vitro transcription, the circular plasmid is linearized downstream of the polyadenylic cassette by a type II restriction enzyme (recognition sequence corresponding to the cleavage site). The polyadenylic cassette thus corresponds to the following poly(A) sequence in the transcript. As a result of this procedure, after linearization some nucleotides remain as partial enzyme cleavage sites and extend or mask the poly(A) sequence at the 3' end. It is not clear whether this non-physiological overhang affects the amount of protein produced intracellularly from such a construct.

[0339] RNA has many advantages over more traditional plasmid or viral methods. Gene expression from RNA sources does not require transcription and produces protein products quickly after transfection. Further, since RNA must only access the cytoplasm rather than the nucleus, typical transfection methods result in extremely high transfection rates. In addition, plasmid-based methods require that the promoter driving the expression of the gene of interest is active in the cells being studied.

[0340] On the other hand, RNA constructs are delivered into cells by electroporation. See, for example, preparations and methods for electroporating nucleic acid constructs into mammalian cells as taught in US 2004 / 0014645, US 2005 / 0052630A1, US 2005 / 0070841A1, US 2004 / 0059285A1, US 2004 / 0092907A1. Multiple parameters including the electric field strength required for electroporation of any known cell type are generally known in the relevant research literature and numerous patents and applications in the field. See, for example, U.S. Patent No. 6,678,556, U.S. Patent No. 7,171,264 and U.S. Patent No. 7,173,116. Equipment for therapeutic applications of electroporation is commercially available, for example, MedPulser TMDNA electroporation therapy system (Inovio / Genetronics, San Diego, Calif.), and described in patents such as U.S. Patent No. 6,567,694; U.S. Patent No. 6,516,223, U.S. Patent No. 5,993,434, U.S. Patent No. 6,181,964, U.S. Patent No. 6,241,701 and U.S. Patent No. 6,233,482; Electroporation can also be used for in vitro cell transfection, for example, as described in US20070128708A1. Electroporation can also be used for in vitro delivery of nucleic acids into cells. Therefore, the electroporation-mediated administration of expression constructs including nucleic acids into cells using any of the many available devices and electroporation systems known to those skilled in the art provides an exciting new means for delivering RNA of interest to target cells.

[0341] In one embodiment, the method comprises electroporating RNA encoding TCR alpha and beta chains. The TCR alpha and beta chains can be encoded on the same or separate RNAs. When alpha and beta are encoded by separate RNAs, the RNAs can be co-electroporated.

[0342] In another embodiment, the method can further comprise electroporating a nucleic acid encoding a co-stimulatory molecule. The co-stimulatory molecule nucleic acid can be co-electroporated with the TCR RNA.

[0343] Source of T cells

[0344] Before expansion, the source of T cells is obtained from the object. Non-limiting examples of objects include humans, dogs, cats, mice, rats and transgenic species thereof. Preferably, the object is a human. T cells can be obtained from a large number of sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, spleen tissue, umbilical cord and tumors. In some embodiments, any number of T cell lines available in the art can be used. In some embodiments, T cells can be obtained from blood units collected from the object using any number of techniques known to the technician, such as Ficoll separation. In one embodiment, cells from the circulating blood of an individual are obtained by apheresis or leukocyte extraction. Apheresis products generally include lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated leukocytes, erythrocytes and platelets. Cells collected by apheresis can be cleaned to remove plasma fractions and cells can be placed in appropriate buffers or culture media for subsequent processing steps, such as phosphate buffered saline (PBS) or cleaning solutions, which lack calcium and can lack magnesium or can lack many, if not all, divalent cations. After washing, the cells can be resuspended in various biocompatible buffers, such as, for example, Ca-free, Mg-free PBS. Alternatively, undesirable components of the apheresis sample can be removed and the cells resuspended directly in culture medium.

[0345] In another embodiment, T cells are produced by lysing red blood cells and depleting monocytes, for example, by PERCOLL TM Gradient centrifugation, separation from peripheral blood. Alternatively, T cells can be isolated from umbilical cord. In any case, specific subsets of T cells can be further isolated by positive or negative selection techniques.

[0346] The cord blood mononuclear cells thus isolated can be depleted of cells expressing certain antigens, which include but are not limited to CD34, CD8, CD14, CD19 and CD56. The depletion of these cells can be accomplished using isolated antibodies, biological samples including antibodies such as ascites, antibodies bound to physical supports, and cell-bound antibodies.

[0347] Enrichment of T cell populations by negative selection can be accomplished using a combination of antibodies against surface markers that are unique to the negatively selected cells. A preferred method is cell sorting and / or selection via negative magnetic immunoadhesion or flow cytometry using a mixture of monoclonal antibodies against cell surface markers present on the negatively selected cells. For example, to enrich CD4+ cells by negative selection, the monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CD11b, CD16, HLA-DR, and CD8.

[0348] For isolating a desired cell population by positive or negative selection, the concentration of cells and surface (e.g., particles such as beads) can be varied. In certain embodiments, it may be desirable to significantly reduce the volume in which beads and cells are mixed together (i.e., increase the concentration of cells) to ensure maximum contact between cells and beads. For example, in one embodiment, a concentration of 2 billion cells / ml is used. In one embodiment, a concentration of 1 billion cells / ml is used. In further embodiments, more than 100 million cells / ml are used. In further embodiments, 10, 15, 20, 25, 30, 35, 40, 45, or 50×10 6 In yet another embodiment, 75, 80, 85, 90, 95 or 100×10 6 In further embodiments, 125 or 150×10 6 Using high concentrations can result in increased cell yield, cell activation, and cell expansion.

[0349] After the cleaning step, T cells can also be frozen, which does not require a monocyte removal step. Although it is not desired to be bound by theory, by removing the granulocytes and a certain degree of monocytes in the cell population, freezing and subsequent thawing steps provide a more uniform product. After the cleaning step of removing plasma and platelets, cells can be suspended in a freezing solution. Although many freezing solutions and parameters are known in the art and will be useful in this context, in non-limiting examples, a method includes using PBS containing 20% ​​DMSO and 8% human serum albumin, or other suitable cell freezing medium. The cells are then frozen to -80 ° C at a rate of 1 ° C per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing and uncontrolled freezing at -20 ° C or in liquid nitrogen can be used.

[0350] In one embodiment, the T cell population is contained in cells such as peripheral blood mononuclear cells, umbilical cord blood cells, purified T cell populations and T cell lines. In another embodiment, peripheral blood mononuclear cells include T cell populations. In yet another embodiment, purified T cells include T cell populations.

[0351] Chimeric membrane protein

[0352] Typically, T cells are expanded by contacting with a surface, and the surface has a reagent attached to it for stimulating CD3 / TCR complex-related signals and a ligand for stimulating co-stimulatory molecules on the surface of T cells. The present invention includes a novel method for expanding T cell groups, which includes making T cells electroporated with RNA encoding chimeric membrane proteins, and cultivating electroporated T cells, wherein the electroporated T cells in the group expand at least 10 times. The chimeric membrane protein of the present invention includes extracellular and intracellular domains. The extracellular domain includes a target-specific binding element, such as an antibody. In one embodiment, the chimeric membrane protein includes an anti-CD3 single-chain variable fragment (scFv) and an intracellular domain derived from a part of the intracellular domain of CD28 and 4-1BB.

[0353] Expression of the chimeric membrane protein allows for interaction with other cells in the population, such as cells expressing CD3, to stimulate and activate expansion of the electroporated T cells. Without wishing to be bound by any particular theory, cells expressing CD3 may contact and bind to the chimeric membrane protein, which is expressed on the surface of the electroporated T cells. At least one T cell expressing the chimeric membrane protein interacts with another cell expressing CD3. This interaction stimulates expansion of the electroporated T cells.

[0354] In one embodiment, the T cells are expanded prior to downregulating the endogenous gene. In another embodiment, the modified T cells are expanded.

[0355] Extracellular domain

[0356] The present invention includes an extracellular domain containing an antigen binding domain, and the antigen binding domain is derived from an antibody for a costimulatory molecule. Costimulatory molecules may include any molecule of costimulatory T cells, such as, but not limited to CD3, CD28 or a combination thereof. In one embodiment, the extracellular domain may include an antigen binding domain, which is derived from anti-CD3, anti-CD28 or a combination thereof. In another embodiment, the extracellular domain includes a single chain variable fragment (scFv) of anti-CD3.

[0357] In another embodiment, the extracellular domain may include any portion of an antibody that binds to an antigen, including but not limited to synthetic antibodies, human antibodies, humanized antibodies, single domain antibodies, single chain variable fragments, and antigen binding domains of fragments thereof. In some cases, it is advantageous for the extracellular domain to be derived from the same species in which the chimeric membrane protein will ultimately be used. For example, for use in humans, it may be advantageous for the extracellular domain of the chimeric membrane protein to include a human antibody or a fragment thereof. Thus, in one embodiment, the extracellular domain portion includes a human antibody or a fragment thereof, as described elsewhere herein. Alternatively, in some embodiments, the extracellular domain portion includes a humanized non-human antibody, as described elsewhere herein.

[0358] Intracellular domain

[0359] The intracellular domain or cytoplasmic domain includes a co-stimulatory signaling region. The co-stimulatory signaling region refers to the intracellular domain of a co-stimulatory molecule. Co-stimulatory molecules are cell surface molecules other than antigen receptors or their ligands that are required for lymphocytes to respond efficiently to antigens.

[0360] The cytoplasmic domain or intracellular signaling domain of the chimeric membrane protein is responsible for at least one of the effector functions of activated T cells. Although the entire intracellular signaling domain can often be employed, in many cases, it is not necessary to use the entire chain. To the extent that a truncated portion of an intracellular signaling domain is used, such a truncated portion can be used to replace the complete chain as long as it transduces an effector function signal. The intracellular signaling domain includes any truncated portion of the intracellular signaling domain that is sufficient to transduce an effector function signal.

[0361] Non-limiting examples of intracellular signaling domains for chimeric membrane proteins include any part of the intracellular domain of CD28, 4-1BB, T cell receptor (TCR), co-stimulatory molecules, any derivatives or variants of these sequences, any synthetic sequences with the same functional capacity, and any combination thereof. In one embodiment, the intracellular domain includes a portion of the intracellular domain of CD28 and 4-1BB.

[0362] Other domains of chimeric membrane proteins

[0363] Between the extracellular domain and the transmembrane domain of the chimeric membrane protein, or between the cytoplasmic domain and the transmembrane domain of the chimeric membrane protein, a spacer domain may be incorporated, such as an oligopeptide or polypeptide that acts to connect the transmembrane domain to the extracellular domain or cytoplasmic domain in the polypeptide chain. The spacer domain may include up to 300 amino acids, preferably 10 to 100 amino acids and most preferably 25 to 50 amino acids.

[0364] In some embodiments, the chimeric membrane protein further comprises a transmembrane domain. In some embodiments, the chimeric membrane protein further comprises a hinge domain. In one embodiment, the RNA encoding the chimeric membrane protein further comprises a transmembrane and hinge domain, such as a CD28 transmembrane domain and a CD8-α hinge domain.

[0365] T cell expansion

[0366] As shown in the data disclosed herein, expansion of T cells by the methods disclosed herein can increase by about 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, 2000 times, 3000 times, 4000 times, 5000 times, 6000 times, 7000 times, 8000 times, 9000 times, 10,000 times, 100,000 times, 1,000,000 times, 10,000,000 times, or more, and any and all whole or partial integers therebetween. In one embodiment, T cells expand in the range of about 20 times to about 50 times.

[0367] After culturing, before the cells are passaged to another culture device, the T cells can be cultivated in the cell culture medium in the culture device for a period of time or until the cells reach confluence or high cell density for optimal passage. The culture device can have any culture device generally used for in vitro culture of cells. Preferably, before the cells are passaged to another culture device, the level of confluence is 70% or greater. More preferably, the level of confluence is 90% or greater. A period of time can be any time suitable for cell in vitro culture. The T cell culture medium can be replaced at any time during the T cell culture. Preferably, the T cell culture medium is replaced approximately every 2 to 3 days. Then the T cells are harvested from the culture device, so that the T cells can be used immediately or stored in cold storage for later use. In one embodiment, the present invention includes refrigerated expanded T cells. Refrigerated T cells are thawed before nucleic acid is introduced into the T cells.

[0368] In another embodiment, the method comprises isolating T cells and expanding the T cells. In another embodiment, the invention further comprises refrigerating the T cells prior to expansion. In yet another embodiment, the refrigerated T cells are thawed so as to be electroporated with RNA encoding the chimeric membrane protein.

[0369] Another procedure for ex vivo expansion of cells is described in U.S. Patent No. 5,199,942 (incorporated herein by reference). Expansion, such as described in U.S. Patent No. 5,199,942, can be an alternative to other expansion methods described herein or a method in addition to other expansion methods described herein. In brief, the ex vivo culture and expansion of T cells include the addition of cell growth factors, such as those described in U.S. Patent No. 5,199,942, or other factors, such as flt3-L, IL-1, IL-3, and c-kit ligands. In one embodiment, expanding T cells includes culturing T cells using factors selected from flt3-L, IL-1, IL-3, and c-kit ligands.

[0370] The culture step as described herein (contacting with an agent as described herein or after electroporation) can be very short, e.g., less than 24 hours such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or 23 hours. The culture step as further described herein (contacting with an agent as described herein) can be longer, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more days.

[0371] A variety of terms are used to describe cells in culture. Cell culture generally refers to cells taken from a living organism and grown under controlled conditions. Primary cell culture is a culture of cells, tissues or organs taken directly from an organism and before the first subculture. When they are placed in a growth medium under conditions that promote cell growth and / or division, cells are expanded in culture to produce larger cell populations. When cells are expanded in culture, the cell proliferation rate is usually measured by the amount of time required for the cell number to double, otherwise known as the doubling time.

[0372] Each round of subculture is referred to as passage. When cells are subcultured, they are referred to as having been passaged. Specific cell groups or cell lines are sometimes referred to as or characterized by the number of times they have been passaged. For example, a cell group of a culture that has been passaged ten times can be referred to as a P10 culture. Primary culture, that is, the first culture after tissue separation cells is designated as P0. After the first subculture, cells are described as secondary cultures (P1 or the 1st generation). After the second subculture, cells become tertiary cultures (tertiary culture) (P2 or the 2nd generation), and so on. It will be appreciated by those skilled in the art that many groups may be multiplied during the period of passage; therefore, the group multiplication number of culture is greater than the number of passages. The cell expansion (that is, group multiplication number) during the period between passages depends on many factors, including but not limited to the time between inoculation density, matrix, culture medium and passage.

[0373] In one embodiment, cells can be cultured for several hours (about 3 hours) to about 14 days or any integer value of hours therebetween. Conditions suitable for T cell culture include appropriate culture medium (e.g., minimal essential medium or RPMI culture medium 1640 or X-vivo 15, (Lonza)), which may include factors necessary for proliferation and survival, including serum (e.g., fetal bovine serum or human serum), interleukin-2 (IL-2), insulin, IFN-γ, IL-4, IL-7, GM-CSF, IL-10, IL-12, IL-15, TGFβ, and TNF-α, or any other additives known to the technician for cell growth. Other additives for cell growth include, but are not limited to, surfactants, human plasma protein powder (plasmanate) and reducing agents such as N-acetylcysteine ​​and 2-mercaptoethanol. The culture medium may include RPMI 1640, AIM-V, DMEM, MEM, α-MEM, F-12, X-Vivo 15, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and / or an amount of cytokine(s) sufficient for T cell growth and expansion. Antibiotics, such as penicillin and streptomycin, are included only in experimental cultures and not in cell cultures to be injected into the subject. The target cells are maintained under conditions necessary to support growth, such as an appropriate temperature (e.g., 37° C.) and atmosphere (e.g., air plus 5% CO 2 ).

[0374] The culture medium for culturing T cells may include reagents that can costimulate T cells. For example, the reagent that can stimulate CD3 is an antibody to CD3, and the reagent that can stimulate CD28 is an antibody to CD28. This is because, as shown by the data disclosed herein, the cells separated by the method disclosed herein can be expanded by about 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times, 300 times, 400 times, 500 times, 600 times, 700 times, 800 times, 900 times, 1000 times, 2000 times, 3000 times, 4000 times, 5000 times, 6000 times, 7000 times, 8000 times, 9000 times, 10,000 times, 100,000 times, 1,000,000 times, 10,000,000 times or more. In one embodiment, T cells are expanded in the range of about 20-fold to about 50-fold or more by culturing the electroporated population.

[0375] In one embodiment, the method comprises introducing into expanded T cells a nucleic acid encoding a T cell receptor (TCR) comprising an affinity for a surface antigen on a target cell, and electroporating into the T cells RNA encoding a co-stimulatory molecule, wherein the electroporated T cells are capable of expressing the TCR and the co-stimulatory molecule.

[0376] In another embodiment, the method further includes using at least one co-stimulatory molecule selected from CD3, CD27, CD28, CD83, CD86, CD127, 4-1BB, 4-1BBL, PD1 and PD1L to stimulate the expanded T cells. Stimulation can include co-electroporation with RNA encoding co-stimulatory molecules. In such an embodiment, the expanded T cells are further electroporated or co-electroporated with RNA encoding CD3. CD3 includes at least two different CD3 chains, such as CD3ζ chains and CD3ε chains.

[0377] In another embodiment, the method for expanding T cells may further include separating and expanding T cells for further application. In another embodiment again, the method for expansion may further include electroporation of the T cells expanded subsequently, then culture. Electroporation subsequently may include introducing the nucleic acid encoding reagent into the T cell group expanded, such as T cells expanded by nucleic acid transduction encoding TCR, T cells expanded by transfection or T cells expanded by electroporation, wherein the reagent further stimulates the T cell. Reagent can stimulate T cells, such as by stimulating further expansion, effector function or another T cell function. In one embodiment, reagent nucleic acid and chimeric membrane protein RNA are electroporated together. In another embodiment, reagent nucleic acid, such as TCR RNA is electroporated after cultivating the electroporated group. In a further embodiment, reagent nucleic acid, such as TCR RNA is electroporated into the T cell of refrigerated expansion.

[0378] therapy

[0379] The modified T cells described herein can be included in a composition for treatment. The composition can include a pharmaceutical composition and further include a pharmaceutically acceptable carrier. A pharmaceutical composition comprising a therapeutically effective amount of the modified T cells can be administered.

[0380] In one aspect, the invention includes a method for stimulating a T cell-mediated immune response against a target cell or tissue in a subject, comprising administering to the subject an effective amount of a modified T cell. In this embodiment, the T cell is modified as described elsewhere herein. The modified T cell can be administered to induce lysis of the target cell or tissue, for example, where the induced lysis is antibody-dependent cell-mediated cytotoxicity (ADCC).

[0381] In another aspect, the invention includes a method for adoptive cell transfer therapy comprising administering to a subject in need thereof an effective amount of a pharmaceutical composition comprising the modified T cells described herein to prevent or treat an immune response adverse to the subject.

[0382] In yet another embodiment, a method of treating a disease or condition associated with enhanced immunity in a subject comprises administering to a subject in need thereof an effective amount of a pharmaceutical composition comprising the modified T cells described herein.

[0383] Modified T cells generated as described herein can be consistent and have T cell function. Further, modified T cells can be administered to animals, preferably mammals, and even more preferably humans, to suppress immune responses, such as those common to autoimmune diseases such as diabetes, psoriasis, rheumatoid arthritis, multiple sclerosis, GVHD, enhanced allograft tolerance induction, transplant rejection, etc. In addition, the cells of the present invention can be used for the treatment of any condition, in which a weakened or otherwise suppressed immune response, especially a cell-mediated immune response, is desired for treating or alleviating the disease. In one aspect, the present invention includes treating a condition in a subject, such as an autoimmune disease, comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a modified T cell described herein.

[0384] Examples of autoimmune diseases include, but are not limited to, acquired immunodeficiency syndrome (AIDS, which is a viral disease with an autoimmune component), alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune inner ear disease (AIED), autoimmune lymphoproliferative syndrome (ALPS), autoimmune thrombocytopenic purpura (ATP), Behcet's disease, cardiomyopathy, celiac disease-dermatitis herpetiformis, chronic fatigue immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy (CIPD), scarring pemphigoid, cold agglutinin disease, CREST syndrome, Crohn's disease, Degos' disease, juvenile dermatomyositis, discoid lupus, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, Graves' disease, Guillain-Barre syndrome, Hashimoto's Thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA nephropathy, insulin-dependent diabetes mellitus, juvenile chronic arthritis (Still's disease), juvenile rheumatoid arthritis, Meniere's disease, mixed connective tissue disease, multiple sclerosis, myasthenia gravis, pernicious anemia, polyarthritis nodularis, polychondritis, polyglandular syndrome, polymyalgia rheumatica, polymyositis and dermatomyositis, essential agammaglobulinemia , primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynaud's phenomenon, Reiter's syndrome, rheumatic fever, rheumatoid arthritis, sarcoidosis, scleroderma (progressive systemic sclerosis (PSS), also known as systemic sclerosis (SS)), Sjogren's syndrome, rigid body syndrome, systemic lupus erythematosus, Takayasu's arteritis, temporal arteritis / giant cell arteritis, ulcerative colitis, uveitis, vitiligo, and Wegener's granulomatosis.

[0385] The T cells generated as described herein can also be modified and used to treat inflammatory disorders. Examples of inflammatory disorders include, but are not limited to, chronic and acute inflammatory disorders. Examples of inflammatory disorders include Alzheimer's disease, asthma, atopic allergies, allergic reactions, atherosclerosis, bronchial asthma, eczema, glomerulonephritis, graft-versus-host disease, hemolytic anemia, osteoarthritis, sepsis, apoplexy, tissue and organ transplantation, vasculitis, diabetic retinopathy, and ventilator-induced lung injury.

[0386] In another embodiment, the modified T cells described herein can be used in the manufacture of a medicament for treating an immune response in a subject in need thereof.

[0387] The cells of the present invention can be administered in dosages and routes, and sometimes determined in appropriate preclinical and clinical experiments and trials. The cell composition can be administered multiple times at dosages within these ranges. The administration of the cells of the present invention can be combined with other methods that can be used to treat a desired disease or condition as determined by those skilled in the art.

[0388] The cells of the invention to be administered may be autologous, allogeneic or xenogeneic to the subject undergoing treatment.

[0389] Administration of the cells of the present invention can be carried out in any conventional manner known to those skilled in the art. The cells of the present invention can be administered to a subject by aerosol inhalation, injection, swallowing, infusion, implantation or transplantation. The compositions described herein can be administered to a patient arterially, subcutaneously, intradermally, intratumorally, intranodally, intramedullaryly, intramuscularly, by intravenous (iv) injection, or intraperitoneally. In other cases, the cells of the present invention are directly injected into a site of inflammation in a subject, a localized disease site in a subject, a lymph node, an organ, a tumor, etc.

[0390] Any number of matrices can also be used to administer the cells described herein. The present invention utilizes such matrices - within the new context of acting as artificial lymphoid organs - to support, maintain or regulate the immune system, which is usually regulated by T cells. Therefore, the present invention can utilize those matrix compositions and preparations, which have demonstrated practicality in tissue engineering. Therefore, the type of matrix that can be used for the compositions, devices and methods of the present invention is virtually unlimited and can include both biological and synthetic matrices. In a specific example, the compositions and devices stated by U.S. Patent Nos. 5,980,889; 5,913,998; 5,902,745; 5,843,069; 5,787,900; or 5,626,561 are utilized, as if these patents are incorporated herein by reference in their entirety. The matrix includes features generally associated with: compatibility when applied to a mammalian host. The matrix can be formed of natural and / or synthetic materials. The matrix can be non-biodegradable--when it is desired to leave a permanent structure or a removable structure such as an implant in the body of an animal; or biodegradable. The matrix can be in the form of a sponge, an implant, a pipe, a telfa pad, a fiber, a hollow fiber, a freeze-dried component, a gel, a powder, a porous composition or a nanoparticle. In addition, the matrix can be designed to allow the cell of sustained release inoculation or the cytokine or other activating agent produced. In some embodiments, the matrix of the present invention is flexible and elastic, and can be described as a semisolid support, which is permeable to materials such as inorganic salts, aqueous fluids and gaseous agents comprising the dissolution of oxygen.

[0391] Matrix is ​​used herein as an example of a biocompatible material. However, the present invention is not limited to a matrix, and thus, wherever the term matrix(s) appears, these terms should be interpreted as including devices and other materials that allow cell retention or cell traversal; are biocompatible; and are capable of allowing macromolecules to traverse directly through the material, so that the material itself is a semipermeable membrane or is used in conjunction with a specific semipermeable material.

[0392] Pharmaceutical composition

[0393] The pharmaceutical composition of the present invention may include a modified T cell as described herein, in combination with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such compositions may include buffers such as neutral buffered saline, phosphate buffered saline, etc.; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; proteins; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The composition of the present invention is preferably formulated for intravenous administration.

[0394] The pharmaceutical composition of the present invention can be used in a manner suitable for the disease to be treated (or prevented). The quantity and frequency of use will be determined by factors such as the patient's condition and the type and severity of the patient's disease, but appropriate dosage can be determined by clinical trials.

[0395] When an "immunologically effective amount", "anti-immune response effective amount", "immune response-suppressing effective amount" or "therapeutic amount" is indicated, the exact amount of the composition of the present invention to be administered can be determined by a physician taking into account individual differences in age, weight, immune response, and condition of the patient (subject). It can generally be specified that the pharmaceutical composition comprising the modified T cells described herein can be administered in an amount of 10 4 Up to 10 9 The dosage is preferably 10 cells / kg body weight. 5 Up to 10 6 The T cell compositions may also be administered multiple times at these doses. The cells may be administered using infusion techniques known in immunotherapy (see, e.g., Rosenberg et al., New Eng. J. of Med. 319:1676, 1988). The optimal dosage and treatment regimen for a particular patient may be readily determined by a person skilled in the art of medicine by monitoring the patient for signs of disease and adjusting treatment accordingly.

[0396] In some embodiments, it is desirable to administer activated T cells to a subject, and then redraw blood (or perform apheresis), activate T cells therefrom according to the present invention, and reinject these activated and expanded T cells into the patient. This process can be implemented multiple times every few weeks. In some embodiments, T cells from a blood draw of 10ml to 400ml can be activated. In some embodiments, T cells from a blood draw of 20ml, 30ml, 40ml, 50ml, 60ml, 70ml, 80ml, 90ml or 100ml are activated. Without being bound by theory, certain T cell populations can be selected using this multiple blood draw / multiple re-infusion scheme.

[0397] In certain embodiments of the invention, cells expanded and modified using the methods described herein, or other methods known in the art for expanding T cells to therapeutic levels, are administered to a patient in conjunction with (e.g., before, simultaneously with, or after) any number of related treatment modalities, including, but not limited to, treatment with agents such as antiviral therapy, cidofovir and interleukin-2, cytarabine (also known as ARA-C), or natalizumab treatment for MS patients, or efalizumab treatment for psoriasis patients, or other treatments for PML patients. In further embodiments, the T cells of the invention can be used in combination with chemotherapy, radiation, immunosuppressants such as cyclosporine, azathioprine, methotrexate, mycophenolate and FK506, antibodies, or other immunoablative agents such as CAM PATH, anti-CD3 antibodies or other antibody therapies, cytotoxins, fludarabine, cyclosporine, FK506, rapamycin, mycophenolic acid, steroids, FR901228, cytokines and irradiation. These drugs inhibit the calcium-dependent phosphatase calcineurin (cyclosporine and FK506) or inhibit p70S6 kinase (rapamycin), which is important for growth factor-induced signaling. (Liu et al., Cell 66: 807-815, 1991; Henderson et al., Immun. 73: 316-321, 1991; Bierer et al., Curr. Opin. Immun. 5: 763-773, 1993). In further embodiments, the cell compositions of the invention are administered to a patient in conjunction with (e.g., before, simultaneously with, or after) a bone marrow transplant, T cell ablative therapy using a chemotherapeutic agent such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide, or an antibody such as OKT3 or CAMPATH. In another embodiment, the cell compositions of the invention are administered after B cell ablative therapy, such as an agent reactive with CD20, e.g., rituximab. For example, in one embodiment, a subject may undergo standard treatment with high-dose chemotherapy followed by a peripheral blood stem cell transplant. In certain embodiments, after the transplant, the subject receives an infusion of the expanded immune cells of the invention. In additional embodiments, the expanded cells are administered before or after surgery.

[0398] The dosage of the above treatment applied to the patient will vary with the precise nature of the illness being treated and the recipient of the treatment. The dosage ratio used by people can be carried out according to the practice accepted in the art. For example, the dosage of CAMPATH will generally be in the range of 1 to about 100 mg for adult patients, usually applied every day, for a period between 1 and 30 days. Although in some cases up to 40 mg daily larger dosages (described in U.S. Patent number 6,120,766) can be used, the preferred daily dosage is 1 to 10 mg daily.

[0399] It should be understood that the methods and compositions that will be useful in the present invention are not limited to the specific formulations set forth in the examples. The following examples are set forth in order to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use cells, expansion and culture methods, and methods of treatment of the present invention, and are not intended to limit the scope of the inventors' invention as they regard it.

[0400] Unless otherwise indicated, the practice of the present invention employs conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are well within the knowledge of the skilled artisan. Such techniques are fully described in the following literature, such as, "Molecular Cloning: A Laboratory Manual", Fourth Edition (Sambrook, 2012); "Oligonucleotide Synthesis" (Gait, 1984); "Culture of Animal Cell" (Freshney, 2010); "Methods in Enzymology" "Handbook of Experimental Immunology" (Weir, 1997); "Gene Transfer Vectors for Mammalian Cells" (Miller and Calos, 1987); "Short Protocols in Molecular Biology" (Ausubel, 2002); "Polymerase Chain Reaction: Principles, Applications and Troubleshooting", (Babar, 2011); "Current Protocols in Immunology" (Coligan, 2002). These techniques are applicable to the production of polynucleotides and polypeptides of the invention, and therefore, can be considered in making and practicing the invention. Particularly useful techniques for specific embodiments will be discussed in the following sections.

[0401] Experimental Examples

[0402] The present invention is further described in detail by reference to the following experimental examples. Unless otherwise specified, these examples are provided for illustrative purposes only and are not intended to be restrictive. Thus, the present invention should never be interpreted as being limited to the following examples, but should be interpreted as including any and all changes that become apparent due to the teachings provided herein.

[0403] Without further description, it is believed that using the previous description and the following illustrative examples, one of ordinary skill in the art can make and utilize the compounds of the present invention, and practice the claimed methods. The following working examples therefore specifically point out preferred embodiments of the present invention, and are not to be construed as limiting the remainder of the present disclosure in any way.

[0404] The materials and methods employed in these experiments are now described.

[0405] Primary human lymphocytes. Primary lymphocytes were stimulated with microbeads coated with CD3 and CD28 stimulatory antibodies (Life Technologies, Grand Island, NY, Catalog) as described (Human gene therapy 2011, 22(12): 1575-1586). T cells were cultured at day 10 at 1×10 8 Cells / vial were refrigerated in a solution of 90% fetal bovine serum and 10% dimethyl sulfoxide (DMSO).

[0406] NALM-6 was purchased from the German DSMZ Cell Collection (DSMZ catalog code: ACC 128). K562 and PC3 were purchased from the American Type Culture Collection. The 624mel melanoma cell line was obtained from the Surgery Branch (NCI / NIH). All cell lines were cultured as directed and routinely tested for mycoplasma contamination and confirmed to be negative.

[0407] Generation of TCR constructs for mRNA electroporation and lentiviral transduction Based on sequencing information provided by relevant publications (The Journal of experimental medicine 2005, 201(8):1243-1255; J Immunol 2008, 180(9):6116-6131), 1G4 NY-ESO-1 TCR and CAR (PSCA or CD19) with different mutations (1G4 and 8F) were synthesized and / or amplified by PCR and subcloned into pGEM.64A RNA-based vectors or pTRPE lentiviral vectors.

[0408] Human primary T cell preparation. Primary human CD4 and CD8 T cells were isolated from healthy volunteer donors after leukapheresis by negative selection using the RosetteSep kit (Stem Cell Technologies, Vancouver BC, Canada). All samples were collected under a protocol approved by the University Institutional Review Board, and written informed consent was obtained from each donor.

[0409] Design and construction of CRISPR. Cas9 DNA was synthesized by PCR and then inserted into the PGEM vector. gRNAs were selected by GN19 with an NGG PAM site, while some were selected from N20 with an NGG PAM site. All gRNAs contained complementary sequences consisting of more than 13 base pair mismatches, excluding potential off-target mRNA sites (Table 1). Figure 1A Design gRNA shown in and synthesized by overlapping PCR. All gRNA PCR products were connected to the MSGV vector. In vitro transcribed CAS9 and gRNA target the constant regions of TCRα, β chain and β-2 microglobulin. gRNA is designed to target sequences within exon 1 of the TCRα constant region, a common sequence shared by exon 1 of both TCRβ constant regions 1 and 2, β-2 microglobulin or PD1. The sequences encoding gRNA are assembled using overlapping PCR and cloned into the MSGV vector containing the T7 promoter. These plasmids are linearized using EcoRI. gRNA is transcribed in vitro. Cas9 mRNA is transcribed in vitro using the mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies, Carlsbad, CA). mRNA is stored in nuclease-free vials at -80°C for single use. The gRNA targeting sequences used for animal studies are as follows:

[0410] TRAC-gRNA: TGTGCTAGACATGAGGTCTA, SEQ ID NO:1

[0411] TRBC-gRNA: GCAGTATCTGGAGTCATTGA, SEQ ID NO: 2

[0412] B2M-gRNA: CGCGAGCACAGCTAAGGCCA, SEQ ID NO:3

[0413] PD1-gRNA: GGCGCCCTGGGCCAGTCGTCT, SEQ ID NO:4

[0414] FAS-gRNA: GAGGGTCCAGATGCCCAGCA, SEQ ID NO:5

[0415] Flow cytometry. The following monoclonal antibodies and reagents were used with the indicated specificity and appropriate isotype controls. From BD Biosciences (San Jose, CA): APC-conjugated anti-CD3 (555335), FITC-anti-CD8 (555366), PE-anti-CD8 (555635), FITC-anti-CD27 (555440), PE-anti-CD107 (555801), PE-anti-β-2 microglobin (551337), FITC-anti-HLA (555552); Biolegend (San Diego, CA): FITC-anti-CD45RO (304204), APC-anti-CD62L (304814), APC-anti-CCR7 (353214); and Beckman Coulter (Pasadena, CA): PE-anti-Vb13.1 (IM2021U). Data were acquired on a FACS Accuri (BD Biosciences, San Jose, CA) using CellQuest version 3.3 (BD ​​Biosciences, San Jose, CA) and analyzed by FCS Express version 3.00 (De Novo Software, Los Angeles, CA) or FlowJo version 7.6.1 (Tree Star, Inc. Ashland, OR).

[0416] Propagation of primary T cells. Primary human T cells were cultured in RPMI 1640 supplemented with 10% FCS, 100-U / ml penicillin, 100-g / ml streptomycin sulfate, 10-mM Hepes, and stimulated using magnetic beads coated with anti-CD3 / anti-CD28 at a cell:bead ratio of 1:3. Cell counts and feeding were performed every 2 days, and once T cells appeared to rest (restdown) - as determined by both reduced growth kinetics and cell size, T cells were used for functional assays or refrigerated.

[0417] CD3 neg Generation of T cells. DNA supercoiled plasmids were linearized by SpeI and EcoRI, respectively. TM gRNA was transcribed in vitro using a standard mRNA production system (Cambio, C-MSC100625, Cambridge, England). All mRNAs (Cas9, TCRα, TCRβ, and CAR) were transcribed in vitro using the mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies, AM1345, Carlsbad, CA). T cells were stimulated with CD3 / CD28 immunomagnetic beads for three days before electroporation. Ten million primary T cells were de-beaded before electrotransferring 20μg Cas9, 10μg gRNA species into cells using 360V, 1ms parameters using BTX830, followed by a second and / or third electrotransfer of 10μg gRNA. Moreover, T cells were washed three times with OPTI-MEM and 1-3×10 8 10 million primary T cells were de-beaded before electrotransferring 20 μg of Cas9 and 10 μg of gRNA species into the cells using a BTX830 (Harvard Apparatus BTX) at 360 V and 1 ms; this process was followed by a second and third electrotransfer of 5 μg of gRNA 12 to 24 hours later.

[0418] After electroporation, cells were immediately placed in 2 mL of pre-warmed culture medium and incubated at 37°C, 5% CO 2 or cultured at 32°C, 5% CO 2 Incubate for 1 day at 37°C and 5% CO 2 .

[0419] TCRα and β double destruction or TRAC, TRBC and B2M triple destruction. In order to generate TCRα and β double knockout T cells, Cas9 mRNA and two different gRNAs targeting TCRα chain (TRAC) and TCRβ chain (TRBC) are co-electroporated. TCRα and β double knockout T cells can be purified in 2 steps: 1) after electroporation of 1G4 TCRα chain RNA, anti-CD3 microbeads are used to deplete TCR-positive and α chain single knockout cells, and 2) after electroporation of TCRβ chain RNA, anti-CD3 microbeads are used to deplete TCRβ chain single knockout cells. For TRAC, TRBC and B2M triple destruction, T cells are electroporated with Cas9 mRNA and gRNA targeting TCRα and β chain and β-2 microglobulin 3 days after anti-CD3 / CD28 bead stimulation. HLA-I-negative cell populations are enriched and electroporated with TCRα chain RNA on the 9th day. TCR-negative populations are enriched on the 10th day. Five days later, these cells were electroporated with TCRβ chain RNA, and the TCR-negative cell population was sorted the next day to obtain universal T cells. On day 18, TCR or CAR RNA was electroporated into universal T cells to generate universal effector cells. TCR and HLA-I molecule expression was confirmed at each step.

[0420] Generation of universal CART cells. Universal CART cells were generated by combining lentiviral transduction of CD19 or PSCA CAR with RNA electroporation of CRISPR / gRNA. One day after anti-CD3 / CD28 bead stimulation, T cells were transduced with lentiviral-CD19 or PSCA CAR. Two days later, Cas9 and gRNA targeting TCRα, β chain, B2M, PD1 were transferred into T cells by electroporation. Six days after CRISPR delivery, CD3, HLA-I, PD1-negative T cells were sorted by microbead depletion.

[0421] CD3 neg T cell enrichment. Cells washed with Auto MACS buffer were incubated with CD3 microbeads (Miltenyi Biotec, 130-050-101, Auburn, CA) at 4°C for 30 minutes. After washing twice, cells were passed through an LD column (Miltenyi Biotec, 130-042-901, Auburn, CA), and the flow-through fraction was collected for further use. CD3 neg CD3 expression of T cells was restored by co-electroporation of 1G4TCRα and β mRNA, and cells were expanded using either the rapid expansion protocol (REP), CD3 / CD28 immunomagnetic beads, or K562-based aAPCs.

[0422] CD3 negT cell generation and proliferation. CD3 neg T cells with CD3 expression restored by electrotransfer of exogenous 1G4 TCR α chain and TCR β chain in vitro transcribed mRNA (5 μg of each chain). These cells were expanded using a single rapid expansion protocol (REP). ND052 from three different donors 105×10 6 ND405 83×10 6 ND410 136×10 6 PBMCs were irradiated and then pooled together to obtain a total of 324 × 10 6 PBMC. PBMC was resuspended in a final volume of 90 ml, then R10 was added to 300 ml, mixed, and divided into two T150 ml flasks. OKT was added to a final concentration of 30 ng / ml. On the 2nd day, IL-2 was added to 50 CU / ml. From the 5th day, cell counting and feeding were performed every 2 days, and once the T cells seemed to be dormant-as determined by both reduced growth kinetics and cell size, the T cells were used for functional assays or refrigerated.

[0423] Sanger sequencing. The level of genomic disruption of TCR alpha chain (TRAC), TCR beta chain 1 (TRBC1), and TCR beta chain 2 (TRBC2) in T cells was determined by Surveyor nuclease assay (Transgenomics, Omaha, NE). The percentage of target disruption was quantified by densitometry. The PCR primers used for target locus amplification were:

[0424] TRAC forward, 5'-TCATGTCCTAACCCTGATCCTCTT-3' SEQ ID NO: 6

[0425] TRAC reverse, 5'-TTGGACTTTTCCCAGCTGACAGA-3'SEQ ID NO:7

[0426] TRBC total forward, 5'-TACCAGGACCAGACAGCTCTTAGA-3' SEQ ID NO: 8

[0427] TRBC total reverse, 5'-TCTCACCTAATCTCCTCCAGGCAT-3' SEQ ID NO: 9

[0428] The PCR product was purified and ligated into a TOPO cloning vector (Invitrogen) and then transformed in E. coli. Single clones were picked and sequenced to calculate indels.

[0429] Generation of siRNA and CRISPRi for electroporation. siRNAs targeting α (5'-rArGrGrArGrGrArUrUrCrGrGrArArCrCrCrArUrCrArCrUrGrArC-3' SEQ ID NO: 10 and 5'-rCrArGrUrGrArUrUrGrGrGrUrUrCrCrGrArArUrCrCrUrCCT-3' SEQ ID NO: 11) or β (5'-rArCrCrUrCrCrUrUrCrCrCrArUrUrCrArCrCrCrArCrCrArGrCrUrC-3' SEQ ID NO: 12 and 5'-rGrCrUrGrGrUrGrGrUrGrArArUrGrGrArArGrGrArGGT-3' SEQ ID NO: 13 RNA duplexes of the TCR constant region of NO:13) were synthesized, and siRNAs were synthesized (Integrated DNA Technologies, Coralville, IA). siRNAs for both TCRα and β were mixed and electroporated into stimulated T cells for endogenous TCR knockdown.

[0430] mRNA in vitro transcription and T cell electroporation. The T7 mscript system kit (CellScript) was used to generate in vitro transcribed (IVT) RNA. CD3 / CD28 bead-stimulated T cells were electroporated with IVT RNA using BTX EM830 (Harvard Apparatus BTX) as previously described (Cancer research 2010, 70(22):9053-9061). Briefly, T cells were washed three times and electroporated at 1-3×10 8 Cells were resuspended in OPTI-MEM (Invitrogen) at a final concentration of 10 cells / ml. Subsequently, 0.1 ml of cells were mixed with 10 μg IVT RNA (or as indicated) and electroporated in 2 mm cuvettes.

[0431] ELISA assay. Target cells, different tumor cell lines expressing CD19, were washed and cultured at 1 × 10 6 Cells were suspended in R10 medium (RPMI 1640 supplemented with 10% fetal bovine serum; Invitrogen) at 100 μl per target cell type in duplicate in 96-well round-bottom plates (Corning). Effector T cells were washed and plated at 1×10 6100 μl of T cells were resuspended in R10 medium, and then 100 μl of T cells were combined with target cells in the indicated wells. In addition, wells containing T cells alone were prepared as controls. The plates were incubated at 37° C. for 18 to 20 hours. After incubation, the supernatant was harvested and subjected to ELISA assay (eBioscience).

[0432] CD107a staining. Cells were expressed at a 1:1 ratio of effector cells to T cells (1×10 5 Effector ratio 1×10 5 Target) plate was inoculated in 160 μl of complete RPMI culture medium in 96-well plates. 20 μl of phycoerythrin-labeled anti-CD107a antibody (BD Biosciences, 555801) was added, and the plate was cultivated for 1 hour at 37°C, then Golgi Stop (2 μl Golgi Stop in 3ml RPMI culture medium, 20 μl / well; BD Biosciences, 51-2092KZ) was added and the plate was cultivated for another 2.5 hours. 5 μl FITC-anti-CD8 and 5 μl APC-anti-CD3 were then added and cultivated for 30 min at 37°C. After cultivation, the samples were washed with FACS buffer and analyzed by flow cytometry.

[0433] Luciferase-based CTL assay. Naml6-CBG tumor cells were generated and employed in a modified version of the luciferase-based cytotoxic T lymphocyte assay. Briefly, click beetle green luciferase (CBG) was cloned into the pELNS vector, packaged into lentivirus, transduced into Naml6 tumor cells and sorted for CBG expression. The resulting Naml6-CBG cells were washed and cultured at 1×10 5 Cells / ml were resuspended in R10 medium, and 100 μl of CBG-labeled cells were cultured with T cells of different ratios (e.g., 30:1, 15:1, etc.) at 37°C overnight. 100 μl of the mixture was transferred to a 96-well white ELISA plate. 100 μl of substrate was added to the cells and luminescence was measured immediately. The results were reported as a percentage of killing based on luciferase activity in wells with tumor cells but no T cells (% killing = 100-((RLU from wells with effector and target cell co-culture) / (RLU from wells with target cells) × 100)).

[0434] Mouse xenograft studies. Studies were performed as previously described with some modifications (Human gene therapy 2011, 22(12):1575-1586; Proceedings of the National Academy of Sciences of the United States of America 2009, 106(9):3360-3365). Briefly, 6-10 week old NOD / SCIDγ (NSG) mice were injected subcutaneously on the right flank with 1×10 6 PC3-CBG tumor cells, and the same mice were given SK-OV3-CBG tumor cells (5×10 6 On day 23 after PC3-CBG tumor inoculation, mice were treated with T cells via the tail vein so that the volume of both tumors was approximately 200 mm 3 . Take 1×10 7 cells / mouse (10M) or 3×10 6 In brief, for the Nalm6 tumor model, 6- to 10-week-old NOD / SCIDγ (NSG) mice were injected with 1×10 cells / mouse (3M) via the tail vein on day 0. 6 Click beetle green (CBG)-transduced Nalm6 (Nalm6-CBG) cells. T cell treatment was started on day 7 after tumor inoculation. For the PC3-PDL1 solid tumor model, 6- to 10-week-old NOD / SCIDγ (NSG) mice were injected subcutaneously in the right flank on day 0 with 1×10 6 PC3 tumor cells transduced with PSCA, PD-L1, and CBG (PC3-PSCA-PDL1-CBG) were injected into the mice. Mice were treated with T cells via the tail vein on day 22 after PC3-PDL1-CBG tumor inoculation so that the volume of the tumor was approximately 200 mm 3 . With 2×10 6 T cells were administered at 100 μg / mouse (2 M). Animals were randomized and divided into groups based on baseline tumor size. All animals were included in the experiment, and blinded tumor evaluation was completed for all animal experiments performed.

[0435] T cell stimulation, lentiviral transduction, and CRISPR electroporation procedures. Fig.84 The procedures for stimulation, lentiviral transduction, and CRISPR electroporation of T cells are shown. On day 0, T cells (100 × 10 6 cells / donor). Cells were stimulated with anti-CD3 / anti-CD28 beads at a T cell:bead ratio of 1:3. The cell concentration was adjusted to 0.5×106 On day 1, stimulated T cells were transduced with CD19 CAR lentivirus at a multiplicity of infection (MOI) of 2. 50 mL (25×10 6 T cells (10 mL, 50 × 10 cells) were retained as unmodified T cells (Group 9). On day 3, beads were removed, cells were washed twice in Opti-MEM medium, and transduced T cells from each donor were divided into two groups, CART / blank control EP (10 mL, 50 × 10 6 / mL) and CART / CRISPR (10mL, 50×10 6 The cells were then electroporated with CAS9 RNA at 500 V / 1 ms and 120 μg of CAS9 RNA / 400 μL of T cells (first EP). After electroporation, cells in groups 1, 3, 5, and 7 were then split by culturing T cells in half new medium and half old medium (cultured medium). On day 4, cells were washed twice and cultured at 50×10 6 20 μg TRBC4 and B2Mg RNA were electroporated into 400 μL T cells. After electroporation, cells were cultured at 1×10 6 The cells were cultured in half new medium and half old medium. On days 5 and 7, the cells were split and resuspended in half new medium and half old medium. On day 8, CD3+ cells were removed from groups 2, 4, and 6 via a low-density column. CD3- T cells were cultured at 0.5-1×10 6 The cells were resuspended in half new medium and half old medium and cultured to expand the cells. On day 11, T cells were harvested and 25×10 5 The remaining cells were aliquoted and frozen.

[0436] The results of the experiments are now described.

[0437] Example 1: Using CRISPR to disrupt the TCR-CD3 complex on T cells.

[0438] Thirteen gRNAs targeting the constant region of the TCR α chain, 10 gRNAs targeting the constant region of the TCR β chain, and 10 gRNAs targeting the β-2 microglobin gene were developed. Figures 1A-1C and Figures 9A-9D) and tested in 293T cells. Primary human T cells were propagated ex vivo for three days - using anti-CD3 / anti-CD28 immunomagnetic beads for three days. Since transient expression of CRISPR is sufficient to mediate gene knockout, a "hit-and-run" delivery strategy was developed to transiently express CRISPR by electrotransfer of in vitro transcribed RNA encoding CAS9 and gRNA ( Figure 2C ).

[0439] To measure TCR expression, a mAb specific for CD3 was used, which is only present on the cell surface when the TCR antibody is expressed. Six days after electrotransfer, flow cytometric analysis revealed that CRISPR targeting TRBC eliminated CD3 expression on primary T cells at a level of 13.7 in donor ND147 ( Figure 2D The efficiency of TCR knockout is correlated with the amount of mRNA electrotransferred ( Figure 2D ). Although electrotransfer of RNA in primary T cells was well tolerated, a slight decrease in cell viability associated with increasing amounts of introduced RNA was observed. ZFN and TALEN-mediated gene disruption have been reported to be more efficient when cells were transiently exposed to mild hypothermia. The same phenomenon was also observed using this CRISPR system.

[0440] T cells were cultured at 32°C for 1 day after electrotransfer. CRISPR-mediated destruction of CD3 was up to 2.5 times better when electroporated T cells were cultured at 32°C vs. 37°C. Using this approach, 5.43% and 16.7% of electroporated T cells lost expression of CD3 using CRISPR targeting TRAC and TRBC, respectively. Figure 2D , lower panel). No changes in the levels of CD3 negative cells in the CAS9 blank control samples were observed, and no detectable decrease in viability (measured by trypan blue) was observed.

[0441] When gRNA was electrotransferred a second and third time, the efficiency of eliminating CD3 expression on primary T cells at certain levels was greatly improved.

[0442] · Targeted TRAC: At a level of 77% after three electrotransfers of gRNA ( Figure 4A ),

[0443] Targeting TRAC or TRBC: After the second electrotransfer of gRNA with slightly reduced viability, the viability of the gRNA increased to 64.5% or 57.5%, respectively ( Figure 4C ).

[0444] To confirm that electroporated T cells had been genetically modified at the intended gRNA target site (TCRα or β locus), Sanger sequencing was performed using specific oligonucleotide primers flanking the target site within TRAC, TRBC1, or TRBC2. Multiple peaks at the indicated PCR products starting from the target site were present only after CRISPR electrotransfer, and the percentage of disruption correlated with the loss of cell surface CD3 expression ( Figure 1C and 3B ). These experiments in primary T cells confirmed that CRISPR designed to target TRAC or TRBC resulted in permanent disruption of αβ TCR expression as assessed by Sanger sequencing and confirmed by flow cytometric analysis of CD3.

[0445] Example 2: Enrichment of TCRαβ-negative T cells.

[0446] For future clinical applications, rapid and robust methods for isolating the source of the TCR-disrupted population could be utilized. To begin addressing this issue, TCR / CD3 was enriched by negative selection using clinically approved paramagnetic beads and depletion columns. neg Using a single depletion step, CD3 neg Group enhancement to over 99% ( Figure 3A ). CD3 neg The population could not be enriched from untransfected control cells. Back-to-back depletion steps resulted in >99% enrichment without skewing CD4 or CD8 T cell subsets ( Figure 3C ). The sequencing results also showed that depletions and insertions were introduced into the TCRα and β loci after CRISPR modification ( Figure 3D ).

[0447] Example 3: Generation of HLA-I Classes by CRISPR neg T cells.

[0448] To test the ability of CRISPR to knock out HLA class I expression from allogeneic T cells, a gRNA targeting β-2 microglobin was designed. The β-2 microglobin locus can be manipulated by CRISPR in 293T cells ( Fig.9A ). Evidence shows that disruption of β-2 microglobin abolishes HLA class I expression on the surface of T cells ( Fig. 9B ).

[0449] IFN-γ greatly increases—approximately 10-fold—the targeting efficiency of beta-2 microglobin in T cells ( Fig. 9C Multiple electroporation of β-2 microglobin gRNA gave a 66% β-2 microglobin negative population ( Fig.11A ).

[0450] For future clinical applications of allogeneic transplantation, rapid and robust methods for isolating the source of the HLA-I class null population will be needed. To begin to address this problem, cells were labeled with PE-anti-β-2 microglobin antibodies and HLA-I class I was enriched by negative selection using clinically approved paramagnetic anti-PE microbeads and depletion columns. neg Using a single depletion step, HLA-I class neg The group was enhanced to over 99%. HLA-I class neg The population could not be enriched from untransfected control cells. Enrichment of HLA-I class by flow cytometry neg Analysis of the HLA class I repertoire in T cells validated the elimination of HLA class I expression from the cell surface. Fig.9D ).

[0451] Example 4: CD3 can be propagated by different methods neg T cells.

[0452] CD3 neg T cells restored CD3 expression after electrotransfer of exogenous 1G4-TCRα and β chain in vitro transcribed mRNA (5 μg each). These cells were expanded as follows: (1) a single rapid expansion protocol (REP) and then tested for activity and specificity. PBMCs were obtained from three different donors: ND052 105×10 6 ND405 83×10 6 ND410 136×10 6 The cells were irradiated and then mixed together to obtain a total of 324 × 10 6 PBMC. 2×10 6 RNA was electroporated into each cell. neg T cells were resuspended in a final volume of 90 ml and R10 culture medium was added for a total volume of 300 ml. The cells were divided into two T150 ml flasks. OKT was added to a final concentration of 30 ng / ml. On the 2nd day, IL-2 was added to 50 CU / ml. From the 5th day, cell counting and feeding were performed every 2 days, and once the T cells seemed to be dormant, as measured by both reduced growth kinetics and cell size, they were used for functional assays or refrigerated.

[0453] After a single REP, CD3 neg T cells were expanded to increase their number 500-fold. These cells were expanded by: (2) stimulation with anti-CD3 / anti-CD28 coated magnetic beads at a 1:3 cell:bead ratio.

[0454] After a single REP, CD3neg T cells were expanded to increase their number 500-fold. These cells were expanded as follows: (3) with 1×10 6 Irradiated K562-CD19 and K562 / 86 / 64 / A2 (2D11) were co-cultured in an equal mixture at a concentration of 2.5 Å / ml.

[0455] After a single REP, CD3 neg T cells were expanded to increase their number 500-fold. These cells were expanded as follows: (4) with 1×10 6 Irradiated K562-CD19 and K562 / 86 / 64 / A2 (2D11) in an equal mixture at a concentration of 2.5447 / ml and 30 ng / ml OKT were co-cultured.

[0456] After a single REP, CD3 neg T cells were expanded to increase their number 500-fold. These cells were expanded as follows: (5) with 1×10 6 Irradiated K562-CD19 and K562 / 86 / 64 / A2 (2D11) in an equal mixture at a concentration of 2.5 % / ml were co-cultured with 1 mg / ml NY-ESO peptide.

[0457] Example 5: Redirecting TCR by electrotransfer of TCR neg T cells.

[0458] To test TCR neg The function of T cells was redirected by electrotransfer of TCR. By introducing TCR α chain and TCR β chain, these cells expressed high levels of TCR. Compared with CAS9 blank control, the expression of Vb13.1 was increased in electrotransferred TCR neg Much higher in T cells ( Fig. 7A When the cells were co-cultured with the Nalm-6 NY-ESO leukemia cell line, which is positive for both HLA-A2 and NY-ESO, the cells showed high levels of 107a, indicating elevated degranulation activity ( Figure 7B Killing assays also showed potent toxicity against this cell line ( Figure 7C ). This indicates that these cells are potentially safer than traditional clinical trials using T cells expressing CAR and TCR, since these cells will not induce GVHD and have less mismatch toxicity than normal T cells treated with TCR.

[0459] Some reports have shown that T cells can be genetically edited by ZFN or TALEN to eliminate the expression of endogenous αβTCR. The methods and compositions described herein for selectively depleting T cells expressing undesired αβTCR also include incomplete knockout of endogenous TCR to treat GVHD and suppress endogenous TCR from adversely affecting CAR function (e.g., by competing transcription factors). Therefore, designer ZFNs are used to design genetic methods to permanently destroy the α and β constant region sequences in T cells, thereby eliminating TCR expression.

[0460] ZFN and TALEN are artificial restriction enzymes generated by fusing a DNA binding domain to a DNA cleavage domain. When ZFN and TALEN do not work efficiently, it is often difficult to determine the cause. Failure may reflect problems with design, accessibility of the target sequence, or delivery issues. At the same time, ZFN targeting efficiency is generally low in T cells, making it difficult to manipulate multiple genes simultaneously.

[0461] Unlike ZFN and TALEN, the CRISPR / Cas system has recently emerged as a potential simple and efficient alternative to ZFN and TALEN for inducing targeted genetic changes. Recent work has shown that target recognition by Cas9 protein requires a 'seed' sequence in crRNA and a protospacer sequence adjacent to a motif (PAM) sequence containing conserved dinucleotides upstream of the crRNA-binding region. Thus, the CRISPR / CAS system can be retargeted to cut almost any DNA sequence by redesigning crRNA. The data disclosed herein show the potential for gene editing by CRISPR / CAS in 293T cells and primary T cells. The CRISPR / CAS system can target multiple genomic loci simultaneously with two or more gRNAs by co-expressing a single CAS9 protein, making this system uniquely suitable for multiple gene editing or synergistic activation of target genes. By applying different gRNAs together with CAS9, a variety of genes can be simultaneously destroyed in T cells.

[0462] Example 6: Triple knockout of HLA class I and TCR α and β chains via CRISPR.

[0463] In order to focus on "off-the-shelf" allogeneic T-cell therapies for malignancies and infectious diseases, cell therapies by infusion of T cells are designed to reconstitute immunity against pathogens and malignancies. The amount of time required to produce T cells with desired properties and sufficient numbers ex vivo is often incompatible with the patient's therapeutic window. In addition, autologous T cells from patients with advanced disease may have impaired function and be tolerant to the desired antigens.

[0464] To address this problem, patients can be infused with allogeneic T cells to avoid immune-mediated rejection by host T cells that recognize different major or minor histocompatibility antigens on the infused cells. To expand the application of T cell therapy, and for further allogeneic transplantation, rapid and robust methods for isolating sources of TCR and HLA-I class-disrupted populations can be generated.

[0465] ZFNs and TALENs include zinc finger DNA-binding domains designed to bind to specific DNA sequences fused to the cleavage domain of the Fok1 endonuclease. Because genes must be targeted individually, the design and construction of ZFNs and TALENs is very complex and time-consuming if there is more than one gene to be manipulated. Using the CRISPR system described herein, the efficacy and shortened time course of gene disruption can be obtained.

[0466] To address this issue, CAS9 was electrotransferred together with three different gRNAs targeting TRAC, TRBC, and β-2 microglobin. Cells were labeled with PE-anti-β-2 microglobin antibody and HLA class I was enriched by negative selection using clinically approved paramagnetic anti-PE microbeads and depletion columns. neg Using a single depletion step, HLA-I class neg The group is enhanced to more than 99% ( Fig.9D ). Then, the cells are reintroduced with TCRα chains and HLA-I class neg CD3 neg The population was enriched by microbeads (Figure 11). Five days later, TCRβ chains were reintroduced into the cells and HLA-I class neg CD3 neg The population was enriched again by microbeads. Two days later, TCRs were electrotransferred into these triple knockout cells. One day after electroporation, cells were stimulated using CD3 / CD28 immunomagnetic beads. The cells then underwent lentiviral delivery of antigen-specific TCRs and culture expansion the next day.

[0467] Example 7: Knockout of FAS, PD1, CTLA4, and PPP2R2D via CRISPR.

[0468] The FAS receptor / FAS ligand (FAS / FASL) apoptosis signaling pathway has been extensively studied and well characterized in T cells. PD1 and CTLA4 are two major inhibitory signaling pathways in T cells that have also been widely studied. Direct evidence of the potential therapeutic effects of targeting these pathways comes from studies in preclinical mouse tumor models, which show enhanced anti-tumor immunity after blocking of antibody-mediated CTLA-4, PD-1 or PD-L1. Similar antibodies for humans have been developed, and early clinical data show promising results. Ppp2r2d knockdown can also inhibit T cell apoptosis and enhance T cell proliferation, as well as cytokine production. Ppp2r2d has the potential to improve human T cell function as a target.

[0469] To address this issue, CAS9 and three different gRNAs targeting FAS, PD1, CTLA4, and PPP2r2d were electrotransferred into T cells. Sanger sequencing data showed that the indicated loci of FAS, PD1, CTLA4, and PPP2r2d had been modified by CRISPR. FAS was also replaced by GFP using homologous recombination initiated by CRISPR. FACS data showed that the surface expression of FAS and PD1 was abolished.

[0470] Example 8: Generation of IPS cells using genetically modified primary cells and T cells.

[0471] The progress of adoptive T cell therapy for cancer and infectious diseases is hampered by the lack of readily available and antigen-specific human T lymphocytes. Pluripotent stem cells can provide an unlimited source of T lymphocytes. To address this problem, the expression of FAS, PD1, CTLA4, PPP2r2d is disrupted in primary cells and T cells.

[0472] Sendai virus is used to reprogram primary cells and T cells. There are multiple methods to generate iPSC, including virus-mediated gene transduction and chemical induction. Although lentiviral and retroviral vectors need to be integrated into the host chromosome to express reprogramming genes, DNA-based vectors, such as adenovirus, adeno-associated virus and plasmid vectors, exist episomally and do not need to be integrated. However, they can still be integrated into the host chromosome at certain frequencies, and the reprogramming efficiency is relatively low. Similarly, mRNA-based reprogramming is complex and shows to be extremely inefficient.

[0473] Unlike these methods, Sendai virus does not integrate into the host genome or alter the genetic information of the host cell.Sendai virus also has a reprogramming potential comparable to lentiviral and retroviral-based gene transduction.

[0474] Each well of a 24-well plate was inoculated with 100,000 wild-type, FASneg 、CD3 neg TCR α chain and TCR β chain knockout T cells.Cells are stimulated using CD3 / CD28 beads.On the 3rd day after stimulation, beads are removed, cells are resuspended in 1mL of preheated T cell complete medium, and then the CytoTune Sendai virus of calculated volume, which includes a polycistronic vector (Lifetechnologies, Carlsbad, CA) for expressing hKlf4, hOct3 / 4 and hSox2 in cells, is cultivated.The T cells processed are inoculated in 24-well plates and centrifuged at room temperature for 90 minutes at 2250rpm.Another 1mL of complete T cell culture medium is added to each well, and the flat plate is cultivated overnight at 37°C in a humid atmosphere of 5% CO2.

[0475] The next day after transduction, Sendai virus was removed by washing T cells and culturing cells for 2 days using fresh complete culture medium. Half of the culture medium was changed every day. On the 3rd day after infection, cells were transferred to MEF feeder plates and cultured in T cell culture medium without any cytokines. Four days after infection, cells were cultured in standard hES culture medium. Culture medium was changed every day. ES sample colonies were observed around the 7th day. Cells were cultured in conditional hES culture medium from the 15th day and culture continued for another 10 days. Colonies were picked around 25 to 30 days after transduction.

[0476] Around day 4, cell clumps formed on the feeder cells, indicating the start of the reprogramming process. T cells undergo dramatic morphological changes during the process of reprogramming to iPSCs. Around day 12, large cell clumps with loose edges begin to appear. Around day 18, T cells are transformed into typical ES-like colonies with well-defined edges. Typical embryonic stem cell morphology is observed, indicating FAS neg 、CD3 neg TCRα and TCRβ knockout T cells were induced to a pluripotent state under defined reprogramming conditions ( Fig.17A and 18A ).

[0477] FAS neg T cells are more easily reprogrammed into iPSCs (about 5 times more efficiently than their wild-type counterparts). Fig. 17B ). Similarly, reprogramming CD3 neg T cells are approximately 5-fold more efficient than their wild-type counterparts ( Fig.18B). p53-deficient cell lines have been reported to be more susceptible to reprogramming due to the obstruction of the apoptotic pathway. FAS knockout further induces apoptosis resistance. Although the loss of TCR expression makes T cells less healthy, it indicates that apoptosis plays an important role in the reprogramming process.

[0478] Example 9: Knockdown of TCR in T cells using siRNA.

[0479] Fig.19 is a graph showing IFN-γ production by wild-type NY-ESO-1 TCR (wt) or modified NY-ESO-1 TCR with a second disulfide bond and de-N-glycosylation of the β chain (S / SD). RNA was electroporated into T cells with endogenous T cell receptor (TCR) knocked down using siRNA. IFN-γ was detected by ELISA 18 h after stimulation of T cells using an HLA-A2 positive cell line pulsed with NY-ESO-1 specific peptide p156-165.

[0480] Figure 20, including Fig. 20A and 20B , shows TCRα knockdown by co-electroporation of CAS9 RNA and gRNA. Six days after electroporation, cells were analyzed for TCR expression by evaluating CD3.

[0481] Fig.21 Sanger sequencing is shown. The results show multiple peaks in CD3-negative enriched T cells, where CAS9 mRNA and gRNA were electroporated to knock down TCRα (TRAC-5) or TCRβ (TRBC-7).

[0482] Fig. 22 The is a panel showing that CD3 negative T cells with endogenous TCRβ (TRB-7) knockdown re-expressed CD3 four hours after NY-ESO-1 TCRα and β (1G4LY95 TCR) RNA electroporation. Normal T cells (ND424 beads) were used as a control, which showed almost 100% CD3 positivity with 5.25% endogenous TCR vb13.1 expression.

[0483] Figure 23, including Figures 23A-23D , is a set of graphs showing that knocking down endogenous TCR enhances both transgene expression and function of T cells electroporated with TCR RNA. Fig.23A Shown are TCR expression of T cells electroporated with TCR siRNA (solid open bars), control siRNA (dashed open bars), and T cells without any siRNA (solid bars). Fig. 23BTransgene (TCR vb13.1) expression of T cells electroporated with wild-type NY-ESO-1 TCR (wt) or modified TCR (SD) RNA with TCR siRNA, control siRNA, or without siRNA is shown. Fig.23C Shown are NY-ESO-1 tetramer staining of T cells electroporated with wild-type NY-ESO-1 TCR (wt) or modified TCR (SD) RNA with TCR siRNA, control siRNA, or without siRNA. Fig.23D Specific lysis of HLA-A2 / NY-ESO-1 positive tumor lines knocked down by TCR siRNA and electroporated with wild-type NY-ESO-1 TCR RNA is shown.

[0484] Fig.24 is a graph showing the fluorescence of tumor cells after T cells were injected into a mouse model. Ten million Nalm6-CBG-ESO-GFP (click beetle green) tumor cells expressing both NY-ESO-1 and GFP were injected intravenously into NOD / SCID mice. Five days after tumor inoculation, T cells transduced with CBR (click beetle green) and electroporated with RNA were injected as indicated in the different groups, and tumor growth was monitored by bioluminescent images (BLI).

[0485] Fig.25 Shown are bioluminescent images of mice from two groups that had been treated with CD19BBZ CAR RNA T cells or modified NY-ESO-1 TCR RNA at different time points.

[0486] Example 10: Universal CAR19 T cells generated using CRISPR through a combination of lentiviral transduction and disruption of the TCR-CD3 complex on T cells.

[0487] like Fig.26 As shown in , primary T cells were stimulated with anti-CD3 / anti-CD28 beads on day 0 and then transduced with lentiviral-CAR19. More than 70% of the cells were CAR19 positive as detected by flow cytometry. Since transient expression of CRISPR is sufficient to mediate gene knockout, a "hit-and-run" delivery strategy was developed to transiently express CRISPR on day 3 by electrotransfer of in vitro transcribed RNA encoding CAS9 and gRNA targeting the constant region of the TCR α chain, TCR β chain, and β-2 microglobulin gene ( Figure 2C ). T cells were cultured at 32°C for 24 h after electrotransfer and then returned to normal conditions.

[0488] To measure TCR expression, a monoclonal antibody specific for CD3 was used. CD3 was selected because it is only present on the cell surface when the TCR is expressed. The CRISPR construct was electroporated into primary T cells ( Fig.26 TCR single negative and TCR / HLA-A double negative cells were expanded by exposure to CD19-presenting K562 cells, which resulted in a >100-fold expansion ( Fig. 27 ).

[0489] After expansion, cells remained TCR single negative or TCR / HLA-A double negative, and the CAR19 positive population was enriched. After expansion stimulated by K562-CD19, endogenous TCR expression remained negative in TCR single negative cells, while TCR and HLA-A expression remained negative in TCR / HLA-A double negative T cells ( Fig.28A CAR19-positive cells were enriched by expansion stimulated by K562-CD19 ( Fig.28B ).

[0490] Most of the expanded universal T cells were CD45RO positive ( Fig.29A ) and retained high levels of CD62L expression ( Fig.29B ), moderate level of CD28 expression ( Fig.29A ) and low levels of CCR7 expression ( Fig.29B ).

[0491] CRISPR gene editing does not affect the in vitro anti-tumor activity of universal CAR19 T cells ( Fig. 30A Depletion of TCR or TCR / HLA-A had minimal effect on CAR19 expression and anti-tumor activity ( Fig. 30B and 30C When challenged with Nalm6 tumor cells, TCR single negative and TCR / HLA-A double negative CAR19 T showed robust lysis ability ( Fig. 30B CD107a release and cytokine secretion also showed potent antitumor activity in universal cells ( Fig. 30C ). After challenge with cells expressing CD19, TCR single ablation or TCR and HLA-A double ablation CAR19 T cells showed similar proliferation kinetics ( Fig.30D ).

[0492] To test the anti-tumor activity of CRISPR / CAS9-edited CAR19 T cells, TCR single negative, TCR and HLA-A double negative CAR19 T were infused into NSG mice bearing Nalm6 tumor cells. All mice receiving unmanipulated T cells and mice infused with wild-type T cells transduced with lentiviral GFP died within 3 weeks after tumor cell infusion. For mice receiving CAR19T cells, regression of target tumors was observed (Figure 6). It was found that CRISPR / CAS9 did not affect the in vivo tumor killing activity of CAR19 T cells, thus confirming the advantages of combining lentiviral gene transfer with CRISPR / CAS9 for T cell therapy.

[0493] When cells were challenged with HLA-mismatched tumor cell lines, complete ablation of TCRα and β chains and HLA-A molecules on T cells completely abolished nonspecific killing ( Fig.32A ). After long-term co-culture (5 days), NK cells activated by HLA-A molecules were eliminated. No off-target activity was observed when these cells were attacked by allogeneic whole blood PBMC for 24 hours in the IFNr Elispot assay. The lack of off-target activity indicates that T cells can play a major role in acute immune responses after encountering allogeneic cells. All results indicate that TCRα and β chains and HLA-A molecules (triple negative) T cells edited by CRISPR / CAS9 can serve as a source of universal effector donor cells.

[0494] CAS9 and different gRNAs targeting FAS were electrotransferred into T cells. FASneg cells were sorted and then transduced with lentiviral CAR19. Flow cytometry and Sanger sequencing data showed that FAS had been modified by CRISPR ( Fig.33 ). CAR19 gene expression of FASneg T cells was comparable to wild-type. Even after a short period of incubation with Nalm6 tumor cells, CD107a expression was greatly enhanced in FASneg CAR19 T cells compared to wild-type counterparts even within 4 hours of co-culture.

[0495] Some reports show that even weak antigen stimulation can trigger FAS activation to promote T cell proliferation (Rethi, et al., Blood, vol. 112 (4): 1195-1204, 2008). Interestingly, when cells were stimulated by high levels of CD19+K562 cells, FASneg CAR19 T cells expanded much faster than wild-type CAR19 T cells. This suggests that FAS / FASL triggers apoptosis rather than activation under high levels of antigen ( Fig.34A ). FASneg CAR19 T cells further showed reduced levels of apoptosis, as measured by Annexin V staining ( Fig.34B ).

[0496] As already observed in vitro, FASneg T cells showed enhanced proliferation compared to wild-type T cells. Similar proliferation results were observed when the True Count assay of CAR19 T cells was performed after the cells were infused into mice bearing Nalm6. When compared to the wild-type group, the FASneg CAR19 group exhibited superior antitumor activity ( Fig.35B ). This difference is illustrated in Fig.35C , which shows the bioluminescence data between those two groups. These data indicate that FAS ablation in CAR T cells enhances their anti-tumor activity.

[0497] CAS9 and different gRNAs targeting PD1 were electroporated into T cells after lentiviral transduction with PSCA-CAR. PD1 knockout cells were confirmed by surface PD1 expression after CD3 / CD28 bead stimulation ( Fig.36 ). PD1 negative cells were enriched by microbead depletion and then stimulated with PSCA antigen presenting PC3 tumor cells. PSCA-CAR positive cells were enriched in both wild-type and PD1 negative groups. After incubation with PC3-PSCA-PDL1 tumor cells, PD1 expression was rapidly upregulated on the surface of wild-type PSCA-CAR T cells, and very low levels of PD1 expression were detected on PD1 negative PSCA-CAR T cells ( Fig.37 PD1-negative PSCA-CAR T cells also showed greatly enhanced and sustained high levels of CD137 expression ( Fig.37 ) - a marker of T cell activation, which indicates that the PD1 / PDL1 inhibitory signaling pathway is blocked.

[0498] When tested in the in vivo PC3-PSCA-PDL1 NSG model, significantly enhanced antitumor activity was detected in the PD1-negative PSCA-CAR T cell group compared with the wild-type group ( Fig.38A and 38B ), which suggests the therapeutic value of PD1 ablation for CAR T cell therapy.

[0499] To test the graft-versus-host disease (GVHD) effects of CRISPR-engineered universal CAR T cells, high T cell doses were given to NSG mice with Nalm6 leukemia. Mice were treated with double-knockout or triple-knockout CAR T cells and did not show any signs of developing GVHD. In contrast, 3 of 4 mice from the wild-type CD19 CAR T group developed GVHD by day 65, which was confirmed by histological examination of different organs ( Fig.39 ).

[0500] In another experiment, cells were resuspended in FBS and infused intravenously into mice after sublethal irradiation. Clinical GVHD was monitored 2 to 3 times per week. During the 60-day study, four of the five mice receiving wild-type T cells died, while the PBS-treated group, the TCR single ablation and the TCR / HLA-I double ablation T cell-treated group did not show any signs of GVHD. Mice receiving wild-type T cells experienced weight loss. However, the PBS-treated group, the TCR single ablation or the TCR / HLA-I double ablation T cell-treated group slightly increased weight during the study ( Fig.40A and 40B ).

[0501] After lentiviral CD19-CAR transduction, T cells were treated with Cas9 and gRNA targeting CD3, B2M, and PD1 or Fas. Triple knockout universal CAR T cells were injected into mice bearing Nalm6-PDL1 tumors. Superior antitumor activity was observed in mice receiving PD1 / CD3 / HLA-I triple knockout cells compared with CD3 / HLA-I double knockout cells, further indicating the therapeutic value of blocking the PD1 signaling pathway ( Fig.41A and 41B ). These data provide a means to enhance universal CAR T cell therapy using CRISPR / Cas9.

[0502] Since gRNA is prone to degradation, a simplified one-step method was developed to generate universal CAR T cells. gRNA together with CAR were constitutively expressed in a single lentiviral vector. One day after stimulation with CD3 / CD28 immunomagnetic beads, naive T cells were transduced with lentivirus encoding gRNA and CAR. Cells were electroporated with Cas9 mRNA ( Fig.42 This system allows the manipulation of multiple genes using one vector ( Fig.42 CD3 expression was confirmed by flow cytometry on day 6. T cells treated with the one-step system showed up to 90% consistent gene ablation in each of the different Cas9 mRNA groups ( Fig.43 ).

[0503] The progress of adoptive T cell therapy for cancer and infectious diseases has been hampered by the lack of readily available antigen-specific human T lymphocytes. Pluripotent stem cells can provide an unlimited source of T lymphocytes. To address this problem, the expression of FAS, PD1, CTLA4 and PPP2r2d is disrupted in primary cells and T cells.

[0504] Sendai virus is used to reprogram primary cells and T cells. There are a variety of methods that can be used to generate iPSC, including virus-mediated gene transduction and chemical induction. Although lentiviral and retroviral vectors need to be integrated into the host chromosome to express reprogramming genes, DNA-based vectors, such as adenovirus, adeno-associated virus and plasmid vectors, exist free and do not need to be integrated, however, they can still be integrated into the host chromosome at some frequency, and the reprogramming efficiency is relatively low. Similarly, mRNA-based reprogramming is complex and has been shown to be extremely inefficient.

[0505] In contrast, Sendai virus does not integrate into the host genome or alter the genetic information of host cells.Sendai virus also has a reprogramming potential comparable to lentiviral and retroviral-based gene transduction.

[0506] Each well in a 24-well plate was inoculated with 100,000 wild-type, FASneg, CD3neg TCRα and β-chain knockout T cells. Cells were stimulated using CD3 / CD28 beads. On the 3rd day after stimulation, beads were removed, cells were resuspended in 1 mL of preheated T cell complete medium, and then the calculated volume of CytoTune Sendai virus, which includes a polycistronic vector (Lifetechnologies, Carlsbad, CA) for expressing hKlf4, hOct3 / 4 and hSox2 in cells, was cultivated. The treated T cells were inoculated in 24-well plates and centrifuged at 2250 rpm for 90 minutes at room temperature. Another 1 mL of complete T cell culture medium was added to each well, and the plate was cultivated overnight at 37 ° C in a humid atmosphere of 5% CO2.

[0507] The next day after transduction, Sendai virus was removed by washing T cells and culturing cells for 2 days using fresh complete medium. Half of the medium was replaced every day. On the 3rd day after infection, cells were transferred to MEF feeding plates and cultured in T cell medium without any cytokines. Four days after infection, cells were cultured in standard hES medium. The medium was replaced every day. ES-like colonies were observed around the 7th day. Cells were cultured in conditional hES medium from the 15th day and culture continued for another 10 days. Colonies were picked around 25 to 30 days after transduction.

[0508] Around day 4, cell clusters formed on the feeder cells, indicating the initiation of the reprogramming process. T cells undergo dramatic morphological changes during the reprogramming process to iPSCs ( Fig.44A Around day 12, large cell clusters with loose edges began to appear. Around day 18, T cells were transformed into typical ES-like colonies with well-defined edges. FASneg T cells were reprogrammed into iPSCs with approximately 5 times the efficiency of their wild-type counterparts ( Fig.44B ). p53-deficient cell lines have been reported to be more susceptible to reprogramming due to the blockade of the apoptotic pathway. FAS knockout may promote the reprogramming process using a similar mechanism.

[0509] ES-like morphology was observed in iPSCs reprogrammed by CD3neg TCRα or β chain knockout T cells ( Fig.45A This morphology remained constant after several passages. Reprogramming of CD3neg T cells was approximately 5-fold less efficient than that of their wild-type counterparts ( Fig.45B ), suggesting that TCR knockout could play a role in T cell reprogramming or affect cell viability after Sendai virus infection. Fig.45C is a panel of images showing phosphatase staining of CD3neg iPSC cells.

[0510] Typical embryonic stem cell morphology was observed, indicating that FASneg, CD3neg TCRα and β chain knockout T cells were induced to a pluripotent state under defined reprogramming conditions. Although loss of TCR expression renders T cells less healthy, the data described herein suggest that apoptosis plays an important role in the reprogramming process.

[0511] Induction of endogenous pluripotent stem cell genes was also detected in different T-iPSC cell lines ( Fig.46 Immunostaining for Tra-1-60 and SSEA4 expression further indicated the stem cell phenotype of T-iPSC cells ( Fig.47A ). Fas knockout in T-iPSCs was confirmed by Sanger sequencing ( Fig.47B ).

[0512] dCas9 and FokI-Cas9 have been reported to have less off-target activity. T cells were evaluated if they could be edited by improved versions of the CRISPR / dCAS9 and CRISPR / FokI-Cas9 systems ( Fig.48A ). Flow cytometry data showed that primary T cells were edited by both CRISPR / dCAS9 and CRISPR / FokI-CAS9 ( Fig.48B ). The CRISPR / dCAS9 gene knockout system exhibits enhanced specificity using at least one pair of gRNAs, which renders the knockout event more precise and specific.

[0513] To test for off-target events of CRISPR / CAS9 in T cells, a surveyor assay was performed at the off-target sites. For the genes tested, no significant cleavage was observed at the genomic locus ( Fig.48C ).

[0514] Example 11: Multiplex genome editing.

[0515] CAR T cells are generated by destroying multiple genomic loci simultaneously using the CRISPR / Cas9 system.CART cells lack the expression of endogenous TCR and HLA class I (HLA-I) molecules, so as to be used as allogeneic universal CAR T cells.MRNA encoding Cas9 and gRNA targeting these genes are co-electroporated to efficiently destroy T cell receptor (TCR) α chain, TCR β chain and β-2 microglobulin (B2M) genes.Car and CRISPR RNA electroporation are delivered by combining lentivirus (LV) to simultaneously destroy endogenous TCR and B2M genes to generate universal TCR or CAR T cells.In addition, the destruction of endogenous PD1 enhances the efficacy of CAR therapy in solid tumor models.

[0516] Multiplexed delivery of gRNA disrupts genes in human primary T cells with high efficiency without compromising effector function

[0517] Generating universal T cells lacking TCR, HLA, and other genes requires efficient multiplex genome editing. CRISPR / gRNA RNA electroporation is optimized to achieve efficient gene disruption in T cells. First, Cas9 and gRNA are co-electroporated with RNA generated using an in vitro transcription system ( Fig.49 , left), and developed a “hit-and-run” delivery strategy to transiently deliver CAS9 mRNA and gRNA to T cells via electroporation ( Fig.49 ,right).

[0518] Initial experiments using single electroporation targeting the TCR α constant region (TRAC) or β constant region (TRBC) resulted in 1% to 3% CD3-negative (CD3 neg )T cells( Fig.50A , upper panel). To determine whether transient exposure to mild hypothermia resulted in more efficient gene disruption, cells were edited at 37°C or 32°C. When T cells were cultured at 32°C for 24 h after Cas9 / gRNA co-electroporation, CRISPR-mediated disruption of TRAC and TRB increased up to 4-fold ( Fig.50A , lower figure). The optimal molecular ratio of Cas9:gRNA for maximum disruption efficiency is 1:1 to 2:1, and gene disruption efficiency is correlated with the amount of mRNA transferred by electroporation ( Fig.51A ).

[0519] Compared to mRNA, gRNA is more prone to rapid degradation, which potentially limits targeting efficiency. Therefore, multiple sequential electroporations of gRNA were tested after the initial Cas9 / gRNA electroporation. There was a significant increase in disruption frequency at the protein level, as 82.4% of cells were CD3+ after the third gRNA electroporation.neg ( Fig.50B ). Clonal sequencing showed that the genome targeting efficiency reached 89.4% after the third gRNA electroporation ( Fig.51B After the third electroporation of gRNA, the surveyor assay confirmed cleavage rates of 81.7% and 49.3% at the genomic loci of TRAC and TRBC, respectively ( Fig.52 Multiple peaks in the Sanger sequencing data flanking the TRAC and TRBC target sites confirm that the genomic reading frame is shifted downstream of the target site ( Fig.53A The occurrence of insertions or deletions (indels) caused by CRISPR / Cas9-mediated NHEJ was confirmed by clone sequencing ( Fig.53B ). TCR / CD3 disrupted by TCR neg The population was enriched to over 99% (99.70 ± 0.20%) by a single step of CD3 negative selection ( Fig.54 ).

[0520] To develop and expand TCR / CD3 neg T cell approach, TCR / CD3 neg T cells were co-electroporated with HLA-A2-restricted 1G4 NY-ESO-1 TCR (α+β) RNA to restore CD3 expression ( Fig.55 , left). Comparisons were made following T cell stimulation / expansion methods: 1) Rapid T cell expansion protocol (REP) using PBMCs as feeder cells, 2) anti-CD3 / CD28 immunomagnetic beads (beads), or 3) OKT3-loaded K562-based artificial antigen-presenting cells (K562 aAPCs) expressing ligands for CD28 and 4-1BB. TCR / CD3 neg T cells were also electroporated with CD19 CAR RNA ( Fig.55 , right) and then stimulated by irradiated K562 aAPC expressing CD19 (K562-CD19). After a single stimulation for 10 days, expansion fold values ​​of 751.0±217.1, 35.7±9.3, 46.3±8.5, and 57.5±5.0 were achieved for REP, beads, K562 aAPC, and K562-CD19, respectively ( Fig.56 ).

[0521] To test whether CRISPR / Cas9 gene editing would affect the phenotype and function of T cells, we examined TCR / CD3 neg The phenotype of T cells was analyzed and it was shown that all expanded cells remained CD3 negative and the majority retained high levels of CD27 (79.8% to 93.4%), which is consistent with a central memory cell phenotype ( Fig.57 ). Expanded TCR / CD3 neg T cells were electroporated a second time with CD19 CAR mRNA to test their anti-tumor activity. neg The surface CAR expression of T cells was equal to that of the control group ( Fig.58 ). When TCR / CD3 neg CD19 CAR T cells use CD19 + When Nalm6 leukemia cells are stimulated, CD19 CAR + TCR / CD3 neg CD107a upregulation on T cells ( Fig.59A ), cytokine secretion ( Fig.59C ) and killing activity ( Fig.59B ) were equivalent to those of wild-type control cells. CD19CAR TCR / CD3 neg T cells were infused into Nalm6-bearing NSG mice to test their in vivo antitumor activity. Tumor regression was significant, with efficacy equivalent to that of CART19 wild-type counterparts ( Fig.59D and 59E ). This result indicates that CRISPR / Cas9 editing of endogenous TCR does not adversely affect the function of primary T cells for adoptive immunotherapy.

[0522] Reduced alloreactivity of TCRα, β, and B2M triple-disrupted T cells.

[0523] Both TCRα and β chains need to be destroyed to prevent TCR mismatch-related toxicity in TCR-redirected T cell adoptive immunotherapy, and B2M is essential for the assembly and expression of the HLA-I complex. In view of this, triple destruction of TCRα and β chains and B2M was developed to generate universal T cells. First, the ability to eliminate HLA-I expression on T cells by destroying B2M was tested. T cells were electroporated with Cas9 / gRNA RNA targeting B2M. This resulted in a 79.9% B2M and HLA-I double-negative population. HLA-I neg The population can be further enriched by negative selection ( Fig.60 ).

[0524] To generate triple knockout T cells lacking TCRα, β chain, and B2M, Cas9 mRNA was co-electroporated with three different gRNAs targeting TRAC, TRBC, and B2M. As a result, the CD3 and HLA-I double-negative cell population was 65.4% ( Fig.61 After enrichment of double-knockout and triple-knockout cells, TCRα and β chains and B2M triple-knockout T cells abolished nonspecific killing of HLA-mismatched tumor cell lines ( Fig.62 No response was observed when these cells were challenged with allogeneic whole blood irradiated PBMCs in the IFNγ Elispot assay ( Fig.63 , left panel). Ablation of HLA-I molecules also dramatically reduced alloreactivity, as confirmed by co-culturing allogeneic PBMCs with irradiated B2M-destroyed cells ( Fig.63 , right panel). The above results suggest that triple-negative T cells lacking TCR α and β chains and B2M can potentially serve as a source of universal T cells for adoptive immunotherapy, which resist rejection by the host immune system without causing graft-versus-host disease.

[0525] TCR redirection enhances antitumor activity of endogenous TCR-destroyed T cells.

[0526] After redirection using NY-ESO-1 TCR (1G4), T cells with CRISPR / Cas9-disrupted TCR α and β chains showed elevated transgenic TCR expression on the cell surface. Transgenic TCR expression was 67.6%, 78.8% or 94.3% for TCR α or β chain single knockout or α / β double knockout, respectively, compared to 46.8% for wild-type T cells. Increased transgenic TCR expression resulted in enhanced T cell function, as evidenced by increased antigen-specific CD107a expression ( Fig.65A ) and enhanced cytotoxicity ( Fig.65B )—especially for α / β double knockout T cells.

[0527] In a separate experiment, α / β double knockout T cells were transfected with a different NY-ESO-1 TCR (8F). Relative to the 1G4TCR, this 8F TCR exhibited a significant difference in transgenic TCR expression ( Fig.66 ;TCR / CD3 neg 60.1% vs. 44.7% of wild-type T cells (Cas9 blank control T cells) (with ~5% endogenous TCR Vβ8 background) and functional ( Fig.67A CD107a expression in Fig.67B These results highlight the differential impact of endogenous TCRs on transgenic TCR expression and function.

[0528] Universal CAR T cells retain antitumor efficacy and do not cause GVHD.

[0529] Generation of universal CD19 CAR T cells by combining LV transduction of CD19 CAR with RNA electroporation of Cas9 / gRNA ( Fig.68 ). The cells were expanded and the remaining CD3 negCells have high levels of CD19 CAR expression ( Fig.69 The majority of expanded T cells were CD45RO positive and retained high levels of CD62L expression and moderate levels of CD28 expression, consistent with a central memory cell profile ( Fig.70 ). The expanded TCR / HLA-I double-negative CD19 CAR T showed robust in vitro anti-tumor activity, such as CD107a release ( Fig.71 ), cytokine secretion ( Fig.72 ), cleavage capacity ( Fig.73 ) and proliferation ( Fig.74 ), which was as effective as wild-type CD19 CAR T cells.

[0530] T cells were infused into NSG mice bearing disseminated Nalm6 leukemia. CAR T cells with a disrupted endogenous TCR (LV-CD19 CAR TCR neg ) or with simultaneous disruption of TCR and HLA-I (LV-CD19CAR TCR / HLA-I neg )-treated mice exhibited tumor regression similar to that of mice treated with wild-type CD19 CAR T cells (LV-CD19 CAR) ( Fig.75A and 75B ), indicating that disruption of TCR alone or together with B2M does not affect the antitumor activity of CAR T cells.

[0531] To test the GVHD effect of engineered T cells, a high T cell dose (20 × 10 6 100 mg / mouse) were administered to NSG mice with Nalm6 leukemia. Fig.76 As shown in the Figure 2, CD19 CAR T cells with separate TCR disruption (LV-CD19 CAR TCR / CD3 neg ) or simultaneous disruption of TCR and B2M (LV-CD19 CAR TCR / HLA-I neg )-treated mice showed similar tumor regression compared with wild-type CD19 CAR T cells (LV-CD19 CAR). Mice treated with double knockout or triple knockout CAR T cells did not develop any signs of GVHD. In contrast, 3 of 4 mice from the wild-type CD19 CART (LV-CD19 CAR) group developed GVHD on day 65, which was confirmed by histological examination of different organs. Thus, destroying a single TCR or TCR together with HLA-I does not affect the in vivo anti-tumor activity of CAR T cells, while eliminating allogeneic reactivity.

[0532] Adenoviral CRISPR delivery into primary T cells.

[0533] The CRISPR / Cas9 system is being rapidly exploited for gene regulation and gene editing purposes in model organisms and cell lines. Viral vectors can be particularly adapted to expand the applicability of CRISPR to other cell types, including dividing cells and dormant primary cells. Adenoviruses, second-generation fiber-modified adenoviruses encoding Cas9 and a single guide RNA (gRNA) molecule, have been used to carry the Cas9 nuclease to the PD1, Fas, and TRAC loci ( Fig.77 Adenovirus-mediated CRISPR transduction into tumor cells ( Fig.78 ) produced high rates of targeted mutagenesis up to approximately 71% ( Fig.79A and 79B ). Adenovirus appears to constitute a valuable platform for introducing CRISPR into human T cells, regardless of their dormancy. This approach will help investigate the potential of CRISPR gene regulation and editing in a wide range of experimental situations.

[0534] Electroporation optimization.

[0535] CD3 and B2M knockout efficiency and T cell expansion were evaluated after Cas9 and gRNA electroporation (EP) in 4 mm cuvettes and 2 mm cuvettes. Standard EP conditions (360 v / 1 ms, first EP – 20 μg Cas9 RNA + 10 μg gRNA / 100 μl T cells, second EP 5 μg gRNA / 100 μl T cells) using 2 mm cuvettes showed the highest CD3 and B2M knockout percentages of 81.8% and 88.6%, respectively, and approximately 2.7-fold T cell expansion (EP#1), compared to approximately 18.8-fold expansion of control EP T cells (EP#12). Lowering the gRNA dose (EP#2-5) drastically increased T cell expansion, but only slightly affected CD3 and B2M knockout efficiency. See Fig.80 Standard EP conditions using 4 mm cuvettes resulted in drastically reduced CD3 and B2M knockdown efficiencies (EP#8), suggesting that EP conditions (voltage or / and pulse length) need to be further optimized for use with 4 mm cuvettes.

[0536] Compared to standard electroporation (EP) conditions in 2 mm cuvettes (EP#10-13) or 4 mm cuvettes, high CD3 / B2M knockout efficiencies were observed (EP#1 and 5), accompanied by increased T cell expansion folds. Fig.81 .

[0537] In order to further optimize the EP conditions to achieve the maximum T cell expansion multiple and more than 60% CD3 / B2M knockout efficiency, different EP conditions and RNA amounts were tested. The results showed that for EP#4, for EP#1 (400v / 2ms / 120μg CAS9RNA) and for EP#2 (500v / 1ms / 20μg gRNA), the expansion multiple was improved with relatively high CD3 / B2M knockout efficiency (63.5% of CD3 and 84.8% of B2M). See Fig.82 .

[0538] Additional experiments were performed to optimize EP conditions. The results showed that compared with the most favorable regulation tested ( Fig.82 EP#1 in ), using 500v / 1ms / 120μg CAS9 RNA (EP#1) and 500v / 1ms / 20μg gRNA (EP#2) resulted in increased CD3 / B2M knockout efficiency and T cell expansion (EP#3). Fig.83 .

[0539] Large-scale electroporation and expansion.

[0540] Experiments were performed to determine whether large-scale electroporation could produce high knockout and expansion efficiencies. On day 0, anti-CD3 / anti-CD28 beads were used to stimulate T cells (100 × 10 6 cells / donor, concentrated to 0.5×10 6 On day 1, stimulated T cells were transduced with CD19 CAR lentivirus. 50mL (25×10 6 T cells (10 mL, 50 × 10 cells) were retained as unmodified T cells (Group 9). On day 3, beads were removed and transduced T cells from each donor were divided into two groups, CART / blank control EP (10 mL, 50 × 10 6 / mL) and CART / CRISPR (10mL, 50×10 6 / mL). The cells were then electroporated with CAS9 RNA (first EP), and groups 1, 3, 5, and 7 were split. On day 4, gRNA was electroporated into T cells, and the cells were divided at 1×10 6 cells / mL were cultured. On days 5 and 7, cells were split. On day 8, CD3+ cells were removed from groups 2, 4, and 6. On day 11, T cells were harvested and 25×10 5 Cells were sent for karyotyping.

[0541] Table 1: Experimental groups.

[0542]

[0543]

[0544] T cell numbers were evaluated after electroporation and culture procedures ( Fig.85 ) and expansion multiples ( Fig.85 The expansion fold of T cells transduced with CD19 CAR alone (TD alone) or transduced with CD19 CAR and CRISPR editing (TD / KO) is shown in Fig.86 The left panel of the figure shows the expansion fold of T cells at day 10. Fig.86 In the right figure. By optimizing the electroporation conditions and CAS9 / gRNA dosage, approximately 60-70% CD3 / B2M knockdown efficiency and approximately 30-fold T cell expansion were observed after 10 days ( Fig.87 CD3 / B2M / CAR expression at day 10 is shown).

[0545] Eight days after CD3 / CD28 bead stimulation and CRISPR RNA electroporation, CD3-positive T cells were removed. Fig.88 CD3 / B2M expression in three donor populations at day 8 is shown. On day 11, T cells were subjected to FACS staining to detect CD3, B2M and CAR expression. Non-transduced ND463 (NOTD) was used as a negative control. Fig.89 Shown are CD19CAR TD (transduced) / CRISPR electroporated, CD3-depleted T cells; CD19 CAR TD / CRISPR electroporated T cells; and CD3 and B2M expression in CD19 CAR TD T cells. Fig.90 Shown are CD19 CAR TD / CRISPR electroporated, CD3-depleted T cells; CD19 CAR TD / CRISPR electroporated T cells; and CAR expression in CD19 CAR TD T cells. Fig.91 Shown are CD3 / B2M / CAR expression at day 11 in CD19 CAR TD (transduced) / CRISPR electroporated, CD3-depleted T cells; CD19 CAR TD / CRISPR electroporated T cells; and CD19CAR TD T cells. Fig.92 An overview of CD3 / B2M / CAR expression in different T cell panels is presented.

[0546] On day 11, different groups of T cells—e.g. Fig.93 As indicated in the figure, CD19 positive cell lines Raji or Nalm6 were stimulated. K562 was used as a CD19 negative control. After 4 h of co-culture, CD107a upregulation was detected in each of the T cell groups except the negative control.

[0547] On day 11, the killing capacity of T cells—e.g. Fig.94 Indicated in - tested using luminescent cytotoxic lymphocyte (CTL) assay after co-culturing T cells with CD19-positive target cells Nalm6-CBG. Also on day 11, cytokine production of T cells was analyzed by stimulating the T cell panel with Nalm6 target cells, see Fig.95 .

[0548] T cells were cultured in medium containing 100 U / ml of IL-2 for up to 26 days. Fig.96 The results shown in indicate that no abnormal T cell growth was observed for CRISPR-edited T cells from three donors.

[0549] As one of the most attractive applications of the CRISPR / Cas9 system, multiple genome editing holds great hope for advancing T cell-based adoptive immunotherapy. However, the low targeting efficiency of DNA transfection limits the use of multiple genome engineering in primary T cells. A "hit and run" delivery strategy was developed to introduce CRISPR into T cells via co-electroporation of Cas9 mRNA and gRNA. By combining up to three rounds of gRNA electroporation with transient exposure to mild hypothermia, >80% targeting efficiency at the protein level is routinely achieved for single gene disruption. More encouragingly, triple gene disruption of TRAC, TRBC and B2M produces approximately 65% ​​of double negative CD3 and HLA-I without any purification and selection. The results also show that gene-disrupted T cells are enriched to >99% purity using clinically approved paramagnetic beads, and purified T cells are expanded up to 500 times within 10 days. The expanded T cells maintain their gene-disrupted phenotypes and display features consistent with central memory T cells. The destroyed T cells do not cause GVHD, which indicates that they can be used as allogeneic CAR T cells. Importantly, gene-edited T cells have shown anti-tumor activity in both in vitro and different tumor mouse models, which is as effective or more effective than unedited T cells. Thus, the process of generating synthetic cells described herein can be easily converted into current GMP-compliant manufacturing procedures.

[0550] The data described herein demonstrate that CRISPR / Cas9 is a powerful multiplex genome editing tool in primary human T cells. Previous reports have shown that T cells can be genetically edited by ZFN or TALEN to eliminate the expression of endogenous TCRα and β chains, thereby avoiding GVHD. Due to the complexity of the targeting strategy of manipulating multiple genes by zinc finger nucleases (ZFNs) and TAL effector nucleases TALEN in T cells, previous studies have not been able to prevent GVHD and host-versus-graft reactions simultaneously in preclinical animal models. NK cell activation can be aborted by ablating stimulatory NK ligands by CRISPR / Cas9 or by expressing atypical HLA class I molecules such as HLA-E, which can potentially prevent universal T cells from NK cell-mediated rejection.

[0551] In summary, clinical-scale universal CAR T cells with effective anti-tumor activity and reduced alloreactivity can be efficiently generated using multiple CRISPR technologies. Considering the successful transformation of adoptive transfer therapy using ZFN for HIV / AIDS, this method can be incorporated into the current GMP-compliant manufacturing procedures and has high transformation potential. It is possible that universal CAR and TCR T cells will provide an alternative to autologous T cells. In fact, it is conceivable that universal CAR and TCRT cells with invalid restriction point molecules can be more effective and have a wider range of uses compared to current CART therapies that use autologous T cells to resist cancer and infectious diseases.

[0552] Other Implementations

[0553] The recitation of a list of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of the recited elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiment or portion thereof.

[0554] The disclosure of each and every patent, patent application and publication cited herein is hereby incorporated by reference in its entirety. Although the present invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of the present invention may be designed by those skilled in the art without departing from the true spirit and scope of the present invention. The appended claims are intended to be interpreted as including all such embodiments and equivalent variations. Sequence Listing <110> The Board of Trustees of the University of Pennsylvania <120> Alteration of gene expression in CAR T cells and its uses <130> 046483-7100CN2 <140> CN 2021113542766 <141> 2015-10-15 <150> 62 / 073,651 <151> 2014-10-31 <160> 97 <170> PatentIn version 3.5 <210> 1 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 1 tgtgctagac atgaggtcta 20 <210> 2 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 2 gcagtatctg gagtcattga 20 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 3 cgcgagcaca gctaaggcca 20 <210> 4 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 4 ggcgccctgg ccagtcgtct 20 <210> 5 <211> 20 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 5 gagggtccag atgcccagca 20 <210> 6 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 6 tcatgtccta accctgatcc tctt 24 <210> 7 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 7 ttggactttt cccagctgac aga 23 <210> 8 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 8 taccaggacc agacagctct taga 24 <210> 9 <211> twenty four <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <400> 9 tctcacctaa tctcctccag gcat 24 <210> 10 <211> 27 <212> RNA <213> Artificial sequence <220> <223> synthetic sequence <400> 10 aggaggauuc ggaacccaau cacugac 27 <210> 11 <211> 25 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <220> <221> misc_RNA <222> (1)..(23) <400> 11 cagugauugg guuccgaauccucct 25 <210> 12 <211> 27 <212> RNA <213> Artificial sequence <220> <223> synthetic sequence <400> 12 accuccucucccauucacccaccagcuc 27 <210> 13 <211> 25 <212> DNA <213> Artificial sequence <220> <223> synthetic sequence <220> <221> misc_RNA <222> (1)..(23) <400> 13 gcuggugggu gaaugggaag gaggt 25 <210> 14 <211> 122 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 1B <400> 14 ttaatacgac tcactatagg caccaaagct gcccttaccg ttttagagct agaaatagca 60 agttaaaata aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt 120 tt 122 <210> 15 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 1C <400> 15 tgtgctagac atgaggtcta tgg 23 <210> 16 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 1C <400> 16 ccctcaatga ctccagatac tgc 23 <210> 17 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.79B , 13 <400> 17 tgggctggcg gccaggatgg ttcttggtag gtaggtgg 38 <210> 18 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.79B , 19 <400> 18 tgggctggcg gccaggatgg ttcttagggg taggtggg 38 <210> 19 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 19 tatatcacag acaaaactgt gctagacatg aggtctatgg acttcaagag caacagtgct 60 gtggcct 67 <210> 20 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 20 tatatcacag acaaaactgt gctagacatg agtctatgga cttcaagagc aacagtgctg 60 tggcct 66 <210> twenty one <211> 65 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> twenty one tatatcacag acaaaactgt gctagacatg gtctatggac ttcaagagca acagtgctgt 60 ggcct 65 <210> twenty two <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> twenty two tatatcacag acaaaactgt gctagacatg agtctatgga cttcaagagc aacagtgctg 60 tggcct 66 <210> twenty three <211> 64 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> twenty three tatatcacag acaaaactgt gctagacatg tctatggact tcaagagcaa cagtgctgtg 60 gcct 64 <210> twenty four <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> twenty four tatatcacag acaaaactgt gctagactga ggtctatgga cttcaagagc aacagtgctg 60 tggcct 66 <210> 25 <211> 64 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 25 tatatcacag acaaaactgt gctagtgagg tctatggact tcaagagcaa cagtgctgtg 60 gcct 64 <210> 26 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 26 tatatcacag acaaaactgt gcttgaggtc tatggacttc aagagcaaca gtgctgtggc 60 ct 62 <210> 27 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 27 tatatcacag acaaaactgt gctagacatg aggttctatg gacttcaaga gcaacagtgc 60 tgtggcc 67 <210> 28 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 28 tatatcacag acaaaactgt gctagacatg agggtctatg gacttcaaga gcaacagtgc 60 tgtggcc 67 <210> 29 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 29 agcagcccgc cctcaatgac tccagatact gcctgagcag ccgcctgagg gtctcggcca 60 ccttctg 67 <210> 30 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 30 agcagcccgc cctcatgact ccagatactg cctgagcagc cgcctgaggg tctcggccac 60 cttctg 66 <210> 31 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 31 agcagcccgc ctcaatgact ccagatactg cctgagcagc cgcctgaggg tctcggccac 60 cttctg 66 <210> 32 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 32 agcagcccgc cctcaatgac tcagatactg cctgagcagc cgcctgaggg tctcggccac 60 cttctg 66 <210> 33 <211> 65 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 33 agcagcccgc cctcaatgac tagatactgc ctgagcagcc gcctgagggt ctcggccacc 60 ttctg 65 <210> 34 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 34 agcagcccgc ccgactccag atactgcctg agcagccgcc tgagggtctc ggccaccttc 60 tg 62 <210> 35 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 35 agcagcccgc cctcaaatga ctccagatac tgcctgagca gccgcctgag ggtctcggcc 60 accttct 67 <210> 36 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 36 agcagcccgc cctcaatgac tcccagatac tgcctgagca gccgcctgag ggtctcggcc 60 accttct 67 <210> 37 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 37 agcagcccgc cctcaatgac tccagatact gcctgagcag ccgcctgagg gtctcggcca 60 ccttctg 67 <210> 38 <211> 64 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 38 agcagcccgc cctcaatgac agatactgcc tgagcagccg cctgagggtc tcggccacct 60 tctg 64 <210> 39 <211> 66 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 39 agcagcccgc cctcaatgac tcagatactg cctgagcagc cgcctgaggg tctcggccac 60 cttctg 66 <210> 40 <211> 55 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 40 agcagcccgc cctcaactgc ctgagcagcc gcctgagggt ctcggccacc ttctg 55 <210> 41 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 41 agcagcccgc ctcatgactc agatactgct gagcagccgc ctgagggtct cggccacctt 60 ct 62 <210> 42 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 42 agcagccact gcgtgagcag ccgcgtgagg gtctcggcca ccttct 46 <210> 43 <211> 67 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Figure 3D <400> 43 agcagcccgc cctcaatgac tccgagatac tgcctgagca gccgcctgag ggtctcggcc 60 accttct 67 <210> 44 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.9A <400> 44 ccgtggcctt agctgtgctc gcg 23 <210> 45 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 12A <400> 45 ccatgctggg catctggacc ctc 23 <210> 46 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.14A <400> 46 gggcggtgct acaactgggc tgg 23 <210> 47 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.15A <400> 47 cataaagcca tggcttgcct tgg 23 <210> 48 <211> 64 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 48 aacaccgctc ccataaagcc atggcttgcc ttggatttca gcggcacaag gctcagctga 60 acct 64 <210> 49 <211> 59 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 49 aacaccgctc ccataatggc ttgccttgga tttcagcggc acaaggctca gctgaacct 59 <210> 50 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 50 aacaccgctc ccataaccat ggcttgcctt ggatttcagc ggcacaaggc tcagctgaac 60 ct 62 <210> 51 <211> 62 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 51 aacaccgctc ccataaccat ggcttgcctt ggatttcagc ggcacaaggc tcagctgaac 60 ct 62 <210> 52 <211> 64 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 52 aacaccgctc ccataaagtc catggcttgc cttggatttc agcggcacaa ggctcagctg 60 aacc 64 <210> 53 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 53 aacaccgctc ccataaacca tggcttgcct tggatttcag cggcacaagg ctcagctgaa 60 CCTV 63 <210> 54 <211> 50 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 54 aacaccgctc ccataaaggg atttcagcgg cacaaggctc agctgaacct 50 <210> 55 <211> 59 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 55 aacaccgctc ccataatggc ttgccttgga tttcagcggc acaaggctca gctgaacct 59 <210> 56 <211> 59 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 56 aacaccgctc ccataatggc ttgccttgga tttcagcggc acaaggctca gctgaacct 59 <210> 57 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 57 aacaccgctc ccataaacca tggcttgcct tggatttcag cggcacaagg ctcagctgaa 60 CCTV 63 <210> 58 <211> 61 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 58 aacaccgctc ccataccatg gcttgccttg gatttcagcg gcacaaggct cagctgaacc 60 t 61 <210> 59 <211> 59 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 59 aacaccgctc ccataatggc ttgccttgga tttcagcggc acaaggctca gctgaacct 59 <210> 60 <211> 64 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig. 15B <400> 60 aacaccgctc ccataaagcc atggcttgcc ttggatttca gcggcacaag gctcagctga 60 acct 64 <210> 61 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.16 <400> 61 ggacatcaag cctgctaaca tgg 23 <210> 62 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.16 <400> 62 catcaagcct gctaacatgg agg 23 <210> 63 <211> 122 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.49 <220> <221> misc_features <222> (19)..(39) <223> n is a, c, g or t <400> 63 taatacgact cactatagnn nnnnnnnnnn nnnnnnnnng ttttagagct agaaatagca 60 agttaaaata aggctagtcc gttatcaact tgaaaaagtg gcaccgagtc ggtgcttttt 120 tt 122 <210> 64 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.79A <400> 64 ggccaggatg gttcttaggt 20 <210> 65 <211> 38 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.79B ; WT <400> 65 tgggctggcg gccaggatgg ttcttaggta ggtggggt 38 <210> 66 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.79B <400> 66 tgggctggcg gccaggatgg taggtaggtg gggt 34 <210> 67 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.79B <400> 67 tgggctggcg gccaggatgg ttttaggtag gtggggt 37 <210> 68 <211> 34 <212> DNA <213> Artificial sequence <220> <223> Synthetic sequences; Fig.79B <400> 68 tgggctggcg gccaggatgg taggtaggtg gggt 34

Claims

1. A modified chimeric antigen receptor (CAR) T cell comprising: An insertion or deletion in the FAS locus capable of down-regulating gene expression of an endogenous FAS gene, wherein the insertion or deletion is introduced using a nucleic acid capable of down-regulating FAS gene expression comprising a CRISPR / Cas system; and A nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular domain of a first co-stimulatory molecule; wherein the expression of the endogenous FAS gene is reduced or eliminated in the modified CAR T cells; wherein the modified CAR T cells expand faster than wild-type CAR T cells; and Compared with wild-type CAR T cells, the modified CAR T cells exhibit better anti-tumor activity.

2. The modified CAR T cell of claim 1, wherein the CRISPR / Cas system comprises a pAd5 / F35-CRISPR vector.

3. The modified CAR T cell of claim 1, wherein (a) the nucleic acid capable of down-regulating FAS gene expression is introduced into the FAS gene sequence corresponding to SEQ ID NO: 5 by insertion or mutation; and / or (b) The nucleic acid capable of down-regulating FAS gene expression comprises the sequence CCATGCTGGGCATCTGGACCCTC.

4. The modified CAR T cell of claim 1, wherein the antigen binding domain of the CAR comprises an antibody selected from a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a single domain antibody, a single chain variable fragment, and an antigen binding fragment thereof.

5. The modified CAR T cell of claim 1, wherein the antigen binding domain of the CAR specifically binds to an antigen on a target cell.

6. The modified CAR T cell of claim 1, wherein the intracellular domain of the CAR comprises dual signaling domains.

7. The modified CAR T cell of any one of claims 1-6, further comprising: (a) an insertion or deletion in the T cell receptor alpha chain (TCRα) locus capable of downregulating gene expression of the endogenous TCRα gene; or (b) an insertion or deletion in the T cell receptor β chain (TCRβ) locus capable of downregulating gene expression of the endogenous TCRβ gene; and (c) an insertion or deletion in the beta-2 microglobulin (B2M) locus capable of downregulating gene expression of an endogenous B2M gene; wherein the insertion or deletion is introduced using a nucleic acid encoding a CRISPR / Cas system, and Wherein the expression of the endogenous TCRα gene or TCRβ gene and B2M is reduced or eliminated in the modified CAR T cells.

8. The modified CAR T cell of claim 7, wherein the insertion or deletion is introduced using a nucleic acid comprising: a nucleic acid capable of downregulating the expression of FAS, TCRα or TCRβ, and B2M genes.

9. A method for generating modified CAR T cells ex vivo, comprising: introducing a nucleic acid capable of down-regulating gene expression of an endogenous FAS gene into T cells ex vivo to generate T cells expressing reduced or eliminated FAS gene expression, wherein the nucleic acid capable of down-regulating gene expression comprises a CRISPR / Cas9 system; Isolating T cells expressing reduced or eliminated FAS gene expression; and introducing a nucleic acid encoding a chimeric antigen receptor (CAR) comprising an antigen binding domain, a transmembrane domain, and an intracellular domain into a T cell to generate a modified CAR T cell expressing reduced or eliminated FAS gene expression; Wherein the expression of the endogenous FAS gene is reduced or eliminated in the modified CAR T cells.

10. The method of claim 9, wherein the CRISPR / Cas system comprises a pAd5 / F35-CRISPR vector.

11. The method of claim 9, wherein the nucleic acid capable of downregulating gene expression introduces an insertion or mutation into the FAS gene sequence corresponding to SEQ ID NO:

5.

12. The method of claim 9, wherein the nucleic acid capable of downregulating gene expression comprises a CCATGCTGGGCATCTGGACCCTC sequence.

13. The method of claim 9, wherein the antigen binding domain of the CAR comprises an antibody selected from a monoclonal antibody, a polyclonal antibody, a synthetic antibody, a human antibody, a humanized antibody, a single domain antibody, a single chain variable fragment, and an antigen binding fragment thereof.

14. The method of claim 9, wherein the antigen binding domain of the CAR comprises a single-chain variable fragment that specifically binds to CD19.

15. The method of claim 9, wherein the antigen binding domain of the CAR specifically binds to an antigen on a target cell.

16. The method of claim 9, wherein the intracellular domain of the CAR comprises dual signaling domains.

17. The method of claim 9, wherein the T cells are obtained from peripheral blood mononuclear cells, umbilical cord blood cells, purified T cell populations, and T cell lines.

18. The method of claim 9, wherein the method further comprises expanding the T cells.

19. The method of claim 18, wherein the step of expanding the T cells comprises culturing the T cells using a factor selected from the group consisting of flt3-L, IL-1, IL-3, and c-kit ligand.

20. The method of claim 9, further comprising cryopreserving the T cells.

21. The method of claim 20, further comprising thawing the cryopreserved T cells prior to introducing the nucleic acid into the T cells.

22. The method of claim 9, wherein introducing the nucleic acid is selected from the group consisting of transducing the T cell, transfecting the T cell, and electroporating the T cell.

23. The method of any one of claims 9-21, further comprising: (a) an insertion or deletion in the T cell receptor alpha chain (TCRα) locus capable of downregulating gene expression of the endogenous TCRα gene; or (b) an insertion or deletion in the T cell receptor β chain (TCRβ) locus capable of downregulating gene expression of the endogenous TCRβ gene; and (c) an insertion or deletion in the beta-2 microglobulin (B2M) locus capable of downregulating gene expression of an endogenous B2M gene; wherein the insertion or deletion is introduced using a nucleic acid encoding a CRISPR / Cas system.

24. The method of claim 23, wherein the insertion or deletion is introduced using a nucleic acid comprising: a nucleic acid capable of downregulating the expression of FAS, TCRα or TCRβ, and B2M genes.

25. The method of claim 9, further comprising expressing Klf4, Oct3 / 4, and Sox2 in the T cells to induce pluripotency of the T cells.

26. Use of the modified CAR T cell of any one of claims 1-8 for the preparation of a medicament for treating cancer in a subject.

27. The use of claim 26, wherein the cancer is selected from breast cancer, prostate cancer, ovarian cancer, cervical cancer, skin cancer, pancreatic cancer, colorectal cancer, kidney cancer, liver cancer, brain cancer, lymphoma, leukemia, lung cancer, and any combination thereof.

28. Use of the modified CAR T cell of any one of claims 1-8 for the preparation of a medicament for stimulating a T cell-mediated anti-tumor immune response against a target cell or tissue in a subject.

29. Use of the modified CAR T cell of any one of claims 1-8 for the preparation of a medicament for adoptive cell transfer therapy in a subject in need thereof to prevent or treat cancer.

30. A composition comprising a modified CAR T cell generated according to the method of any one of claims 9-24.

31. A pharmaceutical composition comprising a modified CAR T cell produced according to the method of any one of claims 9-24 and a pharmaceutically acceptable carrier.

Images