Modified interleukin-7 protein and its use

Abstract

The present invention relates to modified interleukin-7 proteins and uses thereof. The modified IL-7 of the present invention or the IL-7 fusion protein comprising the same can be obtained in high yield and has biological activity in viral infection and cancer models. Therefore, they can be used for the prevention and treatment of various diseases.

Description

Technical Field

[0001] The present invention relates to a modified interleukin-7 protein and uses thereof. Background Art

[0002] Interleukin-7 or a polypeptide having similar activity thereto (hereinafter referred to as "IL-7") is an immunostimulatory cytokine that can promote immune responses mediated by B cells and T cells. In particular, IL-7 plays an important role in the adaptive immune system. IL-7 is mainly secreted by stromal cells in the bone marrow and thymus, but is also produced by keratinocytes, dendritic cells, hepatocytes, neurons and epithelial cells (Heufler C et al., 1993, J. Exp. Med. 178 (3): 1109-14; Kroncke R et al., 1996, Eur. J. Immunol. 26 (10): 2541-4; Sawa Y et al., 2009, Immunity 30 (3): 447-57; Watanabe M et al., 1995, J. Clin. Invest. 95 (6): 2945-53).

[0003] Specifically, IL-7 activates immune function by promoting the survival and differentiation of T cells and B cells, the survival of lymphocytes, stimulating the activity of natural killer (NK) cells, etc., and in particular, IL-7 plays an important role in the development of T cells and B cells. IL-7 binds to hepatocyte growth factor (HGF) and acts as a cofactor for the V(D)J rearrangement of the initial pre-B cell growth stimulating factor and T cell receptor β (TCRβ) (Muegge K, 1993, Science 261(5117):93-5).

[0004] In addition, IL-7 regulates the development of lymph nodes through lymphoid tissue induction (LTi) cells and promotes the survival and division of naive T cells or memory T cells. According to the clinical results of viral infection reported recently, IL-7 maintains naive T cells or memory T cells (Amila Patel, J Antimicrob Chemother 2010). In addition, IL-7 enhances the body's immune response by promoting the secretion of IL-2 and interferon-γ.

[0005] That is, IL-7 is a cytokine that promotes the survival and proliferation of T cells, B cells and other immune cells, and is a candidate material for immunotherapeutic agents for various diseases such as viral infection, cancer and immune system damage. Recently, some clinical studies on malignant tumors and human immunodeficiency virus (HIV) infection have confirmed the role of IL-7 in increasing human immunity (Fry TJ et al., 2002, Blood 99 (11): 3892-904; Muegge K et al., 1993, Science 261 (5117): 93-5; Rosenberg SA et al., J. Immunother. 29 (3): 313-9). In addition, IL-7 is also used for immune recovery after transplantation of allogeneic stem cells (Snyder KM, 2006, Leuk. Lymphoma 47 (7): 1222-8) and the treatment of lymphocytopenia.

[0006] Cancer is a life-threatening disease. Cancer cells provide an environment that can suppress the immune system, allowing it to grow without being recognized by immune cells. Cancer patients show immune deterioration, mainly due to anticancer treatment (such as chemotherapy, radiotherapy) and T cell reduction or T cell number reduction when diagnosing cancer. In addition, although cytotoxic T lymphocytes, effector T cells and macrophages gather in cancer tissues, they cannot effectively remove cancer cells. In addition, since T regulatory cells (Treg) and bone marrow-derived suppressor cells (MDSC) that inhibit the function of immune effector cells are present in cancer tissues, immune cells cannot effectively inhibit the proliferation of cancer cells.

[0007] In this context, immunotherapy has recently been emphasized. Immunotherapy can be used in combination with chemotherapy or radiotherapy currently used for cancer treatment. In particular, the utilization of IL-7 is considered an alternative approach to enhance immune function by overcoming lymphopenia with reduced T cell numbers.

[0008] Chronic infection is maintained by inducing exhaustion of T cells that recognize viruses. For example, by infection with viruses such as HIV, hepatitis B (HBV), hepatitis C (HCV), and simian immunodeficiency virus (SIV), the initial immune response is strongly induced, but the function of virus-specific T cells gradually decreases over time. In particular, PD-1, LAG-3, TIM-3, IL-10 receptor, TGF-β receptor, etc., can reduce the function of virus-specific T cells.

[0009] However, IL-7 restores the lost function of virus-specific T cells or inhibits the reduction of their function by overcoming the immunosuppressive signaling system (Pellegrini M, 2009 May; 15(5): 528-36). In addition, IL-7 induces T cell proliferation and increases the expression of Bcl-2, thereby promoting the expansion and survival of T cells.

[0010] In addition, IL-7 produces cytokines and helps maintain their function by inhibiting the expression of SOCS3 (suppressive mediator of cytokine signaling). In addition, IL-7 reduces immunopathology due to the production of IL-22 (Som G. Nanjappa, Blood. 2011; 117(19): 5123-5132, Marc Pellegrini, Cell 144, 601-613, February 18, 2011).

[0011] However, when recombinant IL-7 is produced for medical purposes, there are problems such as increased impurities, IL-7 degradation, and difficulty in large-scale production compared to general recombinant proteins. Previously, Cytheris developed a synthetic IL-7 that is a conformer with a specific disulfide bond (Cys: 1-4; 2-5; 3-6) (US Patent No. 7,585,947). However, since the production of synthetic IL-7 requires a complex denaturation process, the manufacturing process is not easy. Therefore, there is an urgent need to develop a modified IL-7 protein that can be mass-produced and easy to produce.

[0012] To this end, modified IL-7 that can be mass-produced and easily manufactured was produced, thereby completing the present invention. Summary of the invention

[0013] Technical issues

[0014] One object of the present invention is to provide modified IL-7.

[0015] Another object of the present invention is to provide a fusion protein comprising modified IL-7.

[0016] Another object of the present invention is to provide a nucleic acid encoding modified IL-7 or a fusion protein comprising the same, a vector comprising the nucleic acid and a host cell comprising the vector, as well as a method for preparing the modified IL-7 and a fusion protein comprising the same.

[0017] Another object of the present invention is to provide a pharmaceutical composition comprising modified IL-7 or a fusion protein thereof and use thereof.

[0018] Technical issues

[0019] In order to achieve the above object, the present invention provides a modified IL-7 linked to an oligopeptide consisting of 1 to 10 amino acids.

[0020] In addition, the present invention provides an IL-7 fusion protein, which comprises a first domain, a second domain and a third domain, wherein the first domain comprises a polypeptide having IL-7 activity or an activity similar thereto; the second domain comprises an amino acid sequence having 1 to 10 amino acid residues and consisting of methionine, glycine or a combination thereof; and the third domain prolongs the half-life of the interleukin-7 fusion protein.

[0021] In addition, the present invention provides a nucleic acid encoding a modified IL-7 or IL-7 fusion protein, an expression vector containing the nucleic acid, and a host cell containing the expression vector.

[0022] In addition, the present invention provides a method for producing or preparing modified IL-7 or IL-7 fusion protein using the nucleic acid, the expression vector and the host cell.

[0023] In addition, the present invention provides a method for preventing or treating a disease using the modified IL-7 or IL-7 fusion protein.

[0024] Beneficial Effects

[0025] The modified IL-7 of the present invention can be produced at a high yield without denaturation treatment. Therefore, the modified IL-7 of the present invention or a fusion protein comprising the same can be applied to various medical fields. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a schematic diagram of the gene construct used to produce the modified IL-7 of the present invention or a fusion protein comprising the same.

[0027] Figure 2 The evaluation results of the daily cell unit production (pg / cell / day, p / c / d) of the prepared IL-7 fusion protein are shown, wherein Figure 2 A shows the amount of IL-hyFc in the culture medium, and Figure 2 B shows the amount of cultured MGM-IL-7-hyFc in the culture medium.

[0028] Figure 3 The results of comparison of the stabilities of IL-7-hyFc and MGM-IL-7-hyFc containing the same at different concentrations of sodium chloride are shown.

[0029] Figure 4 Comparative results of native PAGE between IL-7-hyFc and MGM-IL-7-hyFc under different concentrations of sodium chloride are shown.

[0030] Figure 5 The relative production of the prepared IL-7 fusion protein ( Figure 5 A) and purity ( Figure 5 B) comparison results.

[0031] Figure 6 The graph shows the time-dependent changes in serum drug levels after subcutaneous administration of the prepared IL-7 fusion protein to the SD rat model.

[0032] Figure 7 The results show the production level of anti-drug antibodies (ADA) for each protein administration after subcutaneous administration of the prepared IL-7 fusion protein to the SD rat model

[0033] Figure 8 The graph shows the effect of increasing the white blood cell count (WBC) over time after subcutaneous administration of the prepared IL-7 fusion protein to the SD rat model.

[0034] Fig. 9 The results of comparison of the activities between the prepared IL-7 fusion protein and the standard substance are shown.

[0035] Fig.10 The results show that the body weight change ( Fig.10 A) and survival rate changes ( Fig.10 B) diagram.

[0036] Fig.11 The images showing the morphological observation of the anticancer effect according to the administration of the prepared IL-7 fusion protein in the cancer cell transplantation disease model are shown. DETAILED DESCRIPTION

[0037] The present invention provides a modified IL-7 having the following structure:

[0038] A-IL-7;

[0039] Wherein A is an oligopeptide consisting of 1 to 10 amino acid residues, and IL-7 is interleukin 7 or a polypeptide having similar activity thereto.

[0040] As used herein, the term "polypeptide having IL-7 activity or similar activity thereof" refers to a polypeptide or protein having the same or similar sequence and activity as IL-7. Unless otherwise indicated in the present invention, the term can be used as a concept interchangeable with the first domain of an IL-7 fusion protein.

[0041] IL-7 includes polypeptides consisting of the amino acid sequences represented by SEQ ID NOS: 1 to 6. In addition, IL-7 may have a sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% or more to the sequences of SEQ ID NOS: 1 to 6.

[0042] IL-7 may include IL-7 protein or a fragment thereof. Specifically, IL-7 may be derived from humans, rats, mice, monkeys, cattle or sheep.

[0043] Specifically, human IL-7 can have an amino acid sequence represented by SEQ ID NO: 1 (Genbank accession number P13232); rat IL-7 can have an amino acid sequence represented by SEQ ID NO: 2 (Genbank accession number P56478); mouse IL-7 can have an amino acid sequence represented by SEQ ID NO: 3 (Genbank accession number P10168); monkey IL-7 can have an amino acid sequence represented by SEQ ID NO: 4 (Genbank accession number 001279008); bovine IL-7 can have an amino acid sequence represented by SEQ ID NO: 5 (Genbank accession number P26895), and sheep IL-7 can have an amino acid sequence represented by SEQ ID NO: 6 (Genbank accession number Q28540).

[0044] In addition, the IL-7 protein or its fragment may include various modified proteins or peptides, i.e., variants. The above modifications may be performed by replacing, deleting or adding at least one protein of the wild-type IL-7 without changing the function of IL-7. These different proteins or peptides may have 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology with the wild-type protein.

[0045] Traditionally, wild-type amino acid residues are substituted with alanine, but the substitution may be a conservative amino acid substitution that has no or weak effect on the overall protein charge, ie, polarity or hydrophobicity.

[0046] For conservative amino acid substitutions, reference may be made to Table 1 below.

[0047] [Table 1]

[0048]

[0049] For each amino acid, additional conservative substitutions include "homologues" of the amino acid. Specifically, "homologues" refer to amino acids obtained by inserting a methylene group (CH2) into the β-side chain of the amino acid side chain. Examples of "homologues" may include homophenylalanine, homoarginine, homoserine, etc., but are not limited thereto.

[0050] As used herein, the term "IL-7 protein" may be used as a concept including "IL-7 protein and fragments thereof." Unless otherwise specified, the terms "protein," "polypeptide," and "peptide" may be used as interchangeable concepts.

[0051] In the structure of modified IL-7, A can be directly linked to the N-terminus of IL-7 or linked through a linker, and unless otherwise specified, the term can be used as a concept that can be interchanged with the second domain of the IL-7 fusion protein.

[0052] In the present invention, A may be linked to the N-terminus of IL-7. A is characterized in that it comprises 1 to 10 amino acids, which may be selected from methionine, glycine and a combination thereof.

[0053] Methionine and glycine do not induce immune responses in humans. Protein therapeutics produced by E. coli always contain methionine at the N-terminus, but no adverse reactions have been reported. Moreover, glycine is widely used as a GS linker and does not induce immune responses in commercial products such as Dulaglutide (Cell Biophys. 1993 Jan-Jun; 22(103): 189-224).

[0054] In an exemplary embodiment, A can be an oligopeptide comprising 1 to 10 amino acids selected from methionine (Met, M), glycine (Gly, G) and combinations thereof, and is preferably an oligopeptide selected from 1 to 5 amino acids. For example, A can have an N-terminal sequence selected from any of the following sequences: methionine, glycine, methionine-methionine, glycine-glycine, methionine-glycine, glycine-methionine, methionine-methionine-methionine, methionine-methionine-glycine, methionine-glycine-methionine, glycine-methionine-methionine, methionine-glycine-glycine, glycine-methionine-glycine, glycine-glycine-methionine and glycine-glycine-glycine. Specifically, A can be represented by an amino acid sequence selected from the following sequences: methionine, glycine, methionine-methionine, glycine-glycine, methionine-glycine, glycine-methionine, methionine-methionine-methionine, methionine-methionine-glycine, methionine-glycine-methionine, glycine-methionine-methionine, methionine-glycine-glycine, glycine-methionine-glycine, glycine-glycine-methionine and glycine-glycine-glycine.

[0055] Another aspect of the present invention provides an IL-7 fusion protein, which comprises a first domain, a second domain and a third domain, wherein the first domain comprises a polypeptide having IL-7 activity or an activity similar thereto; the second domain comprises an amino acid sequence having 1 to 10 amino acid residues selected from methionine, glycine or a combination thereof; and the third domain prolongs the half-life of the interleukin-7 fusion protein.

[0056] The third domain may be linked to the N-terminus or C-terminus of the first domain or the second domain. In addition, IL-7 including the first domain and the second domain may be linked to both ends of the third domain.

[0057] The third domain can be a fusion partner for increasing the in vivo half-life, and preferably can include any one selected from the following: the Fc region of an immunoglobulin or a portion thereof, albumin, an albumin binding polypeptide, Pro / Ala / Ser (PAS), human chorionic gonadotropin β subunit C-terminal peptide (CTP), polyethylene glycol (PEG), a long chain non-structured hydrophilic sequence of amino acids (XTEN), hydroxyethyl starch (HES), an albumin binding small molecule, and a combination thereof.

[0058] When the third domain is the Fc region of an immunoglobulin, it may be a modified Fc region of an immunoglobulin. Specifically, the Fc region of a modified immunoglobulin may be: an Fc region in which antibody-dependent cellular cytotoxicity (ADCC) or complement-dependent cytotoxicity (CDC) is attenuated due to modification of binding affinity to Fc receptors and / or complement. The modified immunoglobulin may be selected from IgG1, IgG2, IgG3, IgG4, IgA1, IgA2, IgD, IgE and a combination thereof. Specifically, the Fc region of a modified immunoglobulin may include a hinge region, a CH2 domain and a CH3 domain from the N-terminus to the C-terminus. In particular, the hinge region may include a human IgD hinge region; the CH2 domain may include some amino acid residues of human IgD and some amino acid residues of the human IgG4 CH2 domain; and the CH3 domain may include some amino acid residues of the human IgG4 CH3 domain.

[0059] In addition, the two fusion proteins can form a dimer, for example, when the third domain is an Fc region, the Fc regions can bind to each other and thereby form a dimer.

[0060] As used herein, the term "Fc region", "Fc fragment" or "Fc" refers to a protein comprising the heavy chain constant region 2 (CH2) and the heavy chain constant region 3 (CH3) of an immunoglobulin, but excluding its heavy chain variable region and light chain and light chain constant region (CL1), and it may also include the hinge region of the heavy chain constant region. In the present invention, hybrid Fc or its hybrid Fc fragment may be referred to as "hFc" or "hyFc".

[0061] In addition, as used herein, the term "Fc region variant" refers to a variant prepared by replacing part of the amino acids in the Fc region or by combining different kinds of Fc regions. The Fc region variant can prevent being cut off at the hinge region. Specifically, the 144th amino acid and / or the 145th amino acid of SEQ ID NO: 9 can be modified. Preferably, the variant can be a variant in which the 144th amino acid K is substituted by G or S and a variant in which the 145th amino acid E is substituted by G or S.

[0062] In addition, the Fc region or Fc region variant of the modified immunoglobulin can be represented by the following formula (I):

[0063] Formula (I)

[0064] N'-(Z1)pY-Z2-Z3-Z4-C'.

[0065] In the above formula (I),

[0066] N' is the N-terminus of the polypeptide, and C' is the C-terminus of the polypeptide;

[0067] p is an integer of 0 or 1;

[0068] Z1 is an amino acid sequence having 5 to 9 consecutive amino acid residues from the amino acid residue at position 98 toward the N-terminus among the amino acid residues at positions 90 to 98 of SEQ ID NO:7;

[0069] Y is an amino acid sequence having 5 to 64 consecutive amino acid residues from the amino acid residue at position 162 toward the N-terminus among amino acid residues at positions 99 to 162 of SEQ ID NO: 7;

[0070] Z2 is an amino acid sequence having 4 to 37 consecutive amino acid residues from the amino acid residue at position 163 toward the C-terminus among the amino acid residues at positions 163 to 199 of SEQ ID NO: 7;

[0071] Z3 is an amino acid sequence having 71 to 106 consecutive amino acid residues from the amino acid residue at position 220 toward the N-terminus among the amino acid residues at positions 115 to 220 of SEQ ID NO: 8; and

[0072] Z4 is an amino acid sequence having 80 to 107 consecutive amino acid residues from the amino acid residue at position 221 among amino acid residues at positions 221 to 327 of SEQ ID NO:8 toward the C-terminus.

[0073] In addition, the form of the Fc fragment of the present invention may be: having a native sugar chain, an increased sugar chain or a reduced sugar chain compared to the native form, or may be a deglycosylated form. Immunoglobulin Fc sugar chains can be modified by conventional methods such as chemical methods, enzymatic methods, and genetic engineering methods using microorganisms. Removing sugar chains from the Fc fragment results in a sharp decrease in binding affinity to the C1q portion of the first complement component C1, and ADCC or CDC is reduced or lost, thereby not inducing any unnecessary immune response in vivo. In this regard, a deglycosylated or non-glycosylated form of the immunoglobulin Fc region may be more suitable for the purpose of the present invention as a drug carrier. As used herein, the term "deglycosylation" refers to an Fc region in which sugars are enzymatically removed from the Fc fragment. In addition, the term "non-glycosylated" refers to an Fc fragment produced by a prokaryotic organism in a non-glycosylated form, and preferably produced in Escherichia coli.

[0074] In addition, the Fc region of the modified immunoglobulin may include the amino acid sequence of SEQ ID NO: 9 (hyFc), SEQ ID NO: 10 (hyFcM1), SEQ ID NO: 11 (hyFcM2), SEQ ID NO: 12 (hyFcM3)) or SEQ ID NO: 13 (hyFcM4). In addition, the Fc region of the modified immunoglobulin may include the amino acid sequence of SEQ ID NO: 14 (non-cleaved mouse Fc).

[0075] According to the present invention, the modified immunoglobulin Fc region may be as described in US Pat. No. 7,867,491, and the production of the immunoglobulin Fc region may be performed with reference to the disclosure in US Pat. No. 7,867,491.

[0076] The second domain can be directly connected to the N-terminus of the first domain or connected through a linker. Specifically, the result may be in the form of second domain-first domain or second domain-linker-first domain.

[0077] The third domain can be directly connected to the first domain or the second domain or connected through a joint. Specifically, the resulting form can be: second domain-first domain-third domain, third domain-second domain-first domain, second domain-first domain-joint-third domain, third domain-joint-second domain-first domain, second domain-joint-first domain-joint-third domain, or third domain-joint-second domain-first domain.

[0078] When the linker is a peptide linker, the connection may occur in any connection region. They can be coupled using cross-linking agents known in the art. Examples of cross-linking agents may include N-hydroxysuccinimide esters, such as 1,1-bis(diazoacetyl)-2-phenylethane, glutaraldehyde and 4-azidosalicylic acid; imidoesters include disuccinimidyl esters such as 3,3'-dithiobis(succinimidyl propionate) and bifunctional maleimides such as bis-N-maleimide-1,8-octane, but are not limited thereto.

[0079] In addition, the linker may be an albumin linker or a peptide linker. The peptide linker may be a peptide of 10 to 20 amino acid residues consisting of Gly and Ser residues.

[0080] When the linker is formed with one of chemical bonds, the chemical bond may be a disulfide bond, a diamine bond, a thioether-amine bond, a carboxyl-amine bond, an ester bond and a covalent bond.

[0081] In an exemplary embodiment, the modified IL-7 of the present invention may have an A-IL-7 structure comprising a polypeptide having IL-7 activity or an activity similar thereto and an oligopeptide consisting of 1 to 10 amino acids.

[0082] In a specific embodiment, the modified IL-7 may have an amino acid sequence consisting of SEQ ID NOS: 15 to 20. In addition, the modified IL-7 may have 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology to the amino acid sequence consisting of SEQ ID NOS: 15 to 20.

[0083] In another exemplary embodiment, the modified IL-7 or IL-7 fusion protein of the present invention comprises a first domain, a second domain and a third domain, wherein the first domain comprises a polypeptide having IL-7 activity or an activity similar thereto; the second domain comprises an amino acid sequence having 1 to 10 amino acid residues consisting of methionine, glycine or a combination thereof; the third domain is the Fc region of a modified immunoglobulin, and is coupled to the C-terminus of the first domain.

[0084] The IL-7 fusion protein may have an amino acid sequence consisting of SEQ ID NOS: 21 to 25. In addition, the IL-7 fusion protein may have 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology to the amino acid sequence consisting of SEQ ID NOS: 21 to 25.

[0085] Another aspect of the present invention provides an isolated nucleic acid molecule encoding a modified IL-7 or IL-7 fusion protein.

[0086] The nucleic acid molecule may be a nucleic acid molecule encoding a polypeptide having an amino acid sequence selected from SEQ ID NOS: 15 to 25. The nucleic acid molecule may include a polynucleotide sequence selected from SEQ ID NOS: 29 to 39.

[0087] The nucleic acid molecule may further include a signal sequence or a leader sequence.

[0088] As used herein, the term "signal sequence" refers to a fragment that guides the secretion of biologically active molecular drugs and fusion proteins, and is cut off after translation in the host cell. The signal sequence of the present invention is a polynucleotide encoding an amino acid sequence that initiates the movement of proteins that penetrate the endoplasmic reticulum (ER) membrane. Useful signal sequences in the present invention include: antibody light chain signal sequences, such as antibody 14.18 (Gillies et al., J. Immunol. Meth 1989.125:191-202); antibody heavy chain signal sequences, such as antibody heavy chain signal sequence MOPC141 (Sakano et al., Nature, 1980.286:676-683); and other signal sequences known in the art (e.g., see Watson et al., Nucleic Acid Research, 1984.12:5145-5164).

[0089] The characteristics of signal peptides are well known in the art, and signal peptides usually have 16 to 30 amino acids, but they can contain a greater or lesser number of amino acid residues. Conventional signal peptides consist of three regions: a basic N-terminal region, a central hydrophobic region, and a more polar C-terminal region.

[0090] The central hydrophobic region includes 4 to 12 hydrophobic residues, which fix the signal sequence by the membrane lipid bilayer during the immature polypeptide translocation. After startup, the signal sequence is usually cut off in the lumen of the ER by a cell enzyme called a signal peptidase. Specifically, the signal sequence can be a secretion signal sequence of tissue plasminogen activation (tPa), a signal sequence of herpes simplex virus glycoprotein D (HSV gDs), or growth hormone. Preferably, the secretion signal sequence used in higher eukaryotic cells including mammals can be used. In addition, as a secretion signal sequence, the signal sequence contained in wild-type IL-7 can be used, or it can be used after replacing the codon with a high expression frequency in the host cell.

[0091] Another aspect of the present invention provides an expression vector comprising an isolated nucleic acid molecule encoding a modified IL-7 or IL-7 fusion protein.

[0092] As used herein, the term "vector" should be understood as a nucleic acid tool that includes a nucleotide sequence that can be introduced into a host cell for recombination and inserted into the genome of the host cell or replicated autonomously as an episome. Vectors can include linear nucleic acids, plasmids, phagemids, cosmids, RNA vectors, viral vectors and the like. Examples of viral vectors can include retroviruses, adenoviruses and adeno-associated viruses, but are not limited thereto.

[0093] As used herein, the term "gene expression" or "expression" of a target protein is understood to refer to the transcription of the DNA sequence, the translation of the mRNA transcript, and the secretion of the fusion protein product or fragments thereof.

[0094] As used herein, the term "host cell" refers to prokaryotic and eukaryotic cells into which a recombinant expression vector can be introduced. As used herein, the terms "transduced," "transformed," and "transfected" refer to the introduction of nucleic acids (e.g., vectors) into cells using techniques known in the art.

[0095] As used herein, the term "gene expression" or "expression" of a target protein is understood to refer to the transcription of a DNA sequence, the translation of an mRNA transcript, and the secretion of an Fc fusion protein product or an antibody or antibody fragment thereof.

[0096] Useful expression vectors can be RcCMV (Invitrogen, Carlsbad) or variants thereof. The expression vector can include a human cytomegalovirus (CMV) for promoting the continuous transcription of the target gene in mammalian cells and a polyadenylation signal sequence of bovine growth hormone for increasing the stability state of RNA after transcription. In an exemplary embodiment of the present invention, the expression vector is pAD15, which is a modified form of RcCMV.

[0097] In other aspects, the present invention provides a host cell comprising the expression vector. Suitable host cells can be used to express and / or secrete the target protein by transducing or transfecting the DNA sequence of the present invention.

[0098] Examples of host cells suitable for use in the present invention may include immortalized hybridoma cells, NS / 0 myeloma cells, 293 cells, Chinese hamster ovary (CHO) cells, HeLa cells, human amniotic fluid-derived cells (CapT cells) or COS cells.

[0099] In another aspect, the present invention provides a method for producing a protein, comprising culturing cells transformed with an expression vector; and collecting modified IL-7 or a fusion protein comprising IL-7 from the culture or from cells obtained during the culturing process.

[0100] The modified IL-7 or fusion protein comprising IL-7 can be purified from the culture medium or cell extract. For example, after obtaining the supernatant of the culture medium secreting the recombinant protein, the supernatant can be concentrated by a protein concentration filter available on the commercial market, such as an Amicon or Millipore Pellicon ultrafiltration unit. The concentrate can then be purified by methods known in the art. For example, a matrix coupled to protein A can be used for purification.

[0101] On the other hand, the present invention provides a method for preparing modified IL-7, the method comprising connecting an oligopeptide and the N-terminus of a polypeptide, the oligopeptide comprising an amino acid sequence having 1 to 10 amino acid residues selected from methionine, glycine or a combination thereof, and the polypeptide having the activity of IL-7 or a similar activity thereof.

[0102] The above preparation method may further include the step of connecting a polypeptide consisting of a heterologous sequence, and the IL-7 fusion protein may be prepared by the above preparation method. In particular, the polypeptide consisting of a heterologous sequence may be any one selected from the following: an Fc region of an immunoglobulin or a portion thereof, albumin, an albumin binding polypeptide, PAS, CTP of the β subunit of human chorionic gonadotropin, PEG, XTEN, HES, an albumin binding small molecule, and a combination thereof.

[0103] On the other hand, the present invention provides a method for preparing modified IL-7, the method comprising: linking a polynucleotide encoding an oligopeptide to the N-terminus of a polynucleotide encoding a polypeptide, the oligopeptide comprising an amino acid sequence having 1 to 10 amino acid residues selected from methionine, glycine or a combination thereof, the polypeptide comprising an amino acid sequence of a first domain having IL-7 activity or an activity similar thereto, thereby preparing a linked polynucleotide; and, expressing the linked polynucleotide to collect the modified IL-7 protein.

[0104] The above preparation method may further comprise the step of connecting a polynucleotide encoding a polypeptide consisting of a heterologous sequence, and the IL-7 fusion protein may be prepared by the above preparation method. In particular, the polypeptide consisting of a heterologous sequence may be selected from any one of the following: an Fc region of an immunoglobulin or a portion thereof, albumin, an albumin binding polypeptide, PAS, CTP of the β subunit of human chorionic gonadotropin, PEG, XTEN, HES, an albumin binding small molecule, and a combination thereof.

[0105] In another aspect, the present invention provides a pharmaceutical composition for preventing or treating a disease, which contains a modified IL-7 or IL-7 fusion protein.

[0106] The modified IL-7 or IL-7 fusion protein of the present invention can be administered to promote the expansion or survival of naive T cells or pre-existing T cells or transplanted T cells, or to promote the proliferation of T cell aggregates isolated in vitro.

[0107] These diseases may be chronic hepatitis, cancer or infectious diseases. The cancer may be head and neck cancer or cervical cancer, and the chronic hepatitis may be hepatitis B or hepatitis C. In addition, the infectious disease may be a viral infection, and the virus may be selected from influenza virus, CMV, HSV-1, HSV-2, HIV, HCV, HBV, West Nile virus and dengue virus. In addition, the disease may be lymphocytopenia (lymphocytopenia) or any symptoms, diseases and syndromes caused by a low number of lymphocytes, especially T cells.

[0108] The modified IL-7 or IL-7 fusion protein of the present invention may further comprise a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier may be any non-toxic material suitable for delivery to a patient. The carrier may be distilled water, alcohol, fat, wax or an inert solid. In addition, any pharmaceutically acceptable adjuvant (buffer, dispersant) may also be included therein.

[0109] In addition, the pharmaceutical composition containing the modified IL-7 or IL-7 fusion protein of the present invention can be administered to the subject by various methods. For example, the composition can be administered parenterally, such as subcutaneously, intramuscularly or intravenously. The composition can be sterilized by conventional aseptic methods. The composition may contain pharmaceutically acceptable auxiliary substances and adjuvants required for regulating physiological conditions such as pH regulation, toxicity regulators and the like. Specific examples may include sodium acetate, potassium chloride, calcium chloride, sodium lactate, etc. The concentration of the fusion protein contained in the preparation can vary widely. For example, by weight, the concentration of the fusion protein can be less than about 0.5%, usually or at least about 1% to as much as 15% to 20%. The concentration can be selected based on the specific method of administration selected, the volume of the fluid, the viscosity, etc.

[0110] In another aspect, the present invention provides a method for preventing or treating a disease by administering a composition containing the modified IL-7 or IL-7 fusion protein of the present invention as an active ingredient.

[0111] The method comprises administering a therapeutically effective amount of the modified IL-7 or IL-7 fusion protein of the present invention to a subject in need thereof, wherein the subject has a health condition directly related or unrelated to the target disease. The subject may be a mammal, preferably a human.

[0112] The composition of the present invention can be administered by any route. The composition of the present invention can be provided to animals via appropriate means by direct administration (e.g., by injection, transplantation or topical administration in tissue regions for topical administration) or systemic administration (e.g., parenteral or oral). When the composition of the present invention is administered parenterally by intravenous, subcutaneous, intraocular, intraperitoneal, intramuscular, oral, rectal, intraocular, intracerebral, intracranial, intraspinal, intraventricular, intrathecal, intracisternal, intracapsular, intranasal or aerosol administration, the composition preferably comprises an aqueous or physiologically applicable suspension of a part of a body fluid or its solution. Therefore, a physiologically acceptable carrier or transporter can be added to the composition and delivered to the patient, which will not have a negative impact on the patient's electrolyte and / or volume balance. Therefore, a physiologically acceptable carrier or transporter can be normal saline.

[0113] In addition, DNA constructs (or genomic constructs) comprising nucleic acids containing modified IL-7 or IL-7 fusion proteins of the invention can be used as part of a gene therapy regimen.

[0114] In the present invention, in order to reconstruct or supplement the function of the desired protein, an expression vector capable of expressing the fusion protein in a specific cell can be administered together with any biologically effective carrier. This can be any preparation or composition that can effectively deliver the gene encoding the desired protein or IL-7 fusion protein to the cell in vivo.

[0115] In order to use the nucleic acid encoding the modified IL-7 or IL-7 fusion protein for gene therapy, the target gene can be inserted into a viral vector, a recombinant bacterial plasmid or a recombinant eukaryotic plasmid. Viral vectors can include recombinant retroviruses, adenoviruses, adeno-associated viruses and herpes simplex virus-1, etc. The nucleic acid encoding the fusion protein of the present invention can be used for gene therapy in a human dosage range of 0.1 mg to 200 mg. In an exemplary embodiment, the nucleic acid encoding the fusion protein of the present invention can be in a preferred dosage range of 0.6 mg to 100 mg for humans. In an exemplary embodiment, the nucleic acid encoding the fusion protein of the present invention can be in a preferred dosage range of 1.2 mg to 50 mg for humans.

[0116] The unit dose of the modified IL-7 or IL-7 fusion protein of the present invention can be in the range of 0.001 mg / kg to 10 mg / kg. In an exemplary embodiment, the unit dose of the modified IL-7 or IL-7 fusion protein can be in the range of 0.01 mg / kg to 2 mg / kg. In an exemplary embodiment, the unit dose of the protein can be in the range of 0.02 mg / kg to 1 mg / kg for humans. The unit dose may vary depending on the disease and adverse reactions of the subject being treated. The administration of the modified IL-7 protein can be performed by regular bolus injection or external reservoir (e.g., intravenous bag) or by continuous intravenous, subcutaneous or intraperitoneal administration from the inside (e.g., biocorroded implant).

[0117] The modified IL-7 or IL-7 fusion protein of the present invention can be administered in combination with other drugs or physiologically active substances that have a preventive or therapeutic effect on the disease to be prevented or treated, or can be combined with other drugs to prepare a combined preparation, for example, it can be administered in combination with an immunostimulant such as hematopoietic growth factor, cytokine, antigen and adjuvant. The hematopoietic growth factor can be stem cell factor (SCF), G-CSF, GM-CSF or Flt-3 ligand. The cytokine can be gamma interferon, IL-2, IL-15, IL-21, IL-12, RANTES or B7-1.

[0118] The method of using the composition containing the modified IL-7 or IL-7 fusion protein of the present invention for preventing or treating diseases may also include administering it in combination with other drugs or physiologically active substances, and the combined administration route, administration period and dosage can be determined based on the type of disease, the patient's health condition, the purpose of treatment or prevention, and other drugs or physiologically active substances to be administered.

[0119] Mode for Carrying Out the Invention

[0120] The present invention will be described in detail below in conjunction with examples. The following examples are intended to further illustrate the present invention without limiting its scope.

[0121] Example 1: Preparation of modified IL-7 protein containing oligopeptide coupled to IL-7

[0122] A modified IL-7 protein containing an oligopeptide coupled to the N-terminus of IL-7 was prepared, wherein the human IL-7 sequence (SEQ ID NO: 1) was used as IL-7, and methionine (M), glycine (G), MM, GG, MG, GM, MMM, MMG, MGM, GMM, MGG, GMG, GGM, GGG, DDD or MMMM sequence was used as the oligopeptide.

[0123] like Figure 1As shown in A, various forms of modified IL-7 having the structure of "A'-IL-7" were prepared. In this example, methionine (M), glycine (G), MM, GG, MG, GM, MMM, MMG, MGM, GMM, MGG, GMG, GGM, GGG, DDD or MMMM sequence was used as the second domain (oligopeptide, 'A'). For IL-7 fused to an oligopeptide as the first domain, the nucleic acid sequence of SEQ ID NO: 28 was used. The complete nucleic acid sequence of the fusion form of IL-7 and the oligopeptide was obtained and then inserted into the expression vector. As a negative control, an IL-7 protein without oligopeptide modification was prepared in the same manner.

[0124] The expression vector containing A-IL-7 gene was transfected into HEK293 cells. Based on 300mL suspension culture, 208.3μgDNA and 416.6μg (μL) polyethyleneimine (PEI) (w / w) were used to prepare the complex, which was then transfected into HEK293F cells. After 6 days of transfection, cell culture was obtained and western blot was performed to evaluate the expression rate of the target protein. Then, the culture was centrifuged at 8,000rpm for 30 minutes, the culture debris was removed, and the bottle top filter with a pore size of 0.22μm was used to filter. As a result, a culture medium containing modified IL-7 of M-IL-7, G-IL-7, MM-IL-7, GG-IL-7, MG-IL-7, GM-IL-7, MMM-IL-7, MMG-IL-7, MGM-IL-7, GMM-IL-7, MGG-IL-7, GMG-IL-7, GGM-IL-7 and MMMM-IL-7 was obtained.

[0125] Example 2: Preparation of IL-7 fusion protein in which the Fc region is coupled to the C-terminus of IL-7

[0126] An IL-7 fusion protein, i.e., a second domain-first domain-third domain, is prepared, wherein a polypeptide consisting of a heterologous amino acid sequence is further coupled to the C-terminus of the modified IL-7. The sequence of human IL-7 (SEQ ID NO: 1) is used as the first domain, and the sequence of M, G, MM, GG, MG, GM, MMM, MMG, MGM, GMM, MGG, GMG, GGM, GGG, DDD or MMMM is used as the second domain. The sequence of the Fc region (SEQ ID NO: 9 or 14) is used as the third domain.

[0127] like Figure 1As shown in B, various forms of IL-7 fusion proteins consisting of a second domain, a first domain and a third domain were prepared. In this embodiment, methionine (M), glycine (G), MM, GG, MG, GM, MMM, MMG, MGM, GMM, MGG, GMG, GGM, GGG, DDD or MMMM sequence was used as the second domain; human IL-7 was used as the first domain; hybrid Fc (hFc, hyFc) or mouse non-lytic Fc was used as the third domain.

[0128] Specifically, hFc (hybrid Fc) disclosed in US Pat. No. 7,867,491 is used as the hybrid Fc. hFc can be coupled to a physiologically active protein, and thus exhibits a superior in vivo half-life compared to existing modified immunoglobulin Fc regions.

[0129] Gene expression vectors were prepared and transfected in the same manner as in Example 1, and cells were cultured to prepare culture fluids containing various forms of IL-7 fusion proteins. As a result, culture fluids containing G-IL-7-hyFc, M-IL-7-hyFc, MM-IL-7-hyFc, GG-IL-7-hyFc, MG-IL-7-hyFc, GM-IL-7-hyFc, MMM-IL-7-hyFc, MMG-IL-7-hyFc, MGM-IL-7-hyFc, GMM-IL-7-hyFc, MGG-7-hyFc, GGM-IL-7-hyFc, GGG-IL-7-hyFc, DDD-IL-7-hyFc or MMMM-IL-7-hyFc proteins were obtained. In addition, as a control group, a culture fluid containing an IL-7-hyFc protein consisting of the first domain and the third domain was produced.

[0130] Example 3: Production and purification of modified IL-7 and modified IL-7 fusion proteins

[0131] The production amounts of the modified IL-7 and the modified IL-7 fusion proteins in the above examples were compared. For each fusion protein, the amount of protein in the culture medium and the amount of protein present in the cells were measured.

[0132] The concentration of the protein secreted outside the cell was measured by obtaining the cell culture fluid, the amount of protein in the cell was obtained by cell lysis, and the concentration was measured by ELISA. As the first antibody, a human IL-7 specific antibody (Southern Biotech, catalog number 10122-01) was used; as the second antibody, biotin (BD, catalog number 554494) and streptavidin-HRP (BD, catalog number 554066) were used.

[0133] The results of changes in production due to the presence of oligopeptides coupled to the N-terminus are shown in Table 2 below.

[0134] [Table 2]

[0135]

[0136] The results are shown in Table 2. The production amount of MGM-IL-7 was increased compared to IL-7 not coupled to the oligopeptide or DDD-IL-7 coupled to amino acids other than methionine and glycine.

[0137] Furthermore, when hyFc was further fused to the C-terminus of modified IL-7, the produced protein was shown to be present at a high concentration, showing an approximately 2.8-fold increase in relative total production.

[0138] Example 4: Production evaluation of the prepared modified IL-7 and IL-7 fusion proteins

[0139] In the gene construct prepared in Example 2, each gene of IL-7-hyFc and MGM-IL-7-hyFc protein is inserted into pAD15 vector. Then, pAD15 vector is transfected into CHO DG44 cells (Columbia University, the United States) by electroporation method for adherence or suspension culture. In the case of adherence culture, 5 hours after electroporation, the culture medium is replaced with a culture medium containing 10% dFBS (Gibco, USA, 30067-334), MEMα (Gibco, 12561, USA, catalog number 12561-049), HT (5-hydroxy tainamide, Gibco, USA, 11067-030). After transfection for 48 hours, the culture medium is replaced with a MEMα culture medium containing 10% dFBS without HT, and HT selection is performed. The clones selected with HT are expanded by MTX to expand productivity, and the cells are subcultured 2 or 3 times to stabilize the cells.

[0140] After HT selection and MTX amplification, the specific productivity (pg / cell / day, pcd, p / c / d) of modified IL-7 (A-IL-7) and IL-7 fusion protein (A-IL-7-hyFc) was evaluated. In the subculture, the culture supernatant was recovered, the cell number was determined, and the amount of each protein was determined from the supernatant using a human IgG ELISA kit (Bethyl, USA). The specific productivity was calculated according to the following formula 1 to evaluate the production cell line (pg / cell / day, pcd):

[0141] [Formula 1]

[0142]

[0143] Using clones selected by unit productivity evaluation, limiting dilution cloning (LDC) was performed, and as a result, single-cell clones with improved productivity were selected. The selected single-cell clones were cultured as suspension cell lines using serum-free medium. The long-term stability (LTS) test was evaluated by setting a single subculture to 3 days and performing 35 subcultures, and the results are shown in Figure 2 as follows.

[0144] As Figure 2 shown in A, the IL-7 fusion protein with the N-terminus not conjugated to the oligopeptide did not show an increase in production amount with an increase in MTX concentration. In this regard, to further improve productivity, 4 TX treatments were performed, but the effect was not good. However, as Figure 2 shown in B, the IL-7 fusion protein with the N-terminus conjugated to the oligopeptide (MGM-IL-7-hyFc) showed a significant increase in productivity in a MTX concentration-dependent manner. After the LDL performance, the production amount of the protein was shown to be approximately 28 pg / cell / day and approximately 16 μg / mL.

[0145] From the above, it can be confirmed that the conjugation of the oligopeptide to the IL-7 protein shows an excellent effect on increasing the production amount of the prepared recombinant IL-7.

[0146] Example 5: Confirmation of the stability of the prepared modified IL-7 and IL-7 fusion proteins

[0147] The culture broth samples of the IL-7-hyFc and MGM-IL-7-hyFc proteins obtained in the above examples were purified, and size exclusion (SE) HPLC was performed on the purified proteins to confirm the stability of the proteins according to the sodium chloride concentration.

[0148] First, the IL-7-hyFc and MGM-IL-7-hyFc proteins were diluted to a concentration of 1 mg / mL in buffer. The diluted proteins were filtered with a 1 mL syringe and a 0.2 μm filter and added to vials. The vials were inserted into inserts and sealed with vial caps. The proteins were injected into the SE-HPLC system in an amount of 20 μL each. SE-HPLC was performed under the following conditions, and the purity was confirmed by the obtained peaks.

[0149] <SE-HPLC performance conditions>

[0150] Column: TSK-GEL G3000SW x L column (7.8 mm × 300 mm) (Tosoh, Japan)

[0151] Column temperature: 25 °C

[0152] Stationary phase: 50 mM sodium phosphate and 100 mM, 200 mM or 300 mM sodium chloride (pH 6.8) buffer mixture

[0153] Flow rate: 0.6mL / min

[0154] Analysis time: 40 minutes

[0155] Analysis method: equal intensity method

[0156] The results are as follows Figure 3 As shown, MGM-IL-7-hyFc protein showed a stable pattern despite changes in sodium chloride concentrations compared to IL-7-hyFc protein.

[0157] Example 6: Native PAGE confirmation of the prepared modified IL-7 and IL-7 fusion proteins

[0158] As follows, the difference in stability to sodium chloride concentration between the modified IL-7 fusion protein and the IL-7 fusion protein confirmed in Example 5 was confirmed again.

[0159] Specifically, using IL-7-hyFc and MGM-IL-7-hyFc prepared under the same conditions as in the above example, native PAGE was performed according to the conditions described in the following Table 3. G-CSF-hyFc was used as a control group.

[0160] [Table 3]

[0161]

[0162] The results are as follows Figure 4 As shown, MGM-IL-7-hyFc protein did not aggregate compared with IL-7-hyFc protein, which was consistent with the results of SE-HPLC.

[0163] Example 7: Analysis of culture samples of prepared modified IL-7 and IL-7 fusion proteins

[0164] Among the cell lines that can produce IL-7-hyFc or MGM-IL-7-hyFc protein, the cell line with the highest production amount was selected based on the results of Examples 5 and 6. Then, under the same conditions as in Example 5, the subculture fluid was obtained by the same method and subjected to SE-HPLC.

[0165] The results are as follows Figure 5As shown in Figure A, the relative production amount of MGM-IL-7-hyFc was 2091%, which was about 21 times the amount of the produced IL-7-hyFc protein, when the amount of the target protein was compared with the total protein produced by each host cell. In addition, when the purity of IL-7-hyFc was about 11.3%, the purity of MGM-IL-7-hyFc protein was about 66.4%, which showed an increase of about 6 times ( Figure 5 B).

[0166] From the results, it was confirmed that coupling of oligopeptides to IL-7 protein showed an excellent effect on improving the purity and production amount of the prepared recombinant IL-7 protein.

[0167] Example 8: Pharmacokinetics of the prepared modified IL-7 and IL-7 fusion proteins

[0168] The pharmacokinetic profile (PK) was confirmed by comparing the half-life and area under the curve (AUC) of the prepared IL-7-hyFc and MGM-IL-7-hyFc recombinant proteins.

[0169] First, male Sprague Dawley (SD) rats (5 rats / group) were subcutaneously administered with 0.2 mg / kg of each recombinant protein. Blood samples were collected before and 4, 8, 12, 24, 48, 72, 96, 120, 144 and 168 hours after administration, and stored at room temperature for 30 minutes to allow the blood samples to agglutinate. The agglutinated blood samples were centrifuged at 3,000 rpm for 10 minutes, and the serum of each sample was obtained and stored in a deep freezer.

[0170] The samples were analyzed by an assay designed to specifically detect intact forms of recombinant proteins that have not been cleaved. Specifically, the method is to coat the plate with a mouse capture antibody (R&D, catalog number MAB207) coupled to human IL-7, load the sample containing the prepared recombinant protein onto the plate, and then detect the target protein using a secondary antibody (SouthernBiotech, catalog number 9190-05), which is coupled to HRP conjugated to mouse human immunoglobulin G4 (IgG4). The sample was diluted 10 times with 1× PBS containing 10% skim milk and analyzed at the linear position of the standard curve to quantify the sample. The results are shown in Figure 6 As shown, it shows the amount of protein remaining in the blood and the area under the curve of drug concentration at each time point.

[0171] As a result, IL-7-hyFc and MGM-IL-7-hyFc recombinant proteins showed similar AUC values ​​(about 1.2 times). Thus, it was confirmed that the fusion of the oligopeptide as the second domain did not cause pharmacokinetic changes in the first domain. Therefore, MGM-IL-7-hyFc recombinant protein and IL-7-hyFc recombinant protein can show similar pharmacokinetic characteristics in vivo.

[0172] Example 9: Immunogenicity of the prepared modified IL-7 and IL-7 fusion proteins

[0173] The anti-drug antibody (ADA) production abilities of the administered IL-7-hyFc and MGM-IL-7-hyFc recombinant proteins prepared as above were compared to examine the antigenicity of each IL-7 fusion protein.

[0174] First, blood samples obtained in the same manner as described in Example 8 were loaded onto a plate coated with 0.2 μg / well of IL-7-hyFc or MGM-IL-7-hyFc recombinant protein. Then, the samples were analyzed using a test method for detecting ADA in rats using a rat immunoglobulin antibody conjugated to HRP (Southern Biotech, catalog number 1031-05).

[0175] Specifically, the sample was diluted until the reaction of ADA became the same as that of normal rat serum (Negative Cut Off; NCO), and the sample reaction according to the dilution factor was measured by optical density. Figure 7 shown.

[0176] The results are as follows Figure 7 As shown, the dilution factor required to reach the negative cut-off value (NCO) of IL-7-hyFc and MGM-IL-7-hyFc was similar. The results confirmed that the fusion of the oligopeptide as the second domain did not increase the antigenicity.

[0177] Example 10: Pharmacodynamic properties of prepared modified IL-7 and IL-7 fusion proteins

[0178] The white blood cell count (WBC) was compared when the MGM-IL-7-hyFc and IL-7-hyFc recombinant proteins prepared as described above were administered, and the pharmacodynamic properties of each protein were confirmed.

[0179] First, each protein was subcutaneously administered to male SD rats (5 rats / group) at an amount of 0.2 mg / kg. Then, blood samples were collected from the rats before administration and at 1 week, 2 week, and 3 week after administration. In order to prevent agglutination of the blood samples, the samples were obtained in EDTA-treated test tubes, mixed for 5 minutes and stabilized, and the number of WBCs was analyzed by complete blood count (CBC).

[0180] The results are as follows Figure 8 As shown, IL-7-hyFc and MGM-IL-7-hyFc recombinant proteins increased the number of WBCs to the highest level in a similar manner at week 2 after administration. In other words, the fusion of the second domain oligopeptide did not cause any change in pharmacodynamics. Therefore, it was confirmed that IL-7-hyFc and MGM-IL-7-hyFc recombinant proteins can exhibit similar pharmacodynamic properties.

[0181] Example 11: Comparison of in vitro activities of prepared modified IL-7 and IL-7 fusion proteins

[0182] The biological activity was analyzed using 2E8 cells (ATCC, TIB-239), which are mouse immature B lymphocytes.

[0183] First, cells were seeded into 96-well plates (1×10 5 cells / 50μL / well), and the concentration of MGM-IL-7-hyFc was gradually diluted from 750pM to 2.93pM, and treated in the wells. The cells were cultured in an incubator at 37°C, 5% CO2 for 70 hours, treated with MTS at a concentration of 20μL / well, and then cultured in an incubator (37°C, 5% CO2) for 4 hours. Then, the absorbance was measured at 490nm. Specifically, WHO international standard human IL-7 (NIBSC code: 90 / 530, 100,000 units) was used as a control group. A calibration curve (4-parameter fitting) was generated as the concentration of MGM-IL-7-hyFc treatment changed, and the analysis results are shown in Fig. 9 .

[0184] The results are as follows Fig. 9 As shown, based on the international standard of 100,000 units, the logEC of MGM-IL-7-hyFc 50 The activity was shown to be 126,000 units, and the PLA-based activity was shown to be 371,000 units. This indicates that the activity of MGM-IL-7-hyFc is similar to or higher than that of the international standard human IL-7, taking into account the number of IL-7 molecules.

[0185] Example 12: Preventive and therapeutic effects of the prepared modified IL-7 fusion protein in a model infected with a lethal dose of influenza virus

[0186] 3LD is administered intranasally through anesthesia 50 H5N2 virus (A / Aquatic bird / Korea / W81 / 2005) was used to prepare a mouse model with a lethal dose of influenza. Usually, mice infected with the virus begin to lose weight from 2 to 3 days and die after one week. The IL-7 recombinant protein prepared in Examples 2 and 4 was administered intranasally to the disease model thus prepared, and IL-7-mFc (mouse Fc) (SEQ ID NO: 27) was used as a control group.

[0187] In particular, G-CSF can inhibit early influenza virus infection and proliferate neutrophils, thereby promoting immune response. Therefore, G-CSF-hyFc was used as another experimental group.

[0188] Six mice were used in each experimental group, and IL-7-mFc (IL-7-mouse Fc), MGM-IL-7-hyFc, or G-CSF-hyFc were intranasally administered 14 days before infection with a lethal dose of influenza. 50 H5N2 virus, and the body weight and survival rate were observed for 20 days.

[0189] The results are as follows Fig.10 As shown, body weight of all groups began to decrease ( Fig.10 A). However, the difference in weight loss between the IL-7-mFc-treated group and the MGM-IL-7-hyFc-treated group gradually narrowed, and the weight was gradually restored, and their survival rate was high, which was different from the control group. The IL-7-mFc-treated group had 100% survival, and the MGM-IL-7-hyFc-treated group showed a survival rate of 83% ( Fig.10 B).

[0190] The reason why MGM-IL-7-hyFc was observed to be slightly less effective than IL-7-mFc appears to be due to species differences, that is, in the mouse in vivo system, human-derived Fc is less functional than murine-derived Fc.

[0191] Meanwhile, the groups treated with PBS or G-CSF-hyFc showed very low effects, such that the survival rate of mice infected with a lethal dose of influenza was 0% within 10 days.

[0192] In conclusion, MGM-IL-7-hyFc recombinant protein showed a strong effect in the influenza model, but G-CSF-hyFc did not, indicating that MGM-IL-7 is very effective in influenza.

[0193] Example 13: Therapeutic effect of the prepared modified IL-7 fusion protein in a model with TC-1 cancer disease

[0194] To prepare a disease model with endometrial cancer, mice were intraperitoneally administered 3 mg of Depo-Provera to regulate their menstrual period. Within 4 days, mice were vaginally administered with nonoxynol-9 (N9, USP, catalog number 1467950) to stimulate vaginal tissue, and the remaining N9 was removed by washing with PBS. Then, to transplant cancer cells into the uterus, 1×10 5 TC-1 cells (Dr. Jae-Tae LEE, School of Medicine, Kyungpook National University) were added, and then 1 day later, 1 μg of MGM-IL-7-hyFc was administered to the cervix.

[0195] As a result, TC-1 tumor cells were implanted into the cervix or vagina and grew 28 days after administration of the fusion protein. Fig.11 As shown, cancer cells proliferated and were exposed outside the vaginal opening. In the case of the control group administered with PBS, 6 out of 10 mice were observed to have proliferation of TC-1 cells, and one of them died due to excessive proliferation of cancer cells.

[0196] In contrast, in the experimental group administered with MGM-IL-7 fusion protein, only 2 out of 10 mice showed symptoms of TC-1 cell proliferation, and no mice died. Therefore, it was confirmed that modified IL-7 fusion protein is effective for the prevention and treatment of cancer. Sequence Listing <110> GNACINI LIMITED <120> Modified interleukin-7 protein and its use <130> PCB602014GNX <150> KR 2015 / 0082793 <151> 2015-06-11 <160> 40 <170> KoPatentIn 3.0 <210> 1 <211> 177 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of human IL-7 (Accession number : P13232) <400> 1 Met Phe His Val Ser Phe Arg Tyr Ile Phe Gly Leu Pro Pro Leu Ile 1 5 10 15 Leu Val Leu Leu Pro Val Ala Ser Ser Asp Cys Asp Ile Glu Gly Lys 20 25 30 Asp Gly Lys Gln Tyr Glu Ser Val Leu Met Val Ser Ile Asp Gln Leu 35 40 45 Leu Asp Ser Met Lys Glu Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe 50 55 60 Asn Phe Phe Lys Arg His Ile Cys Asp Ala Asn Lys Glu Gly Met Phe 65 70 75 80 Leu Phe Arg Ala Ala Arg Lys Leu Arg Gln Phe Leu Lys Met Asn Ser 85 90 95 Thr Gly Asp Phe Asp Leu His Leu Leu Lys Val Ser Glu Gly Thr Thr 100 105 110 Ile Leu Leu Asn Cys Thr Gly Gln Val Lys Gly Arg Lys Pro Ala Ala 115 120 125 Leu Gly Glu Ala Gln Pro Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu 130 135 140 Lys Glu Gln Lys Lys Leu Asn Asp Leu Cys Phe Leu Lys Arg Leu Leu 145 150 155 160 Gln Glu Ile Lys Thr Cys Trp Asn Lys Ile Leu Met Gly Thr Lys Glu 165 170 175 His <210> 2 <211> 154 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of rat IL-7 (Accession number : P56478) <400> 2 Met Phe His Val Ser Phe Arg Tyr Ile Phe Gly Ile Pro Pro Leu Ile 1 5 10 15 Leu Val Leu Leu Pro Val Thr Ser Ser Asp Cys His Ile Lys Asp Lys 20 25 30 Asp Gly Lys Ala Phe Gly Ser Val Leu Met Ile Ser Ile Asn Gln Leu 35 40 45 Asp Lys Met Thr Gly Thr Asp Ser Asp Cys Pro Asn Asn Glu Pro Asn 50 55 60 Phe Phe Lys Lys His Leu Cys Asp Asp Thr Lys Glu Ala Ala Phe Leu 65 70 75 80 Asn Arg Ala Ala Arg Lys Leu Arg Gln Phe Leu Lys Met Asn Ile Ser 85 90 95 Glu Glu Phe Asn Asp His Leu Leu Arg Val Ser Asp Gly Thr Gln Thr 100 105 110 Leu Val Asn Cys Thr Ser Lys Glu Glu Lys Thr Ile Lys Glu Gln Lys 115 120 125 Lys Asn Asp Pro Cys Phe Leu Lys Arg Leu Leu Arg Glu Ile Lys Thr 130 135 140 Cys Trp Asn Lys Ile Leu Lys Gly Ser Ile 145 150 <210> 3 <211> 154 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of mouse IL-7 (Accession number : P10168) <400> 3 Met Phe His Val Ser Phe Arg Tyr Ile Phe Gly Ile Pro Pro Leu Ile 1 5 10 15 Leu Val Leu Leu Pro Val Thr Ser Ser Glu Cys His Ile Lys Asp Lys 20 25 30 Glu Gly Lys Ala Tyr Glu Ser Val Leu Met Ile Ser Ile Asp Glu Leu 35 40 45 Asp Lys Met Thr Gly Thr Asp Ser Asn Cys Pro Asn Asn Glu Pro Asn 50 55 60 Phe Phe Arg Lys His Val Cys Asp Asp Thr Lys Glu Ala Ala Phe Leu 65 70 75 80 Asn Arg Ala Ala Arg Lys Leu Lys Gln Phe Leu Lys Met Asn Ile Ser 85 90 95 Glu Glu Phe Asn Val His Leu Leu Thr Val Ser Gln Gly Thr Gln Thr 100 105 110 Leu Val Asn Cys Thr Ser Lys Glu Glu Lys Asn Val Lys Glu Gln Lys 115 120 125 Lys Asn Asp Ala Cys Phe Leu Lys Arg Leu Leu Arg Glu Ile Lys Thr 130 135 140 Cys Trp Asn Lys Ile Leu Lys Gly Ser Ile 145 150 <210> 4 <211> 177 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of monkey IL-7 (Accession number : NP_001279008) <400> 4 Met Phe His Val Ser Phe Arg Tyr Ile Phe Gly Leu Pro Pro Leu Ile 1 5 10 15 Leu Val Leu Leu Pro Val Ala Ser Ser Asp Cys Asp Ile Glu Gly Lys 20 25 30 Asp Gly Lys Gln Tyr Glu Ser Val Leu Met Val Ser Ile Asp Gln Leu 35 40 45 Leu Asp Ser Met Lys Glu Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe 50 55 60 Asn Phe Phe Lys Arg His Leu Cys Asp Asp Asn Lys Glu Gly Met Phe 65 70 75 80 Leu Phe Arg Ala Ala Arg Lys Leu Lys Gln Phe Leu Lys Met Asn Ser 85 90 95 Thr Gly Asp Phe Asp Leu His Leu Leu Lys Val Ser Glu Gly Thr Thr 100 105 110 Ile Leu Leu Asn Cys Thr Gly Lys Val Lys Gly Arg Lys Pro Ala Ala 115 120 125 Leu Gly Glu Pro Gln Pro Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu 130 135 140 Lys Glu Gln Lys Lys Leu Asn Asp Ser Cys Phe Leu Lys Arg Leu Leu 145 150 155 160 Gln Lys Ile Lys Thr Cys Trp Asn Lys Ile Leu Met Gly Thr Lys Glu 165 170 175 His <210> 5 <211> 176 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of cow IL-7 (Accession number : P26895) <400> 5 Met Phe His Val Ser Phe Arg Tyr Ile Phe Gly Ile Pro Pro Leu Ile 1 5 10 15 Leu Val Leu Leu Pro Val Ala Ser Ser Asp Cys Asp Ile Ser Gly Lys 20 25 30 Asp Gly Gly Ala Tyr Gln Asn Val Leu Met Val Asn Ile Asp Asp Leu 35 40 45 Asp Asn Met Ile Asn Phe Asp Ser Asn Cys Leu Asn Asn Glu Pro Asn 50 55 60 Phe Phe Lys Lys His Ser Cys Asp Asp Asn Lys Glu Ala Ser Phe Leu 65 70 75 80 Asn Arg Ala Ser Arg Lys Leu Arg Gln Phe Leu Lys Met Asn Ile Ser 85 90 95 Asp Asp Phe Lys Leu His Leu Ser Thr Val Ser Gln Gly Thr Leu Thr 100 105 110 Leu Leu Asn Cys Thr Ser Lys Gly Lys Gly Arg Lys Pro Pro Ser Leu 115 120 125 Ser Glu Ala Gln Pro Thr Lys Asn Leu Glu Glu Asn Lys Ser Ser Lys 130 135 140 Glu Gln Lys Lys Gln Asn Asp Leu Cys Phe Leu Lys Ile Leu Leu Gln 145 150 155 160 Lys Ile Lys Thr Cys Trp Asn Lys Ile Leu Arg Gly Ile Lys Glu His 165 170 175 <210> 6 <211> 176 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of sheep IL-7 (Accession number : Q28540) <400> 6 Met Phe His Val Ser Phe Arg Tyr Ile Phe Gly Ile Pro Pro Leu Ile 1 5 10 15 Leu Val Leu Leu Pro Val Ala Ser Ser Asp Cys Asp Phe Ser Gly Lys 20 25 30 Asp Gly Gly Ala Tyr Gln Asn Val Leu Met Val Ser Ile Asp Asp Leu 35 40 45 Asp Asn Met Ile Asn Phe Asp Ser Asn Cys Leu Asn Asn Glu Pro Asn 50 55 60 Phe Phe Lys Lys His Ser Cys Asp Asp Asn Lys Glu Ala Ser Phe Leu 65 70 75 80 Asn Arg Ala Ala Arg Lys Leu Lys Gln Phe Leu Lys Met Asn Ile Ser 85 90 95 Asp Asp Phe Lys Leu His Leu Ser Thr Val Ser Gln Gly Thr Leu Thr 100 105 110 Leu Leu Asn Cys Thr Ser Lys Gly Lys Gly Arg Lys Pro Pro Ser Leu 115 120 125 Gly Glu Ala Gln Pro Thr Lys Asn Leu Glu Glu Asn Lys Ser Leu Lys 130 135 140 Glu Gln Arg Lys Gln Asn Asp Leu Cys Phe Leu Lys Ile Leu Leu Gln 145 150 155 160 Lys Ile Lys Thr Cys Trp Asn Lys Ile Leu Arg Gly Ile Thr Glu His 165 170 175 <210> 7 <211> 384 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of human IgD constant region (Genbank accession No. P01880) <400> 7 Ala Pro Thr Lys Ala Pro Asp Val Phe Pro Ile Ile Ser Gly Cys Arg 1 5 10 15 His Pro Lys Asp Asn Ser Pro Val Val Leu Ala Cys Leu Ile Thr Gly 20 25 30 Tyr His Pro Thr Ser Val Thr Val Thr Trp Tyr Met Gly Thr Gln Ser 35 40 45 Gln Pro Gln Arg Thr Phe Pro Glu Ile Gln Arg Arg Asp Ser Tyr Tyr 50 55 60 Met Thr Ser Ser Gln Leu Ser Thr Pro Leu Gln Gln Trp Arg Gln Gly 65 70 75 80 Glu Tyr Lys Cys Val Val Gln His Thr Ala Ser Lys Ser Lys Lys Glu 85 90 95 Ile Phe Arg Trp Pro Glu Ser Pro Lys Ala Gln Ala Ser Ser Val Pro 100 105 110 Thr Ala Gln Pro Gln Ala Glu Gly Ser Leu Ala Lys Ala Thr Thr Ala 115 120 125 Pro Ala Thr Thr Arg Asn Thr Gly Arg Gly Gly Glu Glu Lys Lys Lys 130 135 140 Glu Lys Glu Lys Glu Glu Gln Glu Glu Arg Glu Thr Lys Thr Pro Glu 145 150 155 160 Cys Pro Ser His Thr Gln Pro Leu Gly Val Tyr Leu Leu Thr Pro Ala 165 170 175 Val Gln Asp Leu Trp Leu Arg Asp Lys Ala Thr Phe Thr Cys Phe Val 180 185 190 Val Gly Ser Asp Leu Lys Asp Ala His Leu Thr Trp Glu Val Ala Gly 195 200 205 Lys Val Pro Thr Gly Gly Val Glu Glu Gly Leu Leu Glu Arg His Ser 210 215 220 Asn Gly Ser Gln Ser Gln His Ser Arg Leu Thr Leu Pro Arg Ser Leu 225 230 235 240 Trp Asn Ala Gly Thr Ser Val Thr Cys Thr Leu Asn His Pro Ser Leu 245 250 255 Pro Pro Gln Arg Leu Met Ala Leu Arg Glu Pro Ala Ala Gln Ala Pro 260 265 270 Val Lys Leu Ser Leu Asn Leu Leu Ala Ser Ser Asp Pro Pro Glu Ala 275 280 285 Ala Ser Trp Leu Leu Cys Glu Val Ser Gly Phe Ser Pro Pro Asn Ile 290 295 300 Leu Leu Met Trp Leu Glu Asp Gln Arg Glu Val Asn Thr Ser Gly Phe 305 310 315 320 Ala Pro Ala Arg Pro Pro Pro Gln Pro Gly Ser Thr Thr Phe Trp Ala 325 330 335 Trp Ser Val Leu Arg Val Pro Ala Pro Pro Ser Pro Gln Pro Ala Thr 340 345 350 Tyr Thr Cys Val Val Ser His Glu Asp Ser Arg Thr Leu Leu Asn Ala 355 360 365 Ser Arg Ser Leu Glu Val Ser Tyr Val Thr Asp His Gly Pro Met Lys 370 375 380 <210> 8 <211> 327 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of Partial human IgG4 constant region (Genbank accession No. AAH25985) <400> 8 Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Cys Ser Arg 1 5 10 15 Ser Thr Ser Glu Ser Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr 20 25 30 Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser 35 40 45 Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser 50 55 60 Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Lys Thr 65 70 75 80 Tyr Thr Cys Asn Val Asp His Lys Pro Ser Asn Thr Lys Val Asp Lys 85 90 95 Arg Val Glu Ser Lys Tyr Gly Pro Pro Cys Pro Ser Cys Pro Ala Pro 100 105 110 Glu Phe Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys 115 120 125 Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val 130 135 140 Asp Val Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp 145 150 155 160 Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe 165 170 175 Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp 180 185 190 Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu 195 200 205 Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg 210 215 220 Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys 225 230 235 240 Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp 245 250 255 Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys 260 265 270 Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser 275 280 285 Arg Leu Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser 290 295 300 Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser 305 310 315 320 Leu Ser Leu Ser Leu Gly Lys 325 <210> 9 <211> 245 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hyFc <400> 9 Arg Asn Thr Gly Arg Gly Gly Glu Glu Lys Lys Lys Glu Lys Glu Lys 1 5 10 15 Glu Glu Gln Glu Glu Arg Glu Thr Lys Thr Pro Glu Cys Pro Ser His 20 25 30 Thr Gln Pro Leu Gly Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 35 40 45 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 50 55 60 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 65 70 75 80 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser 85 90 95 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 100 105 110 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 115 120 125 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 130 135 140 Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln 145 150 155 160 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 165 170 175 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 180 185 190 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 195 200 205 Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser 210 215 220 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 225 230 235 240 Leu Ser Leu Gly Lys 245 <210> 10 <211> 245 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hyFcM1 <400> 10 Arg Asn Thr Gly Arg Gly Gly Glu Glu Lys Lys Gly Gly Lys Glu Lys 1 5 10 15 Glu Glu Gln Glu Glu Arg Glu Thr Lys Thr Pro Glu Cys Pro Ser His 20 25 30 Thr Gln Pro Leu Gly Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 35 40 45 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 50 55 60 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 65 70 75 80 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser 85 90 95 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 100 105 110 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 115 120 125 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 130 135 140 Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln 145 150 155 160 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 165 170 175 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 180 185 190 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 195 200 205 Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser 210 215 220 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 225 230 235 240 Leu Ser Leu Gly Lys 245 <210> 11 <211> 245 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hyFcM2 <400> 11 Arg Asn Thr Gly Arg Gly Gly Glu Glu Lys Lys Gly Ser Lys Glu Lys 1 5 10 15 Glu Glu Gln Glu Glu Arg Glu Thr Lys Thr Pro Glu Cys Pro Ser His 20 25 30 Thr Gln Pro Leu Gly Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 35 40 45 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 50 55 60 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 65 70 75 80 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser 85 90 95 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 100 105 110 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 115 120 125 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 130 135 140 Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln 145 150 155 160 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 165 170 175 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 180 185 190 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 195 200 205 Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser 210 215 220 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 225 230 235 240 Leu Ser Leu Gly Lys 245 <210> 12 <211> 245 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hyFcM3 <400> 12 Arg Asn Thr Gly Arg Gly Gly Glu Glu Lys Lys Ser Gly Lys Glu Lys 1 5 10 15 Glu Glu Gln Glu Glu Arg Glu Thr Lys Thr Pro Glu Cys Pro Ser His 20 25 30 Thr Gln Pro Leu Gly Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 35 40 45 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 50 55 60 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 65 70 75 80 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser 85 90 95 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 100 105 110 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 115 120 125 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 130 135 140 Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln 145 150 155 160 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 165 170 175 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 180 185 190 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 195 200 205 Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser 210 215 220 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 225 230 235 240 Leu Ser Leu Gly Lys 245 <210> 13 <211> 245 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of hyFcM4 <400> 13 Arg Asn Thr Gly Arg Gly Gly Glu Glu Lys Lys Ser Ser Lys Glu Lys 1 5 10 15 Glu Glu Gln Glu Glu Arg Glu Thr Lys Thr Pro Glu Cys Pro Ser His 20 25 30 Thr Gln Pro Leu Gly Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr 35 40 45 Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val 50 55 60 Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val 65 70 75 80 Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser 85 90 95 Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu 100 105 110 Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser 115 120 125 Ser Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro 130 135 140 Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln 145 150 155 160 Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala 165 170 175 Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr 180 185 190 Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu 195 200 205 Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser 210 215 220 Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser 225 230 235 240 Leu Ser Leu Gly Lys 245 <210> 14 <211> 243 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of mouse IgG Fc variant <400> 14 Ala Ser Ala Glu Pro Arg Gly Pro Thr Ile Lys Pro Cys Pro Pro Cys 1 5 10 15 Lys Cys Pro Ala Pro Asn Leu Glu Gly Gly Pro Ser Val Phe Ile Phe 20 25 30 Pro Pro Lys Ile Lys Asp Val Leu Met Ile Ser Leu Ser Pro Ile Val 35 40 45 Thr Cys Val Val Val Asp Val Ser Glu Asp Asp Pro Asp Val Gln Ile 50 55 60 Ser Trp Phe Val Asn Asn Val Glu Val His Thr Ala Gln Thr Gln Thr 65 70 75 80 His Arg Glu Asp Tyr Asn Ser Thr Leu Arg Val Val Ser Ala Leu Pro 85 90 95 Ile Gln His Gln Asp Trp Met Ser Gly Lys Ala Phe Ala Cys Ala Val 100 105 110 Asn Asn Lys Asp Leu Pro Ala Pro Ile Glu Arg Thr Ile Ser Lys Pro 115 120 125 Lys Gly Ser Val Arg Ala Pro Gln Val Tyr Val Leu Pro Pro Pro Glu 130 135 140 Glu Glu Met Thr Lys Lys Gln Val Thr Leu Thr Cys Met Val Thr Asp 145 150 155 160 Phe Met Pro Glu Asp Ile Tyr Val Glu Trp Thr Asn Asn Gly Lys Thr 165 170 175 Glu Leu Asn Tyr Lys Asn Thr Glu Pro Val Leu Asp Ser Asp Gly Ser 180 185 190 Tyr Phe Met Tyr Ser Lys Leu Arg Val Glu Lys Lys Asn Trp Val Glu 195 200 205 Arg Asn Ser Tyr Ser Cys Ser Val Val His Glu Gly Leu His Asn His 210 215 220 His Thr Thr Lys Ser Phe Ser Arg Thr Pro Gly Lys Gly Gly Gly Asn 225 230 235 240 Ser Gly Ser <210> 15 <211> 153 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of modified IL-7(M) <400> 15 Met Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu Ser Val 1 5 10 15 Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu Ile Gly 20 25 30 Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His Ile Cys 35 40 45 Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg Lys Leu 50 55 60 Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu His Leu 65 70 75 80 Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr Gly Gln 85 90 95 Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro Thr Lys 100 105 110 Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu Asn Asp 115 120 125 Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys Trp Asn 130 135 140 Lys Ile Leu Met Gly Thr Lys Glu His 145 150 <210> 16 <211> 154 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of modified IL-7(MM) <400> 16 Met Met Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu Ser 1 5 10 15 Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu Ile 20 25 30 Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His Ile 35 40 45 Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg Lys 50 55 60 Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu His 65 70 75 80 Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr Gly 85 90 95 Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro Thr 100 105 110 Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu Asn 115 120 125 Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys Trp 130 135 140 Asn Lys Ile Leu Met Gly Thr Lys Glu His 145 150 <210> 17 <211> 155 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of modified IL-7(MMM) <400> 17 Met Met Met Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu 1 5 10 15 Ser Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu 20 25 30 Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His 35 40 45 Ile Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg 50 55 60 Lys Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu 65 70 75 80 His Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr 85 90 95 Gly Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro 100 105 110 Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu 115 120 125 Asn Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys 130 135 140 Trp Asn Lys Ile Leu Met Gly Thr Lys Glu His 145 150 155 <210> 18 <211> 155 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of modified IL-7(MGM) <400> 18 Met Gly Met Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu 1 5 10 15 Ser Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu 20 25 30 Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His 35 40 45 Ile Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg 50 55 60 Lys Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu 65 70 75 80 His Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr 85 90 95 Gly Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro 100 105 110 Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu 115 120 125 Asn Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys 130 135 140 Trp Asn Lys Ile Leu Met Gly Thr Lys Glu His 145 150 155 <210> 19 <211> 155 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of modified IL-7(DDD) <400> 19 Asp Asp Asp Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu 1 5 10 15 Ser Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu 20 25 30 Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His 35 40 45 Ile Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg 50 55 60 Lys Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu 65 70 75 80 His Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr 85 90 95 Gly Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro 100 105 110 Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu 115 120 125 Asn Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys 130 135 140 Trp Asn Lys Ile Leu Met Gly Thr Lys Glu His 145 150 155 <210> 20 <211> 156 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of modified IL-7(MMMM) <400> 20 Met Met Met Met Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr 1 5 10 15 Glu Ser Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys 20 25 30 Glu Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg 35 40 45 His Ile Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala 50 55 60 Arg Lys Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp 65 70 75 80 Leu His Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys 85 90 95 Thr Gly Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln 100 105 110 Pro Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys 115 120 125 Leu Asn Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr 130 135 140 Cys Trp Asn Lys Ile Leu Met Gly Thr Lys Glu His 145 150 155 <210> 21 <211> 398 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of modified IL-7(M) fused hyFc <400> 21 Met Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu Ser Val 1 5 10 15 Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu Ile Gly 20 25 30 Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His Ile Cys 35 40 45 Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg Lys Leu 50 55 60 Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu His Leu 65 70 75 80 Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr Gly Gln 85 90 95 Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro Thr Lys 100 105 110 Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu Asn Asp 115 120 125 Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys Trp Asn 130 135 140 Lys Ile Leu Met Gly Thr Lys Glu His Arg Asn Thr Gly Arg Gly Gly 145 150 155 160 Glu Glu Lys Lys Lys Glu Lys Glu Lys Glu Glu Gln Glu Glu Arg Glu 165 170 175 Thr Lys Thr Pro Glu Cys Pro Ser His Thr Gln Pro Leu Gly Val Phe 180 185 190 Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro 195 200 205 Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val 210 215 220 Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr 225 230 235 240 Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val 245 250 255 Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys 260 265 270 Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser 275 280 285 Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro 290 295 300 Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val 305 310 315 320 Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly 325 330 335 Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp 340 345 350 Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp 355 360 365 Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His 370 375 380 Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys 385 390 395 <210> 22 <211> 399 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of modified IL-7(MM) fused hyFc <400> 22 Met Met Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu Ser 1 5 10 15 Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu Ile 20 25 30 Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His Ile 35 40 45 Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg Lys 50 55 60 Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu His 65 70 75 80 Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr Gly 85 90 95 Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro Thr 100 105 110 Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu Asn 115 120 125 Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys Trp 130 135 140 Asn Lys Ile Leu Met Gly Thr Lys Glu His Arg Asn Thr Gly Arg Gly 145 150 155 160 Gly Glu Glu Lys Lys Lys Glu Lys Glu Lys Glu Glu Gln Glu Glu Arg 165 170 175 Glu Thr Lys Thr Pro Glu Cys Pro Ser His Thr Gln Pro Leu Gly Val 180 185 190 Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr 195 200 205 Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu 210 215 220 Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys 225 230 235 240 Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser 245 250 255 Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys 260 265 270 Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile 275 280 285 Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro 290 295 300 Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu 305 310 315 320 Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn 325 330 335 Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser 340 345 350 Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg 355 360 365 Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu 370 375 380 His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys 385 390 395 <210> 23 <211> 400 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of modified IL-7(MMM) fused hyFc <400> 23 Met Met Met Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu 1 5 10 15 Ser Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu 20 25 30 Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His 35 40 45 Ile Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg 50 55 60 Lys Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu 65 70 75 80 His Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr 85 90 95 Gly Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro 100 105 110 Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu 115 120 125 Asn Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys 130 135 140 Trp Asn Lys Ile Leu Met Gly Thr Lys Glu His Arg Asn Thr Gly Arg 145 150 155 160 Gly Gly Glu Glu Lys Lys Lys Glu Lys Glu Lys Glu Glu Gln Glu Glu 165 170 175 Arg Glu Thr Lys Thr Pro Glu Cys Pro Ser His Thr Gln Pro Leu Gly 180 185 190 Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 195 200 205 Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro 210 215 220 Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 225 230 235 240 Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val 245 250 255 Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr 260 265 270 Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr 275 280 285 Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu 290 295 300 Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys 305 310 315 320 Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 325 330 335 Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 340 345 350 Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser 355 360 365 Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala 370 375 380 Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys 385 390 395 400 <210> 24 <211> 400 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of modified IL-7(MGM) fused hyFc <400> 24 Met Gly Met Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu 1 5 10 15 Ser Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu 20 25 30 Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His 35 40 45 Ile Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg 50 55 60 Lys Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu 65 70 75 80 His Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr 85 90 95 Gly Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro 100 105 110 Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu 115 120 125 Asn Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys 130 135 140 Trp Asn Lys Ile Leu Met Gly Thr Lys Glu His Arg Asn Thr Gly Arg 145 150 155 160 Gly Gly Glu Glu Lys Lys Lys Glu Lys Glu Lys Glu Glu Gln Glu Glu 165 170 175 Arg Glu Thr Lys Thr Pro Glu Cys Pro Ser His Thr Gln Pro Leu Gly 180 185 190 Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg 195 200 205 Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro 210 215 220 Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala 225 230 235 240 Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val 245 250 255 Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr 260 265 270 Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr 275 280 285 Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu 290 295 300 Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys 305 310 315 320 Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser 325 330 335 Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp 340 345 350 Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser 355 360 365 Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala 370 375 380 Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys 385 390 395 400 <210> 25 <211> 401 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of modified IL-7(MMMM) fused hyFc <400> 25 Met Met Met Met Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr 1 5 10 15 Glu Ser Val Leu Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys 20 25 30 Glu Ile Gly Ser Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg 35 40 45 His Ile Cys Asp Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala 50 55 60 Arg Lys Leu Arg Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp 65 70 75 80 Leu His Leu Leu Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys 85 90 95 Thr Gly Gln Val Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln 100 105 110 Pro Thr Lys Ser Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys 115 120 125 Leu Asn Asp Leu Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr 130 135 140 Cys Trp Asn Lys Ile Leu Met Gly Thr Lys Glu His Arg Asn Thr Gly 145 150 155 160 Arg Gly Gly Glu Glu Lys Lys Lys Glu Lys Glu Lys Glu Glu Gln Glu 165 170 175 Glu Arg Glu Thr Lys Thr Pro Glu Cys Pro Ser His Thr Gln Pro Leu 180 185 190 Gly Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser 195 200 205 Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp 210 215 220 Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn 225 230 235 240 Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val 245 250 255 Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu 260 265 270 Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys 275 280 285 Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr 290 295 300 Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr 305 310 315 320 Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu 325 330 335 Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu 340 345 350 Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys 355 360 365 Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu 370 375 380 Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly 385 390 395 400 Lys <210> 26 <211> 397 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of human IL-7 fused hyFc <400> 26 Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu Ser Val Leu 1 5 10 15 Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu Ile Gly Ser 20 25 30 Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His Ile Cys Asp 35 40 45 Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg Lys Leu Arg 50 55 60 Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu His Leu Leu 65 70 75 80 Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr Gly Gln Val 85 90 95 Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro Thr Lys Ser 100 105 110 Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu Asn Asp Leu 115 120 125 Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys Trp Asn Lys 130 135 140 Ile Leu Met Gly Thr Lys Glu His Arg Asn Thr Gly Arg Gly Gly Glu 145 150 155 160 Glu Lys Lys Lys Glu Lys Glu Lys Glu Glu Gln Glu Glu Arg Glu Thr 165 170 175 Lys Thr Pro Glu Cys Pro Ser His Thr Gln Pro Leu Gly Val Phe Leu 180 185 190 Phe Pro Pro Lys Pro Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu 195 200 205 Val Thr Cys Val Val Val Asp Val Ser Gln Glu Asp Pro Glu Val Gln 210 215 220 Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys 225 230 235 240 Pro Arg Glu Glu Gln Phe Asn Ser Thr Tyr Arg Val Val Ser Val Leu 245 250 255 Thr Val Leu His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys 260 265 270 Val Ser Asn Lys Gly Leu Pro Ser Ser Ile Glu Lys Thr Ile Ser Lys 275 280 285 Ala Lys Gly Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser 290 295 300 Gln Glu Glu Met Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys 305 310 315 320 Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln 325 330 335 Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly 340 345 350 Ser Phe Phe Leu Tyr Ser Arg Leu Thr Val Asp Lys Ser Arg Trp Gln 355 360 365 Glu Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn 370 375 380 His Tyr Thr Gln Lys Ser Leu Ser Leu Ser Leu Gly Lys 385 390 395 <210> 27 <211> 395 <212> PRT <213> Artificial Sequence <220> <223> amino acid sequence of human IL-7 fused nonlytic mouse Fc <400> 27 Asp Cys Asp Ile Glu Gly Lys Asp Gly Lys Gln Tyr Glu Ser Val Leu 1 5 10 15 Met Val Ser Ile Asp Gln Leu Leu Asp Ser Met Lys Glu Ile Gly Ser 20 25 30 Asn Cys Leu Asn Asn Glu Phe Asn Phe Phe Lys Arg His Ile Cys Asp 35 40 45 Ala Asn Lys Glu Gly Met Phe Leu Phe Arg Ala Ala Arg Lys Leu Arg 50 55 60 Gln Phe Leu Lys Met Asn Ser Thr Gly Asp Phe Asp Leu His Leu Leu 65 70 75 80 Lys Val Ser Glu Gly Thr Thr Ile Leu Leu Asn Cys Thr Gly Gln Val 85 90 95 Lys Gly Arg Lys Pro Ala Ala Leu Gly Glu Ala Gln Pro Thr Lys Ser 100 105 110 Leu Glu Glu Asn Lys Ser Leu Lys Glu Gln Lys Lys Leu Asn Asp Leu 115 120 125 Cys Phe Leu Lys Arg Leu Leu Gln Glu Ile Lys Thr Cys Trp Asn Lys 130 135 140 Ile Leu Met Gly Thr Lys Glu His Ala Ser Ala Glu Pro Arg Gly Pro 145 150 155 160 Thr Ile Lys Pro Cys Pro Pro Cys Lys Cys Pro Ala Pro Asn Leu Glu 165 170 175 Gly Gly Pro Ser Val Phe Ile Phe Pro Pro Lys Ile Lys Asp Val Leu 180 185 190 Met Ile Ser Leu Ser Pro Ile Val Thr Cys Val Val Val Asp Val Ser 195 200 205 Glu Asp Asp Pro Asp Val Gln Ile Ser Trp Phe Val Asn Asn Val Glu 210 215 220 Val His Thr Ala Gln Thr Gln Thr His Arg Glu Asp Tyr Asn Ser Thr 225 230 235 240 Leu Arg Val Val Ser Ala Leu Pro Ile Gln His Gln Asp Trp Met Ser 245 250 255 Gly Lys Ala Phe Ala Cys Ala Val Asn Asn Lys Asp Leu Pro Ala Pro 260 265 270 Ile Glu Arg Thr Ile Ser Lys Pro Lys Gly Ser Val Arg Ala Pro Gln 275 280 285 Val Tyr Val Leu Pro Pro Pro Glu Glu Glu Met Thr Lys Lys Gln Val 290 295 300 Thr Leu Thr Cys Met Val Thr Asp Phe Met Pro Glu Asp Ile Tyr Val 305 310 315 320 Glu Trp Thr Asn Asn Gly Lys Thr Glu Leu Asn Tyr Lys Asn Thr Glu 325 330 335 Pro Val Leu Asp Ser Asp Gly Ser Tyr Phe Met Tyr Ser Lys Leu Arg 340 345 350 Val Glu Lys Lys Asn Trp Val Glu Arg Asn Ser Tyr Ser Cys Ser Val 355 360 365 Val His Glu Gly Leu His Asn His His Thr Thr Lys Ser Phe Ser Arg 370 375 380 Thr Pro Gly Lys Gly Gly Gly Asn Ser Gly Ser 385 390 395 <210> 28 <211> 531 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of human IL-7 <400> 28 atgttccacg tgagcttcag gtacatcttc ggcctgccac ccctgatcct ggtgctgctg 60 cctgtggcca gctccgactg cgacatcgag ggaaaagacg gcaagcagta cgaaagcgtg 120 ctgatggtgt ccatcgacca gctgctggat tctatgaagg agattgggag taactgcctg 180 aacaatgagt tcaacttctt caacggcac atttgtg ccaaagga gggaatgttc 240 ctgtttcgggg ccgctagaaa actgaggcag ttcctgaga tgacagcac cggagacttt 300 gatctgcatc tgctgaaagt gtctgaggc accacaatcc tgctgaactg cactggggcag 360 gtgaaaggaa ggaagcctgc cgctctggga gaggctcagc caccaagctc actggaggaa 420 aacaaaagcc tgaggaca gagaaactg atgacctgt gctttctgaa acggctgctg 480 caggagatca aacatgttg gacagatt ctgatggggca aaggaca c 531 <210> 29 <211> 534 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of modified IL-7(M) <400> 29 atgttccacg tgagctcag atacatctc gcctgcccc ccctgatcct gtgctgctg 60 cccgtggcca gcagcatgga ctgcgacatc gagggcaagg acggcaagca gtacgagagc 120 gtgctgatgg tgagcatcga ccagctgctg ggagcatga aggagatcgg cagcaactgc 180 ctgaacaacg agttcaactt cttcaagaga cacatctgcg acgccaaca ggaggcatg 240 300 ttcgacctgc acctgctgaa ggtgagcgag ggcacaacca tcctgctgaa ctgcaccggc 360 caggtgaagg gcagaaagcc cgccgccctg ggcgaggccc agcccaccaa gagcctggag 420 gagacaaga gcctgaagga cgagaaag ctgaacgacc tgtgcttcct gaagagactg 480 ctgcaggaga tcaagacctg ctggaacaag atcctgatgg gcaccaagga gcac 534 <210> 30 <211> 537 <212> DNA <213> Artificial Sequence <220> <223> Nucleotide sequence of modified IL-7(MM) <400> 30 atgttccacg tgagcttcag atacatcttc ggcctgcccc ccctgatcct ggtgctgctg 60 cccgtggcca gcagcatgat ggactgcgac atcgagggca aggacggcaa gcagtacgag 120 agcgtgctga tggtgagcat cgaccagctg ctggacagca tgaaggagat cggcagcaac 180 tgcctgaaca acgagttcaa cttcttcaag agacacatct gcgacgccaa caaggagggc 240 atgttcctgt tcagagccgc cagaaagctg agacagttcc tgaagatgaa cagcaccggc 300 gacttcgacc tgcacctgct gaaggtgagc gagggcacaa ccatcctgct gaactgcacc 360 ggccaggtga agggcagaaa gccgccgcc ctgggcgagg cccagcccac caagagcctg 420 gaggagaaca agagcctgaa ggagcagaag aagctgaacg acctgtgctt cctgaagaga 480 ctgctgcagg agatcaagac ctgctggaac aagatcctga tgggcaccaa ggagcac 537 <210> 31 <211> 540 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of modified IL-7(MMM) <400> 31 atgttccacg tgagcttcag atacatcttc ggcctgcccc ccctgatcct ggtgctgctg 60 cccgtggcca gcagcatgat gatggactgc gacatcgagg gcaaggacgg caagcagtac 120 gagagcgtgc tgatggtgag catcgaccag ctgctggaca gcatgaagga gatcggcagc 180 aactgcctga acaacgagtt caacttcttc aagagacaca tctgcgacgc caacaaggag 240 ggcatgttcc tgttcagagc cgccagaaag ctgagacagt tcctgaagat gaacagcacc 300 ggcgactcg acctgcacct gctgaaggtg agcgagggca caaccatcct gctgaactgc 360 accggccagg tgaagggcag aaagcccgcc gccctgggcg aggcccagcc caccaagagc 420 ctggaggaga acaagagcct gaaggagcag aagaagctga acgacctgtg cttcctgaag 480 agactgctgc aggagatcaa gacctgctgg aacaagatcc tgatgggcac caaggagcac 540 <210> 32 <211> 540 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of modified IL-7(MGM) <400> 32 atgttccacg tgagcttcag gtacatcttc ggcctgccac ccctgatcct ggtgctgctg 60 cctgtggcca gctccatggg gatggactgc gacatcgagg gaaaagacgg caagcagtac 120 gaaagcgtgc tgatggtgtc catcgaccag ctgctggatt ctatgaagga gattgggagt 180 aactgcctga acaatgagtt caacttcttc aaacggcaca tttgtgatgc caacaaggag 240 ggaatgttcc tgttcggc cgctagaaaa ctgaggcagt tcctgagat gaacagcacc 300 ggagacttg atctgcatct gctgaaagtg tctgaggca ccacaatcct gctgaactgc 360 actgggcagg tgaaggaag gaagcctgcc gctctgggag aggctcagcc aaccaagtca 420 ctggaggaaa aaaagcct gagagacag aagaactga atgactgtg ctttctgaaa 480 cggctgctgc aggagatcaa aacatgttgg aacagattc tgatgggcac aaggagcac 540 <210> 33 <211> 540 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of modified IL-7(DDD) <400> 33 atgttccacg tgagctcag atacatctc gcctgcccc ccctgatcct gtgctgctg 60 cccgtggcca gcagcgacga tgacgactgc gatccgagg gcaggcgg gcagcagc 120 gagagcgtgc tgatggtgag catcgaccag ctgctggaca gcatgaagga gatcggcagc 180 aactgcctga acacgagtt caactctc agagacaca tctgcgacgc acacgag 240 ggcatgttcc tgttcagagc cgccagaaag ctgagacagt tcctgaagagat gaacagcacc 300 ggcgacttcg acctgcacct gctgaaggtg agcgaggca caaccaccct gctgaactgc 360 accggccagg tgaagggcag aaagcccgcc gccctgggcg agccccagcc caccaagagc 420 ctggaggaga acaagagcct gaaggagcag aagaagctga acgacctgtg ctcctgaag 480 agactgctgc aggagatcaa gacctgctgg aaagatcc tgatgggcac aaggagcac 540 <210> 34 <211> 543 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of modified IL-7(MMMM) <400> 34 atgttccacg tgagctcag atacatctc gcctgcccc ccctgatcct gtgctgctg 60 cccgtggcca gcagcatgat gatgatggac tgcgacatcg agggcaag cggcaagcag 120 tacgagagcg tgctgatggt gagcatcgac cagctgctgg acagcatgaa ggagatcggc 180 agcaactgcc tgaacaacga gttcaacttc ttcagagac acatctgcga cgccaacaag 240 gaggcatgt tcctgttcag agccgccaga aagctgagac agttcctgaa gatgacacagc 300 accggcgact tcgacctgca cctgctgaag gtgagcgagg gcacaccat cctgctgaac 360 tgcaccggcc aggtgaaggg cagaaagccc gccgccctgg gcgaggccca gcccaccaag 420 agcctggagg agacaagag cctgaaggag cagaagaagc tgaacgacct gtgcttccctg 480 aagagactgc tgcaggagat caacctgc tggaacaga tcctgatggg caccaaggag 540 cac 543 <210> 35 <211> 1284 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of modified IL-7(M) fused hyFc <400> 35 atgttccacg tgagctcag atacatctc gcctgcccc ccctgatcct gtgctgctg 60 cccgtggcca gcagcatgga ctgcgacatc gagggcaagg acggcaagca gtacgagagc 120 gtgctgatgg tgagcatcga ccagctgctg ggagcatga aggagatcgg cagcaactgc 180 ctgaacaacg agttcaactt cttcaagaga cacatctgcg acgccaaca ggaggcatg 240 ttcctgttca gagccgccag aaagctgaga cagttcctga agatgacag caccggcgac 300 ttcgacctgc acctgctgaa ggtgagcgag ggcacaacca tcctgctgaa ctgcaccggc 360 caggtgaagg gcagaaagcc cgccgccctg ggcgaggccc agcccaccaa gagcctggag 420 gagaacaaga gcctgaagga gcagaagaag ctgaacgacc tgtgcttcct gagagactg 480 ctgcaggaga tcagacctg ctggacaag atcctgatgg gcaccaagga gcacaggaac 540 acaggcagag gcggcgagggagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagagaa 600 gagaccaaga cccccgagtg ccccagccac acccaccccc tgggcgtgtt cctgttccct 660 cccaagccca aggacaccct gatgatcagc agaacccccg aggtgacctg cgtggtcgtg 720 gatgtgagcc aggagatcc cgaagtgcag ttcaactggt acgtggatgg cgtggaagtg 780 cacaacgcca agaccaagcc cagagagag cagttcact ccacctacag agtggtgagc 840 gtgctgaccg tgctgcacca ggactggctg aacggcagg agtacaagtg caggtgtcc 900 aacaaaggcc tgcccagctc catcgagaag accatcagca aagccaagg catcccagca 960 gaaccccagg tgtacaccct gcctcccagc caggaagaga tgaccaagaa ccaggtgtcc 1020 ctgacctgcc tggtgaaagg cttctacccc agcgacatcg ccgtggagtg ggaaagcaac 1080 ggccagcccg agaacaatta caagacaacc cctcccgtgc tggatagcga tggcagcttc 1140 tttctgtaca gcagactgac cgtggacaag agcagatggc aggaaggcaa cgtgttcagc 1200 tgcagcgtga tgcacgaagc cctgcacaac cactacaccc agaagagcct gtccctgagc 1260 ctgggcaagt gactcgagtc from 1284 <210> 36 <211> 1272 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of modified IL-7(MM) fused hyFc <400> 36 atgttccacg tgagcttcag atacatcttc ggcctgcccc ccctgatcct ggtgctgctg 60 cccgtggcca gcagcatgat ggactgcgac atcgagggca aggacggcaa gcagtacgag 120 agcgtgctga tggtgagcat cgaccagctg ctggacagca tgaaggagat cggcagcaac 180 tgcctgaaca acgagttcaa cttcttcaag agacacatct gcgacgccaa caaggagggc 240 atgttcctgt tcagagccgc cagaaagctg agacagttcc tgaagatgaa cagcaccggc 300 gacttcgacc tgcacctgct gaaggtgagc gagggcacaa ccatcctgct gaactgcacc 360 ggccaggtga agggcagaaa gcccgccgcc ctgggcgagg cccagcccac caagagcctg 420 480 ctgctgcagg agatcaagac ctgctggaac aagatcctga tgggcaccaa ggagcacagg 540 aacacaggca gagggcggca ggagagaag aaggaagg agaaggaga cgaggagaa 600 agagagacca agaccccga gtgccccagc cacaccagc ccctgggcgt gttcctgttc 660 cctcccaagc ccaaggacac cctgatgatc agcagaaccc ccgaggtgac ctgcgtggtc 720 780 gtgcacaacg ccaagaccaa gcccagaagaa gagcagttca actccaccta cagagtggtg 840 agcgtgctga ccgtgctgca ccaggactgg ctgaacggca aggagatcaa gtgcaaggtg 900 tccaacaaag gcctgcccag ctccatcgag aagaccatca gcaaagccaa aggccagccc 960 agagaacccc aggtgtacac cctgcctccc agccaggaag agatgaccaa gaaccaggtg 1020 tcctgacct gcctggtgaa aggctctac cccagcgaca tcgccgtgga gtgggaaagc 1080 aacggccagc ccgagaacaa ttacaagaca acccctcccg tgctggatag cgatggcagc 1140 ttctttctgt acagcagact gaccgtggac aagagcagat ggcaggaagg caacgtgttc 1200 agctgcagcg tgatgcacga agccctgcac aaccactaca cccagaagag cctgtccctg 1260 agcctgggca ag 1272 <210> 37 <211> 1275 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of modified IL-7(MMM) fused hyFc <400> 37 atgttccacg tgagcttcag atacatcttc ggcctgcccc ccctgatcct ggtgctgctg 60 cccgtggcca gcagcatgat gatggactgc gacatcgagg gcaaggacgg caagcagtac 120 gagagcgtgc tgatggtgag catcgaccag ctgctggaca gcatgaagga gatcggcagc 180 aactgcctga acaacgagtt caacttcttc aagagacaca tctgcgacgc caacaaggag 240 ggcatgttcc tgttcagagc cgccagaaag ctgagacagt tcctgaagagat gaacagcacc 300 ggcgacttcg acctgcacct gctgaaggtg agcgaggca caaccaccct gctgaactgc 360 accggccagg tgaagggcag aaagcccgcc gccctgggcg agccccagcc caccaagagc 420 ctggaggaga acagagcct gaaggagcag aagaagctga acgacctgtg ctcctgaag 480 agactgctgc aggagatcaa gacctgctgg aaagatcc tgatgggcac aaggagcac 540 aggaacag gcagaggcgg yeah yeah yeah yeah yeah yeah yeah yeah yeah yeah 600 gaaagagaga ccaagacccc cgagtgcccc agccacccc agcccctggg cgtgttccctg 660 ttccctccca agcccagga caccctgatg atcagcagaa cccccgaggt gacctgcgtg 720 gtcgtggatg tgagccagga agatcccgaa gtgcagttca actggtacgt ggatggcgtg 780 gaagtgcaca acgccaagc caagcccaga gagagcagt tcaactccac ctacagagtg 840 gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg gcaggagta caagtgcaag 900 gtgtccaa aaggcctgcc cagctccatc gagaagacca tcagcaagc aaggccag 960 cccagagaac cccaggtgta caccctgcct cccagccagg aagagatgac caagaaccag 1020 gtgtccctga cctgcctggt gaaaggcttc taccccagcg acatcgccgt ggagtgggaa 1080 agcaacggcc agcccgagaa caattacaag acaacccctc ccgtgctgga tagcgatggc 1140 agcttctttc tgtacagcag actgaccgtg gacaagagca gatggcagga aggcaacgtg 1200 ttcagctgca gcgtgatgca cgaagccctg cacaaccact acacccagaa gagcctgtcc 1260 ctgagcctgg gcaag 1275 <210> 38 <211> 1275 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of modified IL-7(MGM) fused hyFc <400> 38 atgttccacg tgagcttcag gtacatcttc ggcctgccac ccctgatcct ggtgctgctg 60 cctgtggcca gctccatggg gatggactgc gacatcgagg gaaaagacgg caagcagtac 120 gaaagcgtgc tgatggtgtc catcgaccag ctgctggatt ctatgaagga gattgggagt 180 aactgcctga acaatgagtt caacttcttc aaacggcaca tttgtgatgc caacaaggag 240 ggaatgttcc tgttcggc cgctagaaaa ctgaggcagt tcctgagat gaacagcacc 300 ggagacttg atctgcatct gctgaaagtg tctgaggca ccacaatcct gctgaactgc 360 actgggcagg tgaaggaag gaagcctgcc gctctgggag aggctcagcc aaccaagtca 420 ctggaggaaa aaaagcct gagagacag aagaactga atgactgtg ctttctgaaa 480 cggctgctgc aggagatcaa aacatgttgg aacagattc tgatgggcac aaggacac 540 cgcaatactg ggcggggcgg ggaaaagg ggaaaagg ggaaaagg 600 gaaagagaga ctaagacccc agaatgtccc agccatactc agcccctggg ggtgttccctg 660 ttcccccta aaccttagga taccctgatg atcagcagga cacccgaggt gacctgcgtg 720 gtcgtggatg tgagccagga agatcccgaa gtgcagttca actggtacgt ggatggcgtg 780 gaagtgcaca acgccaagc caagcccaga gagagcagt tcaactccac ctacagagtg 840 gtgagcgtgc tgaccgtgct gcaccaggac tggctgaacg gcaggagta caagtgcaag 900 gtgtccaa aaggcctgcc cagctccatc gagaagacca tcagcaagc aaggccag 960 cccagagaac cccaggtgta caccctgcct cccagccagg aagagatgac caagaaccag 1020 gtgtccctga cctgcctggt gaaaggcttc taccccagcg acatcgccgt ggagtgggaa 1080 agcaacggcc agcccgagaa caattacaag acaacccctc ccgtgctgga tagcgatggc 1140 agcttctttc tgtacagcag actgaccgtg gacaagagca gatggcagga aggcaacgtg 1200 ttcagctgca gcgtgatgca cgaagccctg cacaaccact acacccagaa gagcctgtcc 1260 ctgagcctgg gcaag 1275 <210> 39 <211> 1278 <212> DNA <213> Artificial Sequence <220> <223> nucleotide sequence of modified IL-7(MMMM) fused hyFc <400> 39 atgttccacg tgagcttcag atacatcttc ggcctgcccc ccctgatcct ggtgctgctg 60 cccgtggcca gcagcatgat gatgatggac tgcgacatcg agggcaagga cggcaagcag 120 tacgagagcg tgctgatggt gagcatcgac cagctgctgg acagcatgaa ggagatcggc 180 agcaactgcc tgaacaacga gttcaacttc ttcaagagac acatctgcga cgccaacaag 240 gaggcatgt tcctgttcag agccgccaga aagctgagac agttcctgaa gatgacacagc 300 accggcgact tcgacctgca cctgctgaag gtgagcgagg gcacaccat cctgctgaac 360 tgcaccggcc aggtgaaggg cagaaagccc gccgccctgg gcgaggccca gcccaccaag 420 agcctggagg agacaagag cctgaaggag cagaagaagc tgaacgacct gtgcttccctg 480 aagagactgc tgcaggagat caacctgc tggaacaga tcctgatggg caccaaggag 540 crawl crawl crawl crawl crawl crawl crawl crawl crawl crawl crawl crawl 600 gaggaaagag agaccaagac cccgagtgc cccagccaca cccagcccct gggcgtgttc 660 ctgttccctc ccaagcccca ggacaccctg atgatcagca gaacccccga ggtgaccctgc 720 gtggtcgtgg atgtgagcca ggagatccc gaagtgcagt tcactgta cgtggatggc 780 gtggaagtgc acaacgccaa gaccaagccc agagagagc agttcaactc cacctacaga 840 gtggtgagcg tgctgaccgt gctgcaccag gactggctga acggcaagga gtacaagtgc 900 aaggtgtcca acaaaggcct gcccagctcc atcgagaga ccatcagcaa agccaaggc 960 cagcccagag aaccccaggt gtacaccctg cctcccagcc aggaagagat gaccaagaac 1020 caggtgtccc tgacctgcct ggtgaaaggc ttctacccca gcgacatcgc cgtggagtgg 1080 gaaagcaacg gccagcccga gaacaattac aagacaaccc ctcccgtgct ggatagcgat 1140 ggcagcttct ttctgtacag cagactgacc gtggacaaga gcagatggca ggaaggcaac 1200 gtgttcagct gcagcgtgat gcacgaagcc ctgcacaacc actacaccca gaagagcctg 1260 tcctgagcc tgggcaag 1278 <210> 40 <211> 4 <212> PRT <213> Artificial Sequence <220> <223> oligopeptides conjugated with IL-7 <400> 40 What What What What 1

Claims

1. A modified interleukin-7, the amino acid sequence of which is shown in SEQ ID NO.

18.

2. Interleukin-7 fusion protein, the amino acid sequence of which is shown in SEQ ID NO.

24.

3. An isolated nucleic acid molecule encoding the modified interleukin-7 according to claim 1 or the interleukin-7 fusion protein according to claim 2.

4. An expression vector comprising the nucleic acid molecule according to claim 3. A host cell comprising the expression vector according to claim 4.

6. A pharmaceutical composition for preventing or treating a disease, comprising the modified interleukin-7 according to claim 1 or the interleukin-7 fusion protein according to claim 2.

7. The pharmaceutical composition according to claim 6, characterized in that It further includes a pharmaceutically acceptable carrier.

Images