Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof
By developing immunogenic compositions containing multiple pneumococcal capsular saccharide conjugates, the problem of serotypes not covered by existing vaccines was addressed, achieving broader protection against pneumococcus, especially in infants and immunocompromised populations.
Patent Information
- Application Number
- CN202210391127.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2014-01-21
- Filing Date
- 2015-01-15
- Publication Date
- 2025-09-05
- Estimated Expiration
- 2035-01-15
AI Technical Summary
Existing pneumococcal vaccines such as PREVNAR fail to cover all potential serotypes, resulting in insufficient protection against some pneumococcal infections, especially in immunocompromised populations, and the uncovered serotypes may change over time, requiring broader vaccine protection.
Develop immunogenic compositions containing multiple pneumococcal capsular saccharide conjugates, including saccharide conjugates from different serotypes, such as 15B, 22F, 33F, etc., conjugated to carrier proteins such as CRM197 to form multivalent vaccine compositions that cover more serotypes.
It enhances the immune response to multiple pneumococcal serotypes, provides broader protection, especially in infants and immunocompromised people, and improves the immune response to uncovered serotypes.
Smart Images

Figure CN114887048B_ABST
Abstract
Description
[0001] The present application is a divisional application of Chinese patent application No. 201580015008.8, filed on January 15, 2015, entitled “Immunogenic compositions comprising conjugated capsular saccharide antigens and uses thereof”. Field of the Invention
[0002] The present invention relates to novel immunogenic compositions comprising conjugated capsular saccharide antigens (glycoconjugates) and uses thereof. The immunogenic compositions of the invention will generally comprise a saccharide conjugate wherein the saccharide is derived from a serotype of Streptococcus pneumoniae. The invention also relates to the use of the novel immunogenic compositions for vaccinating human subjects, particularly infants and the elderly, against pneumococcal infection. Background of the Invention
[0003] Infections caused by pneumococci are a leading cause of morbidity and mortality worldwide. Pneumonia, febrile bacteremia, and meningitis are the most common manifestations of invasive pneumococcal disease, while spread of bacteria within the respiratory tract can lead to middle ear infections, sinusitis, or recurrent bronchitis. Non-invasive manifestations are generally less severe than invasive disease but are much more common.
[0004] In Europe and the Americas, pneumococcal pneumonia is the most common form of community-acquired bacterial pneumonia, estimated to affect approximately 100 per 100,000 adults annually. The corresponding figures for febrile bacteremia and meningitis are 15–19 per 100,000 and 1–2 per 100,000, respectively. The risk of developing one or more of these manifestations is much higher in infants and the elderly, as well as in immunocompromised individuals of any age. Even in economically developed regions, invasive pneumococcal disease carries a high mortality rate; the mortality rate for adults with pneumococcal pneumonia averages 10%–20%, but it can exceed 50% in high-risk groups. Pneumonia is currently the most common cause of pneumococcal death worldwide.
[0005] The causative agent of pneumococcal disease, Streptococcus pneumoniae (pneumococcus), is a Gram-positive, encapsulated coccus surrounded by a polysaccharide capsule. Variation in the composition of this capsule allows for the serological distinction of approximately 91 capsular types, some of which are frequently associated with pneumococcal disease, while others are less common. Invasive pneumococcal infections include pneumonia, meningitis, and febrile bacteremia; common noninvasive manifestations include otitis media, sinusitis, and bronchitis.
[0006] Pneumococcal conjugate vaccines (PCVs) are pneumococcal vaccines used to protect against diseases caused by Streptococcus pneumoniae (S. pneumoniae). There are currently three PCV vaccines available on the global market: (called Prevenar in some countries) (seven-valent vaccine), (decavalent vaccine) and PREVNAR (13-valent vaccine).
[0007] The recent development of widespread microbial resistance to essential antibiotics and the increasing number of immunocompromised people have highlighted the need for pneumococcal vaccines with broader protection.
[0008] Specifically, there is a need to address the remaining unmet medical need for pneumococcal disease coverage due to PREVNAR Serotypes not present in the PREVNAR and the potential for serotype replacement over time. The specific serotypes causing disease beyond the 13 in the pneumococcal population vary by region and population, and may change over time due to the acquisition of antibiotic resistance, the introduction of pneumococcal vaccines, and secular trends of unknown origin. There is a need for immunogenic compositions that can be used to induce immune responses against additional S. pneumoniae serotypes in humans, and particularly in children under 2 years of age.
[0009] The novel immunogenic compositions of the present invention are targeted against PREVNAR In one aspect, the immunogenic compositions of the present invention are targeted to (Seven-valent vaccine), and / or PREVNAR The invention provides suitable protection against serotypes of S. pneumoniae not found in the vaccine, while maintaining immune responses against serotypes covered by currently described vaccines. SUMMARY OF THE INVENTION
[0010] The present invention relates to an immunogenic composition comprising at least one saccharide conjugate selected from the group consisting of a saccharide conjugate from Streptococcus pneumoniae serotype 15B, a saccharide conjugate from Streptococcus pneumoniae serotype 22F, a saccharide conjugate from Streptococcus pneumoniae serotype 33F, a saccharide conjugate from Streptococcus pneumoniae serotype 12F, a saccharide conjugate from Streptococcus pneumoniae serotype 10A, a saccharide conjugate from Streptococcus pneumoniae serotype 11A, and a saccharide conjugate from Streptococcus pneumoniae serotype 8.
[0011] In one aspect, the present invention provides an immunogenic composition comprising at least one saccharide conjugate from S. pneumoniae serotype 15B, at least one saccharide conjugate from S. pneumoniae serotype 22F, and at least one saccharide conjugate from S. pneumoniae serotype 33F.
[0012] In another aspect the present invention provides an immunogenic composition comprising at least one saccharide conjugate from Streptococcus pneumoniae serotype 15B, at least one saccharide conjugate from Streptococcus pneumoniae serotype 22F, at least one saccharide conjugate from Streptococcus pneumoniae serotype 33F, at least one saccharide conjugate from Streptococcus pneumoniae serotype 12F, at least one saccharide conjugate from Streptococcus pneumoniae serotype 10A, at least one saccharide conjugate from Streptococcus pneumoniae serotype 11A, and at least one saccharide conjugate from Streptococcus pneumoniae serotype 8.
[0013] In one aspect the immunogenic composition further comprises a saccharide conjugate from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F.
[0014] In another aspect the above immunogenic composition further comprises a saccharide conjugate from S. pneumoniae serotypes 1, 5, and 7F.
[0015] In another aspect the above immunogenic composition further comprises saccharide conjugates from S. pneumoniae serotypes 6A and 19A.
[0016] In another aspect the above immunogenic composition further comprises a saccharide conjugate from S. pneumoniae serotype 3.
[0017] In another aspect the above immunogenic composition further comprises a saccharide conjugate from S. pneumoniae serotypes 2, 9N, 17F, 20 and / or 15C.
[0018] In one aspect, the immunogenic composition described above does not comprise capsular saccharides from S. pneumoniae serotypes 9N, 9A and / or 9L.
[0019] In one aspect, the immunogenic composition is an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20-valent pneumococcal conjugate composition. In one aspect, the immunogenic composition is a 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25-valent pneumococcal conjugate composition.
[0020] In one aspect, the glycoconjugates are independently conjugated to a carrier protein selected from the group consisting of DT (diphtheria toxin), TT (tetanus toxoid), CRM 197 , other DT mutants, PD (Haemophilus influenzae protein D), or immunologically functional equivalents thereof
[0021] In one aspect, the invention provides a container filled with any of the immunogenic compositions defined herein.
[0022] In one aspect, the invention provides any immunogenic composition as defined herein for use as a medicament, in particular as a vaccine.
[0023] In one aspect, the present invention provides a method of preventing, treating or ameliorating an infection, disease or condition associated with S. pneumoniae in a subject, comprising administering to the subject an immunologically effective amount of any immunogenic composition defined herein. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 : Shows the repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 8 (Pn-8).
[0025] Figure 2 : Shows the repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 10A (Pn-10A).
[0026] Figure 3 : Shows the repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 11A (Pn-11A).
[0027] Figure 4 : Shows the repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 12F (Pn-12F).
[0028] Figure 5 : Shows the repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 15B (Pn-15B).
[0029] Figure 6 : Shows the repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 22F (Pn-22F).
[0030] Figure 7 : Shows the repeating polysaccharide structure of the capsular polysaccharide of Streptococcus pneumoniae serotype 33F (Pn-33F).
[0031] Figure 8 : Representative process flow diagram showing activation (A) and conjugation (B) methods that can be used for the preparation of Pn-33F glycoconjugates.
[0032] Figure 9 : Shows the effect of varying the amount of NCS in the TEMPO / NCS oxidation reaction on DO.
[0033] Figure 10 : shows the evaluation of the stability of the Pn-12F glycoconjugate.
[0034] Figure 11Cross-functional OPA reactivity. A subset of 59 sera from adults vaccinated with a 13-valent pneumococcal conjugate vaccine (US study 6115A1-004; ClinicalTrials.gov Identifier: NCT00427895) was evaluated for the presence of functional antibodies against serotypes 9V, 9A, 9L, and 9N in OPA. The percentage of samples with positive OPA titers (i.e., ≥1:8) is indicated above each group. The geometric mean titer (GMT) is listed below each group on the X-axis.
[0035] Figure 12 : Cross-functional OPA reactivity of 66 matched pre- / post-sera. In OPA, a subset of 66 sera from matched pre- and post-vaccination sera from adults vaccinated with a 13-valent pneumococcal conjugate vaccine (study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572) were evaluated for the presence of functional antibodies against serotypes 9V, 9A, 9L, and 9N. The percentage of samples with an OPA positive titer (i.e., ≥1:8) is indicated above each group. The geometric mean titer (GMT) is listed below each group on the X-axis.
[0036] Figure 13 : Reverse cumulative distribution curves (RCDC) before and after immunization - Pneumococcal serotype 9V (Pn9V).
[0037] Reverse cumulative distribution curves of OPA for serotype 9V from matched pre- and post-vaccination serogroups (N=66) vaccinated with the 13-valent pneumococcal vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The graph represents the percentage of sera with positive OPA titers (i.e., ≥1:8).
[0038] Figure 14 : Reverse cumulative distribution curves (RCDC) before and after immunization - Pneumococcal serotype 9A (Pn9A).
[0039] Reverse cumulative distribution curves of OPA for serotype 9A from matched pre- and post-vaccination serogroups (N=66) vaccinated with the 13-valent pneumococcal vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The graph represents the percentage of sera with positive OPA titers (i.e., ≥1:8).
[0040] Figure 15: Reverse cumulative distribution curves (RCDC) before and after immunization - Pneumococcal serotype 9L (Pn9L).
[0041] Reverse cumulative distribution curves of OPA for serotype 9L from matched pre- and post-vaccination serogroups (N=66) vaccinated with the 13-valent pneumococcal vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The graph represents the percentage of sera with positive OPA titers (i.e., ≥1:8).
[0042] Figure 16 : Reverse cumulative distribution curves (RCDC) before and after immunization - Pneumococcal serotype 9N (Pn9N).
[0043] Reverse cumulative distribution curves of OPA for serotype 9N from matched pre- and post-vaccination serogroups (N=66) vaccinated with the 13-valent pneumococcal vaccine (Study 6115A1-3005; ClinicalTrials.gov Identifier: NCT00546572). The graph represents the percentage of sera with positive OPA titers (i.e., ≥1:8). Detailed Description of the Invention
[0044] 1. Immunogenic compositions of the present invention
[0045] The immunogenic compositions of the invention will typically comprise a conjugated capsular saccharide antigen (also known as a glycoconjugate) wherein the saccharide is derived from a serotype of S. pneumoniae.
[0046] Preferably, the number of S. pneumoniae capsular saccharides can range from 8 different serotypes (or "v", valence) to 20 different serotypes (20v). In one embodiment, there are 8 different serotypes. In one embodiment, there are 9 different serotypes. In one embodiment, there are 10 different serotypes. In one embodiment, there are 11 different serotypes. In one embodiment, there are 12 different serotypes. In one embodiment, there are 13 different serotypes. In one embodiment, there are 14 different serotypes. In one embodiment, there are 15 different serotypes. In one embodiment, there are 16 different serotypes. In one embodiment, there are 17 different serotypes. In one embodiment, there are 18 different serotypes. In one embodiment, there are 19 different serotypes. In one embodiment, there are 20 different serotypes. The capsular saccharide is conjugated to a carrier protein to form a glycoconjugate as described below.
[0047] If the protein carrier of the two or more saccharides in the composition is the same, the saccharides may be conjugated to the same molecule of the protein carrier (with two or more different saccharides conjugated to the carrier molecule) [see, for example, WO 2004 / 083251].
[0048] However, in a preferred embodiment, the saccharides are each independently conjugated to a different protein carrier molecule (each molecule of protein carrier is conjugated to only one type of saccharide). In such an embodiment, the capsular saccharides are said to be independently conjugated to a carrier protein.
[0049] For the purposes of the present invention, the term "glycoconjugate" refers to a capsular saccharide covalently linked to a carrier protein. In one embodiment, the capsular saccharide is directly linked to the carrier protein. In a second embodiment, the bacterial saccharide is linked to the protein via a spacer / linker.
[0050] 1.1 Carrier Protein of the Present Invention
[0051] One component of the glycoconjugates of the present invention is a carrier protein to which the glycoconjugate is conjugated. The terms "protein carrier" or "carrier protein" or "carrier" are used interchangeably herein. The carrier protein should be amenable to standard conjugation procedures.
[0052] In a preferred embodiment, the carrier protein of the glycoconjugate is selected from the group consisting of DT (diphtheria toxin), TT (tetanus toxoid) or fragment C of TT, CRM 197(a nontoxic but immunogenic equivalent variant of diphtheria toxin), other DT mutants (such as CRM176, CRM228, CRM45 (Uchida et al. (1973) J. Biol. Chem. 218:3838-3844), CRM9, CRM102, CRM103 or CRM107; and other mutations described by Nicholls and Youle in Genetically Engineered Toxins, Ed: Frankel, Maecel Dekker Inc. (1992); deletion or mutation of Glu-148 to Asp, Gln or Ser and / or deletion or mutation of Ala 158 to Glγ and other mutations disclosed in U.S. Patent Nos. 4,709,017 and 4,950,740; Lys 516, Lys 526, Phe 530 and / or Lys at least one or more mutations of 534 and other mutations disclosed in U.S. Pat. Nos. 5,917,017 and 6,455,673; or fragments disclosed in U.S. Pat. No. 5,843,711, pneumococcal pneumolysin (ply) (Kuo et al. (1995) Infect Immun 63:2706-2713) including ply that is detoxified in some way, such as dPLY-GMBS (WO 2004 / 081515, WO 2006 / 032499) or dPLY-formol, PhtX, including PhtA, PhtB, PhtD, PhtE (the sequence of PhtA, PhtB, PhtD or PhtE is disclosed in WO 00 / 37105 and WO 00 / 39299) and fusions of Pht proteins, such as PhtDE fusions, PhtBE fusions, Pht AE (WO 01 / 98334, WO 03 / 054007, WO 2009 / 000826), OMPC (meningococcal outer membrane protein), which is often extracted from Neisseria meningitidis serogroup B (EP0372501), PorB (from N.meningitidis), PD (Haemophilus influenzae protein D; see, for example, EP 0 594 610 B), or an immunologically functional equivalent thereof, synthetic peptides ( EP 0 378 881 , EP 0 427 347 ), heat shock proteins ( WO 93 / 17712 , WO 94 / 03208 ), pertussis proteins ( WO 98 / 58668 , EP 0 471 177 ), cytokines, lymphokines, growth factors or hormones ( WO 91 / 01146 ), artificial proteins comprising multiple human CD4+ T cell epitopes (antigens from various pathogenic sources) ( Falugi et al. (2001) Eur J Immunol 31:3816-3824 ) such as N19 protein ( Baraldoi et al. (2004) Infect Immun 72:4884-4887 ), pneumococcal surface protein PspA ( WO 02 / 091998), iron uptake proteins (WO 01 / 72337), Clostridium difficile toxin A and toxin B (WO 00 / 61761), transferrin binding protein, pneumococcal adhesion protein (PsaA), recombinant Pseudomonas aeruginosa exotoxin A (particularly non-toxic mutants thereof (e.g., exotoxin A with a substitution at glutamic acid 553 (Douglas et al. (1987) J. Bacteriol. 169(11):4967-4971)). Other proteins, such as ovalbumin, keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA), or purified protein derivatives of tuberculin (PPD) can also be used as carrier proteins. Other suitable carrier proteins include inactivated bacterial toxins such as cholera toxoid (e.g., WO 2004 / 083251), Escherichia coli LT, Escherichia coli ST, and exotoxin A from Pseudomonas aeruginosa.
[0053] In a preferred embodiment, the carrier protein of the glycoconjugate is independently selected from the group consisting of: TT, DT, DT mutants (such as CRM 197 ), H. influenzae protein D, PhtX, PhtD, PhtDE fusions (particularly those described in WO 01 / 98334 and WO 03 / 054007), detoxified pneumolysin, PorB, N19 protein, PspA, OMPC, toxins A and B of C. difficile, and PsaA.
[0054] In one embodiment, the carrier protein of the glycoconjugate of the present invention is DT (diphtheria toxoid). In another embodiment, the carrier protein of the glycoconjugate of the present invention is TT (tetanus toxoid).
[0055] In another embodiment, the carrier protein of the glycoconjugate of the invention is PD (Haemophilus influenzae protein D; see, eg, EP 0 594 610 B).
[0056] In a preferred embodiment, the capsular saccharide of the invention is conjugated to a CRM 197 Protein. The CRM 197 The protein is a nontoxic form of diphtheria toxin but is immunologically indistinguishable from diphtheria toxin. 197 Non-toxigenic phage β197 tox- Produced by Corynebacterium diphtheriae infected with (created by nitrosoguanidine mutagenesis of toxigenic β-rostral phage) (Uchida et al. (1971) Nature New Biology 233:8-11). CRM 197 The protein has the same molecular weight as diphtheria toxin but differs from it by a single base change in the structural gene (guanine to adenine). This single base change causes an amino acid substitution in the mature protein (glutamic acid instead of glycine) and eliminates the toxicity of diphtheria toxin. CRM 197 Proteins are safe and effective T-cell dependent carriers for carbohydrates. About CRM 197 Further details of and their generation can be found in, for example, US Patent No. 5,614,382.
[0057] In one embodiment, the capsular saccharide of the invention is conjugated to a CRM 197 Protein or CRM 197 In one embodiment, the capsular saccharide of the present invention is conjugated to a CRM obtained by expressing genetically recombinant E. coli. 197 In one embodiment, all capsular saccharides of the present invention are conjugated to CRM 197 In one embodiment, all of the capsular saccharides of the invention are conjugated to a CRM 197 A chain.
[0058] Thus, in common embodiments, the glycoconjugates of the invention comprise a CRM 197 As a carrier protein, wherein the capsular polysaccharide is covalently linked to the CRM 197 .
[0059] 1.2 Capsular saccharides of the present invention
[0060] Throughout this specification the term "saccharide" may refer to a polysaccharide or an oligosaccharide and includes both. In common embodiments, the saccharide is a polysaccharide, in particular a S. pneumoniae capsular polysaccharide.
[0061] Capsular polysaccharides are prepared by standard techniques known to those skilled in the art.
[0062] In the present invention, capsular polysaccharides can be prepared from, for example, serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F of S. pneumoniae. Capsular polysaccharides are typically produced by culturing S. pneumoniae serotypes in a culture medium (e.g., a soy-based culture medium), followed by preparation of the polysaccharide from the bacterial culture. The strains of S. pneumoniae used to prepare the polysaccharides used in the glycoconjugates of the present invention can be obtained from established culture collections or clinical samples.
[0063] The colony of organism (every kind of Streptococcus pneumoniae serotype) is often amplified to seed bottle from seed bottle scale and passed down through the seed fermentation tank that one or more volumes increase until reaching the fermentation volume of production scale.At the end of the growth cycle, cell lysis and then results lysate are used for the processing of downstream (purification) (see for example WO 2006 / 110381, WO2008 / 118752 and U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498 and 2008 / 0286838).
[0064] Individual polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752).
[0065] Purified polysaccharides can be activated (eg, chemically activated) to enable them to react (eg, with an eTEC spacer) and subsequently be incorporated into the glycoconjugates of the invention, as further described herein.
[0066] The S. pneumoniae capsular polysaccharide comprises repeating oligosaccharide units (which may contain up to 8 sugar residues).
[0067] In one embodiment, the capsular saccharide of the invention may be an oligosaccharide unit or a repeating oligosaccharide unit of a sugar chain shorter than the natural length. In one embodiment, the capsular saccharide of the invention is a repeating oligosaccharide unit of the relevant serotype.
[0068] In one embodiment, the capsular saccharide of the invention may be an oligosaccharide. Oligosaccharides have a low number of repeating units (typically 5-15 repeating units) and are typically derived synthetically or from the hydrolysis of polysaccharides.
[0069] However, preferably, all capsular saccharides of the present invention, and all capsular saccharides in the immunogenic compositions of the present invention, are polysaccharides. High molecular weight capsular polysaccharides are capable of inducing certain antibody immune responses (due to the presence of epitopes on the surface of the antigen). For the conjugates, compositions and methods of the present invention, it is preferred to isolate and purify the high molecular weight capsular polysaccharide.
[0070] In some embodiments, the purified polysaccharide has a molecular weight of 10 kDa to 4,000 kDa prior to conjugation. In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 4,000 kDa. In further such embodiments, the polysaccharide has a molecular weight of 50 kDa to 3,500 kDa; 50 kDa to 3,000 kDa; 50 kDa to 2,500 kDa; 50 kDa to 2,000 kDa; 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 4,000 kDa; 100 kDa to 3,500 kDa; 100 kDa to 3,000 kDa; 100 kDa to 2,500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1 kDa; 200kDa to 1,500kDa; 100kDa to 1,250kDa; 100kDa to 1,000kDa; 100kDa to 750kDa; 100kDa to 500kDa; 200kDa to 4,000kDa; 200kDa to 3,500kDa; 200kDa to 3,000kDa; 200kDa to 2,500kDa; 200kDa to 2,000kDa; 200kDa to 2,000kDa; 200kDa to 1,750kDa; 200kDa to 1,500kDa; 200kDa to 1,250kDa; 200kDa to 1,000kDa; 200kDa to 750kDa; or 200kDa to 500kDa. Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0071] The polysaccharide may be slightly reduced in size during normal purification. Additionally, as described herein, the polysaccharide may be subjected to a sizing technique prior to conjugation. Mechanical or chemical sizing may be used. Chemical hydrolysis may be performed using acetic acid. Mechanical sizing may be performed using high pressure homogenization shearing. The molecular weight ranges mentioned above refer to the purified polysaccharide prior to conjugation (e.g., prior to activation).
[0072] In a preferred embodiment, the purified polysaccharide is a capsular polysaccharide from serotype 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F or 33F of S. pneumoniae, wherein the capsular polysaccharide has a molecular weight falling within the molecular weight ranges described above.
[0073] As used herein, the term "molecular weight" of a polysaccharide or a carrier protein-polysaccharide conjugate refers to the molecular weight calculated by size exclusion chromatography (SEC) combined with multi-angle laser light scattering detection (MALLS).
[0074] In some embodiments, the pneumococcal saccharides of the invention from serotypes 9V, 18C, 11A, 15B, 22F and / or 33F are O-acetylated. In some embodiments, the pneumococcal saccharides of the invention from serotypes 9V, 11A, 15B, 22F and / or 33F are O-acetylated.
[0075] The purified polysaccharides described herein are chemically activated to enable the saccharide to react with the carrier protein.These pneumococcal conjugates are prepared by separate processes and formulated into single-dose formulations as described herein.
[0076] 1.2.1 Pneumococcal polysaccharides from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F
[0077] Capsular saccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F can be prepared by standard techniques known to those skilled in the art (see, for example, WO 2006 / 110381). Capsular polysaccharides can be produced by growing each S. pneumoniae serotype in culture; at the end of the growth cycle, the cells are hydrolyzed and the lysate is then harvested for downstream (purification) processing. Each polysaccharide is typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752). The purified polysaccharides can be further processed as further described herein to prepare the glycoconjugates of the present invention.
[0078] In some embodiments, the purified polysaccharide from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and / or 23F has a molecular weight of 10 kDa to 4,000 kDa prior to conjugation. In other such embodiments, the polysaccharide has a molecular weight of 50 kDa to 4,000 kDa; 50 kDa to 3,000 kDa; or 50 kDa to 2,000 kDa.
[0079] In further such embodiments, the polysaccharide has a molecular weight of 50 kDa to 3,500 kDa; a molecular weight of 50 kDa to 3,000 kDa; a molecular weight of 50 kDa to 2,500 kDa; a molecular weight of 50 kDa to 2,000 kDa; a molecular weight of 50 kDa to 1,750 kDa; a molecular weight of 50 kDa to 1,500 kDa; a molecular weight of 50 kDa to 1,250 kDa; a molecular weight of 50 kDa to 1,00 0 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 4,000 kDa; 100 kDa to 3,500 kDa; 100 kDa to 3,000 kDa; 100 kDa to 2,500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa molecular weight; molecular weight of 100kDa to 1,500kDa; molecular weight of 100kDa to 1,250kDa; molecular weight of 100kDa to 1,000kDa; molecular weight of 100kDa to 750kDa; molecular weight of 100kDa to 500kDa; molecular weight of 200kDa to 4,000kDa; molecular weight of 200kDa to 3,500kDa; molecular weight of 200kDa to 3,000kDa Molecular weight; a molecular weight of 200 kDa to 2,500 kDa; a molecular weight of 200 kDa to 2,000 kDa; a molecular weight of 200 kDa to 1,750 kDa; a molecular weight of 200 kDa to 1,500 kDa; a molecular weight of 200 kDa to 1,250 kDa; a molecular weight of 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or a molecular weight of 200 kDa to 500 kDa. Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0080] Polysaccharides may be slightly reduced in size during normal purification processes. Additionally, polysaccharides may be subjected to resizing techniques prior to conjugation, as described herein. The molecular weight ranges mentioned above refer to purified polysaccharides after the final resizing step prior to conjugation (e.g., prior to activation).
[0081] In some embodiments, the pneumococcal saccharides of the invention from serotypes 9V and / or 18C are O-acetylated. In some embodiments, the pneumococcal saccharides of the invention from serotype 9V are O-acetylated and the pneumococcal saccharides of the invention from serotype 18C are de-O-acetylated.
[0082] 1.2.2 Pneumococcal polysaccharide serotype 8
[0083] The polysaccharide repeating unit of serotype 8 consists of a linear tetrasaccharide unit, in which there is one glucuronic acid (GlcpA), two glucopyranoses (Glcp) and one galactopyranose (Galp) (Jones et al. (1957) The Journal of the American Chemical Society. 79(11):2787-2793). All four monosaccharides are linked by 1,4-linkages, such as Figure 1 shown.
[0084] Serotype 8 saccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). Alternatively, they can be produced using synthetic protocols.
[0085] Serotype 8 S. pneumoniae strains can be obtained from established culture collections such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA) or clinical specimens.
[0086] In some embodiments, the purified polysaccharide from S. pneumoniae serotype 8 has a molecular weight of 10 kDa to 2,000 kDa prior to conjugation. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa.
[0087] In other embodiments, the capsular polysaccharide has a molecular weight of 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 200 kDa to 600 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 250 kDa to 600; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0088] Polysaccharides may be slightly reduced in size during normal purification processes. Additionally, polysaccharides may be subjected to resizing techniques prior to conjugation, as described herein. The molecular weight ranges mentioned above refer to purified polysaccharides after the final resizing step prior to conjugation (e.g., prior to activation).
[0089] 1.2.3 Pneumococcal polysaccharide serotype 10A
[0090] The purified polysaccharide of serotype 10A consists of a branched hexasaccharide repeating unit, in which two galactofuranose (Gal f ), three galactopyranose (Gal p ), an N-acetylgalactosamine (Gal p NAc) and backbone ribitol phosphate (Jones, C. (2005) Carbohydrate Research 269 (1): 175-181). There are two branched monosaccharides (β-3-Galp and β-6-Galf) in the β-GalpNAc part, such as Figure 2 shown.
[0091] Serotype 10A saccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). Alternatively, they can be produced using synthetic protocols.
[0092] Serotype 10A S. pneumoniae strains can be obtained from established culture collections such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA) or clinical specimens.
[0093] In some embodiments, the purified polysaccharide from S. pneumoniae serotype 10A has a molecular weight of 10 kDa to 2,000 kDa prior to conjugation. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa.
[0094] In other embodiments, the capsular polysaccharide has a molecular weight of 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 200 kDa to 600 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 250 kDa to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0095] Polysaccharides may be slightly reduced in size during normal purification processes. Additionally, polysaccharides may be subjected to resizing techniques prior to conjugation, as described herein. The molecular weight ranges mentioned above refer to purified polysaccharides after the final resizing step prior to conjugation (e.g., prior to activation).
[0096] 1.2.4 Pneumococcal polysaccharide serotype 11A
[0097] The purified polysaccharide of serotype 11A consists of a linear tetrasaccharide backbone (two galactopyranose (Gal p ) and two glucopyranose (Glc p )) and pendant glycerol phosphate (Richards et al. (1988) Adv. Exp. Med. Biol. 228: 595-597), such as Figure 3The polysaccharide is O-acetylated at multiple positions, and based on data reported in the literature (Calix et al. (2011) J Bacteriol. 193(19):5271-5278), the total amount of O-acetylation in the 11A polysaccharide is approximately 2.6 O-acyl groups per polysaccharide repeat unit.
[0098] Serotype 11A saccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). Alternatively, they can be produced using synthetic protocols.
[0099] Serotype 11A S. pneumoniae strains can be obtained from established culture collections such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA) or clinical specimens.
[0100] Isolated serotype 11A capsular polysaccharide obtained by purifying serotype 11A polysaccharide from S. pneumoniae hydrolysate and optionally resizing the purified polysaccharide can be characterized by various properties including, for example, molecular weight (MW) and mM acetate per mM of the serotype 11A capsular polysaccharide.
[0101] In some embodiments, the purified polysaccharide from S. pneumoniae serotype 11A has a molecular weight of 10 kDa to 2,000 kDa prior to conjugation. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa.
[0102] In other embodiments, the capsular polysaccharide has a molecular weight of 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 100 kDa to 200 kDa; 150 kDa to 600 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 150 kDa to 300 kDa; 150 kDa to 200 kDa; 200 kDa to 6 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 250 kDa to 600 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0103] Polysaccharides may be slightly reduced in size during normal purification processes. Additionally, polysaccharides may be subjected to resizing techniques prior to conjugation, as described herein. The molecular weight ranges mentioned above refer to purified polysaccharides after the final resizing step prior to conjugation (e.g., prior to activation).
[0104] In one embodiment, the size of the purified serotype 11A polysaccharide is reduced by high pressure homogenization. High pressure homogenization achieves high shear rates by pumping the process stream through sufficiently small flow paths. The shear rate is increased by using a greater applied homogenization pressure, while the exposure time can be increased by recirculating the feed stream through the homogenizer.
[0105] The high pressure homogenization process is particularly suitable for reducing the size of purified serotype 11A polysaccharide while retaining the structural characteristics of the polysaccharide, such as the presence of O-acetyl groups.
[0106] The presence of O-acetyl groups in purified, isolated or activated serotype 11A capsular polysaccharide or in serotype 11A polysaccharide-carrier protein conjugates is expressed as mM per mM of polysaccharide acetate or as the number of O-acetyl groups per polysaccharide repeat unit.
[0107] In preferred embodiments, the purified polysaccharide from S. pneumoniae serotype 11A has at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4 or 1.6 μmol acetate per μmol of said serotype 11A capsular polysaccharide.
[0108] 1.2.5 Pneumococcal polysaccharide serotype 12F
[0109] The purified polysaccharide of serotype 12F consists of a linear trisaccharide backbone (one N-acetylfucosamine (Fuc p NAc), an N-acetylgalactosamine (Gal p NAc), and an N-acetylmannuronic acid (Man p NAcA)) with two branches: a pendant α-galactopyranose (Gal p )Connect to Fuc p C3 and α-Glc in NAc p -(1→2)-α-Glc p Disaccharide branches attached to Man p C3 of NAcA (Leontein et al. (1983) Carbohydrate Research 114 (2): 257-266.), such as Figure 4 shown.
[0110] Serotype 12F S. pneumoniae strains can be obtained from established culture collections such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA) or clinical specimens.
[0111] Capsular saccharides from Streptococcus pneumoniae serotype 12F can be prepared by standard techniques well known to those skilled in the art. Capsular polysaccharides are usually produced by growing every kind of Streptococcus pneumoniae serotype in a culture medium (e.g., in a culture medium based on soybeans), followed by preparation of polysaccharides from bacterial cultures. The colony of organism (Streptococcus pneumoniae serotype 12F) is often amplified from a seed bottle scale to a seed bottle and passed down through one or more volume-increased seed fermentation tanks until the fermentation volume of a production scale is reached. At the end of the growth cycle, the cells are lysed and then harvested in the processing of lysate for downstream (purification) (see, e.g., WO 2006 / 110381 and WO 2008 / 118752, U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and US2008 / 0286838). Polysaccharides are typically purified by centrifugation, precipitation, ultrafiltration, and / or column chromatography (see, for example, WO 2006 / 110352 and WO 2008 / 118752).
[0112] Purified polysaccharides from serotype 12F may be activated (eg, chemically activated) to enable their reaction and subsequent incorporation into the glycoconjugates of the invention, as further described herein.
[0113] In some embodiments, the purified polysaccharide from S. pneumoniae serotype 12F has a molecular weight of 10 kDa to 2,000 kDa prior to conjugation. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 300 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 300 kDa. In other embodiments, the capsular polysaccharide has a molecular weight of 90 kDa to 250 kDa; 90 kDa to 150 kDa; 90 kDa to 120 kDa; 80 kDa to 120 kDa; 70 kDa to 100 kDa; 70 kDa to 110 kDa; 70 kDa to 120 kDa; 70 kDa to 130 kDa; 70 kDa to 140 kDa; 70 kDa to 150 kDa; 70 kDa to 160 kDa; 80 kDa to 110 kDa; 80 kDa to 120 kDa; 80 kDa to 130 kDa kDa; 80 kDa to 140 kDa; 80 kDa to 150 kDa; 80 kDa to 160 kDa; 90 kDa to 110 kDa; 90 kDa to 120 kDa; 90 kDa to 130 kDa; 90 kDa to 140 kDa; 90 kDa to 150 kDa; 90 kDa to 160 kDa; 100 kDa to 120 kDa; 100 kDa to 130 kDa; 100 kDa to 140 kDa; 100 kDa to 150 kDa; 100 kDa to 160 kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0114] Polysaccharides may be slightly reduced in size during normal purification processes. Additionally, polysaccharides may be subjected to resizing techniques prior to conjugation, as described herein. The molecular weight ranges mentioned above refer to purified polysaccharides after the final resizing step prior to conjugation (e.g., prior to activation).
[0115] 1.2.6 Pneumococcal polysaccharide serotype 15B
[0116] like Figure 5 As shown, the purified polysaccharide of serotype 15B consists of a branched trisaccharide backbone (one N-acetylglucosamine (Glc p NAc), a galactopyranose (Gal p ), and a glucopyranose (Glc p )) and connected to Glc p αGal at the C4 hydroxyl group of NAc p -βGal p The disaccharide branch is composed of glycerol phosphate connected to βGal in the disaccharide branch.p The C3 hydroxyl group of the residue (Jones et al. (2005) Carbohydrate Research 340(3):403-409). The capsular polysaccharide from serotype 15C has the same backbone structure as serotype 15B but lacks O-acetylation.
[0117] Serotype 15B polysaccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). They can be produced using synthetic protocols known to those skilled in the art.
[0118] Serotype 15B S. pneumoniae strains can be obtained from established culture collections such as, for example, the American Type Culture Collection (ATCC, Manassas, VA USA) (e.g., deposited strain number ATCC 10354) or the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA USA) or from clinical specimens.
[0119] Bacterial cells are grown in a culture medium, preferably in a culture medium based on soybeans. After fermentation of the bacterial cells producing the pneumococcal serotype 15B capsular polysaccharide, the bacterial cells are lysed to produce a cell lysate. Purification techniques known in the art can then be used to separate the polysaccharide of serotype 15B from the cell lysate, including centrifugation, depth filtration, precipitation, ultrafiltration, activated carbon treatment, diafiltration and / or column chromatography (see, for example, U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498 and WO2008 / 118752). The purified serotype 15B capsular polysaccharide can then be used to prepare immunogenic conjugates.
[0120] The isolated serotype 15B capsular polysaccharide obtained by purifying serotype 15B polysaccharide from a S. pneumoniae hydrolysate and optionally resizing the purified polysaccharide can be characterized by various parameters including, for example, molecular weight (MW), mM acetate per mM of the serotype 15B capsular polysaccharide, and mM glycerol per mM of the serotype 15B capsular polysaccharide.
[0121] Preferably, to produce a serotype 15B conjugate with favorable filterability characteristics and / or yield, the polysaccharide is size-modified to a target molecular weight range prior to conjugation to a carrier protein. Advantageously, the size of the purified serotype 15B polysaccharide is reduced while retaining key structural features of the polysaccharide, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 15B polysaccharide is reduced by mechanical homogenization.
[0122] In a preferred embodiment, the size of the purified serotype 15B polysaccharide is reduced by high pressure homogenization. High pressure homogenization achieves high shear rates by pumping the process stream through sufficiently small flow paths. The shear rate is increased by using a greater applied homogenization pressure, while the exposure time can be increased by recirculating the feed stream through the homogenizer.
[0123] The high pressure homogenization process is particularly suitable for reducing the size of purified serotype 15B polysaccharide while retaining the structural characteristics of the polysaccharide, such as the presence of O-acetyl groups.
[0124] In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 5 kDa to 500 kDa, 50 kDa to 500 kDa, 50 kDa to 450 kDa, 100 kDa to 400 kDa, and 100 kDa to 350 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 300 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa. In preferred embodiments, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa. In other embodiments, the capsular polysaccharide has a molecular weight of 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 100 kDa to 200 kDa; 150 kDa to 500 kDa; 150 kDa to 400 kDa; 150 kDa to 300 kDa; 150 kDa to 200 kDa; 200 kDa to 500 kDa; 200 kDa to 400 kDa; 250 kDa to 500 kDa; 250 kDa to 400 kDa; 250 kDa to 350 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0125] Serotype 15B polysaccharide is O-acetylated and the total amount of O-acetylation is approximately 0.8-0.9 O-acetyl groups per polysaccharide repeat unit. The degree of O-acetylation of the polysaccharide can be determined by any method known in the art, such as by proton NMR (see, for example, Lemercinier et al. (1996) Carbohydrate Research 296:83-96; Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis 30:1233-1247; WO 2005 / 033148 and WO 00 / 56357). Another commonly used method is described in Hestrin, S. (1949) J. Biol. Chem. 180:249-261. Preferably, the presence of O-acetyl groups is determined by ion HPLC analysis.
[0126] The presence of O-acetyl groups in purified, isolated or activated serotype 15B capsular polysaccharide or in serotype 15B polysaccharide-carrier protein conjugates is expressed as mM acetate per mM of the polysaccharide or as the number of O-acetyl groups per polysaccharide repeat unit.
[0127] In preferred embodiments, the purified polysaccharide from S. pneumoniae serotype 15B comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM acetate per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6, or 0.7 mM acetate per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.7 mM acetate per mM of serotype 15B capsular polysaccharide.
[0128] The presence of glycerol phosphate side chains (after their release by treating the polysaccharide with hydrofluoric acid (HF)) was determined by measuring glycerol using high performance anion exchange chromatography-pulsed amperometric detection (HPAEC-PAD). The glycerol present in the purified, isolated or activated serotype 15B polysaccharide or in the serotype 15B polysaccharide-carrier protein conjugate was expressed as mM glycerol per mM serotype 15B polysaccharide.
[0129] In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM of glycerol per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6, or 0.7 mM of glycerol per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.6 mM of glycerol per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the isolated serotype 15B capsular polysaccharide comprises at least 0.7 mM of glycerol per mM of serotype 15B capsular polysaccharide.
[0130] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa and comprises at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide.
[0131] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa such that it comprises at least 0.6 mM of glycerol per mM of the serotype 15B capsular polysaccharide.
[0132] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa such that it comprises at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide.
[0133] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa such that it comprises at least 0.6 mM of glycerol per mM of the serotype 15B capsular polysaccharide.
[0134] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa such that it comprises at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide.
[0135] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa such that it comprises at least 0.6 mM of glycerol per mM of the serotype 15B capsular polysaccharide.
[0136] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate and at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide.
[0137] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa such that per mM of the serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate and at least 0.6 mM glycerol.
[0138] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 300 kDa such that per mM of the serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate and at least 0.6 mM glycerol.
[0139] In a preferred embodiment, the isolated serotype 15B capsular polysaccharide has a molecular weight of 150 kDa to 350 kDa such that per mM of the serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate and at least 0.6 mM glycerol.
[0140] 1.2.7 Pneumococcal polysaccharide serotype 22F
[0141] like Figure 6 As shown, the purified polysaccharide of serotype 22F consists of a branched pentasaccharide backbone (one glucuronic acid (Glc p A), a pyranose glucose (Glc p ), a galactofuranose (Gal f ) and two rhamnopyranose (Rha p )) and linked to βRha p C3 hydroxyl group of αGlc p Branched composition (Richards et al. (1989) Canadian Journal of Chemistry 67(6):1038-1050). p Approximately 80% of the C2 hydroxyl groups of the residue are O-acetylated.
[0142] Serotype 22F polysaccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). Alternatively, they can be produced using synthetic protocols.
[0143] Serotype 22F S. pneumoniae strains can be obtained from established culture collections such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA) or clinical specimens.
[0144] The isolated serotype 22F capsular polysaccharide obtained by purifying serotype 22F polysaccharide from a S. pneumoniae hydrolysate and optionally resizing the purified polysaccharide can be characterized by various parameters including, for example, molecular weight (MW) and mM acetate per mM of the serotype 22F capsular polysaccharide.
[0145] Preferably, to produce a serotype 22F conjugate with favorable filterability characteristics and / or yield, the polysaccharide is size-modified to a target molecular weight range prior to conjugation to a carrier protein. Advantageously, the size of the purified serotype 22F polysaccharide is reduced while retaining key structural features of the polysaccharide, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 22F polysaccharide is reduced by mechanical homogenization.
[0146] In a preferred embodiment, the size of the purified polysaccharide is reduced by high pressure homogenization. High pressure homogenization achieves high shear rates by pumping the process stream through sufficiently small flow paths. The shear rate is increased by using a greater applied homogenization pressure, while the exposure time can be increased by recirculating the feed stream through the homogenizer.
[0147] The high pressure homogenization process is particularly suitable for reducing the size of purified serotype 22F polysaccharide while retaining the structural characteristics of the polysaccharide, such as the presence of O-acetyl groups.
[0148] In some embodiments, the purified polysaccharide from S. pneumoniae serotype 22F has a molecular weight of 10 kDa to 2,000 kDa prior to conjugation. In one embodiment, the capsular polysaccharide has a molecular weight of 50 kDa to 1,000 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 70 kDa to 900 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 100 kDa to 800 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 200 kDa to 600 kDa. In another embodiment, the capsular polysaccharide has a molecular weight of 400 kDa to 700 kDa.
[0149] In further embodiments, the capsular polysaccharide has a molecular weight of 100 kDa to 1,000 kDa; 100 kDa to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 150 kDa to 1,000 kDa; 150 kDa to 900 kDa; 1 50kDa to 800kDa; 150kDa to 700kDa; 150kDa to 600kDa; 150kDa to 500kDa; 150kDa to 400kDa; 150kDa to 300kDa; 200kDa to 1,000kDa; 200kDa to 900kDa; 200kDa to 800kDa; 200kDa to 700kDa; 200kDa to 600kDa; 200kDa to 500kDa; 2 00kDa to 400kDa; 200kDa to 300kDa; 250kDa to 1,000kDa; 250kDa to 900kDa; 250kDa to 800kDa; 250kDa to 700kDa; 250kDa to 600kDa; 250kDa to 500kDa; 250kDa to 400kDa; 250kDa to 350kDa; 300kDa to 1,000kDa; 300kDa to 900kDa kDa; 300 kDa to 800 kDa; 300 kDa to 700 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 1,000 kDa; 400 kDa to 900 kDa; 400 kDa to 800 kDa; 400 kDa to 700 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa; and similar desired molecular weight ranges. Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0150] The polysaccharide may be slightly reduced in size during normal purification. Additionally, as described above, the 22F polysaccharide may be subjected to a resizing technique prior to conjugation. The molecular weight ranges mentioned above refer to the purified polysaccharide after the final resizing step prior to conjugation (e.g., prior to activation).
[0151] The degree of O-acetylation of the polysaccharide can be determined by any method known in the art, for example by proton NMR (Lemercinier et al. (1996) Carbohydrate Research 296:83-96; Jones et al. (2002) J. Pharmaceutical and Biomedical Analysis 30:1233-1247; WO 2005 / 033148 and WO 00 / 56357). Another commonly used method is described in Hestrin, S. (1949) J. Biol. Chem. 180:249-261. Preferably, the presence of O-acetyl groups is determined by ion HPLC analysis.
[0152] The presence of O-acetyl groups in purified, isolated or activated serotype 22F capsular polysaccharide or in serotype 22F polysaccharide-carrier protein conjugates is expressed as mM per mM of polysaccharide acetate or as the number of O-acetyl groups per polysaccharide repeat unit.
[0153] In preferred embodiments, the purified polysaccharide from S. pneumoniae serotype 22F has at least 0.2, 0.4, 0.6, 0.8, 1, 1.2, 1.4 or 1.6 μmol acetate per μmol of said serotype 22F capsular polysaccharide.
[0154] 1.2.8 Pneumococcal polysaccharide serotype 33F
[0155] like Figure 7 As shown, the purified polysaccharide of serotype 33F consists of a branched pentasaccharide backbone (two galactopyranose (Gal p ), two galactofuranose (Gal f ) and a glucopyranose (Glc p ) and linked to the αGal p The C2 hydroxyl group of the residue is terminal αGal p Composition (Lemercinier et al. (2006) Carbohydrate Research 341 (1): 68-74.). The literature has reported that the skeleton 3-β-Gal f The C2 hydroxyl group of the residue is O-acetylated.
[0156] Serotype 33F polysaccharides can be obtained directly from bacteria using isolation procedures known to those skilled in the art (see, for example, methods disclosed in U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2007 / 0184071, 2007 / 0184072, 2007 / 0231340, and 2008 / 0102498, and WO 2008 / 118752). Alternatively, they can be produced using synthetic methods.
[0157] Serotype 33F S. pneumoniae strains can be obtained from established culture collections such as, for example, the Streptococcus Reference Laboratory (Centers for Disease Control and Prevention, Atlanta, GA) or clinical specimens.
[0158] Purified polysaccharides from serotype 33F may be activated (eg, chemically activated) to enable their reaction and subsequent incorporation into the glycoconjugates of the invention, as further described herein.
[0159] Isolated serotype 33F capsular polysaccharide obtained by purifying serotype 33F polysaccharide from S. pneumoniae hydrolysate and optionally resizing the purified polysaccharide can be characterized by various parameters including, for example, molecular weight and mM acetate per mM of the serotype 33F capsular polysaccharide.
[0160] In some embodiments, the purified polysaccharide from S. pneumoniae serotype 33F has a molecular weight of 10 kDa to 2,000 kDa prior to conjugation. In other such embodiments, the saccharide has a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharide has a molecular weight of: 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; 200 kDa to 500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa. Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0161] Polysaccharides may be slightly reduced in size during normal purification processes. Additionally, polysaccharides may be subjected to resizing techniques prior to conjugation, as described herein. The molecular weight ranges mentioned above refer to purified polysaccharides after the final resizing step prior to conjugation (e.g., prior to activation).
[0162] The presence of O-acetyl groups in purified, isolated or activated serotype 33F capsular polysaccharide or in serotype 33F polysaccharide-carrier protein conjugates is expressed as mM per mM of polysaccharide acetate or as the number of O-acetyl groups per polysaccharide repeat unit.
[0163] In preferred embodiments, the purified polysaccharide from S. pneumoniae serotype 33F has at least 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4 or 1.6 μmol acetate per μmol of said serotype 33F capsular polysaccharide.
[0164] 1.3 Glycoconjugates of the Invention
[0165] The purified sugar is chemically activated to enable the sugar (i.e., activated sugar) to react with the carrier protein. Once activated, each capsular sugar is conjugated to the carrier protein to form a glycoconjugate. In one embodiment, each capsular sugar is conjugated to the same carrier protein. Chemical activation of the sugar and subsequent conjugation to the carrier protein can be accomplished by the activation and conjugation methods disclosed herein.
[0166] 1.3.1 Glycoconjugates from Streptococcus pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F
[0167] Capsular polysaccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are prepared by standard techniques known to those skilled in the art (see, e.g., WO 2006 / 110381, WO 2008 / 118752, WO 2006 / 110352, and U.S. Patent Application Publication Nos. 2006 / 0228380, 2006 / 0228381, 2008 / 0102498, and 2008 / 0286838).
[0168] In one embodiment, the polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate. The activated polysaccharide is then coupled directly or via a spacer (linker) group to a carrier protein (preferably CRM). 197) on an amino group. For example, the spacer may be cystamine or cysteamine to give a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reaction with a maleimide-activated carrier protein (e.g., using N-[γ-maleimidobutyloxy]succinimide ester (GMBS)) or with a haloacetylated carrier protein (e.g., using iodoacetimide, N-succinimidyl bromoacetate (SBA; SIB), N-succinimidyl (4-iodoacetyl) aminobenzoate (S1AB), sulfosuccinimidyl (4-iodoacetyl) aminobenzoate (sulfo-SIAB), N-succinimidyl iodoacetate (SIA), or succinimidyl 3-[bromoacetamide] propionate (SBAP)). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexamethylenediamine or adipic acid dihydrazide (ADH) and the amino-derivatized sugar is conjugated to the carrier protein (e.g., CRM) via the carboxyl groups on the protein carrier using carbodiimide (e.g., EDAC or EDC) chemistry. 197 ). Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.
[0169] Other suitable techniques for conjugation use carbodiimides, hydrazides, active esters, norborane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reacting the free hydroxyl groups of the sugar with 1,1'-carbonyldiimidazole (CDI) (see Bethell et al. (1979) J. Biol. Chem. 254:2572-2574; Hearn et al. (1981) J. Chromatogr. 218:509-518) followed by reaction with the protein to form a carbamate bond. This can involve reduction of the anomeric end to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling of the CDI carbamate intermediate to an amino group on the protein.
[0170] In a preferred embodiment, at least one capsular polysaccharide from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F is conjugated to a carrier protein by reductive amination (as described in U.S. Patent Application Publication Nos. 2006 / 0228380, 2007 / 0231340, 2007 / 0184071, and 2007 / 0184072, WO 2006 / 110381, WO 2008 / 079653, and WO 2008 / 143709). In a preferred embodiment, all capsular polysaccharides from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, and 23F are conjugated to a carrier protein by reductive amination.
[0171] Reductive amination involves two steps: (1) oxidation of the polysaccharide, and (2) reduction of the activated polysaccharide with the carrier protein to form a conjugate. Prior to oxidation, the polysaccharide is optionally hydrolyzed. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed with acetic acid. The oxidation step can involve reaction with periodate. For the purposes of the present invention, the term "periodate" includes periodate and periodic acid; the term also includes metaperiodate (10 - ) and orthoperiodate (IO6 5- ) and various salts of periodic acid (such as sodium periodate and potassium periodate).
[0172] In one embodiment, the capsular polysaccharide from S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F or 23F is oxidized in the presence of metaperiodate, preferably sodium periodate (NaIO4). In another embodiment, the capsular polysaccharide from S. pneumoniae serotype 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F is oxidized in the presence of orthoperiodate, preferably periodic acid.
[0173] After the polysaccharide oxidation step, the polysaccharide is considered activated and is referred to hereinafter as "activated polysaccharide". The activated polysaccharide and the carrier protein can be lyophilized (freeze-dried) separately (separate lyophilization) or together (co-lyophilization). In one embodiment, the activated polysaccharide and the carrier protein are co-lyophilized. In another embodiment, the activated polysaccharide and the carrier protein are lyophilized separately.
[0174] In one embodiment, the freeze-drying is carried out in the presence of a non-reducing sugar, possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and isomalt.
[0175] The second step of the conjugation method is the reduction of the activated polysaccharide and the carrier protein to form a conjugate (so-called reductive amination), using a reducing agent. Suitable reducing agents include cyanoborohydrides, such as sodium cyanoborohydride, borane pyridine, or borohydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.
[0176] In one embodiment, the reduction reaction is carried out in an aqueous solvent. In another embodiment, the reduction reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.
[0177] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, which can be capped (end-capped) with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH4). After conjugation (reduction and optional end-capping), the glycoconjugate can be purified. The glycoconjugate can be purified by diafiltration and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by diafiltration or ion exchange chromatography or size exclusion chromatography. In one embodiment, the glycoconjugate is sterile filtered.
[0178] In some embodiments, the saccharide conjugate from S. pneumoniae serotype 9V and / or 18C comprises a saccharide having a degree of O-acetylation of 10% to 100%, 20% to 100%, 30% to 100%, 40% to 100%, 50% to 100%, 60% to 100%, 70% to 100%, 75% to 100%, 80% to 100%, 90% to 100%, 50% to 90%, 60% to 90%, 70% to 90%, or 80% to 90%. In other embodiments, the degree of O-acetylation is ≥10%, ≥20%, ≥30%, ≥40%, ≥50%, ≥60%, ≥70%, ≥80%, or ≥90%, or about 100%.
[0179] In some embodiments, the glycoconjugates of the present invention from S. pneumoniae serotype 9V and / or 18C are O-acetylated. In some embodiments, the glycoconjugates from S. pneumoniae serotype 9V are O-acetylated and the glycoconjugates from S. pneumoniae serotype 18C are de-O-acetylated.
[0180] 1.3.2 Glycoconjugates from Streptococcus pneumoniae serotype 22F
[0181] In one embodiment, the serotype 22F saccharide conjugate is obtained by activating the polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled to amino groups on the carrier protein directly or via a spacer (linker) group. For example, the spacer can be cystamine or cysteamine to give a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexamethylenediamine or adipic acid dihydrazide (ADH) and the amino-derivatized saccharide is conjugated to the carrier protein using carbodiimide chemistry (e.g., EDAC or EDC) via carboxyl groups on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.
[0182] Other suitable techniques use carbodiimides, hydrazides, active esters, norbornane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of the free hydroxyl groups of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254: 2572-2574; Hearn et al. (1981) J. Chromatogr. 218: 509-518) followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric end to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling of the CDI carbamate intermediate to an amino group on the protein.
[0183] In a preferred embodiment, the serotype 22F glycoconjugates of the present invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functionality from the vicinal diols in the individual hexasaccharide units, and (2) the activation of the polysaccharide and a carrier protein (e.g., CRM). 197 ) to produce the conjugate.
[0184] Preferably, the serotype 22F polysaccharide is resized to a target molecular weight (MW) range prior to oxidation. Advantageously, the size of the purified serotype 22F polysaccharide is reduced while retaining key structural features of the polysaccharide, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 22F polysaccharide is reduced by mechanical homogenization (see Section 1.2.7 above).
[0185] In one embodiment, the serotype polysaccharide is activated (oxidized) by a method comprising the steps of:
[0186] (a) reacting the isolated serotype 22F polysaccharide with an oxidizing agent;
[0187] (b) Quenching of the oxidation reaction by addition of a quencher results in activated serotype 22F polysaccharide.
[0188] In a preferred embodiment, the oxidizing agent is a periodate. For the purposes of the present invention, the term "periodate" includes periodate and periodic acid; the term also includes metaperiodate (IO4 - ) and orthoperiodate (IO6 5- ) and various salts of periodic acid (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the oxidizing agent is sodium periodate. In a preferred embodiment, the periodate used to oxidize serotype 22F polysaccharide is metaperiodate. In a preferred embodiment, the periodate used to oxidize serotype 22F polysaccharide is sodium metaperiodate.
[0189] In one embodiment, the quencher is selected from a vicinal diol, a 1,2-amino alcohol, an amino acid, glutathione, a sulfite, a bisulfate, a dithionite, a metabisulfite, a thiosulfate, a phosphite, a hypophosphite, or phosphoric acid.
[0190] In one embodiment, the quencher is a 1,2-amino alcohol of formula (I):
[0191]
[0192] where R 1 is selected from H, methyl, ethyl, propyl, or isopropyl.
[0193] In one embodiment, the quencher is selected from sodium and potassium salts of sulfite, bisulfate, dithionite, metabisulfite, thiosulfate, phosphite, hypophosphite, or phosphoric acid.
[0194] In one embodiment, the quencher is an amino acid. In such embodiments, the amino acid may be selected from the group consisting of serine, threonine, cysteine, cystine, methionine, proline, hydroxyproline, tryptophan, tyrosine, and histidine.
[0195] In one embodiment, the quencher is a sulfite such as bisulfate, dithionite, metabisulfite, thiosulfate.
[0196] In one embodiment, the quencher is a compound comprising two vicinal hydroxyl groups (vicinal diol), ie, two hydroxyl groups are covalently attached to two adjacent carbon atoms.
[0197] Preferably, the quencher is a compound of formula (II):
[0198]
[0199] where R 1 and R 2 are independently selected from H, methyl, ethyl, propyl, or isopropyl.
[0200] In a preferred embodiment, the quencher is glycerol, ethylene glycol, 1,2-propylene glycol, 1,2-butanediol or 2,3-butanediol, or ascorbic acid. In a preferred embodiment, the quencher is 2,3-butanediol.
[0201] In a preferred embodiment, the isolated serotype 22F polysaccharide is activated by a method comprising the steps of:
[0202] (a) reacting serotype 22F polysaccharide with periodate;
[0203] (b) The oxidation reaction was quenched by the addition of 2,3-butanediol, resulting in activated serotype 22F polysaccharide.
[0204] After the oxidation step of the polysaccharide, the polysaccharide is considered activated and is hereinafter referred to as "activated polysaccharide".
[0205] In a preferred embodiment, the activated serotype 22F polysaccharide is purified. The activated serotype 22F polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / diafiltration. For example, the activated 22F polysaccharide is purified by concentration and diafiltration using an ultrafiltration device.
[0206] In preferred embodiments, the degree of oxidation of the activated serotype 22F polysaccharide is from 2 to 30, from 2 to 25, from 2 to 20, from 2 to 15, from 2 to 10, from 2 to 5, from 5 to 30, from 5 to 25, from 5 to 20, from 5 to 15, from 5 to 10, from 10 to 30, from 10 to 25, from 10 to 20, from 10 to 15, from 15 to 30, from 15 to 25, from 15 to 20, from 20 to 30, or from 20 to 25. In preferred embodiments, the degree of oxidation of the activated serotype 22F polysaccharide is from 2 to 10, from 4 to 8, from 4 to 6, from 6 to 8, from 6 to 12, from 8 to 14, from 9 to 11, from 10 to 16, from 12 to 16, from 14 to 18, from 16 to 20, from 16 to 18, from 18 to 22, or from 18 to 20.
[0207] In preferred embodiments, the activated serotype 22F polysaccharide has a molecular weight of 25 kDa to 1,000 kDa, 100 kDa to 1,000 kDa, 300 kDa to 800 kDa, 300 kDa to 700 kDa, 300 kDa to 600 kDa, 400 kDa to 1,000 kDa, 400 kDa to 800 kDa, 400 kDa to 700 kDa, or 400 kDa to 600 kDa. In one embodiment, the activated serotype 22F polysaccharide has a molecular weight of 300 kDa to 800 kDa. In one embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa. In preferred embodiments, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa and a degree of oxidation of 10 to 25, 10 to 20, 12 to 20, or 14 to 18. In preferred embodiments, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 600 kDa and a degree of oxidation of 10 to 20.
[0208] In preferred embodiments, the activated serotype 22F polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, or 0.7, or about 0.8 mM acetate per mM of serotype 22F polysaccharide. In preferred embodiments, the activated serotype 22F polysaccharide comprises at least 0.5, 0.6, or 0.7 mM acetate per mM of serotype 22F polysaccharide. In preferred embodiments, the activated serotype 22F polysaccharide comprises at least 0.6 mM acetate per mM of serotype 22F polysaccharide. In preferred embodiments, the activated serotype 22F polysaccharide comprises at least 0.7 mM acetate per mM of serotype 22F polysaccharide.
[0209] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 800 kDa and comprises at least 0.6 mM acetate per mM of serotype 22F polysaccharide.
[0210] In a preferred embodiment, the activated serotype 22F polysaccharide has a molecular weight of 400 kDa to 800 kDa, a degree of oxidation between 12 and 20, and contains at least 0.6 mM acetate per mM of serotype 22F polysaccharide.
[0211] The activated polysaccharide and / or the carrier protein may be lyophilized (freeze-dried) separately (separate lyophilization) or lyophilized (freeze-dried) together (co-lyophilization).
[0212] In one embodiment, the activated serotype 22F polysaccharide is lyophilized, optionally in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and isomalt. In a preferred embodiment, the sugar is sucrose. In one embodiment, the lyophilized activated polysaccharide is then mixed with a solution containing a carrier protein.
[0213] In another embodiment, the activated polysaccharide and the carrier protein are co-lyophilized. In such embodiments, the activated serotype 22F polysaccharide is mixed with the carrier protein and optionally lyophilized in the presence of a sugar. In preferred embodiments, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and isomalt. In preferred embodiments, the sugar is sucrose. The co-lyophilized polysaccharide and carrier protein can then be resuspended in solution and reacted with a reducing agent.
[0214] The second step of the conjugation process is the reduction of the activated polysaccharide and the carrier protein to form the conjugate (reductive amination), using a reducing agent.
[0215] The activated serotype 22F polysaccharide can be conjugated to a carrier protein by a method comprising the following steps:
[0216] (c) mixing the activated serotype 22F polysaccharide with a carrier protein; and
[0217] (d) reacting the mixed activated serotype 22F polysaccharide and carrier protein with a reducing agent to form a serotype 22F polysaccharide-carrier protein conjugate.
[0218] In one embodiment, the reduction reaction is carried out in an aqueous solvent. In another embodiment, the reduction reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.
[0219] The activated serotype 22F polysaccharide is conjugated to the protein carrier by reductive amination in dimethyl sulfoxide (DMSO), which is suitable for preserving the O-acetyl content of the polysaccharide, for example, compared to reductive amination in an aqueous phase where the O-acetylation level of the polysaccharide can be significantly reduced. Therefore, in a preferred embodiment, steps (c) and (d) are carried out in DMSO.
[0220] In one embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, sodium borohydride or zinc borohydride in the presence of a Bronsted or Lewis acid, an ammonia borane such as borane pyridine, 2-picoline borane, 2,6-diborane-methanol, dimethylamine borane, t-BuMe i PrN-BH3, benzylamine-BH3 or 5-ethyl-2-methylboranepyridine (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride.
[0221] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, which can be capped with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH4).
[0222] After the serotype 22F polysaccharide is conjugated to the carrier protein, the conjugate can be purified (enriched in the amount of polysaccharide-protein conjugate) by a variety of techniques known to those skilled in the art. These techniques include dialysis, concentration / diafiltration procedures, tangential flow filtration precipitation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration.
[0223] In some embodiments, the serotype 22F saccharide conjugates of the invention comprise a saccharide having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the saccharide has a molecular weight of 50 kDa to 1,000 kDa. In other such embodiments, the saccharide has a molecular weight of 70 kDa to 900 kDa. In other such embodiments, the saccharide has a molecular weight of 100 kDa to 800 kDa. In other such embodiments, the saccharide has a molecular weight of 200 kDa to 600 kDa. In further such embodiments the saccharide has a molecular weight of: 100 kDa to 1,000 kDa; 100 kDa to 900 kDa; 100 kDa to 800 kDa; 100 kDa to 700 kDa; 100 kDa to 600 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 150 kDa to 1,000 kDa; 150 kDa to 900 kDa ; 150kDa to 800kDa; 150kDa to 700kDa; 150kDa to 600kDa; 150kDa to 500kDa; 150kDa to 400kDa; 150kDa to 300kDa; 200kDa to 1,000kDa; 200kDa to 900kDa; 200kDa to 800kDa; 200kDa to 700kDa; 200kDa to 600kDa; 200kDa to 50 0kDa; 200kDa to 400kDa; 200kDa to 300kDa; 250kDa to 1,000kDa; 250kDa to 900kDa; 250kDa to 800kDa; 250kDa to 700kDa; 250kDa to 600kDa; 250kDa to 500kDa; 250kDa to 400kDa; 250kDa to 350kDa; 300kDa to 1,000kDa; 300kDa to 400kDa kDa; 300 kDa to 800 kDa; 300 kDa to 700 kDa; 300 kDa to 600 kDa; 300 kDa to 500 kDa; 300 kDa to 400 kDa; 400 kDa to 1,000 kDa; 400 kDa to 900 kDa; 400 kDa to 800 kDa; 400 kDa to 700 kDa; 400 kDa to 600 kDa; 500 kDa to 600 kDa. Any integer within any of the above ranges is considered an embodiment of the present disclosure. In some such embodiments, the serotype 22F glycoconjugate is prepared using reductive amination.
[0224] In some embodiments, the serotype 22F glycoconjugates of the present invention have a molecular weight of 400 kDa to 15,000 kDa; 500 kDa to 10,000 kDa; 2,000 kDa to 10,000 kDa; 3,000 kDa to 8,000 kDa; or 3,000 kDa to 5,000 kDa. In other embodiments, the serotype 22F glycoconjugates have a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 22F glycoconjugates have a molecular weight of 1,000 kDa to 8,000 kDa. In other embodiments, the serotype 22F glycoconjugates have a molecular weight of 2,000 kDa to 8,000 kDa or 3,000 kDa to 7,000 kDa.In further embodiments, the serotype 22F glycoconjugates of the invention have a molecular weight of: 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa kDa to 10,000 kDa; 500 kDa to 7,500 kDa; 500 kDa to 6,000 kDa; 500 kDa to 5,000 kDa; 500 kDa to 4,000 kDa; 500 kDa to 3,000 kDa; 500 kDa to 2,000 kDa; 500 kDa to 1,500 kDa; 500 kDa to 1,000 kDa; 750 kDa to 20,000 kDa; 750 kDa to 15,000 kDa; 750 kDa to 12,500 kDa; 750 kDa to 10,000 kDa kDa; 750kDa to 7,500kDa; 750kDa to 6,000kDa; 750kDa to 5,000kDa; 750kDa to 4,000kDa; 750kDa to 3,000kDa; 750kDa to 2,000kDa; 750kDa to 1,500kDa; 1,000kDa to 15,000kDa; 1,000kDa to 12,500kDa; 1,000kDa to 10,000kDa; 1,000kDa to 7,500kDa; 1,000kDa to 6,000kDa kDa; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.
[0225] In further embodiments, the serotype 22F glycoconjugates of the invention have a molecular weight of: 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa.
[0226] In further embodiments, the serotype 22F glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa; 5,000 kDa to 7,500 kDa; 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 12,500 kDa; 6,000 kDa to 10,000 kDa; or 6,000 kDa to 7,500 kDa.
[0227] The molecular weight of the glycoconjugates is measured by SEC-MALLS.Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0228] In preferred embodiments, the serotype 22F saccharide conjugates of the present invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, or 0.7, or about 0.8 mM acetate per mM of serotype 22F polysaccharide. In preferred embodiments, the saccharide conjugates comprise at least 0.5, 0.6, or 0.7 mM acetate per mM of serotype 22F polysaccharide. In preferred embodiments, the saccharide conjugates comprise at least 0.6 mM acetate per mM of serotype 22F polysaccharide. In preferred embodiments, the saccharide conjugates comprise at least 0.7 mM acetate per mM of serotype 22F polysaccharide.
[0229] In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 22F polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 22F polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.7. In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 22F polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 22F polysaccharide in the isolated polysaccharide is at least 0.9.
[0230] In preferred embodiments, the ratio of mM acetate / salt per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate / salt per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate / salt per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate / salt per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate / salt per mM serotype 22F polysaccharide in the glycoconjugate to mM acetate / salt per mM serotype 22F polysaccharide in the activated polysaccharide is at least 0.9.
[0231] Another way to characterize the serotype 22F glycoconjugates of the present invention is to use a carrier protein (e.g., CRM 197 The number of lysine residues conjugated to the sugar in the carrier protein can be characterized as the extent of the conjugated lysine residues (degree of conjugation). Evidence of lysine modification of the carrier protein (due to covalent bonding to the polysaccharide) can be obtained by amino acid analysis using conventional methods known to those skilled in the art. The number of lysine residues recovered as a result of conjugation is consistent with the CRM used to produce the conjugated material. 197In preferred embodiments, the degree of conjugation of the serotype 22F saccharide conjugates of the present invention is 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the degree of conjugation of the serotype 22F saccharide conjugates of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In preferred embodiments, the degree of conjugation of the serotype 22F saccharide conjugates of the present invention is 4 to 7. In some such embodiments, the carrier protein is CRM 197 .
[0232] The serotype 22F glycoconjugates of the present invention can also be characterized by the ratio of saccharide to carrier protein (weight / weight). In some embodiments, the ratio of serotype 22F polysaccharide to carrier protein (w / w) in the glycoconjugate is 0.5 to 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In other embodiments, the ratio of sugar to carrier protein (w / w) is 0.5 to 2.0, 0.5 to 1.5, 0.8 to 1.2, 0.5 to 1.0, 1.0 to 1.5, or 1.0 to 2.0. In further embodiments, the ratio of sugar to carrier protein (w / w) is 0.8 to 1.2. In preferred embodiments, the ratio of serotype 22F capsular polysaccharide to carrier protein in the conjugate is 0.9 to 1.1. In some such embodiments, the carrier protein is CRM 197 .
[0233] The serotype 22F saccharide conjugates and immunogenic compositions of the present invention may contain free sugars that are not covalently conjugated to a carrier protein but are present in the saccharide conjugate composition. Such free sugars may be non-covalently associated with the saccharide conjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the saccharide conjugate).
[0234] In preferred embodiments, the serotype 22F saccharide conjugate comprises less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F saccharide conjugate comprises less than about 40% free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F saccharide conjugate comprises less than about 25% free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F saccharide conjugate comprises less than about 20% free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide. In preferred embodiments, the serotype 22F saccharide conjugate comprises less than about 15% free serotype 22F polysaccharide compared to the total amount of serotype 22F polysaccharide.
[0235] Serotype 22F glycoconjugates can also be identified by their molecular size distribution (K d ) for characterization. Size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular weight size distribution of the conjugate. Size exclusion chromatography (SEC) is used in a gravity feed column to describe the molecular size distribution of the conjugate. Large molecules are discharged from the pores in the medium eluate much faster than small molecules. A fraction collector is used to collect the column eluate. The fractions are tested colorimetrically by saccharide determination. In order to determine K d , the column is calibrated to establish the fraction where the molecules are completely excluded (V0), (K d = 0), and the fraction representing the maximum retention (V i ), (K d =1). The fraction that achieves the specified sample attribute (V e ) through the expression K d =(V e -V0) / (V i -V0) and K d Related.
[0236] In a preferred embodiment, at least 30% of the serotype 22F glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40% of the glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d In preferred embodiments, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 22F glycoconjugates have a K of less than or equal to 0.3 in a CL-4B column. dIn a preferred embodiment, at least 60% of the serotype 22F glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 50% to 80% of the serotype 22F glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 65% to 80% of the serotype 22F glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d .
[0237] 1.3.3 Glycoconjugates from Streptococcus pneumoniae serotype 33F
[0238] In one embodiment, the serotype 33F saccharide conjugate is obtained by activating the polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled to amino groups on the carrier protein directly or via a spacer (linker) group. For example, the spacer can be cystamine or cysteamine to give a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reaction with a maleimide-activated carrier protein (e.g., using GMBS) or with a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexamethylenediamine or adipic acid dihydrazide (ADH) and the amino-derivatized sugar is conjugated to the carrier protein using carbodiimide chemistry (e.g., EDAC or EDC) via carboxyl groups on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.
[0239] Other suitable techniques use carbodiimides, hydrazides, active esters, norbornane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of the free hydroxyl groups of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254: 2572-2574; Hearn et al. (1981) J. Chromatogr. 218: 509-518) followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric end to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling of the CDI carbamate intermediate to an amino group on the protein.
[0240] In certain embodiments, the serotype 33F glycoconjugates of the present invention are prepared using reductive amination. In such embodiments, the serotype 33F glycoconjugates of the present invention can be prepared using reductive amination in an aqueous phase (RAC / water). Reductive amination in an aqueous phase has been successfully used to produce pneumococcal conjugate vaccines (see, for example, WO 2006 / 110381). However, preferably, when reductive amination is used, the serotype 33F glycoconjugate is prepared by reductive amination in DMSO (RAC / DMSO). Given the challenges associated with maintaining O-acetyl functionality when using the RAC / water method, reductive amination in DMSO is preferred. RAC / DMSO has been successfully used to produce pneumococcal conjugate vaccines (see, for example, WO 2006 / 110381).
[0241] In a preferred embodiment, the serotype 33F saccharide conjugates of the present invention are prepared using eTEC conjugation (hereinafter referred to as "serotype 33F eTEC-linked saccharide conjugates") as described in Examples 1, 2, and 3 and WO 2014 / 027302. The 33F saccharide conjugates comprise a saccharide covalently conjugated to a carrier protein via one or more eTEC spacers, wherein the saccharide is covalently conjugated to the eTEC spacer via a carbamate bond, and wherein the carrier protein is covalently conjugated to the eTEC spacer via an amide bond. The eTEC-linked saccharide conjugates of the present invention can be represented by the general formula (III):
[0242]
[0243] The atoms that make up the eTEC spacer are contained in the middle box.
[0244] The eTEC spacer comprises seven linear atoms (i.e., –C(O)NH(CH2)2SCH2C(O)-) and provides stable thioether and amide bonds between the sugar and the carrier protein. The synthesis of eTEC-linked glycoconjugates involves reacting an activated hydroxyl group of the sugar with an amino group of a thioalkylamine reagent (e.g., cystamine or cysteine amine or a salt thereof) to form a carbamate bond on the sugar to provide a thiolated sugar. Generation of one or more free sulfhydryl groups is achieved by reaction with a reducing agent to provide an activated thiolated sugar. Reaction of the free sulfhydryl groups of the activated thiolated sugar with an activated carrier protein (having one or more α-haloacetamide groups on an amine-containing residue) generates a thioether bond to form a conjugate, wherein the carrier protein is attached to the eTEC spacer via an amide bond.
[0245] In the serotype 33F saccharide conjugates of the present invention, the saccharide may be a polysaccharide or an oligosaccharide. The carrier protein may be selected from any suitable carrier described herein or known to those skilled in the art. In common embodiments, the saccharide is a polysaccharide. In some such embodiments, the carrier protein is a CRM. 197 In some such embodiments, the eTEC-linked saccharide conjugate comprises S. pneumoniae serotype 33F capsular polysaccharide.
[0246] In a particularly preferred embodiment, the eTEC-linked glycoconjugate comprises Pn-33F capsular polysaccharide covalently conjugated to the CRM via an eTEC spacer. 197 (Serotype 33F eTEC linked glycoconjugate).
[0247] In some embodiments, the saccharide conjugates of serotype 33F of the present invention comprise a saccharide having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the saccharide has a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharide has a molecular weight of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; 200 kDa to 500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa. Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0248] In some embodiments, the serotype 33F glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 33F glycoconjugates have a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 33F glycoconjugates have a molecular weight of 200 kDa to 10,000 kDa. In other embodiments, the serotype 33F glycoconjugates have a molecular weight of 1,000 kDa to 3,000 kDa.
[0249] In further embodiments, the serotype 33F glycoconjugates of the invention have a molecular weight of: 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa to 10,000 kDa; 500 kDa to 7,500 kDa; 500 kDa to 6,000 kDa. ; 500kDa to 5,000kDa; 500kDa to 4,000kDa; 500kDa to 3,000kDa; 500kDa to 2,000kDa; 500kDa to 1,500kDa; 500kDa to 1,000kDa; 750kDa to 20,000kDa; 750kDa to 15,000kDa; 750kDa to 12,500kDa; 750kDa to 10,000kDa; 750kDa to 7,500kDa; 750kDa to 6,000kDa; 750kDa to 5,000kDa; 750kDa to 4,000kDa; 750kDa to 3,000kDa; 7 50kDa to 2,000kDa; 750kDa to 1,500kDa; 1,000kDa to 15,000kDa; 1,000kDa to 12,500kDa; 1,000kDa to 10,000kDa; 1,000kDa to 7,500kDa; 1,000kDa to 6,000kDa; 1,000kDa to 5,000kDa; 1,000kDa to 4,000kDa; 1,000kDa to 2,500kDa; 2,000kDa to 15,000kDa; 2,000kDa to 12,500kDa; 2,000kDa to 10,000kDa; 2,000kDa to 7 ,500kDa; 2,000kDa to 6,000kDa; 2,000kDa to 5,000kDa; 2,000kDa to 4,000kDa; 2,000kDa to 3,000kDa; 3,000kDa to 20,000kDa; 3,000kDa to 15,000kDa; 3,000kDa to 12,500kDa; 3,000kDa to 10,000kDa; 3,000kDa to 9,000kDa; 3,000kDa to 8,000kDa; 3,000kDa to 7,000kDa; 3,000kDa to 6,000kDa; 3,000kDa to 5,000kDa;or 3,000 kDa to 4,000 kDa. Any integer within any of the above ranges is considered an embodiment of the present disclosure. ;
[0250] Another way to characterize the serotype 33F glycoconjugates of the present invention is to use a carrier protein (e.g., CRM 197 ) is conjugated to a sugar, which can be characterized as the extent of the conjugated lysine residues (degree of conjugation).
[0251] In preferred embodiments, the degree of conjugation of the serotype 33F saccharide conjugates of the invention is 2 to 20, 4 to 16, 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the degree of conjugation of the serotype 33F saccharide conjugates of the invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20. In preferred embodiments, the degree of conjugation of the serotype 33F saccharide conjugates of the invention is 4 to 16. In some such embodiments, the carrier protein is CRM 197 .
[0252] In a preferred embodiment, the carrier protein comprises a CRM 197 , which contains 39 lysine residues. In some such embodiments, the CRM 197 There may be 4 to 16 lysine residues among the 39 lysine residues covalently linked to the sugar. Another way to express this parameter is that about 10% to about 41% of the CRM 197 Lysine is covalently linked to a sugar. In another such embodiment, the CRM 197 Of the 39 lysine residues covalently linked to the sugar, 2 to 20 lysine residues may be present. Another way to express this parameter is that about 5% to about 50% of the CRM 197 Lysine is covalently linked to a sugar. In some embodiments, the CRM 197 About 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, or about 16 lysine residues can be included among the 39 lysine residues covalently linked to the sugar.
[0253] In common embodiments, the carrier protein is covalently conjugated to the eTEC spacer via an amide bond to one or more epsilon-amino groups of a lysine residue on the carrier protein. In some such embodiments, the carrier protein comprises 2 to 20 lysine residues covalently conjugated to a saccharide. In other such embodiments, the carrier protein comprises 4 to 16 lysine residues covalently conjugated to a saccharide.
[0254] The serotype 33F saccharide conjugates of the present invention can also be characterized by the ratio of saccharide to carrier protein (weight / weight). In some embodiments, the ratio of saccharide to carrier protein (w / w) is 0.2 to 4.0 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the ratio of sugar to carrier protein (w / w) is from 1.0 to 2.5. In further embodiments, the ratio of sugar to carrier protein (w / w) is from 0.4 to 1.7. In some such embodiments, the carrier protein is CRM 197 .
[0255] The frequency of sugar chain attachment to lysine residues on the carrier protein is another parameter used to characterize the serotype 33F glycoconjugates of the present invention. For example, in some embodiments, at least one covalent bond between the carrier protein and the polysaccharide occurs for every four repeating sugar units of the polysaccharide. In another embodiment, at least one covalent bond between the carrier protein and the polysaccharide occurs for every ten repeating sugar units of the polysaccharide. In another embodiment, at least one covalent bond between the carrier protein and the polysaccharide occurs for every fifteen repeating sugar units of the polysaccharide. In yet another embodiment, at least one covalent bond between the carrier protein and the polysaccharide occurs for every twenty-five repeating sugar units of the polysaccharide.
[0256] In common embodiments, the carrier protein is CRM 197 And the CRM appears at least once every 4, 10, 15 or 25 sugar repeating units of the polysaccharide 197 and the covalent bond between the polysaccharide and the eTEC spacer.
[0257] In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the sugar for every 5 to 10 sugar repeating units; at least one covalent bond between the carrier protein and the sugar for every 2 to 7 sugar repeating units; at least one covalent bond between the carrier protein and the sugar for every 3 to 8 sugar repeating units; at least one covalent bond between the carrier protein and the sugar for every 4 to 9 sugar repeating units; at least one covalent bond between the carrier protein and the sugar for every 6 to 11 sugar repeating units; at least one covalent bond between the carrier protein and the sugar for every 7 to 12 sugar repeating units; at least one covalent bond between the carrier protein and the sugar for every 8 to 13 sugar repeating units; at least one covalent bond between the carrier protein and the sugar for every 9 to 14 sugar repeating units; at least one covalent bond between the carrier protein and the sugar for every 10 to 15 sugar repeating units; at least one covalent bond between the carrier protein and the sugar for every 2 to 6 sugar repeating units. covalent bonds, every 3 to 7 sugar repeating units contain at least one covalent bond between the carrier protein and the sugar; every 4 to 8 sugar repeating units contain at least one covalent bond between the carrier protein and the sugar; every 6 to 10 sugar repeating units contain at least one covalent bond between the carrier protein and the sugar; every 7 to 11 sugar repeating units contain at least one covalent bond between the carrier protein and the sugar; every 8 to 12 sugar repeating units contain at least one covalent bond between the carrier protein and the sugar; every 9 to 13 sugar repeating units contain at least one covalent bond between the carrier protein and the sugar; every 10 to 14 sugar repeating units contain at least one covalent bond between the carrier protein and the sugar; every 10 to 20 sugar repeating units contain at least one covalent bond between the carrier protein and the sugar; every 4 to 25 sugar repeating units contain at least one covalent bond between the carrier protein and the sugar, or every 2 to 25 sugar repeating units contain at least one covalent bond between the carrier protein and the sugar. In a common embodiment, the carrier protein is CRM 197 .
[0258] In another embodiment, at least one linkage between the carrier protein and the sugar occurs every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 sugar repeating units of the polysaccharide. 197 Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0259] An important consideration during conjugation is the development of conditions that allow for retention of potentially sensitive non-sugar substituted functional groups of each component, such as O-acyl, phosphate or glycerophosphate side chains (which may form part of the sugar epitope).
[0260] In one embodiment, the serotype 33F saccharide conjugates of the invention comprise a saccharide having a degree of O-acetylation of 10% to 100%. In some such embodiments, the saccharide has a degree of O-acetylation of 50% to 100%. In other such embodiments, the saccharide has a degree of O-acetylation of 75% to 100%. In further embodiments, the saccharide has a degree of O-acetylation greater than or equal to 70% (≥70%).
[0261] In preferred embodiments, the serotype 33F saccharide conjugates of the present invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM acetate per mM serotype 33F capsular polysaccharide. In preferred embodiments, the saccharide conjugates comprise at least 0.5, 0.6, or 0.7 mM acetate per mM serotype 33F capsular polysaccharide. In preferred embodiments, the saccharide conjugates comprise at least 0.6 mM acetate per mM serotype 33F capsular polysaccharide. In preferred embodiments, the saccharide conjugates comprise at least 0.7 mM acetate per mM serotype 33F capsular polysaccharide. In preferred embodiments, the presence of O-acetyl groups is determined by ion HPLC analysis.
[0262] In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 33F polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 33F polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.7. In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 33F polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 33F polysaccharide in the isolated polysaccharide is at least 0.9.
[0263] In preferred embodiments, the ratio of mM acetate / salt per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate / salt per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate / salt per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate / salt per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate / salt per mM serotype 33F polysaccharide in the glycoconjugate to mM acetate / salt per mM serotype 33F polysaccharide in the activated polysaccharide is at least 0.9.
[0264] The serotype 33F saccharide conjugates and immunogenic compositions of the present invention may contain free sugars that are not covalently conjugated to a carrier protein but are present in the saccharide conjugate composition. Such free sugars may be non-covalently associated with the saccharide conjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the saccharide conjugate).
[0265] In some embodiments, the serotype 33F saccharide conjugates of the present invention contain less than 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide. Preferably, the serotype 33F saccharide conjugate contains less than 15% free saccharide, more preferably less than 10% free saccharide, and more preferably less than 5% free saccharide. In a preferred embodiment, the serotype 33F saccharide conjugate contains less than about 25% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide. In a preferred embodiment, the serotype 33F saccharide conjugate contains less than about 20% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide. In a preferred embodiment, the serotype 33F saccharide conjugate contains less than about 15% free serotype 33F polysaccharide compared to the total amount of serotype 33F polysaccharide.
[0266] In certain preferred embodiments, the present invention provides a serotype 33F saccharide conjugate having one or more of the following characteristics (alone or in combination): the polysaccharide has a molecular weight of 50 kDa to 2,000 kDa; the saccharide conjugate has a molecular weight of 500 kDa to 10,000 kDa; the carrier protein comprises 2 to 20 lysine residues covalently linked to the saccharide; the saccharide to carrier protein ratio (w / w) is 0.2 to 4.0; every 4, 10, 15 or 25 saccharide repeating units of the saccharide conjugate polysaccharide comprises at least one covalent bond between the carrier protein and the polysaccharide; the saccharide has a degree of O-acetylation of 75% to 100%; the conjugate contains less than about 15% free polysaccharide relative to the total polysaccharide; the carrier protein is CRM 197 .
[0267] The serotype 33F glycoconjugates can also be identified by their molecular size distribution (K d Size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular weight size distribution of the conjugate, as described above.
[0268] In one embodiment, at least 15% of the serotype 33F glycoconjugates of the invention have a K value of less than or equal to 0.3 in a CL-4B column. d In one embodiment, at least 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 60%, 70%, 80%, or 90% of the serotype 33F glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d .
[0269] In a preferred embodiment, at least 35% of the serotype 33F glycoconjugates of the invention have a K value of less than or equal to 0.3 in a CL-4B column. d In preferred embodiments, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 33F glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 33F glycoconjugates of the invention have a K value lower than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 70% of the serotype 33F glycoconjugates of the invention have a K value lower than or equal to 0.3 in a CL-4B column. d .
[0270] In a preferred embodiment, 40% to 90% of the serotype 33F glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. dIn a preferred embodiment, 50% to 90% of the serotype 33F glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 65% to 80% of the serotype 33F glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d .
[0271] 1.3.4 Glycoconjugates from Streptococcus pneumoniae serotype 15B
[0272] In one embodiment, serotype 15B saccharide conjugates are obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide can be coupled to amino groups on a carrier protein directly or via a spacer (linker) group. For example, the spacer can be cystamine or cysteamine to give a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared using CDAP chemistry) is coupled with hexamethylenediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein via carboxyl groups on the protein carrier using carbodiimide chemistry (e.g., EDAC or EDC). Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.
[0273] Other suitable techniques use carbodiimides, hydrazides, active esters, norbornane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of the free hydroxyl groups of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254: 2572-2574; Hearn et al. (1981) J. Chromatogr. 218: 509-518) followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric end to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling of the CDI carbamate intermediate to an amino group on the protein.
[0274] In a preferred embodiment, the serotype 15B glycoconjugates of the present invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functionality from the vicinal diols in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide with a carrier protein to form the conjugate.
[0275] Preferably, the serotype 15B polysaccharide is resized to a target molecular weight (MW) range prior to oxidation. Advantageously, the size of the purified serotype 15B polysaccharide is reduced while retaining key structural features of the polysaccharide, such as the presence of O-acetyl groups. Preferably, the size of the purified serotype 15B polysaccharide is reduced by mechanical homogenization (see Section 1.2.6 above).
[0276] The oxidation step may involve reaction with a periodate. For the purposes of the present invention, the term "periodate" includes periodate and periodic acid; the term also includes metaperiodate (IO4 - ) and orthoperiodate (IO6 5- ) and various salts of periodic acid (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the periodate used to oxidize the serotype 15B capsular polysaccharide is metaperiodate. In a preferred embodiment, the periodate used to oxidize the serotype 15B capsular polysaccharide is sodium metaperiodate.
[0277] In preferred embodiments, the polysaccharide is reacted with 0.01 to 10.0, 0.05 to 5.0, 0.1 to 1.0, 0.5 to 1.0, 0.7 to 0.8, 0.05 to 0.5, 0.1 to 0.3 molar equivalents of the oxidant. In preferred embodiments, the polysaccharide is reacted with approximately 0.1, 0.15, 0.2, 0.25, 0.3, 0.35, 0.4, 0.45, 0.5, 0.55, 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, 0.95 molar equivalents of the oxidant. In preferred embodiments, the polysaccharide is reacted with approximately 0.15 molar equivalents of the oxidant. In preferred embodiments, the polysaccharide is reacted with approximately 0.25 molar equivalents of the oxidant. In preferred embodiments, the polysaccharide is reacted with approximately 0.5 molar equivalents of the oxidant. In a preferred embodiment, the polysaccharide is reacted with about 0.6 molar equivalents of the oxidant. In a preferred embodiment, the polysaccharide is reacted with about 0.7 molar equivalents of the oxidant.
[0278] In preferred embodiments, the reaction duration is from 1 hour to 50 hours, from 10 hours to 30 hours, from 15 hours to 20 hours, from 15 hours to 17 hours, or about 16 hours.
[0279] In preferred embodiments, the temperature of the reaction is maintained at 15°C to 45°C, 15°C to 30°C, 20°C to 25°C. In preferred embodiments, the temperature of the reaction is maintained at approximately 23°C.
[0280] In a preferred embodiment, the oxidation reaction is carried out in a buffer selected from the group consisting of sodium phosphate, potassium phosphate, 2-(N-morpholino)ethanesulfonic acid (MES), or Bis-Tris. In a preferred embodiment, the buffer is potassium phosphate.
[0281] In preferred embodiments, the buffer has a concentration of 1 mM to 500 mM, 1 mM to 300 mM, or 50 mM to 200 mM. In preferred embodiments, the buffer has a concentration of approximately 100 mM.
[0282] In preferred embodiments, the oxidation reaction is carried out at a pH of 4.0 to 8.0, 5.0 to 7.0, or 5.5 to 6.5. In preferred embodiments, the pH is about 6.0.
[0283] In a preferred embodiment, the activated serotype 15B capsular polysaccharide is obtained by reacting 0.5 mg / mL to 5 mg / mL of isolated serotype 15B capsular polysaccharide with 0.2-0.3 molar equivalents of periodate at a temperature of 20°C to 25°C.
[0284] In a preferred embodiment, the activated serotype 15B capsular polysaccharide is purified. The activated serotype 15B capsular polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / diafiltration. For example, the activated capsular polysaccharide is purified by concentration and diafiltration using an ultrafiltration device.
[0285] In preferred embodiments, the degree of oxidation of the activated serotype 15B capsular polysaccharide is from 2 to 20, from 2 to 15, from 2 to 10, from 2 to 5, from 5 to 20, from 5 to 15, from 5 to 10, from 10 to 20, from 10 to 15, or from 15 to 20. In preferred embodiments, the degree of oxidation of the activated serotype 15B capsular polysaccharide is from 2 to 10, from 4 to 8, from 4 to 6, from 6 to 8, from 6 to 12, from 8 to 12, from 9 to 11, from 10 to 16, from 12 to 16, from 14 to 18, from 16 to 20, from 16 to 18, or from 18 to 20.
[0286] In preferred embodiments, the activated serotype 15B capsular polysaccharide has a molecular weight of 5 kDa to 500 kDa, 50 kDa to 500 kDa, 50 kDa to 450 kDa, 100 kDa to 400 kDa, or 100 kDa to 350 kDa. In preferred embodiments, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 350 kDa. In preferred embodiments, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 300 kDa. In preferred embodiments, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa.
[0287] In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM acetate per mM of the serotype 15B capsular polysaccharide. In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6, or 0.7 mM acetate per mM of the serotype 15B capsular polysaccharide. In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide. In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.7 mM acetate per mM of the serotype 15B capsular polysaccharide.
[0288] In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM glycerol per mM of the serotype 15B capsular polysaccharide. In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.5, 0.6, or 0.7 mM glycerol per mM of the serotype 15B capsular polysaccharide. In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide. In preferred embodiments, the activated serotype 15B capsular polysaccharide comprises at least 0.7 mM glycerol per mM of the serotype 15B capsular polysaccharide.
[0289] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa such that it comprises at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide.
[0290] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa such that it comprises at least 0.6 mM of glycerol per mM of the serotype 15B capsular polysaccharide.
[0291] In a preferred embodiment, the activated serotype 15B capsular polysaccharide comprises at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide.
[0292] In a preferred embodiment, the activated serotype 15B capsular polysaccharide has a molecular weight of 100 kDa to 250 kDa such that it comprises at least 0.6 mM acetate per mM of the serotype 15B capsular polysaccharide and at least 0.6 mM glycerol per mM of the serotype 15B capsular polysaccharide.
[0293] In one embodiment, the activated serotype 15B capsular polysaccharide is lyophilized, optionally in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and isomalt. In a preferred embodiment, the sugar is sucrose. The lyophilized activated capsular polysaccharide is then mixed with a solution containing a carrier protein.
[0294] In another embodiment, the activated serotype 15B capsular polysaccharide is mixed with a carrier protein and optionally lyophilized in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and isomalt. In a preferred embodiment, the sugar is sucrose. The co-lyophilized polysaccharide and carrier protein can then be resuspended in solution and reacted with a reducing agent.
[0295] The activated serotype 15B capsular polysaccharide can be conjugated to a carrier protein by a method comprising the following steps:
[0296] (a) mixing the activated serotype 15B capsular polysaccharide with a carrier protein, and
[0297] (b) reacting the mixed activated serotype 15B capsular polysaccharide and carrier protein with a reducing agent to form a serotype 15B capsular polysaccharide-carrier protein conjugate.
[0298] The activated serotype 15B capsular polysaccharide is conjugated to the protein carrier by reductive amination in dimethyl sulfoxide (DMSO), which is suitable for preserving the O-acetyl content of the polysaccharide, for example, by reductive amination in an aqueous phase where the O-acetylation level of the polysaccharide can be significantly reduced. In a preferred embodiment, steps (a) and (b) are carried out in DMSO.
[0299] In a preferred embodiment, step (a) comprises dissolving lyophilized serotype 15B capsular polysaccharide in a solution comprising a carrier protein and DMSO.In a preferred embodiment, step (a) comprises dissolving co-lyophilized serotype 15B capsular polysaccharide and carrier protein in DMSO.
[0300] When steps (a) and (b) are performed in an aqueous solution, steps (a) and (b) are performed in a buffer, preferably selected from PBS, MES, HEPES, Bis-tris, ADA, PIPES, MOPSO, BES, MOPS, DIPSO, MOBS, HEPPSO, POPSO, TEA, EPPS, Bicine, or HEPB, at a pH of 6.0 to 8.5, 7.0 to 8.0, or 7.0 to 7.5. In a preferred embodiment, the buffer is PBS. In a preferred embodiment, the pH is about 7.3.
[0301] In preferred embodiments, the concentration of the capsular polysaccharide of serotype 15B activated in step (b) is 0.1 mg / mL to 10 mg / mL, 0.5 mg / mL to 5 mg / mL, or 0.5 mg / mL to 2 mg / mL. In preferred embodiments, the concentration of the capsular polysaccharide of serotype 15B activated in step (b) is about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, or 3.0 mg / mL.
[0302] In preferred embodiments, the initial input ratio (weight to weight) of activated serotype 15B capsular polysaccharide to carrier protein is 5:1 to 0.1:1, 2:1 to 0.1:1, 2:1 to 1:1, 1.5:1 to 1:1, 0.1:1 to 1:1, 0.3:1 to 1:1, or 0.6:1 to 1:1.
[0303] In a preferred embodiment, the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is about 0.6:1 to 1:1. In another preferred embodiment, the initial input ratio of the activated serotype 15B capsular polysaccharide to the carrier protein is about 0.6:1 to 1.5:1. Such an initial input ratio is particularly suitable for obtaining low levels of free polysaccharide in the glycoconjugate.
[0304] In preferred embodiments, the initial input ratio of activated serotype 15B capsular polysaccharide to carrier protein is about 0.4:1, 0.5:1, 0.6:1, 0.7:1, 0.8:1, 0.9:1, 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1 or 2:1.
[0305] In one embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, sodium borohydride, or zinc borohydride in the presence of a Bronsted or Lewis acid, an ammonia borane such as borane pyridine, 2-picoline borane, 2,6-diborane-methanol, dimethylamine borane, t-BuMeiPrN-BH3, benzylamine-BH3, or 5-ethyl-2-methylborane pyridine (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride. In a preferred embodiment, the reducing agent is sodium 2-picoline borane.
[0306] In preferred embodiments, the amount of reducing agent used in step (b) is about 0.1 to 10.0 molar equivalents, 0.5 to 5.0 molar equivalents, or 1.0 to 2.0 molar equivalents. In preferred embodiments, the amount of reducing agent used in step (b) is about 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, or 2.0 molar equivalents.
[0307] In a preferred embodiment, the duration of step (b) is 1 hour to 60 hours, 10 hours to 50 hours, 40 hours to 50 hours, or 42 hours to 46 hours. In a preferred embodiment, the duration of step (b) is about 44 hours.
[0308] In preferred embodiments, the temperature of the reaction in step (b) is maintained at 10° C. to 40° C., 15° C. to 30° C., or 20° C. to 26° C. In preferred embodiments, the temperature of the reaction in step (b) is maintained at approximately 23° C.
[0309] In a preferred embodiment, the method for preparing a glycoconjugate comprising a capsular polysaccharide of Streptococcus pneumoniae serotype 15B covalently linked to a carrier protein further comprises the step of capping unreacted aldehyde by adding NaBH4 (step (c)).
[0310] In preferred embodiments, the amount of NaBH used in step (c) is 0.1 to 10 molar equivalents, 0.5 to 5.0 molar equivalents, or 1.0 to 3.0 molar equivalents. In preferred embodiments, the amount of NaBH used in step (c) is about 2 molar equivalents.
[0311] In a preferred embodiment, the duration of step (c) is 0.1 to 10 hours, 0.5 to 5 hours, or 2 to 4 hours. In a preferred embodiment, the duration of step (c) is about 3 hours.
[0312] In preferred embodiments, the temperature of the reaction in step (c) is maintained at 15° C. to 45° C., 15° C. to 30° C., or 20° C. to 26° C. In preferred embodiments, the temperature of the reaction in step (c) is maintained at approximately 23° C.
[0313] In preferred embodiments, the yield of the conjugation step exceeds 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%. In preferred embodiments, the yield of the conjugation step (step b) exceeds 60%. In preferred embodiments, the yield of the conjugation step (step b) exceeds 70%. The yield is (amount of serotype 15B polysaccharide in the conjugate x 100) / amount of activated polysaccharide used in the conjugation step.
[0314] In a preferred embodiment, the method for preparing a glycoconjugate comprising a capsular polysaccharide of Streptococcus pneumoniae serotype 15B covalently linked to a carrier protein comprises the following steps:
[0315] (a) Purified serotype 15B polysaccharide was resized by high pressure homogenization;
[0316] (b) reacting the size-modified serotype 15B polysaccharide with an oxidizing agent;
[0317] (c) mixing the activated serotype 15B polysaccharide with a carrier protein;
[0318] (d) reacting the mixed activated serotype 15B polysaccharide and carrier protein with a reducing agent to form a serotype 15B polysaccharide-carrier protein conjugate; and
[0319] (e) Unreacted aldehyde is capped (quenched) by the addition of NaBH4.
[0320] In preferred embodiments, the yield of the conjugation step (step d) of the above method exceeds 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, or 90%. In preferred embodiments, the yield of the conjugation step (step d) exceeds 60%. In preferred embodiments, the yield of the conjugation step (step d) exceeds 70%. The yield is (amount of serotype 15B polysaccharide in the conjugate x 100) / amount of activated polysaccharide used in the conjugation step.
[0321] After the serotype 15B capsular polysaccharide is conjugated to the carrier protein, the polysaccharide-protein conjugate can be purified (the amount of polysaccharide-protein conjugate is enriched) by a number of techniques known to those skilled in the art. These techniques include dialysis, concentration / diafiltration procedures, tangential flow filtration, precipitation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration.
[0322] In one embodiment, the carrier protein is as defined in Section 1.1. In one embodiment, the carrier protein is selected from the group consisting of: DT (diphtheria toxin), TT (tetanus toxoid), CRM 197 , other DT mutants, PD (Haemophilus influenzae protein D), or immunologically functional equivalents thereof. In one embodiment, the carrier protein is CRM 197 .
[0323] In some embodiments, the serotype 15B glycoconjugates of the invention are conjugated to a carrier protein (e.g., CRM 197) and comprises a saccharide having a molecular weight of 5 kDa to 1,500 kDa. In other such embodiments, the saccharide has a molecular weight of 10 kDa to 1,500 kDa. In further such embodiments the saccharide has a molecular weight of 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 50 kDa to 250 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa; 100 kDa to 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 100 kDa to 250 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa; or 200 kDa to 400 kDa. Any integer within any of the above ranges is considered an embodiment of the present disclosure. In some embodiments, the serotype 15B glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In some embodiments, the serotype 15B glycoconjugates of the present invention have a molecular weight of 1,000 kDa to 20,000 kDa. In preferred embodiments, the serotype 15B glycoconjugates of the present invention have a molecular weight of 3,000 kDa to 20,000 kDa, 5,000 kDa to 10,000 kDa, 5,000 kDa to 20,000 kDa, 8,000 kDa to 20,000 kDa, 8,000 kDa to 16,000 kDa, or 10,000 kDa to 16,000 kDa.
[0324] In further embodiments, the serotype 15B glycoconjugates of the invention have a molecular weight of about 1,000 kDa, about 1,500 kDa, about 2,000 kDa, about 2,500 kDa, about 3,000 kDa, about 3,500 kDa, about 4,000 kDa, about 4,500 kDa, about 5,000 kDa, about 5,500 kDa, about 6,000 kDa, about 6,500 kDa, about 7,000 kDa, about 7,500 kDa, about 8,000 kDa, about 8,500 kDa, about 9,000 kDa, about 9,500 kDa, about 10,000 kDa kDa, about 15,000 kDa, about 16,500 kDa, about 17,000 kDa, about 17,500 kDa, about 18,000 kDa, about 18,500 kDa, about 19,000 kDa, about 19,500 kDa, or about 20,000 kDa.
[0325] In further embodiments, the serotype 15B glycoconjugates of the invention have a molecular weight of 1,000 kDa to 20,000 kDa; 1,000 kDa to 15,000 kDa; 1,000 kDa to 10,000 kDa; 1,000 kDa to 7,500 kDa; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 3,000 kDa; 2 ...5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 3,000 kDa; 2,000 kDa to 5,000 kDa; 0 kDa to 20,000 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.
[0326] In further embodiments, the serotype 15B glycoconjugates of the invention have a molecular weight of 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 3,000 kDa to 4,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa.
[0327] In further embodiments, the serotype 15B glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa; 5,000 kDa to 7,500 kDa; 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 12,500 kDa; 6,000 kDa to 10,000 kDa; or 6,000 kDa to 7,500 kDa.
[0328] The molecular weight of the glycoconjugate is measured by SEC-MALLS. Any integer within any of the above ranges is considered an embodiment of the present disclosure. In one embodiment, the serotype 15B glycoconjugate is prepared using reductive amination.
[0329] The serotype 15B saccharide conjugates of the present invention can also be characterized by the ratio of saccharide to carrier protein (weight / weight). In preferred embodiments, the ratio of serotype 15B capsular polysaccharide to carrier protein (weight to weight) is between 0.5 and 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In preferred embodiments, the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is between 0.4 and 2. In preferred embodiments, the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.5 to 2.0, 0.5 to 1.5, 0.5 to 1.0, 1.0 to 1.5, 1.0 to 2.0. In preferred embodiments, the ratio of serotype 15B capsular polysaccharide to carrier protein in the conjugate is 0.7 to 0.9.
[0330] The serotype 15B saccharide conjugates and immunogenic compositions of the present invention may contain free sugars that are not covalently conjugated to a carrier protein but are present in the saccharide conjugate composition. Such free sugars may be non-covalently associated with the saccharide conjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the saccharide conjugate).
[0331] In preferred embodiments, the serotype 15B saccharide conjugates of the invention comprise less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, or 15% free serotype 15B capsular polysaccharide compared to the total amount of serotype 15B capsular polysaccharide. In preferred embodiments, the serotype 15B saccharide conjugates of the invention comprise less than about 25% free serotype 15B capsular polysaccharide compared to the total amount of serotype 15B capsular polysaccharide. In preferred embodiments, the serotype 15B saccharide conjugates of the invention comprise less than about 20% free serotype 15B capsular polysaccharide compared to the total amount of serotype 15B capsular polysaccharide. In preferred embodiments, the serotype 15B saccharide conjugates of the invention comprise less than about 15% free serotype 15B capsular polysaccharide compared to the total amount of serotype 15B capsular polysaccharide.
[0332] The serotype 15B glycoconjugates can also be identified by their molecular size distribution (K d Size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular weight size distribution of the conjugate, as described above.
[0333] In a preferred embodiment, at least 20% of the serotype 15B glycoconjugates of the present invention have a K value lower than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 30% of the immunogenic conjugate has a K value less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40% of the serotype 15B glycoconjugates of the present invention have a K value lower than or equal to 0.3 in a CL-4B column. d In preferred embodiments, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 15 glycoconjugates of the invention have a K of less than or equal to 0.3. d In a preferred embodiment, at least 60% of the serotype 15B glycoconjugates of the present invention have a K value lower than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 70% of the serotype 15B glycoconjugates of the present invention have a K value lower than or equal to 0.3 in a CL-4B column. d .
[0334] In a preferred embodiment, 40% to 90% of the serotype 15B glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 50% to 90% of the serotype 15B glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 65% to 80% of the serotype 15B glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d .
[0335] In preferred embodiments, the serotype 15B glycoconjugates of the present invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM acetate per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the glycoconjugates comprise at least 0.5, 0.6, or 0.7 mM acetate per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the glycoconjugates comprise at least 0.6 mM acetate per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the glycoconjugates comprise at least 0.7 mM acetate per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the presence of O-acetyl groups is determined by ion HPLC analysis.
[0336] In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 15B capsular polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 15B capsular polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.7. In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 15B capsular polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 15B capsular polysaccharide in the isolated polysaccharide is at least 0.9. In preferred embodiments, the presence of O-acetyl groups is determined by ion HPLC analysis.
[0337] In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 15B capsular polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 15B capsular polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.7. In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 15B capsular polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 15B capsular polysaccharide in the activated polysaccharide is at least 0.9. In preferred embodiments, the presence of O-acetyl groups is determined by ion HPLC analysis.
[0338] In preferred embodiments, the serotype 15B glycoconjugates of the present invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, or 0.8 mM glycerol per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the serotype 15B glycoconjugates of the present invention comprise at least 0.5, 0.6, or 0.7 mM glycerol per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the serotype 15B glycoconjugates of the present invention comprise at least 0.6 mM glycerol per mM of serotype 15B capsular polysaccharide. In preferred embodiments, the serotype 15B glycoconjugates of the present invention comprise at least 0.7 mM glycerol per mM of serotype 15B capsular polysaccharide.
[0339] Another way to characterize the serotype 15B glycoconjugates of the present invention is to use a carrier protein (e.g., CRM 197The number of lysine residues conjugated to the sugar in the carrier protein can be characterized as the extent of the conjugated lysine residues (degree of conjugation). Evidence of lysine modification of the carrier protein (due to covalent bonding to the polysaccharide) can be obtained by amino acid analysis using conventional methods known to those skilled in the art. The number of lysine residues recovered as a result of conjugation is consistent with the CRM used to produce the conjugated material. 197 Protein is reduced compared to starting material.
[0340] In preferred embodiments, the degree of conjugation of the serotype 15B saccharide conjugates of the present invention is 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the degree of conjugation of the serotype 15B saccharide conjugates of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In preferred embodiments, the degree of conjugation of the serotype 15B saccharide conjugates of the present invention is 2 to 5.
[0341] 1.3.5 Glycoconjugates from Streptococcus pneumoniae serotype 12F
[0342] In the saccharide conjugates of the present invention derived from Streptococcus pneumoniae serotype 12F, the saccharide is selected from the group consisting of polysaccharides and oligosaccharides, and the carrier protein is selected from any suitable carrier described herein or known to those skilled in the art. In some preferred embodiments, the saccharide is a polysaccharide derived from serotype 12F Streptococcus pneumoniae.
[0343] In one embodiment, a saccharide conjugate from Streptococcus pneumoniae serotype 12F is prepared using CDAP. The polysaccharide is activated with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. The activated polysaccharide is then coupled to a carrier protein (preferably CRM) directly or via a spacer (linker) group. 197 ). For example, the spacer may be cystamine or cysteamine to give a thiolated polysaccharide which can be coupled to the carrier via a thioether bond obtained after reaction with a maleimide-activated carrier protein (e.g. using GMBS) or with a haloacetylated carrier protein (e.g. using iodoacetimide, SIB, SlAB, sulfo-SIAB, SIA or SBAP). Preferably, the cyanate ester (optionally prepared by CDAP chemistry) is coupled with hexamethylenediamine or adipic acid dihydrazide (ADH) and the amino-derivatized sugar is conjugated to the carrier protein (e.g. CRM) via the carboxyl groups on the protein carrier using carbodiimide (e.g. EDAC or EDC) chemistry.197 ).
[0344] Other suitable techniques use carbodiimides, hydrazides, active esters, norbornane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of the free hydroxyl groups of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254: 2572-2574; Hearn et al. (1981) J. Chromatogr. 218: 509-518) followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric end to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling of the CDI carbamate intermediate to an amino group on the protein.
[0345] In one embodiment, the capsular polysaccharide of serotype 12F Streptococcus pneumoniae is conjugated to a carrier protein by reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functionality from vicinal diols in individual hexasaccharide units, and (2) reduction of the activated polysaccharide and the carrier protein to form the conjugate.
[0346] Prior to oxidation, the serotype 12F polysaccharide is optionally hydrolyzed (resized). Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid.
[0347] In one embodiment, the oxidizing agent is a periodate.The term "periodate" includes periodate and periodic acid (see below).
[0348] In a preferred embodiment, the oxidizing agent is 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) free radical and N-chlorosuccinimide (NCS) as a co-oxidant. In this embodiment, the saccharide conjugate from Streptococcus pneumoniae serotype 12F is prepared using 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) free radical to oxidize the primary alcohol of the saccharide to an aldehyde and using N-chlorosuccinimide (NCS) as a co-oxidant (hereinafter referred to as "TEMPO / NCS oxidation"), as described in Example 7 and in WO 2014 / 097099. Thus, in one aspect, the saccharide conjugate from Streptococcus pneumoniae serotype 12F can be obtained by a method comprising the following steps: a) reacting the 12F saccharide with 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and N-chlorosuccinimide (NCS) in an aqueous solvent to produce an activated saccharide; and b) reacting the activated saccharide with a carrier protein comprising one or more amine groups (hereinafter referred to as "TEMPO / NCS-reductive amination"). In one aspect, the saccharide conjugate from Streptococcus pneumoniae serotype 12F is obtained by the method. In one embodiment, the degree of oxidation of the activated 12F sugar ranges from 1 to 50, from 1 to 40, from 1 to 30, from 1 to 20, from 1 to 10, from 1 to 5, from 3 to 40, from 3 to 30, from 3 to 20, from 3 to 10, from 4 to 40, from 4 to 30, from 4 to 20, from 4 to 10, from 5 to 30, from 5 to 25, from 5 to 20, from 5 to 10, from 6 to 50, from 6 to 40, from 6 to 30, from 6 to 20, from 6 to 15, from 6 to 14, from 6 to 13, from 6 to 12 ... from 8 to 13, from 8 to 13, from 8 to 12, from 8 to 11, from 8 to 10, from 9 to 40, from 9 to 30, from 9 to 20, from 9 to 15, from 10 to 40, from 10 to 30, from 10 to 20, or from 10 to 15. In other aspects, the activated sugar has a degree of oxidation of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40. Preferably, the carrier protein is CRM 197 .
[0349] In one embodiment, prior to step a), the 12F saccharide is hydrolyzed to a molecular weight range of from 100 kDa to 400 kDa. For example, in one aspect, the molecular weight range is from 100 kDa to 350 kDa, from 100 kDa to 300 kDa, from 100 kDa to 250 kDa, from 100 kDa to 200 kDa, from 100 kDa to 150 kDa, from 200 kDa to 400 kDa, from 200 kDa to 350 kDa, from 200 kDa to 300 kDa, from 200 kDa to 250 kDa, from 300 kDa to 400 kDa, or from 300 kDa to 350 kDa.
[0350] In another aspect, the method further comprises purifying the activated polysaccharide before step b). In another aspect, the method further comprises adding a reducing agent after step b). In one aspect, the reducing agent is NaCNBH3. In another aspect, the method further comprises adding NaBH4 after adding NaCNBH3. In another aspect, the method further comprises purifying after adding NaBH4.
[0351] In another aspect, the present disclosure provides a saccharide conjugate from Streptococcus pneumoniae serotype 12F that can be produced or obtained by the methods disclosed above. For example, in one aspect, the present disclosure provides a saccharide conjugate from Streptococcus pneumoniae serotype 12F, comprising a saccharide conjugated to a carrier protein, which can be produced or obtained by a method comprising the following steps: a) reacting the saccharide with 2,2,6,6-tetramethyl-1-piperidinyloxy (TEMPO) and N-chlorosuccinimide (NCS) in an aqueous solvent to produce an activated saccharide; and b) reacting the activated saccharide with a carrier protein comprising one or more amine groups.
[0352] In one embodiment, the glycoconjugate of the present invention from S. pneumoniae serotype 12F has a molecular weight of about 50 kDa to about 20,000 kDa. In another embodiment, the glycoconjugate has a molecular weight of about 200 kDa to about 10,000 kDa. In another embodiment, the glycoconjugate from S. pneumoniae serotype 12F has a molecular weight of about 500 kDa to about 5,000 kDa. In one embodiment, the glycoconjugate from S. pneumoniae serotype 12F has a molecular weight of about 1,000 kDa to about 3,000 kDa. In other embodiments, the glycoconjugate from S. pneumoniae serotype 12F has a molecular weight of about 600 kDa to about 2,800 kDa; about 700 kDa to about 2,700 kDa; about 1,000 kDa to about 2,000 kDa; about 1,800 kDa to about 2,500 kDa; about 1,100 kDa to about 2,200 kDa; about 1,900 kDa to about 2,700 kDa; about 1,200 kDa to about 2,400 kDa; about 1,700 kDa to about 2,600 kDa; about 1,300 kDa to about 2,600 kDa; about 1,600 kDa to about 3,000 kDa.
[0353] In further embodiments, the serotype 12F glycoconjugates of the invention have molecular weights of: 1,000 kDa to 20,000 kDa; 1,000 kDa to 15,000 kDa; 1,000 kDa to 10,000 kDa; 1,000 kDa to 7,500 kDa; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 3,000 kDa; 2,0 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa. Any integer within any of the above ranges is considered an embodiment of the present disclosure. In some such embodiments, the carrier protein is a CRM 197 In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein via TEMPO / NCS-reductive amination.
[0354] Another way to characterize the serotype 12F glycoconjugates of the present invention is to characterize the serotype 12F glycoconjugates by carrier proteins (e.g. CRM197 ) is conjugated to a sugar, which can be characterized as the extent of the conjugated lysine residues (degree of conjugation).
[0355] In preferred embodiments, the degree of conjugation of the serotype 12F saccharide conjugates of the invention is from 2 to 20, from 4 to 16, from 4 to 15, from 2 to 15, from 2 to 13, from 2 to 10, from 2 to 8, from 2 to 6, from 2 to 5, from 2 to 4, from 3 to 15, from 3 to 13, from 3 to 10, from 3 to 8, from 3 to 6, from 3 to 5, from 3 to 4, from 5 to 15, from 5 to 10, from 8 to 15, from 8 to 12, from 10 to 15, or from 10 to 12. In one embodiment, the degree of conjugation of the serotype 12F saccharide conjugates of the invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20.
[0356] The number of lysine residues in the carrier protein conjugated to the sugar can also be expressed as a molar ratio. 197 4 to 15 lysine residues covalently linked to the sugar), the conjugated lysine in the sugar conjugate is 197 The molar ratio of CRM is about 10:1 to about 40:1. 197 2 to 20 lysine residues covalently linked to the sugar), the conjugated lysine in the sugar conjugate is 197 The molar ratio of conjugated lysine to carrier protein is from about 5:1 to about 50:1. In one embodiment, in the glycoconjugates of the invention from S. pneumoniae serotype 12F, the molar ratio of conjugated lysine to carrier protein is from about 10:1 to about 25:1. In some such embodiments, the carrier protein is CRM 197 In some embodiments, the CRM 197 It may comprise approximately 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 of the 39 lysine residues covalently linked to the saccharide. In some such embodiments, the serotype 12F saccharide conjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.
[0357] In one embodiment, the ratio of saccharide to carrier protein (w / w) in the saccharide conjugate from S. pneumoniae serotype 12F is from 0.2 to 4 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In another embodiment, the ratio of sugar to carrier protein (w / w) in the saccharide conjugate from Streptococcus pneumoniae serotype 12F is 1.1 to 1.7. In other embodiments, the ratio of sugar to carrier protein (w / w) is 0.8 to 1.8 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, or about 1.8). In some such embodiments, the carrier protein is CRM 197 In some such embodiments, the carrier protein is CRM 197 In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein via TEMPO / NCS-reductive amination.
[0358] The frequency of sugar chains attached to lysines on the carrier protein is another parameter that characterizes the serotype 12F glycoconjugates of the present disclosure. For example, in one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 100 sugar repeating units of the polysaccharide. In one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 50 sugar repeating units of the polysaccharide. In one embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 25 sugar repeating units of the polysaccharide. In another embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 4 sugar repeating units of the polysaccharide. In another embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 10 sugar repeating units of the polysaccharide. In another embodiment, there is at least one covalent bond between the carrier protein and the polysaccharide for every 15 sugar repeating units of the polysaccharide. In a common embodiment, the carrier protein is CRM 197 At least one CRM occurs every 4, 10, 15, or 25 sugar repeating units of the polysaccharide. 197 Covalent bonds with polysaccharides.
[0359] In other embodiments, the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 5 to 10 saccharide repeating units; the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 2 to 7 saccharide repeating units; the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 3 to 8 saccharide repeating units; the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 4 to 9 saccharide repeating units; the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 6 to 11 saccharide repeating units; the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 7 to 12 saccharide repeating units; the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 8 to 13 saccharide repeating units; the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 9 to 14 saccharide repeating units; the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 10 to 15 saccharide repeating units; the conjugate comprises at least one covalent bond between the carrier protein and the saccharide for every 2 to 6 saccharide repeating units. for every 3 to 7 sugar repeating units, the conjugate comprises at least one covalent bond between the carrier protein and the sugar; for every 4 to 8 sugar repeating units, the conjugate comprises at least one covalent bond between the carrier protein and the sugar; for every 6 to 10 sugar repeating units, the conjugate comprises at least one covalent bond between the carrier protein and the sugar; for every 7 to 11 sugar repeating units, the conjugate comprises at least one covalent bond between the carrier protein and the sugar; for every 8 to 12 sugar repeating units, the conjugate comprises at least one covalent bond between the carrier protein and the sugar; for every 9 to 13 sugar repeating units, the conjugate comprises at least one covalent bond between the carrier protein and the sugar; for every 10 to 14 sugar repeating units, the conjugate comprises at least one covalent bond between the carrier protein and the sugar; for every 10 to 20 sugar repeating units, the conjugate comprises at least one covalent bond between the carrier protein and the sugar; for every 4 to 25 sugar repeating units or for every 2 to 25 sugar repeating units, the conjugate comprises at least one covalent bond between the carrier protein and the sugar. In common embodiments, the carrier protein is CRM 197 .
[0360] In another embodiment, at least one CRM occurs for every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 carbohydrate repeat units of the polysaccharide. 197 In some such embodiments, the serotype 12F saccharide conjugate is conjugated to the carrier protein via TEMPO / NCS-reductive amination.
[0361] In one embodiment, the saccharide conjugate from Streptococcus pneumoniae serotype 12F of the present invention comprises at least one covalent bond between the carrier protein and the polysaccharide for every 25 saccharide repeating units of the polysaccharide. In another embodiment, at least one covalent bond between the carrier protein and the polysaccharide occurs for every 4 saccharide repeating units of the polysaccharide. In another embodiment, at least one covalent bond between the carrier protein and the polysaccharide occurs for every 10 saccharide repeating units of the polysaccharide. In yet another embodiment, at least one covalent bond between the carrier protein and the polysaccharide occurs for every 15 saccharide repeating units of the polysaccharide. In some such embodiments, the serotype 12F saccharide conjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.
[0362] The serotype 12F saccharide conjugates and immunogenic compositions of the present invention may contain free sugars that are not covalently conjugated to a carrier protein but are present in the saccharide conjugate composition. Such free sugars may be non-covalently associated with the saccharide conjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the saccharide conjugate).
[0363] In some embodiments, the serotype 12F saccharide conjugates of the present invention comprise less than about 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5% free serotype 12F polysaccharide compared to the total amount of serotype 12F polysaccharide. In one embodiment, the saccharide conjugate from S. pneumoniae serotype 12F comprises less than about 50% free serotype 12F polysaccharide compared to the total amount of serotype 12F polysaccharide. In one embodiment, the saccharide conjugate from S. pneumoniae serotype 12F comprises less than about 45% free serotype 12F polysaccharide compared to the total amount of serotype 12F polysaccharide. In another embodiment, the saccharide conjugate comprises less than about 30% free serotype 12F polysaccharide compared to the total amount of serotype 12F polysaccharide. In another embodiment, the saccharide conjugate from Streptococcus pneumoniae serotype 12F comprises less than about 20% free serotype 12F polysaccharide compared to the total amount of serotype 12F polysaccharide. In another embodiment, the saccharide conjugate from Streptococcus pneumoniae serotype 12F comprises less than about 10% free serotype 12F polysaccharide compared to the total amount of serotype 12F polysaccharide. In another embodiment, the saccharide conjugate from Streptococcus pneumoniae serotype 12F comprises less than about 5% free serotype 12F polysaccharide compared to the total amount of serotype 12F polysaccharide. In some such embodiments, the serotype 12F saccharide conjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.
[0364] In some embodiments, the serotype 12F saccharide conjugates of the invention comprise a saccharide having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the saccharide has a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharide has a molecular weight of: 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa. a; 100 kDa to 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa; or 200 kDa to 400 kDa. In some such embodiments, the serotype 12F glycoconjugate is conjugated to the carrier protein by TEMPO / NCS-reductive amination.
[0365] The serotype 12F glycoconjugates can also be identified by their molecular size distribution (K d Size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular weight size distribution of the conjugate, as described above.
[0366] In a preferred embodiment, at least 35% of the serotype 12F glycoconjugates of the present invention have a K value lower than or equal to 0.3 in a CL-4B column. d In preferred embodiments, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 12F glycoconjugates of the invention have a K value of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 12F glycoconjugates of the present invention have a K value lower than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 70% of the serotype 12F glycoconjugates of the present invention have a K value lower than or equal to 0.3 in a CL-4B column. d .
[0367] In a preferred embodiment, 40% to 90% of the serotype 12F glycoconjugates have a Kd of less than or equal to 0.3 in a CL-4B column. In a preferred embodiment, 50% to 90% of the serotype 12F glycoconjugates have a Kd of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 65% to 80% of the serotype 12F glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d .
[0368] 1.3.6 Glycoconjugates from Streptococcus pneumoniae serotype 10A
[0369] In one embodiment, serotype 10A saccharide conjugates are obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. This activated polysaccharide can be coupled to amino groups on a carrier protein directly or via a spacer (linker) group. For example, the spacer can be cystamine or cysteamine to give a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared using CDAP chemistry) is coupled with hexamethylenediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein via carboxyl groups on the protein carrier using carbodiimide chemistry (e.g., EDAC or EDC). Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.
[0370] Other suitable techniques use carbodiimides, hydrazides, active esters, norbornane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of the free hydroxyl groups of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254: 2572-2574; Hearn et al. (1981) J. Chromatogr. 218: 509-518) followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric end to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling of the CDI carbamate intermediate to an amino group on the protein.
[0371] In a preferred embodiment, the serotype 10A saccharide conjugates of the present invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functionality from the vicinal diols in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide with the carrier protein to form the conjugate.
[0372] Prior to oxidation, the serotype 10A polysaccharide is optionally hydrolyzed (resized). Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid.
[0373] In one embodiment, the serotype polysaccharide is activated (oxidized) by preservation comprising the following steps:
[0374] (a) reacting the isolated serotype 10A polysaccharide with an oxidizing agent;
[0375] (b) Quenching of the oxidation reaction by addition of a quencher results in activated serotype 10A polysaccharide.
[0376] In a preferred embodiment, the oxidizing agent is a periodate. For the purposes of the present invention, the term "periodate" includes periodate and periodic acid, and the term also includes metaperiodate (IO4 - ) and orthoperiodate (IO6 5- ) and various salts of periodic acid (e.g., sodium periodate and potassium periodate). In a preferred embodiment, the oxidizing agent is sodium periodate. In a preferred embodiment, the periodate used to oxidize serotype 10A polysaccharide is metaperiodate. In a preferred embodiment, the periodate used to oxidize serotype 10A polysaccharide is sodium metaperiodate.
[0377] In one embodiment, the quencher is selected from a vicinal diol, a 1,2-amino alcohol, an amino acid, glutathione, a sulfite, a bisulfate, a dithionite, a metabisulfite, a thiosulfate, a phosphite, a hypophosphite, or a phosphoric acid.
[0378] In one embodiment, the quencher is a 1,2-amino alcohol of formula (I):
[0379]
[0380] where R 1 is selected from H, methyl, ethyl, propyl, or isopropyl.
[0381] In one embodiment, the quencher is selected from sodium and potassium salts of sulfite, bisulfate, dithionite, metabisulfite, thiosulfate, phosphite, hypophosphite, or phosphoric acid.
[0382] In one embodiment, the quencher is an amino acid. In such embodiments, the amino acid may be selected from the group consisting of serine, threonine, cysteine, cystine, methionine, proline, hydroxyproline, tryptophan, tyrosine, and histidine.
[0383] In one embodiment, the quencher is a sulfite such as bisulfate, dithionite, metabisulfite, thiosulfate.
[0384] In one embodiment, the quencher is a compound comprising two vicinal hydroxyl groups (vicinal diol), ie, two hydroxyl groups are covalently attached to two adjacent carbon atoms.
[0385] Preferably, the quencher is a compound of formula (II):
[0386]
[0387] where R 1 and R 2 are independently selected from H, methyl, ethyl, propyl, or isopropyl.
[0388] In a preferred embodiment, the quencher is glycerol, ethylene glycol, 1,2-propylene glycol, 1,2-butanediol or 2,3-butanediol, or ascorbic acid. In a preferred embodiment, the quencher is 2,3-butanediol.
[0389] In a preferred embodiment, the isolated serotype 10A polysaccharide is activated by a method comprising the steps of:
[0390] (a) reacting the isolated serotype 10A polysaccharide with periodate;
[0391] (b) The oxidation reaction was quenched by the addition of 2,3-butanediol, resulting in activated serotype 10A polysaccharide.
[0392] After the oxidation step of the polysaccharide, the polysaccharide is considered activated and is hereinafter referred to as "activated polysaccharide".
[0393] In a preferred embodiment, the activated serotype 10A polysaccharide is purified. The activated serotype 10A polysaccharide is purified according to methods known to those skilled in the art, such as gel permeation chromatography (GPC), dialysis, or ultrafiltration / diafiltration. For example, the activated 10A polysaccharide is purified by concentration and diafiltration using an ultrafiltration device.
[0394] In preferred embodiments the degree of oxidation of the activated serotype 10A polysaccharide is from 2 to 30, 2 to 25, 2 to 20, 2 to 15, 2 to 10, 2 to 5, 5 to 30, 5 to 25, 5 to 20, 5 to 15, 5 to 10, 10 to 30, 10 to 25, 10 to 20, 10 to 15, 15 to 30, 15 to 25, 15 to 20, 20 to 30, or 20 to 25. In preferred embodiments the degree of oxidation of the activated serotype 10A polysaccharide is from 2 to 10, 4 to 8, 4 to 6, 6 to 8, 6 to 12, 8 to 14, 9 to 11, 10 to 16, 12 to 16, 14 to 18, 16 to 20, 16 to 18, 18 to 22, or 18 to 20.
[0395] In preferred embodiments, the activated serotype 10A polysaccharide has a molecular weight of 50 kDa to 400 kDa, 50 kDa to 350 kDa, 50 kDa to 300 kDa, 50 kDa to 250 kDa, 50 kDa to 200 kDa, 100 kDa to 300 kDa, 100 kDa to 250 kDa, or 100 kDa to 200 kDa. In preferred embodiments, the activated serotype 10A polysaccharide has a molecular weight of 50 kDa to 300 kDa. In preferred embodiments, the activated serotype 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa. In preferred embodiments, the activated serotype 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa and a degree of oxidation of 5 to 20, 5 to 15, 8 to 14, 8 to 12, or 9 to 11. In a preferred embodiment, the activated serotype 10A polysaccharide has a molecular weight of 100 kDa to 200 kDa and a degree of oxidation of 9 to 11.
[0396] The activated polysaccharide and / or the carrier protein may be lyophilized (freeze-dried) separately (separate lyophilization) or together (co-lyophilization).
[0397] In one embodiment, the activated serotype 10A polysaccharide is lyophilized, optionally in the presence of a sugar. In a preferred embodiment, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and isomalt. In a preferred embodiment, the sugar is sucrose. In one embodiment, the lyophilized activated polysaccharide is then mixed with a solution comprising a carrier protein.
[0398] In another embodiment, the activated polysaccharide and the carrier protein are co-lyophilized. In such embodiments, the activated serotype 10A polysaccharide is mixed with the carrier protein and optionally lyophilized in the presence of a sugar. In preferred embodiments, the sugar is selected from sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and isomalt. In preferred embodiments, the sugar is sucrose. The co-lyophilized polysaccharide and carrier protein can then be resuspended in solution and reacted with a reducing agent.
[0399] The second step of the conjugation process is the reduction of the activated polysaccharide and the carrier protein to form the conjugate (reductive amination), using a reducing agent.
[0400] The activated serotype 10A polysaccharide can be conjugated to a carrier protein by a method comprising the following steps:
[0401] (c) mixing the activated serotype 10A polysaccharide with a carrier protein; and
[0402] (d) reacting the mixed activated serotype 10A polysaccharide and carrier protein with a reducing agent to form a serotype 10A polysaccharide-carrier protein conjugate.
[0403] In one embodiment, the reduction reaction is carried out in an aqueous solvent. In another embodiment, the reduction reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.
[0404] In one embodiment, the reducing agent is sodium cyanoborohydride, sodium triacetoxyborohydride, sodium borohydride or zinc borohydride in the presence of a Bronsted or Lewis acid, an aminoborane such as borane pyridine, 2-picoline borane, 2,6-diborane-methanol, dimethylaminoborane, t-BuMeiPrN-BH3, benzylamine-BH3 or 5-ethyl-2-methylborane pyridine (PEMB). In a preferred embodiment, the reducing agent is sodium cyanoborohydride.
[0405] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, which can be capped with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH4).
[0406] After conjugation of the serotype 10A polysaccharide to the carrier protein, the conjugate can be purified (enriched in the amount of polysaccharide-protein conjugate) by a variety of techniques known to those skilled in the art. These techniques include dialysis, concentration / diafiltration procedures, tangential flow filtration precipitation / elution, column chromatography (DEAE or hydrophobic interaction chromatography), and depth filtration.
[0407] In some embodiments, the serotype 10A saccharide conjugates of the invention comprise a saccharide having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the saccharide has a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharide has a molecular weight of: 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa. kDa; 100 kDa to 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa; or 200 kDa to 400 kDa. In some such embodiments, the serotype 10A glycoconjugate is prepared using reductive amination.
[0408] In some embodiments, the serotype 10A glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 10A glycoconjugates have a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 10A glycoconjugates have a molecular weight of 500 kDa to 15,000 kDa; 500 kDa to 10,000 kDa; 2,000 kDa to 10,000 kDa; or 3,000 kDa to 8,000 kDa. In other embodiments, the serotype 10A glycoconjugates have a molecular weight of 1,000 kDa to 10,000 kDa. In other embodiments, the serotype 10A glycoconjugates have a molecular weight of 1000 kDa to 8,000 kDa. In other embodiments, the serotype 10A glycoconjugate has a molecular weight of 2,000 kDa to 8,000 kDa or 3,000 kDa to 7,000 kDa.In further embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of: 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa to 10,000 kDa; 500 kDa to 7,500 kDa; 500 kDa to 6,000 kDa; 500 kDa to 5,000 kDa; 500 kDa to 4,000 kDa; 500 kDa to 3,000 kDa; 500 kDa to 2,000 kDa; 500 kDa to 1,500 kDa; 500 kDa to 1,000 kDa; 750 kDa to 20,000 kDa; 750 kDa to 15,000 kDa; 750 kDa to 12,500 kDa; 750 kDa to 10,000 kDa a; 750kDa to 7,500kDa; 750kDa to 6,000kDa; 750kDa to 5,000kDa; 750kDa to 4,000kDa; 750kDa to 3,000kDa; 750kDa to 2,000kDa; 750kDa to 1,500kDa; 1,000kDa to 15,000kDa; 1,000kDa to 12,500kDa; 1,000kDa to 10,000kDa; 1,000kDa to 7,500kDa; 1,000kDa to 6,000kDa a; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.
[0409] In further embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of: 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In other embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa or 5,000 kDa to 7,500 kDa. In other embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 10,000 kDa or 6,000 kDa to 7,500 kDa. In other embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 7,000 kDa to 20,000 kDa; 7,000 kDa to 15,000 kDa; 7,000 kDa to 10,000 kDa or 7,000 kDa to 8,000 kDa. In other embodiments, the serotype 10A glycoconjugates of the invention have a molecular weight of 8,000 kDa to 20,000 kDa; 8,000 kDa to 15,000 kDa; or 8,000 kDa to 10,000 kDa.
[0410] Any integer within any of the above ranges is considered an embodiment of the present disclosure.The molecular weight of the glycoconjugates was measured by SEC-MALLS.
[0411] Another way to characterize the serotype 10A glycoconjugates of the present invention is by using a carrier protein (e.g., CRM 197 The number of lysine residues conjugated to the sugar in the carrier protein can be characterized as the extent of the conjugated lysine residues (degree of conjugation). Evidence of lysine modification of the carrier protein (due to covalent bonding to the polysaccharide) can be obtained by amino acid analysis using conventional methods known to those skilled in the art. The number of lysine residues recovered as a result of conjugation is consistent with the CRM used to produce the conjugated material. 197 Protein is reduced compared to starting material.
[0412] In preferred embodiments, the degree of conjugation of the serotype 10A glycoconjugates of the present invention is 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In preferred embodiments, the degree of conjugation of the serotype 10A glycoconjugates of the present invention is 6 to 8. In preferred embodiments, the carrier protein is CRM 197 .
[0413] The serotype 10A saccharide conjugates of the present invention can also be characterized by the ratio of saccharide to carrier protein (weight / weight). In some embodiments, the ratio of saccharide to carrier protein (w / w) is 0.5 to 3.0 (e.g., about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3.0). In preferred embodiments, the serotype 10A saccharide to carrier protein in the conjugate is 0.5 to 2.0, 0.5 to 1.5, 0.5 to 1.0, 1.0 to 1.5, or 1.0 to 2.0. In preferred embodiments, the ratio of serotype 10A polysaccharide to carrier protein in the conjugate is 0.8 to 1.4. In preferred embodiments, the ratio of serotype 10A capsular polysaccharide to carrier protein in the conjugate is 0.8 to 1.2 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, or about 1.2). In some such embodiments, the carrier protein is CRM 197 .
[0414] The serotype 10A saccharide conjugates and immunogenic compositions of the present invention may contain free sugars that are not covalently conjugated to a carrier protein but are present in the saccharide conjugate composition. Such free sugars may be non-covalently associated with the saccharide conjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the saccharide conjugate).
[0415] In some embodiments, the serotype 10A saccharide conjugates of the present invention comprise less than about 50% free sugars, less than about 45% free sugars, less than about 40% free sugars, less than about 35% free sugars, less than about 30% free sugars, less than about 25% free sugars, less than about 20% free sugars, less than about 15% free sugars, less than about 10% free sugars, or less than about 5% free sugars, relative to the total amount of 10A saccharides. Preferably, the serotype 10A saccharide conjugates comprise less than 15% free sugars, more preferably less than 10% free sugars, and even more preferably less than 5% free sugars.
[0416] Serotype 10A glycoconjugates can also be identified by their molecular size distribution (K d Size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular weight size distribution of the conjugate, as described above.
[0417] In a preferred embodiment, at least 30% of the serotype 10A glycoconjugates of the invention have a K value of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 40% of the serotype 10A glycoconjugates of the invention have a K value lower than or equal to 0.3 in a CL-4B column. d In preferred embodiments, at least 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 10A glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 10A glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 50% to 80% of the serotype 10A glycoconjugates of the invention have a K value of less than or equal to 0.3 in a CL-4B column. d .
[0418] 1.3.7 Glycoconjugates from Streptococcus pneumoniae serotype 11A
[0419] In one embodiment, serotype 11A saccharide conjugates are obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. This activated polysaccharide can be coupled to amino groups on a carrier protein directly or via a spacer (linker) group. For example, the spacer can be cystamine or cysteamine to give a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared using CDAP chemistry) is coupled with hexamethylenediamine or adipic acid dihydrazide (ADH), and the amino-derivatized saccharide is conjugated to the carrier protein via carboxyl groups on the protein carrier using carbodiimide chemistry (e.g., EDAC or EDC). Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.
[0420] Other suitable techniques use carbodiimides, hydrazides, active esters, norbornane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of the free hydroxyl groups of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254: 2572-2574; Hearn et al. (1981) J. Chromatogr. 218: 509-518) followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric end to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling of the CDI carbamate intermediate to an amino group on the protein.
[0421] In a preferred embodiment, the serotype 11A glycoconjugates of the present invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functionality from the vicinal diols in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide with the carrier protein to form the conjugate.
[0422] Prior to oxidation, the serotype 11A polysaccharide is optionally hydrolyzed to reduce its viscosity. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid. Mechanical size change can be performed using high pressure homogenization shearing.
[0423] The oxidation step may involve reaction with a periodate. For the purposes of the present invention, the term "periodate" includes periodate and periodic acid; the term also includes metaperiodate (IO4- ) and orthoperiodate (IO6 5- ) and various salts of periodic acid (e.g., sodium periodate and potassium periodate). In one embodiment, the capsular polysaccharide from S. pneumoniae serotype 11A is oxidized in the presence of metaperiodate, preferably sodium periodate (NaIO4). In another embodiment, the capsular polysaccharide from serotype 11A is oxidized in the presence of orthoperiodate, preferably periodic acid.
[0424] After the oxidation step of the polysaccharide, the polysaccharide is considered activated and is referred to hereinafter as “activated polysaccharide.” The activated polysaccharide may be purified and lyophilized (freeze-dried).
[0425] The activated polysaccharide and the carrier protein can be lyophilized (freeze-dried) separately (separate lyophilization) or together (co-lyophilization). In one embodiment, the activated polysaccharide and the carrier protein are co-lyophilized. In another embodiment, the activated polysaccharide and the carrier protein are lyophilized separately.
[0426] In one embodiment, the freeze-drying is carried out in the presence of a non-reducing sugar, possible non-reducing sugars include sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol and isomalt.
[0427] The second step of the conjugation method is the reduction of the activated polysaccharide and the carrier protein to form a conjugate (reductive amination), using a reducing agent. Suitable reducing agents include cyanoborohydrides, such as sodium cyanoborohydride, borane pyridine, or borohydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.
[0428] In one embodiment, the reduction reaction is carried out in an aqueous solvent. In another embodiment, the reduction reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.
[0429] In one embodiment, 0.1 to 3.0, 0.15 to 2.0, 0.2 to 2.0, or 0.5 to 1.5 molar equivalents of sodium cyanoborohydride are used in the reduction reaction. In one embodiment, approximately 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.9, or 3.0 molar equivalents of sodium cyanoborohydride are used in the reduction reaction.
[0430] In one embodiment, the reducing agent is sodium triacetoxyborohydride. In other embodiments, 1.0 to 6.0 molar equivalents of sodium triacetoxyborohydride, 2.0 to 5.0 molar equivalents of sodium triacetoxyborohydride, or about 3.0 molar equivalents of sodium triacetoxyborohydride are used in the reduction reaction.
[0431] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, which can be capped with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH4). In one embodiment, capping is achieved by mixing the reduction reaction with 0.5 to 5.0 molar equivalents of NaBH4, for example, about 1, 1.5, 2, 2.5, or 3 molar equivalents of NaBH4.
[0432] After conjugation (reduction and optional end-capping), the glycoconjugate can be purified. The glycoconjugate can be purified by diafiltration and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by diafiltration or ion exchange chromatography or size exclusion chromatography.
[0433] In one embodiment, the glycoconjugate is sterile filtered.
[0434] In some embodiments, the serotype 11A glycoconjugates of the invention are conjugated to a carrier protein (e.g., CRM 197) and comprises a saccharide having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the saccharide has a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharide has a molecular weight of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 50 kDa to 400 kDa; 50 kDa to 300 kDa; 50 kDa to 200 kDa; 50 kDa to 100 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa kDa; 100 kDa to 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 100 kDa to 400 kDa; 100 kDa to 300 kDa; 100 kDa to 200 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa; 200 kDa to 400 kDa or 200 kDa to 300 kDa.
[0435] In some embodiments, the serotype 11A glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 11A glycoconjugates have a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 11A glycoconjugates have a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 11A glycoconjugates have a molecular weight of 200 kDa to 10,000 kDa. In other embodiments, the serotype 11A glycoconjugates have a molecular weight of 1,000 kDa to 8,000 kDa or 2,000 kDa to 8,000 kDa.
[0436] In further embodiments, the serotype 11A glycoconjugates of the invention have a molecular weight of: 200 kDa to 20,000 kDa; 200 kDa to 17,500 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 17,500 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500kDa to 10,000kDa; 500kDa to 7,500kDa; 500kDa to 6,000kDa; 500kDa to 5,000kDa; 500kDa to 4,000kDa; 500kDa to 3,000kDa; 500kDa to 2,000kDa; 500kDa to 1,500kDa; 500kDa to 1,000kDa; 700kDa to 20,000kDa; 700kDa to 17,500kDa; 700kDa to 15,000kDa; 700kDa to 12,500kDa; 700kDa to 10,000kDa; 700kDa to 7,500kDa; 700 kDa to 6,000kDa; 700kDa to 5,000kDa; 700kDa to 4,500kDa; 700kDa to 4,000kDa; 700kDa to 3,500kDa; 700kDa to 3,000kDa; 700kDa to 2,000kDa; 700kDa to 1,500kDa; 1,000kDa to 20,000kDa; 1,000kDa to 17,500kDa; 1,000kDa to 15,000kDa; 1,000kDa to 12,500kDa; 1,000kDa to 10,000kDa; 1,000kDa to 7,500kDa; 1,000kDa to 6 kDa; 2,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 20,000 kDa; 2,000 kDa to 17,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.
[0437] In further embodiments, the serotype 11A glycoconjugates of the invention have a molecular weight of: 3,000 kDa to 20,000 kDa; 3,000 kDa to 17,500 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,0 kDa; 5,000 kDa to 17,500 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 12,500 kDa; 5,000 kDa to 10,000 kDa; 5,000 kDa to 7,500 kDa; 5,000 kDa to 6,000 kDa; or 5,000 kDa to 5,000 kDa. In further embodiments, the serotype 11A glycoconjugates of the invention have a molecular weight of: 5,000 kDa to 20,000 kDa; 5,000 kDa to 17,500 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa or 5,000 kDa to 7,500 kDa.
[0438] In one embodiment, the serotype 11A glycoconjugate is prepared using reductive amination.
[0439] In preferred embodiments, the serotype 11A saccharide conjugates of the present invention comprise at least 0.3, 0.5, 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, 3.0, 3.4, 3.8, 4.2, 4.6, or 5 mM acetate per mM of serotype 11A polysaccharide. In preferred embodiments, the serotype 11A saccharide conjugates comprise at least 1.8, 2.2, or 2.6 mM acetate per mM of serotype 11A polysaccharide. In one embodiment, the saccharide conjugates comprise at least 0.6 mM acetate per mM of serotype 11A polysaccharide. In preferred embodiments, the serotype 11A saccharide conjugates of the invention comprise at least 0.6, 1, 1.4, 1.8, 2.2, 2.6, 3, 3.4, 3.8, 4.2, or 4.6 mM acetate per mM of serotype 11A polysaccharide and less than about 5 mM acetate. In one embodiment, the serotype 11A saccharide conjugates of the invention comprise at least 0.6, 1.0, 1.4, 1.8, 2.2, 2.6, or 3.0 mM acetate per mM of serotype 11A polysaccharide and less than about 3.4 mM acetate. In one embodiment, the serotype 11A saccharide conjugates of the invention comprise at least 0.6, 1, 1.4, 1.8, 2.2, 2.6, or about 3.0 mM acetate per mM of serotype 11A polysaccharide and less than about 3.3 mM acetate. Any of the above numbers are considered embodiments of the present disclosure.
[0440] In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 11A capsular polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 11A capsular polysaccharide in the isolated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 11A capsular polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 11A capsular polysaccharide in the isolated polysaccharide is at least 0.7. In preferred embodiments, the ratio of the number of mM acetate / salt per mM serotype 11A capsular polysaccharide in the glycoconjugate to the number of mM acetate / salt per mM serotype 11A capsular polysaccharide in the isolated polysaccharide is at least 0.9. In preferred embodiments, the presence of O-acetyl groups is determined by ion HPLC analysis.
[0441] In preferred embodiments, the ratio of mM acetate / salt per mM serotype 11A capsular polysaccharide in the glycoconjugate to mM acetate / salt per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.6, 0.65, 0.7, 0.75, 0.8, 0.85, 0.9, or 0.95. In preferred embodiments, the ratio of mM acetate / salt per mM serotype 11A capsular polysaccharide in the glycoconjugate to mM acetate / salt per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.7. In preferred embodiments, the ratio of mM acetate / salt per mM serotype 11A capsular polysaccharide in the glycoconjugate to mM acetate / salt per mM serotype 11A capsular polysaccharide in the activated polysaccharide is at least 0.9. In preferred embodiments, the presence of O-acetyl groups is determined by ion HPLC analysis.
[0442] In preferred embodiments, the serotype 11A saccharide conjugates of the invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0 mM glycerol per mM of serotype 11A polysaccharide. In preferred embodiments, the serotype 11A saccharide conjugates of the invention comprise at least 0.2, 0.3, or 0.4 mM glycerol per mM of serotype 11A polysaccharide. In preferred embodiments, the serotype 11A saccharide conjugates of the invention comprise at least 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, or 0.9 mM glycerol per mM of serotype 11A polysaccharide and less than about 1.0 mM glycerol. In preferred embodiments, the serotype 11A saccharide conjugates of the invention comprise at least 0.3, 0.4, 0.5, 0.6, or 0.7 mM glycerol and less than about 0.8 mM glycerol per mM of serotype 11A polysaccharide. Any of the foregoing figures are considered embodiments of the present disclosure.
[0443] Another way to characterize the serotype 11A glycoconjugates of the present invention is to characterize them by using a carrier protein (e.g. CRM 197 ) is conjugated to a sugar, which can be characterized as the extent of the conjugated lysine residues (degree of conjugation).
[0444] Evidence of carrier protein lysine modification (due to covalent bonding to the polysaccharide) can be obtained by amino acid analysis using conventional methods known to those skilled in the art. The number of lysine residues recovered as a result of conjugation will be consistent with the CRM used to generate the conjugate material. 197 Protein is reduced compared to starting material.
[0445] In preferred embodiments, the degree of conjugation of the serotype 11A glycoconjugates of the invention is 1 to 15, 1 to 13, 1 to 10, 1 to 8, 1 to 6, 1 to 5, 1 to 4, 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the degree of conjugation of the serotype 11A glycoconjugates of the invention is about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In preferred embodiments, the degree of conjugation of the serotype 11A glycoconjugates of the invention is 1 to 6 or 2 to 5. In some such embodiments, the carrier protein is CRM 197 .
[0446] The serotype 11A saccharide conjugates of the present invention can also be characterized by the ratio of saccharide to carrier protein (weight / weight). In some embodiments, the ratio of saccharide to carrier protein (w / w) is 0.2 to 4 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the ratio of sugar to carrier protein (w / w) is 0.7 to 2.5, 0.8 to 2.0, 0.7 to 2.0, 0.8 to 1.5, 0.7 to 1.5, 0.7 to 1.4, 0.8 to 1.4, 0.7 to 1.45, or 0.8 to 1.45. In further embodiments, the ratio of sugar to carrier protein (w / w) is 0.8 to 1.6 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, or about 1.6). In some such embodiments, the carrier protein is CRM 197 In one embodiment, the serotype 11A glycoconjugate is prepared using reductive amination.
[0447] The serotype 11A glycoconjugates and immunogenic compositions of the present invention may contain free sugars that are not covalently conjugated to a carrier protein but are present in the glycoconjugate composition. Such free sugars may be non-covalently associated with the glycoconjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the glycoconjugate).
[0448] In some embodiments, the serotype 11A saccharide conjugates of the present invention comprise less than about 50% free serotype 11A capsular polysaccharide, less than about 45% free saccharides, less than about 40% free saccharides, less than about 35% free saccharides, less than about 30% free saccharides, less than about 25% free saccharides, less than about 20% free saccharides, less than about 15% free saccharides, less than about 10% free saccharides, or less than about 5% free saccharide of serotype 11A capsular polysaccharide compared to the total amount of serotype 11A capsular polysaccharide. Preferably, the serotype 11A saccharide conjugates comprise less than 15% free saccharides, more preferably less than 10% free saccharides, and even more preferably less than 5% free saccharides.
[0449] Serotype 11A glycoconjugates can also be identified by their molecular size distribution (K d Size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular weight size distribution of the conjugate, as described above.
[0450] In a preferred embodiment, at least 30% of the serotype 11A glycoconjugates of the present invention have a K value of less than or equal to 0.3 in a CL-4B column. d In preferred embodiments, at least 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 11A glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 11A glycoconjugates of the present invention have a K value lower than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 65% of the serotype 11A glycoconjugates of the invention have a K value lower than or equal to 0.3 in a CL-4B column. d .
[0451] 1.3.8 Glycoconjugates from Streptococcus pneumoniae serotype 8
[0452] In one embodiment, serotype 8 saccharide conjugates are obtained by activating a polysaccharide with 1-cyano-4-dimethylaminopyridinium tetrafluoroborate (CDAP) to form a cyanate ester. This activated polysaccharide can be coupled to amino groups on a carrier protein directly or via a spacer (linker) group. For example, the spacer can be cystamine or cysteamine to give a thiolated polysaccharide, which can be coupled to the carrier via a thioether bond obtained by reaction with a maleimide-activated carrier protein (e.g., using GMBS) or a haloacetylated carrier protein (e.g., using iodoacetimide, SIB, S1AB, sulfo-SIAB, SIA, or SBAP). Preferably, the cyanate ester (optionally prepared using CDAP chemistry) is coupled with hexamethylenediamine or adipic acid dihydrazide (ADH) and the amino-derivatized saccharide is conjugated to the carrier protein using carbodiimide chemistry (e.g., EDAC or EDC) via carboxyl groups on the protein carrier. Such conjugates are described, for example, in WO 93 / 15760, WO 95 / 08348 and WO 96 / 129094.
[0453] Other suitable techniques use carbodiimides, hydrazides, active esters, norbornane, p-nitrobenzoic acid, N-hydroxysuccinimide, S-NHS, EDC, TSTU. Many are described in International Patent Application Publication No. WO 98 / 42721. Conjugation may involve a carbonyl linker, which can be formed by reaction of the free hydroxyl groups of the sugar with CDI (see Bethell et al. (1979) J. Biol. Chem. 254: 2572-2574; Hearn et al. (1981) J. Chromatogr. 218: 509-518) followed by reaction with the protein to form a carbamate bond. This may involve reduction of the anomeric end to a primary hydroxyl group, optional protection / deprotection of the primary hydroxyl group, reaction of the primary hydroxyl group with CDI to form a carbamate intermediate, and coupling of the CDI carbamate intermediate to an amino group on the protein.
[0454] In a preferred embodiment, the serotype 8 glycoconjugates of the present invention are prepared using reductive amination. Reductive amination involves two steps: (1) oxidation of the polysaccharide to generate aldehyde functionality from the vicinal diols in the individual hexasaccharide units, and (2) reduction of the activated polysaccharide with the carrier protein to form the conjugate.
[0455] Prior to oxidation, the serotype 8 polysaccharide is optionally hydrolyzed to reduce its viscosity. Mechanical or chemical hydrolysis can be used. Chemical hydrolysis can be performed using acetic acid.
[0456] The oxidation step may involve reaction with a periodate. For the purposes of the present invention, the term "periodate" includes periodate and periodic acid; the term also includes metaperiodate (IO4 - ) and orthoperiodate (IO65- ) and various salts of periodic acid (e.g., sodium periodate and potassium periodate). In one embodiment, the capsular polysaccharide from S. pneumoniae serotype 8 is oxidized in the presence of metaperiodate, preferably sodium periodate (NaIO4). In another embodiment, the capsular polysaccharide from serotype 8 is oxidized in the presence of orthoperiodate, preferably periodic acid.
[0457] After the oxidation step of the polysaccharide, the polysaccharide is considered activated and is referred to hereinafter as “activated polysaccharide.” The activated polysaccharide may be purified and lyophilized (freeze-dried).
[0458] The activated polysaccharide and the carrier protein can be lyophilized (freeze-dried) separately (separate lyophilization) or together (co-lyophilization). In one embodiment, the activated polysaccharide and the carrier protein are co-lyophilized. In another embodiment, the activated polysaccharide and the carrier protein are independently lyophilized.
[0459] In one embodiment, the lyophilization occurs in the presence of a non-reducing sugar, possible non-reducing sugars including sucrose, trehalose, raffinose, stachyose, melezitose, dextran, mannitol, lactitol, and isomalt.
[0460] The second step of the conjugation method is the reduction of the activated polysaccharide and the carrier protein to form a conjugate (reductive amination), using a reducing agent. Suitable reducing agents include cyanoborohydrides, such as sodium cyanoborohydride, borane pyridine, or borohydride exchange resins. In one embodiment, the reducing agent is sodium cyanoborohydride.
[0461] In one embodiment, the reduction reaction is carried out in an aqueous solvent. In another embodiment, the reduction reaction is carried out in an aprotic solvent. In one embodiment, the reduction reaction is carried out in a DMSO (dimethyl sulfoxide) or DMF (dimethylformamide) solvent. The DMSO or DMF solvent can be used to reconstitute the lyophilized activated polysaccharide and carrier protein.
[0462] In one embodiment, 0.1 to 3.0, 0.15 to 2.0, 0.2 to 1.0, or 0.25 to 0.5 molar equivalents of sodium cyanoborohydride are used in the reduction reaction. In one embodiment, about 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.9, or 3.0 molar equivalents of sodium cyanoborohydride are used in the reduction reaction.
[0463] In one embodiment, the reducing agent is sodium triacetoxyborohydride. In another embodiment, 1.0 to 6.0 molar equivalents of sodium triacetoxyborohydride, 2.0 to 5.0 molar equivalents of sodium triacetoxyborohydride, or about 3.0 molar equivalents of sodium triacetoxyborohydride are used in the reduction reaction.
[0464] At the end of the reduction reaction, unreacted aldehyde groups may remain in the conjugate, which can be capped with a suitable capping agent. In one embodiment, the capping agent is sodium borohydride (NaBH4). In one embodiment, capping is achieved by mixing the reduction reaction with 0.5 to 5.0 molar equivalents of NaBH4, for example, about 1.0, 1.5, 2.0, 2.5, or 3.0 molar equivalents of NaBH4.
[0465] After conjugation (reduction and optional end-capping), the glycoconjugate can be purified. The glycoconjugate can be purified by diafiltration and / or ion exchange chromatography and / or size exclusion chromatography. In one embodiment, the glycoconjugate is purified by diafiltration or ion exchange chromatography or size exclusion chromatography.
[0466] In one embodiment, the glycoconjugate is sterile filtered.
[0467] In some embodiments, the serotype 8 glycoconjugates of the invention are conjugated to a carrier protein (e.g., CRM 197 ) and comprises a saccharide having a molecular weight of 10 kDa to 2,000 kDa. In other such embodiments, the saccharide has a molecular weight of 50 kDa to 2,000 kDa. In further such embodiments, the saccharide has a molecular weight of 50 kDa to 1,750 kDa; 50 kDa to 1,500 kDa; 50 kDa to 1,250 kDa; 50 kDa to 1,000 kDa; 50 kDa to 750 kDa; 50 kDa to 500 kDa; 100 kDa to 2,000 kDa; 100 kDa to 1,750 kDa; 100 kDa to 1,500 kDa; 100 kDa to 1,250 kDa a; 100 kDa to 1,000 kDa; 100 kDa to 750 kDa; 100 kDa to 500 kDa; 200 kDa to 2,000 kDa; 200 kDa to 1,750 kDa; 200 kDa to 1,500 kDa; 200 kDa to 1,250 kDa; 200 kDa to 1,000 kDa; 200 kDa to 750 kDa; or 200 kDa to 500 kDa; or 200 kDa to 400 kDa. In one embodiment, the serotype 8 glycoconjugate is prepared using reductive amination.
[0468] In some embodiments, the serotype 8 glycoconjugates of the present invention have a molecular weight of 50 kDa to 20,000 kDa. In other embodiments, the serotype 8 glycoconjugates have a molecular weight of 50 kDa to 15,000 kDa. In other embodiments, the serotype 8 glycoconjugates have a molecular weight of 500 kDa to 10,000 kDa. In other embodiments, the serotype 8 glycoconjugates have a molecular weight of 200 kDa to 10,000 kDa. In other embodiments, the serotype 8 glycoconjugates have a molecular weight of 1,000 kDa to 8,000 kDa or 2,000 kDa to 8,000 kDa.
[0469] In further embodiments, the serotype 8 glycoconjugates of the invention have a molecular weight of: 200 kDa to 20,000 kDa; 200 kDa to 15,000 kDa; 200 kDa to 10,000 kDa; 200 kDa to 7,500 kDa; 200 kDa to 5,000 kDa; 200 kDa to 3,000 kDa; 200 kDa to 1,000 kDa; 500 kDa to 20,000 kDa; 500 kDa to 15,000 kDa; 500 kDa to 12,500 kDa; 500 kDa to 10,000 kDa; 500 kDa to 7,500 kDa; 500 kDa to 6,000 kDa; 500 kDa to 5,000 kDa; 500 kDa to 4,000 kDa; 500 kDa to 3,000 kDa; 500 kDa to 2,000 kDa; 500 kDa to 1,500 kDa; 500 kDa to 1,000 kDa; 750 kDa to 20,000 kDa; 750 kDa to 15,000 kDa; 750 kDa to 12,500 kDa; 750 kDa to 10,000 kDa a; 750kDa to 7,500kDa; 750kDa to 6,000kDa; 750kDa to 5,000kDa; 750kDa to 4,000kDa; 750kDa to 3,000kDa; 750kDa to 2,000kDa; 750kDa to 1,500kDa; 1,000kDa to 15,000kDa; 1,000kDa to 12,500kDa; 1,000kDa to 10,000kDa; 1,000kDa to 7,500kDa; 1,000kDa to 6,000kDa a; 1,000 kDa to 5,000 kDa; 1,000 kDa to 4,000 kDa; 1,000 kDa to 2,500 kDa; 2,000 kDa to 15,000 kDa; 2,000 kDa to 12,500 kDa; 2,000 kDa to 10,000 kDa; 2,000 kDa to 7,500 kDa; 2,000 kDa to 6,000 kDa; 2,000 kDa to 5,000 kDa; 2,000 kDa to 4,000 kDa; or 2,000 kDa to 3,000 kDa.
[0470] In further embodiments, the serotype 8 glycoconjugates of the invention have a molecular weight of 3,000 kDa to 20,000 kDa; 3,000 kDa to 15,000 kDa; 3,000 kDa to 10,000 kDa; 3,000 kDa to 7,500 kDa; 3,000 kDa to 5,000 kDa; 4,000 kDa to 20,000 kDa; 4,000 kDa to 15,000 kDa; 4,000 kDa to 12,500 kDa; 4,000 kDa to 10,000 kDa; 4,000 kDa to 7,500 kDa; 4,000 kDa to 6,000 kDa; or 4,000 kDa to 5,000 kDa. In other embodiments, the serotype 8 glycoconjugates of the present invention have a molecular weight of 5,000 kDa to 20,000 kDa; 5,000 kDa to 15,000 kDa; 5,000 kDa to 10,000 kDa or 5,000 kDa to 7,500 kDa. In other embodiments, the serotype 8 glycoconjugates of the present invention have a molecular weight of 6,000 kDa to 20,000 kDa; 6,000 kDa to 15,000 kDa; 6,000 kDa to 10,000 kDa or 6,000 kDa to 7,500 kDa.
[0471] In other embodiments, the serotype 8 glycoconjugates of the present invention have a molecular weight of 7,000 kDa to 20,000 kDa; 7,000 kDa to 15,000 kDa; 7,000 kDa to 10,000 kDa or 7,000 kDa to 8,000 kDa. In other embodiments, the serotype 8 glycoconjugates of the present invention have a molecular weight of 8,000 kDa to 20,000 kDa; 8,000 kDa to 15,000 kDa; or 8,000 kDa to 10,000 kDa.
[0472] In one embodiment, the serotype 8 glycoconjugate is prepared using reductive amination.
[0473] Another way to characterize the serotype 8 glycoconjugates of the present invention is to use a carrier protein (e.g. CRM 197 ) is conjugated to a sugar, which can be characterized as the extent of the conjugated lysine residues (degree of conjugation).
[0474] Evidence of carrier protein lysine modification (due to covalent bonding to polysaccharides) can be obtained by amino acid analysis using conventional methods known to those skilled in the art. In common embodiments, the carrier protein is covalently conjugated to the active polysaccharide via amide bonds of one or more ε-amino groups of lysine residues on the carrier protein. In some such embodiments, the carrier protein comprises 2 to 20 lysine residues covalently conjugated to the sugar. In other such embodiments, the carrier protein comprises 4 to 16 or 6-14 lysine residues covalently conjugated to the sugar.
[0475] In preferred embodiments, the degree of conjugation of the serotype 8 glycoconjugates of the present invention is 2 to 20, 2 to 15, 2 to 13, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, 3 to 15, 3 to 13, 3 to 10, 3 to 8, 3 to 6, 3 to 5, 3 to 4, 5 to 15, 5 to 10, 8 to 15, 8 to 12, 10 to 15, or 10 to 12. In one embodiment, the degree of conjugation of the serotype 8 glycoconjugates of the present invention is about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, or about 15. In preferred embodiments, the degree of conjugation of the serotype 8 glycoconjugates of the present invention is 4 to 16 or 6 to 14. In some such embodiments, the carrier protein is CRM 197 .
[0476] In a preferred embodiment, the carrier protein comprises a CRM 197 , which contains 39 lysine residues. In some such embodiments, the CRM 197 The CRM may contain 4 to 16 or 6 to 14 of the 39 lysine residues covalently linked to a sugar. Another way to express this parameter is that about 10% to about 41%, or about 15% to about 36% of the CRM 197 Lysine is covalently linked to a sugar. In another such embodiment, the CRM 197 It may contain 2 to 20 of the 39 lysine residues covalently linked to a sugar. Another way to express this parameter is that about 5% to about 50% of the CRM 197 Lysine is covalently linked to the sugar. In some such embodiments, the CRM 197 It may comprise about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 of the 39 lysine residues covalently linked to the sugar.
[0477] The serotype 8 saccharide conjugates of the present invention can also be characterized by the ratio of saccharide to carrier protein (weight / weight). In some embodiments, the ratio of saccharide to carrier protein (w / w) is 0.2 to 4.0 (e.g., about 0.2, about 0.3, about 0.4, about 0.5, about 0.6, about 0.7, about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, about 3.0, about 3.1, about 3.2, about 3.3, about 3.4, about 3.5, about 3.6, about 3.7, about 3.8, about 3.9, or about 4.0). In other embodiments, the ratio of sugar to carrier protein (w / w) is from 0.7 to 2.5. In further embodiments, the ratio of sugar to carrier protein (w / w) is from 0.8 to 1.5 (e.g., about 0.8, about 0.9, about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, or about 1.5). In some such embodiments, the carrier protein is CRM 197 In one embodiment, the serotype 8 glycoconjugate is prepared using reductive amination.
[0478] The serotype 8 glycoconjugates and immunogenic compositions of the present invention may contain free sugars that are not covalently conjugated to a carrier protein but are present in the glycoconjugate composition. Such free sugars may be non-covalently associated with the glycoconjugate (i.e., non-covalently bound to, adsorbed to, or embedded in the glycoconjugate).
[0479] In some embodiments, the serotype 8 glycoconjugates of the present invention comprise less than about 50% free sugars, less than about 45% free sugars, less than about 40% free sugars, less than about 35% free sugars, less than about 30% free sugars, less than about 25% free sugars, less than about 20% free sugars, less than about 15% free sugars, less than about 10% free sugars, or less than about 5% free sugars, relative to the total amount of serotype 8 saccharides. Preferably, the serotype 8 glycoconjugates comprise less than 15% free sugars, more preferably less than 10% free sugars, and even more preferably less than 5% free sugars.
[0480] The serotype 8 glycoconjugates can also be identified by their molecular size distribution (K d) for characterization. Size exclusion chromatography medium (CL-4B) can be used to determine the relative molecular weight size distribution of the conjugate. Size exclusion chromatography (SEC) is used in a gravity feed column to characterize the molecular size distribution of the conjugate. Large molecules are discharged from the pores of the medium eluate much faster than small molecules. A fraction collector is used to collect the column eluate. The fractions are tested colorimetrically by saccharide determination. In order to determine K d The column is calibrated to establish the fraction with complete molecular expulsion (V0), (Kd = 0), and the fraction representing maximum retention (V i ), (K d =1). The fraction that achieves the specified sample attribute (V e ) through the expression K d= (V e -V0) / (V i -V0) and K d Related.
[0481] In a preferred embodiment, at least 40% of the serotype 8 glycoconjugates of the present invention have a K value lower than or equal to 0.3 in a CL-4B column. d In preferred embodiments, at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, or 85% of the serotype 8 glycoconjugates of the invention have a K of less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 60% of the serotype 8 glycoconjugates of the present invention have a K value lower than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, at least 70% of the serotype 8 glycoconjugates of the present invention have a K value lower than or equal to 0.3 in a CL-4B column. d .
[0482] In a preferred embodiment, 40% to 90% of the serotype 8 glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 50% to 90% of the serotype 8 glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d In a preferred embodiment, 65% to 80% of the serotype 8 glycoconjugates have a K value less than or equal to 0.3 in a CL-4B column. d .
[0483] 1.4 Combinations of the Glycoconjugates of the Present Invention
[0484] In one embodiment, the immunogenic composition of the invention comprises any of the glycoconjugates disclosed herein.
[0485] In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate selected from the following group: a saccharide conjugate from Streptococcus pneumoniae serotype 15B (such as the saccharide conjugates of Section 1.3.4 above), a saccharide conjugate from Streptococcus pneumoniae serotype 22F (such as the saccharide conjugates of Section 1.3.2 above), a saccharide conjugate from Streptococcus pneumoniae serotype 33F (such as the saccharide conjugates of Section 1.3.3 above), a saccharide conjugate from Streptococcus pneumoniae serotype 12F (such as the saccharide conjugates of Section 1.3.5 above), a saccharide conjugate from Streptococcus pneumoniae serotype 10A (such as the saccharide conjugates of Section 1.3.6 above), a saccharide conjugate from Streptococcus pneumoniae serotype 11A (such as the saccharide conjugates of Section 1.3.7 above), and a saccharide conjugate from Streptococcus pneumoniae serotype 8 (such as the saccharide conjugates of Section 1.3.8 above).
[0486] In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate from Streptococcus pneumoniae serotype 15B, such as the saccharide conjugates of Section 1.3.4 above. In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate from Streptococcus pneumoniae serotype 22F, such as those disclosed in Section 1.3.2 above. In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate from Streptococcus pneumoniae serotype 33F, such as those disclosed in Section 1.3.3 above. In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate from Streptococcus pneumoniae serotype 12F, such as those disclosed in Section 1.3.5 above. In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate from Streptococcus pneumoniae serotype 10A, such as those disclosed in Section 1.3.6 above. In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate from Streptococcus pneumoniae serotype 11A, such as those disclosed in Section 1.3.7 above. In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate from S. pneumoniae serotype 8, such as those disclosed above in Section 1.3.8.
[0487] In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate of each of two S. pneumoniae serotypes selected from the group consisting of 15B and 22F, 15B and 33F, 15B and 12F, 15B and 10A, 15B and 11A, 15B and 8, 22F and 33F, 22F and 12F, 22F and 10A, 22F and 11A, 22F and 8, 33F and 12F, 33F and 10A, 33F and 11A, 33F and 8, 12F and 10A, 12F and 11A, 12F and 8, 10A and 11A, 10A and 8, and 11A and 8.
[0488] In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate of each of the following three serotypes of S. pneumoniae:
[0489] 15B, 22F, and 33F,
[0490] 15B and 22F and 12F,
[0491] 15B and 22F and 10A,
[0492] 15B and 22F and 11A,
[0493] 15B and 22F and 8,
[0494] 15B and 33F and 12F,
[0495] 15B and 33F and 10A,
[0496] 15B and 33F and 11A,
[0497] 15B and 33F and 8,
[0498] 15B and 12F and 10A,
[0499] 15B and 12F and 11A,
[0500] 15B and 12F and 8,
[0501] 15B and 10A and 11A,
[0502] 15B and 10A and 8,
[0503] 15B and 11A and 8,
[0504] 22F, 33F and 12F,
[0505] 22F and 33F and 10A,
[0506] 22F and 33F and 11A,
[0507] 22F and 33F and 8,
[0508] 22F and 12F and 10A,
[0509] 22F, 12F, and 11A,
[0510] 22F and 12F and 8,
[0511] 22F, 10A, and 11A,
[0512] 22F and 10A and 8,
[0513] 22F and 11A and 8,
[0514] 33F, 12F, and 10A,
[0515] 33F, 12F, and 11A,
[0516] 33F and 12F and 8,
[0517] 33F, 10A, and 11A,
[0518] 33F and 10A and 8,
[0519] 33F and 11A and 8,
[0520] 12F, 10A, and 11A,
[0521] 12F and 10A and 8,
[0522] 12F and 11A and 8 or
[0523] 10A and 11A and 8.
[0524] In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate of each of the following four serotypes of S. pneumoniae:
[0525] 15B and 22F and 33F and 12F,
[0526] 15B and 22F and 33F and 10A,
[0527] 15B and 22F and 33F and 11A,
[0528] 15B and 22F and 33F and 8,
[0529] 15B and 22F and 12F and 10A,
[0530] 15B and 22F and 12F and 11A,
[0531] 15B and 22F and 12F and 8,
[0532] 15B and 22F and 10A and 11A,
[0533] 15B and 22F and 10A and 8,
[0534] 15B and 22F and 11A and 8,
[0535] 15B and 33F and 12F and 10A,
[0536] 15B and 33F and 12F and 11A,
[0537] 15B and 33F and 12F and 8,
[0538] 15B and 33F and 10A and 11A,
[0539] 15B and 33F and 10A and 8,
[0540] 15B and 33F and 11A and 8,
[0541] 15B and 12F and 10A and 11A,
[0542] 15B and 12F and 10A and 8,
[0543] 15B and 12F and 11A and 8,
[0544] 15B and 10A and 11A and 8,
[0545] 22F and 33F and 12F and 10A,
[0546] 22F and 33F and 12F and 11A,
[0547] 22F and 33F and 12F and 8,
[0548] 22F and 33F and 10A and 11A,
[0549] 22F and 33F and 10A and 8,
[0550] 22F and 33F and 11A and 8,
[0551] 22F and 12F and 10A and 11A,
[0552] 22F and 12F and 10A and 8,
[0553] 22F and 12F and 11A and 8,
[0554] 22F and 10A and 11A and 8,
[0555] 33F and 12F and 10A and 11A,
[0556] 33F and 12F and 10A and 8,
[0557] 33F and 12F and 11A and 8,
[0558] 33F and 10A and 11A and 8 or
[0559] 12F and 10A and 11A and 8.
[0560] In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate of each of the following five serotypes of S. pneumoniae:
[0561] 15B and 22F and 33F and 12F and 10A,
[0562] 15B and 22F and 33F and 12F and 11A,
[0563] 15B and 22F and 33F and 12F and 8,
[0564] 15B and 22F and 33F and 10A and 11A,
[0565] 15B and 22F and 33F and 10A and 8,
[0566] 15B and 22F and 33F and 11A and 8,
[0567] 15B and 22F and 12F and 10A and 11A,
[0568] 15B and 22F and 12F and 10A and 8,
[0569] 15B and 22F and 12F and 11A and 8,
[0570] 15B and 22F and 10A and 11A and 8,
[0571] 15B and 33F and 12F and 10A and 11A,
[0572] 15B and 33F and 12F and 10A and 8,
[0573] 15B and 33F and 12F and 11A and 8,
[0574] 15B and 33F and 10A and 11A and 8,
[0575] 15B and 12F and 10A and 11A and 8,
[0576] 22F and 33F and 12F and 10A and 11A,
[0577] 22F and 33F and 12F and 10A and 8,
[0578] 22F and 33F and 12F and 11A and 8,
[0579] 22F and 33F and 10A and 11A and 8,
[0580] 22F and 12F and 10A and 11A and 8 or
[0581] 33F and 12F and 10A and 11A and 8.
[0582] In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate of each of the following six serotypes of S. pneumoniae:
[0583] 15B and 22F and 33F and 12F and 10A and 11A,
[0584] 15B and 22F and 33F and 12F and 10A and 8,
[0585] 15B and 22F and 33F and 12F and 11A and 8,
[0586] 15B and 22F and 33F and 10A and 11A and 8,
[0587] 15B and 22F and 12F and 10A and 11A and 8,
[0588] 15B and 33F and 12F and 10A and 11A and 8 or
[0589] 22F and 33F and 12F and 10A and 11A and 8.
[0590] In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate of each of the following seven S. pneumoniae serotypes: 15B and 22F and 33F and 12F and 10A and 11A and 8.
[0591] In one embodiment, the saccharide conjugates from S. pneumoniae serotypes 15B, 22F, 33F, 12F, 10A, 11A and / or 8 of any immunogenic composition defined in this section are as disclosed above in Sections 1.3.2 to 1.3.8.
[0592] In one embodiment, any of the above immunogenic compositions further comprises a glycoconjugate from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F (such as the glycoconjugates of Section 1.3.1 above).
[0593] In one embodiment, any of the above immunogenic compositions further comprises a glycoconjugate from S. pneumoniae serotypes 1, 5, and 7F (such as the glycoconjugates of Section 1.3.1 above).
[0594] In one embodiment, any of the above immunogenic compositions further comprises a glycoconjugate from S. pneumoniae serotypes 6A and 19A (such as the glycoconjugates of Section 1.3.1 above).
[0595] In one embodiment, any of the above immunogenic compositions further comprises a saccharide conjugate from S. pneumoniae serotype 3 (such as the saccharide conjugates of Section 1.3.1 above).
[0596] Preferably, all glycoconjugates of the above immunogenic composition are independently conjugated to a carrier protein.
[0597] In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 22F is conjugated to a CRM197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 33F is conjugated to a CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 15B is conjugated to a CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 12F is conjugated to a CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 10A is conjugated to a CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 11A is conjugated to a CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 8 is conjugated to a CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F are conjugated to CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugates from S. pneumoniae serotypes 1, 5, and 7F are conjugated to CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugates from S. pneumoniae serotypes 6A and 19A are conjugated to CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 3 is conjugated to a CRM 197 .
[0598] In one embodiment, all glycoconjugates of any of the above immunogenic compositions are independently conjugated to a CRM 197 .
[0599] In one embodiment, the saccharide conjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above immunogenic compositions are independently conjugated to PD.
[0600] In one embodiment, the saccharide conjugate from S. pneumoniae serotype 18C of any of the above immunogenic compositions is conjugated to TT.
[0601] In one embodiment, the saccharide conjugate from S. pneumoniae serotype 19F of any of the above immunogenic compositions is conjugated to DT.
[0602] In one embodiment, the saccharide conjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above immunogenic compositions are independently conjugated to PD, the saccharide conjugate from S. pneumoniae serotype 18C is conjugated to TT, and the saccharide conjugate from S. pneumoniae serotype 19F is conjugated to DT.
[0603] In one embodiment, the immunogenic composition comprises 8 to 20 different serotypes of S. pneumoniae. In one embodiment, the immunogenic composition comprises saccharide conjugates from 12, 13, 14, 15, 16, 17, 18, 19 or 20 different serotypes. In one embodiment, the immunogenic composition comprises saccharide conjugates from 16 or 20 different serotypes.
[0604] In one embodiment, the immunogenic composition is an 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, or 20-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 14-, 15-, 16-, 17-, 18-, or 19-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 16-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 19-valent pneumococcal conjugate composition.
[0605] 1. In one embodiment, the immunogenic composition of the invention comprises at least one saccharide conjugate from Streptococcus pneumoniae serotype 15B, such as disclosed in Section 1.3.4 above.
[0606] 2. In another embodiment, the immunogenic composition of the present invention, in addition to point 1 above, further comprises at least one saccharide conjugate from Streptococcus pneumoniae serotype 22F, such as those disclosed in Section 1.3.2 above.
[0607] 3. In another embodiment, the immunogenic composition of the present invention, in addition to point 1 or 2 above, further comprises at least one saccharide conjugate from Streptococcus pneumoniae serotype 33F, such as those disclosed in Section 1.3.3 above.
[0608] 4. In another embodiment, the immunogenic composition of the present invention, in addition to point 1, 2 or 3 above, further comprises at least one saccharide conjugate from Streptococcus pneumoniae serotype 12F, such as those disclosed in Section 1.3.5 above.
[0609] 5. In another embodiment, the immunogenic composition of the present invention comprises, in addition to point 1, 2, 3 or 4 above, at least one saccharide conjugate from Streptococcus pneumoniae serotype 10A, such as those disclosed in Section 1.3.6 above.
[0610] 6. In another embodiment, the immunogenic composition of the present invention comprises, in addition to point 1, 2, 3, 4 or 5 above, at least one saccharide conjugate from Streptococcus pneumoniae serotype 11A, such as those disclosed in Section 1.3.7 above.
[0611] 7. In another embodiment, the immunogenic composition of the present invention comprises, in addition to point 1, 2, 3, 4, 5 or 6 above, at least one saccharide conjugate from S. pneumoniae serotype 8, such as those disclosed in Section 1.3.8 above.
[0612] 8. In another embodiment, the immunogenic composition of the present invention, in addition to point 1, 2, 3, 4, 5, 6 or 7 above, further comprises a saccharide conjugate from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F, such as the saccharide conjugates of Section 1.3.1 above.
[0613] 9. In another embodiment, the immunogenic composition of the present invention further comprises, in addition to points 1, 2, 3, 4, 5, 6, 7 or 8 above, a saccharide conjugate from S. pneumoniae serotypes 1, 5, and 7F, such as the saccharide conjugates of Section 1.3.1 above.
[0614] 10. In another embodiment, the immunogenic composition of the present invention further comprises, in addition to point 1, 2, 3, 4, 5, 6, 7, 8 or 9 above, saccharide conjugates from S. pneumoniae serotypes 6A and 19A, such as the saccharide conjugates described in Section 1.3.1 above.
[0615] 11. In another embodiment, the immunogenic composition of the present invention further comprises, in addition to points 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 above, a saccharide conjugate from Streptococcus pneumoniae serotype 3, such as the saccharide conjugate of Section 1.3.1 above.
[0616] In one embodiment, the immunogenic composition of the invention comprises saccharide conjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
[0617] In one embodiment, the immunogenic composition of the invention comprises saccharide conjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
[0618] In one embodiment, the immunogenic composition of the invention comprises conjugated S. pneumoniae saccharides from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
[0619] In one embodiment, the immunogenic composition of the invention comprises conjugated S. pneumoniae saccharides from serotypes 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
[0620] In one embodiment, the glycoconjugates of the immunogenic composition of the invention consist of glycoconjugates from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F. In one embodiment, the glycoconjugates of the immunogenic composition of the invention consist of glycoconjugates from serotypes 1, 4, 5, 6A, 6B, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F. In one embodiment, the glycoconjugates of the immunogenic composition of the invention consist of glycoconjugates from serotypes 1, 3, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F. In one embodiment, the glycoconjugates of the immunogenic composition of the invention consist of glycoconjugates from 1, 4, 5, 6A, 6B, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F.
[0621] Preferably, all glycoconjugates of the immunogenic composition of the present invention (eg, any of 1-11 above) are independently conjugated to a carrier protein.
[0622] In one embodiment, the saccharide conjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of points 8-11 above are independently conjugated to PD.
[0623] In one embodiment, the saccharide conjugate from S. pneumoniae serotype 18C of any of points 8-11 above is conjugated to TT.
[0624] In one embodiment, the saccharide conjugate from S. pneumoniae serotype 19F of any of points 8-11 above is conjugated to DT.
[0625] In the embodiments of any of the above points 8-11, saccharide conjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F are independently conjugated to PD, saccharide conjugates from S. pneumoniae serotype 18C are conjugated to TT, and saccharide conjugates from S. pneumoniae serotype 19F are conjugated to DT.
[0626] In the embodiments of any of points 1-11 above, the saccharide conjugate from S. pneumoniae serotype 22F is conjugated to the CRM 197 In the embodiments of any of points 2-11 above, the saccharide conjugate from S. pneumoniae serotype 33F is conjugated to the CRM 197 In the embodiments of any of points 3-11 above, the saccharide conjugate from S. pneumoniae serotype 15B is conjugated to the CRM 197 In the embodiments of any of points 4-11 above, the saccharide conjugate from S. pneumoniae serotype 12F is conjugated to the CRM 197 In the embodiments of any of points 5-11 above, the saccharide conjugate from S. pneumoniae serotype 10A is conjugated to the CRM 197 In the embodiments of any of points 6-11 above, the saccharide conjugate from S. pneumoniae serotype 11A is conjugated to the CRM 197 In the embodiments of any of points 7-11 above, the saccharide conjugate from S. pneumoniae serotype 8 is conjugated to the CRM 197 In the embodiments of any of points 8-11 above, saccharide conjugates from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F, and 23F are conjugated to the CRM 197 In the embodiments of any of points 9-11 above, saccharide conjugates from S. pneumoniae serotypes 1, 5, and 7F are conjugated to the CRM 197 In the embodiments of any of points 10-11 above, saccharide conjugates from S. pneumoniae serotypes 6A and 19A are conjugated to the CRM 197 In the embodiment of point 11 above, the saccharide conjugate from S. pneumoniae serotype 3 is conjugated to the CRM 197 .
[0627] In one embodiment, the glycoconjugates of the immunogenic composition of points 1 to 11 above are independently conjugated to CRM 197 .
[0628] In one embodiment, the immunogenic composition of the invention comprises 12-20 different serotypes of S. pneumoniae. In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from 12, 13, 14, 15, 16, 17, 18, 19, or 20 different serotypes. In one embodiment, the immunogenic composition of the invention comprises glycoconjugates from 16 or 20 different serotypes.
[0629] In one embodiment, the immunogenic composition of points 1 to 11 above is an 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, or 20-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition of points 1 to 11 above is a 15-, 16-, 17-, 18-, or 19-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition of points 1 to 11 above is a 16-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition of points 1 to 11 above is a 19-valent pneumococcal conjugate composition.
[0630] After the capsular polysaccharide is conjugated to the carrier protein, the glycoconjugate is purified (enriched for the amount of polysaccharide-protein conjugate) by various techniques. These techniques include concentration / diafiltration procedures, precipitation / elution, column chromatography, and depth filtration (see, for example, U.S. Patent Application Publication No. 2007 / 0184072 or WO 2008 / 079653). After the individual glycoconjugates are purified, they are mixed to formulate the immunogenic composition of the present invention.
[0631] 1.5 Additional Combinations of the Glycoconjugates of the Invention
[0632] In an embodiment of any of the immunogenic compositions defined in Section 1.4 above, at least one saccharide conjugate from S. pneumoniae serotype 9V is included.
[0633] In an embodiment of any of the immunogenic compositions defined in Section 1.4 above, at least one saccharide conjugate is comprised from two S. pneumoniae serotypes each selected from the group consisting of 9V and 4, 9V and 6B, 9V and 14, 9V and 18C, 9V and 19F, 9V and 23F.
[0634] In an embodiment of any of the immunogenic compositions defined above in Section 1.4, at least one saccharide conjugate of each of the following seven S. pneumoniae serotypes is included: 9V, 4, 6B, 14, 18C, 19F, and 23F.
[0635] In an embodiment of any of the immunogenic compositions defined in Section 1.4 above, comprising at least one saccharide conjugate of each of the following eight serotypes of S. pneumoniae:
[0636] 9V and 1 and 4 and 6B and 14 and 18C and 19F and 23F,
[0637] 9V and 4 and 5 and 6B and 14 and 18C and 19F and 23F, or
[0638] 9V and 4 and 6B and 7F and 14 and 18C and 19F and 23F.
[0639] In an embodiment of any of the immunogenic compositions defined in Section 1.4 above, at least one saccharide conjugate of each of the following ten S. pneumoniae serotypes is included: 9V, 1, 5, 4, 6B, 7F, 14, 18C, 19F, and 23F.
[0640] In an embodiment of any of the immunogenic compositions defined in Section 1.4 above, comprising at least one saccharide conjugate of each of the following eleven S. pneumoniae serotypes:
[0641] 9V and 1 and 4 and 5 and 6A and 6B and 7F and 14 and 18C and 19F and 23F or
[0642] 9V and 1 and 4 and 5 and 6B and 7F and 14 and 18C and 19A and 19F and 23F.
[0643] In an embodiment of any of the immunogenic compositions defined in Section 1.4 above, at least one saccharide conjugate of each of the following twelve S. pneumoniae serotypes is included: 9V, 1, 4, 5, 6A, 6B, 7F, 14, 18C, 19A, 19F, and 23F.
[0644] In an embodiment of any of the immunogenic compositions defined in Section 1.4 above, at least one saccharide conjugate of each of the following thirteen S. pneumoniae serotypes is included: 9V, 1, 3, 4, 5, 6A, 6B, 7F, 14, 18C, 19A, 19F, and 23F.
[0645] In an embodiment of any of the immunogenic compositions defined in Section 1.4 above, further comprising at least one saccharide conjugate from S. pneumoniae serotype 2.
[0646] In an embodiment of any of the immunogenic compositions defined in Section 1.4 above, further comprising at least one saccharide conjugate from Streptococcus pneumoniae serotype 17F.
[0647] In an embodiment of any of the immunogenic compositions defined in Section 1.4 above, further comprising at least one saccharide conjugate from S. pneumoniae serotype 20.
[0648] In an embodiment of any of the immunogenic compositions defined in Section 1.4 above, further comprising at least one saccharide conjugate from Streptococcus pneumoniae serotype 15C.
[0649] In an embodiment of any of the immunogenic compositions defined in Section 1.4 above, further comprising at least one saccharide conjugate from Streptococcus pneumoniae serotype 9N.
[0650] Preferably, all glycoconjugates of the above immunogenic composition are independently conjugated to a carrier protein.
[0651] In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 9V is conjugated to a CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugates from S. pneumoniae serotypes 4, 6B, 14, 18C, 19F, and 23F are conjugated to CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugates from S. pneumoniae serotypes 1, 5, and 7F are conjugated to CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugates from S. pneumoniae serotypes 6A and 19A are conjugated to CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 3 is conjugated to a CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 2 is conjugated to a CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 17F is conjugated to a CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 20 is conjugated to a CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 15C is conjugated to a CRM 197 In any of the above immunogenic composition embodiments, the saccharide conjugate from S. pneumoniae serotype 9N is conjugated to a CRM 197 .
[0652] In one embodiment, the glycoconjugates of the immunogenic composition are all independently conjugated to CRM 197 .
[0653] In another embodiment, the saccharide conjugate from S. pneumoniae serotype 9V of any of the above immunogenic compositions is independently conjugated to PD.
[0654] In one embodiment, the saccharide conjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above immunogenic compositions are independently conjugated to PD.
[0655] In one embodiment, the saccharide conjugate from S. pneumoniae serotype 18C of any of the above immunogenic compositions is conjugated to TT.
[0656] In one embodiment, the saccharide conjugate from S. pneumoniae serotype 19F of any of the above immunogenic compositions is conjugated to DT.
[0657] In one embodiment, the saccharide conjugates from S. pneumoniae serotypes 1, 4, 5, 6B, 7F, 9V, 14 and / or 23F of any of the above immunogenic compositions are independently conjugated to PD, the saccharide conjugate from S. pneumoniae serotype 18C is conjugated to TT and the saccharide conjugate from S. pneumoniae serotype 19F is conjugated to DT.
[0658] In one embodiment, the immunogenic composition comprises 7 to 25 different serotypes of S. pneumoniae. In one embodiment, the immunogenic composition comprises saccharide conjugates from 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 different serotypes. In one embodiment, the immunogenic composition comprises saccharide conjugates from 16 or 20 different serotypes.
[0659] In one embodiment, the immunogenic composition is an 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, or 20-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 14-, 15-, 16-, 17-, 18-, or 19-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 16-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 19-valent pneumococcal conjugate composition. In one embodiment, the immunogenic composition is a 20-valent pneumococcal conjugate composition.
[0660] After the capsular polysaccharide is conjugated to the carrier protein, the glycoconjugate is purified (enriched for the amount of polysaccharide-protein conjugate) by various techniques. These techniques include concentration / diafiltration procedures, precipitation / elution, column chromatography, and depth filtration (see, for example, U.S. Patent Application Publication No. 2007 / 0184072 or WO 2008 / 079653). After the individual glycoconjugates are purified, they are mixed to formulate the immunogenic compositions of the invention.
[0661] 1.6 Specific Combinations of Glycoconjugates of the Invention
[0662] In an embodiment of any of the immunogenic compositions defined in Section 1.4 or 1.5 above, capsular saccharides from S. pneumoniae serotype 9N are not included.
[0663] In an embodiment of any of the immunogenic compositions defined in Section 1.4 or 1.5 above, capsular saccharides from S. pneumoniae serotype 9A are not included.
[0664] In an embodiment of any of the immunogenic compositions defined in Section 1.4 or 1.5 above, capsular saccharides from S. pneumoniae serotype 9L are not included.
[0665] In an embodiment of any of the immunogenic compositions defined in Section 1.4 or 1.5 above, capsular saccharides from S. pneumoniae serotypes 9N and 9A are not included.
[0666] In an embodiment of any of the immunogenic compositions defined in Section 1.4 or 1.5 above, capsular saccharides from S. pneumoniae serotypes 9N and 9L are not included.
[0667] In an embodiment of any of the immunogenic compositions defined in Section 1.4 or 1.5 above, capsular saccharides from S. pneumoniae serotypes 9A and 9L are not included.
[0668] In an embodiment of any of the immunogenic compositions defined in Section 1.4 or 1.5 above, capsular saccharides from S. pneumoniae serotypes 9N, 9A and 9L are not included.
[0669] 2. Dosage of the Immunogenic Composition
[0670] The amount of glycoconjugate in each dose is selected to be an amount that induces an immunoprotective response in a typical vaccine recipient without significant adverse side effects. This amount will vary depending on which specific immunogen is used and how it is presented.
[0671] 2.1 Amount of glycoconjugate
[0672] The amount of a particular saccharide conjugate in an immunogenic composition can be calculated based on the total polysaccharide in the conjugate (conjugated and unconjugated). For example, a saccharide conjugate with 20% free polysaccharide would have approximately 80 μg of conjugated polysaccharide and approximately 20 μg of unconjugated polysaccharide in a 100 μg dose of polysaccharide. The amount of saccharide conjugate may vary depending on the pneumococcal serotype. The concentration of sugars can be determined by uronic acid assay.
[0673] The "immunogenic amount" of the different polysaccharide components in the immunogenic composition can vary and each can contain about 1 μg, about 2 μg, about 3 μg, about 4 μg, about 5 μg, about 6 μg, about 7 μg, about 8 μg, about 9 μg, about 10 μg, about 15 μg, about 20 μg, about 30 μg, about 40 μg, about 50 μg, about 60 μg, about 70 μg, about 80 μg, about 90 μg, or about 100 μg of any particular polysaccharide antigen.
[0674] Generally, each dose will contain 0.1 μg to 100 μg of polysaccharide for a given serotype, particularly 0.5 μg to 20 μg, more particularly 1.0 μg to 10 μg, and more particularly 2.0 μg to 5.0 μg.Any integer within any of the above ranges is considered an embodiment of the present disclosure.
[0675] In one embodiment, each dose comprises about 1.0 μg, about 1.2 μg, about 1.4 μg, about 1.6 μg, about 1.8 μg, about 2.0 μg, about 2.2 μg, about 2.4 μg, about 2.6 μg, about 2.8 μg, about 3.0 μg, about 3.2 μg, about 3.4 μg, about 3.6 μg, about 3.8 μg, about 4.0 μg, about 4.2 μg, about 4.4 μg, about 4.6 μg, about 4.8 μg, about 5.0 μg, about 5.2 μg, about 5.4 μg, about 5.6 μg, about 5.8 μg, or about 6.0 μg of polysaccharide for each specific glycoconjugate.
[0676] In one embodiment, for a saccharide conjugate from S. pneumoniae serotype 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and / or 33F, each dose comprises about 1.1 μg, about 1.2 μg, about 1.3 μg, about 1.4 μg, about 1.5 μg, about 1.6 μg, about 1.7 μg, about 1.8 μg, about 1.9 μg, about 2.0 μg, about 2.1 μg, about 2.2 μg, about 2.3 μg, about 2.4 μg, about 2.5 μg, about 2.6 μg, about 2.7 μg, about 2.8 μg, about 2.9 μg, or about 3.0 μg of polysaccharide.
[0677] In one embodiment, for a saccharide conjugate from S. pneumoniae serotype 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and / or 33F, each dose comprises about 1.1 μg, about 1.2 μg, about 1.3 μg, about 1.4 μg, about 1.5 μg, about 1.6 μg, about 1.7 μg, about 1.8 μg, about 1.9 μg, about 2.0 μg, about 2.1 μg, about 2.2 μg, about 2.3 μg, about 2.4 μg, about 2.5 μg, about 2.6 μg, about 2.7 μg, about 2.8 μg, about 2.9 μg, or about 3.0 μg of polysaccharide.
[0678] In one embodiment, for a saccharide conjugate from S. pneumoniae serotype 6B, each dose comprises about 2.0 μg, about 2.2 μg, about 2.4 μg, about 2.6 μg, about 2.8 μg, about 3.0 μg, about 3.2 μg, about 3.4 μg, about 3.6 μg, about 3.8 μg, about 4.0 μg, about 4.2 μg, about 4.4 μg, about 4.6 μg, about 4.8 μg, about 5.0, about 5.2 μg, about 5.4 μg, about 5.6 μg, about 5.8 μg, or about 6.0 μg of polysaccharide.
[0679] In one embodiment, each dose comprises from about 1.5 μg to about 3.0 μg of polysaccharide for each saccharide conjugate from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and from about 3.0 μg to about 6.0 μg of polysaccharide for the saccharide conjugate from S. pneumoniae serotype 6B.
[0680] In one embodiment, each dose comprises from about 2.0 μg to about 2.5 μg of polysaccharide for each saccharide conjugate from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and from about 4.0 μg to about 4.8 μg of polysaccharide for the saccharide conjugate from S. pneumoniae serotype 6B.
[0681] In one embodiment, each dose comprises about 2.2 μg of polysaccharide for each saccharide conjugate from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and about 4.4 μg of polysaccharide for the saccharide conjugate from S. pneumoniae serotype 6B.
[0682] In one embodiment, each dose comprises from about 1.5 μg to about 3.0 μg of polysaccharide for each saccharide conjugate from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and from about 3 μg to about 6 μg of polysaccharide for the saccharide conjugate from S. pneumoniae serotype 6B.
[0683] In one embodiment, each dose comprises from about 2.0 μg to about 2.5 μg of polysaccharide for each saccharide conjugate from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and from about 4.0 μg to about 4.8 μg of polysaccharide for the saccharide conjugate from S. pneumoniae serotype 6B.
[0684] In one embodiment, each dose comprises about 2.2 μg of polysaccharide for each saccharide conjugate from S. pneumoniae serotypes 1, 3, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and about 4.4 μg of polysaccharide for the saccharide conjugate from S. pneumoniae serotype 6B.
[0685] In one embodiment, each dose comprises from about 1.5 μg to about 3.0 μg of polysaccharide for each saccharide conjugate from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and from about 3.0 μg to about 6.0 μg of polysaccharide for the saccharide conjugate from S. pneumoniae serotype 6B.
[0686] In one embodiment, each dose comprises from about 2.0 μg to about 2.5 μg of polysaccharide for each saccharide conjugate from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and from about 4.0 μg to about 4.8 μg of polysaccharide for the saccharide conjugate from S. pneumoniae serotype 6B.
[0687] In one embodiment, each dose comprises about 2.2 μg of polysaccharide for each saccharide conjugate from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 8, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and about 4.4 μg of polysaccharide for the saccharide conjugate from S. pneumoniae serotype 6B.
[0688] In one embodiment, each dose comprises from about 1.5 μg to about 3.0 μg of polysaccharide for each saccharide conjugate from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and from about 3.0 μg to about 6.0 μg of polysaccharide for the saccharide conjugate from S. pneumoniae serotype 6B.
[0689] In one embodiment, each dose comprises from about 2.0 μg to about 2.5 μg of polysaccharide for each saccharide conjugate from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and from about 4.0 μg to about 4.8 μg of polysaccharide for the saccharide conjugate from S. pneumoniae serotype 6B.
[0690] In one embodiment, each dose comprises about 2.2 μg of polysaccharide for saccharide conjugates from S. pneumoniae serotypes 1, 4, 5, 6A, 7F, 9V, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F, and about 4.4 μg of polysaccharide for saccharide conjugates from S. pneumoniae serotype 6B.
[0691] 2.2 Amount of carrier
[0692] Generally, each dose will contain 10 μg to 150 μg of carrier protein, particularly 15 μg to 100 μg of carrier protein, more particularly 25 μg to 75 μg of carrier protein, and more particularly 40 μg to 60 μg of carrier protein. In one embodiment, the carrier protein is CRM 197 .
[0693] In one embodiment, each dose comprises about 25 μg, about 26 μg, about 27 μg, about 28 μg, about 29 μg, about 30 μg, about 31 μg, about 32 μg, about 33 μg, about 34 μg, about 35 μg, about 36 μg, about 37 μg, about 38 μg, about 39 μg, about 40 μg, about 41 μg, about 42 μg, about 43 μg, about 44 μg, about 45 μg, about 46 μg, about 47 μg, about 48 μg, about 49 μg, about 50 μg, about 51 μg, about 52 μg, about 53 μg, about 54 μg, about 55 μg, about 56 μg, about 57 μg, about 58 μg, about 59 μg, about 60 μg, about 61 μg, about 62 μg, about 63 μg, about 64 μg, about 65 μg, about 66 μg, about 67 μg, about 68 μg, about 69 μg, about 70 μg, about 71 μg, about 72 μg, about 73 μg, about 74 μg In one embodiment, the carrier protein is about 50 μg, about 51 μg, about 52 μg, about 53 μg, about 54 μg, about 55 μg, about 56 μg, about 57 μg, about 58 μg, about 59 μg, about 60 μg, about 61 μg, about 62 μg, about 63 μg, about 64 μg, about 65 μg, about 66 μg, about 67 μg, about 68 μg, about 69 μg, about 70 μg, about 71 μg, about 72 μg, about 73 μg, about 74 μg, or about 75 μg of a carrier protein. 197 .
[0694] 3. Additional antigens
[0695] The immunogenic compositions of the present invention comprise conjugated pneumococcal saccharide antigens (glycoconjugates). They may also include antigens from other pathogens, in particular from bacteria and / or viruses. Preferred additional antigens are selected from the group consisting of: diphtheria toxoid (D), tetanus toxoid (T), pertussis antigen (P), which is usually acellular (Pa), hepatitis B virus (HBV) surface antigen (HBsAg), hepatitis A virus (HAV) antigen, conjugated Haemophilus influenzae type b capsular saccharide (Hib), and inactivated poliovirus vaccine (IPV).
[0696] In one embodiment, the immunogenic composition of the invention comprises DT-Pa. In one embodiment, the immunogenic composition of the invention comprises DT-Pa-Hib, DT-Pa-IPV, or DT-Pa-HBsAg. In one embodiment, the immunogenic composition of the invention comprises DT-Pa-HBsAg-IPV or DT-Pa-HBsAg-Hib. In one embodiment, the immunogenic composition of the invention comprises DT-Pa-HBsAg-IPV-Hib.
[0697] Pertussis antigens: Bordetella pertussis causes pertussis. The pertussis antigens in the vaccine are either cellular (whole cells, in the form of inactivated B. pertussis cells) or acellular. The preparation of cellular pertussis antigens is well documented (for example, they can be obtained by heat inactivation of a Phase I culture of B. pertussis). However, the present invention preferably uses acellular antigens. When acellular antigens are used, one, two, or (preferably) three of the following antigens are preferably used: (1) detoxified pertussis toxin (pertussis toxoid, or PT); (2) filamentous hemagglutinin (FHA); (3) pertactin (also known as the 69 kilodalton outer membrane protein). FHA and pertactin may be treated with formaldehyde prior to use in accordance with the present invention. PT is preferably detoxified by treatment with formaldehyde and / or glutaraldehyde. The acellular pertussis antigens are preferably adsorbed onto one or more aluminum salt adjuvants. Alternatively, they may be added in an unadsorbed state. When pertactin is added, it is preferably already adsorbed onto an aluminium hydroxide adjuvant. PT and FHA may be adsorbed onto either aluminium hydroxide or aluminium phosphate adjuvants. Most preferably, PT, FHA and pertactin are all adsorbed onto aluminium hydroxide.
[0698] Inactivated poliovirus vaccines: Poliovirus causes polio. Preferred embodiments of the present invention use IPV rather than oral poliovirus vaccines. Prior to administration to a patient, the poliovirus must be inactivated, which can be achieved by treatment with formaldehyde. Polio can be caused by one of three types of poliovirus. The three types are similar and cause the same symptoms, but they are antigenically different and infection with one type does not protect against infection with the other types. Therefore, three poliovirus antigens are preferably used in the present invention: poliovirus type 1 (e.g., Mahoney strain), poliovirus type 2 (e.g., MEF-1 strain), and poliovirus type 3 (e.g., Saukett strain). The viruses are preferably cultured, purified, and inactivated individually, and then recombined to provide a large trivalent mixture for use in the present invention.
[0699] Diphtheria toxoid: Corynebacterium diphtheriae causes diphtheria. The diphtheria toxin can be treated (e.g., with formalin or formaldehyde) to remove toxicity while retaining the ability to induce specific anti-toxin antibodies after injection. These diphtheria toxoids are used in diphtheria vaccines. Preferred diphtheria toxoids are those prepared by formaldehyde treatment. Diphtheria toxoid can be obtained by growing Corynebacterium diphtheriae in a growth medium followed by formaldehyde treatment, ultrafiltration, and precipitation. The toxoided material can then be processed by methods including sterile filtration and / or dialysis. Preferably, the diphtheria toxoid is adsorbed onto an aluminum hydroxide adjuvant.
[0700] Tetanus Toxoid: Clostridium tetani causes tetanus. Tetanus toxin can be processed to provide a protective toxoid. This toxoid is used in tetanus vaccines. Preferred tetanus toxoids are those prepared by treatment with formaldehyde. Tetanus toxoid can be obtained by growing Clostridium tetani in a growth medium, followed by formaldehyde treatment, ultrafiltration, and precipitation. The material can then be processed by methods including sterile filtration and / or dialysis.
[0701] Hepatitis A virus antigen: Hepatitis A virus (HAV) is a known agent that causes viral hepatitis. Preferred HAV components are based on inactivated virus, and inactivation can be achieved by formalin treatment.
[0702] Hepatitis B virus (HBV) is a known agent that causes viral hepatitis. The main component of the capsid is a protein known as the HBV surface antigen (or more commonly, HBsAg), which is typically a 226-amino acid polypeptide with a molecular weight of ~24 kDa. All existing hepatitis B vaccines contain HBsAg, and when this antigen is administered to normal vaccine recipients, it stimulates the production of anti-HBsAg antibodies that protect against HBV infection.
[0703] For vaccine preparation, HBsAg has been prepared in two ways: by purifying a specific form of the antigen from the plasma of chronic hepatitis B carriers or by expressing the protein via recombinant DNA methods (e.g., recombinant expression in yeast cells). Unlike native HBsAg (i.e., the plasma-purified product), yeast-expressed HBsAg is generally non-glycosylated and is the most preferred form of HBsAg for use in the present invention.
[0704] Conjugated Haemophilus influenzae type b antigens: Haemophilus influenzae type b (Hib) causes bacterial meningitis. Hib vaccines are usually based on capsular saccharide antigens, the preparation of which is well documented. Hib saccharides can be conjugated to carrier proteins to enhance their immunogenicity, especially in children. Typical carrier proteins are tetanus toxoid, diphtheria toxoid, CRM 197 , Haemophilus influenzae protein D, and the outer membrane protein complex from serogroup B meningococci. The sugar portion of the conjugate may comprise full-length polyribosylribitol phosphate (PRP, such as prepared from Hib bacteria), and / or fragments of full-length PRP. The Hib conjugate may or may not be adsorbed to an aluminum salt adjuvant.
[0705] In one embodiment, the immunogenic composition of the invention further comprises conjugated meningococcal serogroup Y capsular saccharide (MenY), and / or conjugated meningococcal serogroup C capsular saccharide (MenC).
[0706] In one embodiment, the immunogenic composition of the invention further comprises conjugated meningococcal serogroup A capsular saccharide (MenA), conjugated meningococcal serogroup W135 capsular saccharide (MenW135), conjugated meningococcal serogroup Y capsular saccharide (MenY), and / or conjugated meningococcal serogroup C capsular saccharide (MenC).
[0707] In one embodiment the immunogenic composition of the invention further comprises conjugated meningococcal serogroup W135 capsular saccharide (MenW135), conjugated meningococcal serogroup Y capsular saccharide (MenY), and / or conjugated meningococcal serogroup C capsular saccharide (MenC).
[0708] 4. Adjuvant
[0709] In some embodiments, the immunogenic compositions disclosed herein may further comprise at least one, two, or three adjuvants. The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. An antigen may serve primarily as a delivery system, primarily as an immunomodulator, or possess both of these strong characteristics. Suitable adjuvants include those suitable for use in mammals, including humans.
[0710] Known examples of suitable delivery system types of adjuvants that can be used in humans include, but are not limited to: aluminum (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide), calcium phosphate, liposomes, oil-in-water emulsions such as MF59 (4.3% w / v squalene, 0.5% w / v polysorbate 80 (Tween 80), 0.5% w / v sorbitan trioleate (Span 85)), water-in-oil emulsions such as Montanide, and poly (D, L-lactide-co-glycolide) (PLG) microparticles or nanoparticles.
[0711] In one embodiment, the immunogenic compositions disclosed herein comprise an aluminum salt (aluminum) as an adjuvant (e.g., aluminum phosphate, aluminum sulfate, or aluminum hydroxide). In a preferred embodiment, the immunogenic compositions disclosed herein comprise aluminum phosphate or aluminum hydroxide as an adjuvant. In one embodiment, the immunogenic compositions disclosed herein comprise 0.1 mg / mL to 1 mg / mL or 0.2 mg / mL to 0.3 mg / mL of elemental aluminum in the form of aluminum phosphate. In one embodiment, the immunogenic compositions disclosed herein comprise approximately 0.25 mg / mL of elemental aluminum in the form of aluminum phosphate.
[0712] Known examples of suitable immunomodulatory adjuvants that can be used in humans include, but are not limited to, saponin extracts from the bark of the Aquilla tree (QS21, Quil A), TLR4 agonists such as MPL (monophosphoryl lipid A), 3DMPL (3-O-deacetyl MPL) or GLA-AQ, LT / CT mutants, cytokines such as various interleukins (e.g., IL-2, IL-12) or GM-CS, and the like.
[0713] Known examples of suitable immunomodulatory-type adjuvants (having both delivery and immunomodulatory characteristics) for use in humans include, but are not limited to, ISCOMS (see, e.g., et al. (1998) J. Leukocyte Biol. 64:713; WO 90 / 03184, WO 96 / 11711, WO 00 / 48630, WO 98 / 36772, WO 00 / 41720, WO 2006 / 134423 and WO 2007 / 026190) or GLA-EM, which is a combination of a TLR4 agonist and an oil-in-water emulsion.
[0714] For veterinary applications (including but not limited to animal experiments), Freund's complete adjuvant (CFA), Freund's incomplete adjuvant (IFA), Emulsigen, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoyloxy)-ethylamine (CGP 19835A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria: monophosphoryl lipid A, trehalose dimycolate, and the cell wall skeleton (MPL+TDM+CWS, in a 2% squalene / Tween 80 emulsion), can be used.
[0715] Additional exemplary adjuvants for enhancing the effectiveness of the pneumococcal vaccines disclosed herein include, but are not limited to: (1) oil-in-water emulsion formulations (with or without other specific immunostimulants such as muramyl peptides (see below) or bacterial cell wall components), such as, for example, (a) SAF containing 10% squalane, 0.4% Tween 80, 5% pluronic-blocked polymer L121, and thr-MDP (microfluidized to form a submicron emulsion or vortexed to produce an emulsion with larger particle size), and (b) RIBI TMAdjuvant system (RAS), (Ribi Immunochem, Hamilton, MT) contains 2% squalene, 0.2% Tween 80, and one or more bacterial cell wall components such as monophosphoryl lipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL + CWS (DETOX TM ); (2) saponin adjuvants, such as QS21, STIMULON TM (Cambridge Bioscience, Worcester, MA), (Isconova, Sweden), or (Commonwealth Serum Laboratories, Australia), or particles produced therefrom such as ISCOMs (immunostimulating complexes), which may lack additional detergents (e.g. WO 00 / 07621); (3) complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA); (4) cytokines, such as interleukins (e.g. IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12 (e.g. WO 99 / 44636)), interferons (e.g. gamma interferon), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), etc.; (5) monophosphoryl lipid A (MPL) or 3-O-deacetyl MPL (3dMPL) (see, e.g. GB-2220221, EP0689454), optionally substantially lacking aluminum when used with pneumococcal saccharides (see, e.g. WO 00 / 56358); (6) combinations of 3dMPL with, for example, QS21 and / or oil-in-water emulsions (see, for example, EP0835318, EP0735898, EP0761231); (7) polyoxyethylene ethers or polyoxyethylene esters (see, for example, WO 99 / 52549); (8) polyoxyethylene sorbitan ester surfactants in combination with octoxynol (e.g., WO 01 / 21207) or polyoxyethylene alkyl ether or ester surfactants in combination with at least one additional nonionic surfactant such as octoxynol (e.g., WO 01 / 21152); (9) saponins and immunostimulatory oligonucleotides (e.g., CpG oligonucleotides) (e.g., WO 00 / 62800); (10) immunostimulatory agents and metal salt particles (see, for example, WO 00 / 23105); (11) saponins and oil-in-water emulsions (e.g., WO 99 / 11241); (12) saponin (e.g., QS21) + 3dMPL + IM2 (optionally + sterol) (e.g., WO 98 / 57659); (13) other substances that act as immunostimulants to enhance the efficacy of the composition. Muramyl peptides include N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-25 acetyl-normuramyl-L-alanyl-D-isoglutamine (nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoyloxy)-ethylamine MTP-PE), and the like.
[0716] In an embodiment of the present invention, the immunogenic compositions disclosed herein comprise CpG oligonucleotides as adjuvants. As used herein, CpG oligonucleotides refer to immunostimulatory CpG oligodeoxynucleotides (CpG ODNs), and thus these terms are used interchangeably unless otherwise indicated. Immunostimulatory CpG oligodeoxynucleotides contain one or more immunostimulatory CpG motifs, which are unmethylated cytosine-guanine dinucleotides, optionally in certain preferred base environments. The methylation state of a CpG immunostimulatory motif generally refers to the cytosine residue in the dinucleotide. An immunostimulatory oligonucleotide containing at least one unmethylated CpG dinucleotide is an oligonucleotide that contains a 5' unmethylated cytosine linked to a 3' guanine via a phosphate bond, and that activates the immune system by binding to Toll-like receptor 9 (TLR-9). In another embodiment, the immunostimulatory oligonucleotide may contain one or more methylated CpG dinucleotides, which will activate the immune system through TLR9 but not as strongly as unmethylated CpG motifs. CpG immunostimulatory oligonucleotides may comprise one or more palindromes (which in turn may comprise CpG dinucleotides). CpG oligonucleotides have been described in numerous issued patents, published patent applications, and other publications, including U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068.
[0717] In an embodiment of the invention, the immunogenic composition disclosed herein comprises any of the CpG oligonucleotides described on page 3, line 22 to page 12, line 36 of WO 2010 / 125480.
[0718] Different classes of CpG immunostimulatory oligonucleotides have been identified. These are referred to as classes A, B, C and P, and are described in more detail in WO 2010 / 125480, page 3, line 22, to page 12, line 36. The methods of the present invention relate to the use of these different classes of CpG immunostimulatory oligonucleotides.
[0719] In embodiments of the present invention, the immunogenic compositions disclosed herein comprise class A CpG oligonucleotides. Preferably, the "class A" CpG oligonucleotides of the present invention have the following nucleic acid sequence: 5'GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO: 1). Some non-limiting examples of class A oligonucleotides include: 5'G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G*G*G*G 3' (SEQ ID NO: 2); wherein "*" indicates a phosphorothioate bond and "_" indicates a phosphodiester bond.
[0720] In embodiments of the present invention, the immunogenic compositions disclosed herein comprise a Class B CpG oligonucleotide. In one embodiment, the CpG oligonucleotide used in the present invention is a Class B CpG oligonucleotide represented by at least the following formula: 5' XXCGX3X4 3', wherein X1, X2, X3, and X4 are nucleotides. In one embodiment, X2 is adenine, guanine, or thymine. In another embodiment, X3 is cytosine, adenine, or thymine.
[0721] The class B CpG oligonucleotide sequences of the present invention are those broadly described above and disclosed in WO 96 / 02555, WO 98 / 18810, and U.S. Patent Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116, and 6,339,068. Exemplary sequences include, but are not limited to, those disclosed in these applications and patents.
[0722] In one embodiment, a "class B" CpG oligonucleotide of the invention has the following nucleic acid sequence:
[0723] 5'TCGTCGTTTTTCGGTGCTTT 3' (SEQ ID NO:3), or
[0724] 5'TCGTCGTTTTTCGGTCGTTTT 3' (SEQ ID NO:4), or
[0725] 5'TCGTCGTTTTGTCGTTTTGTCGTT 3'(SEQ ID NO:5), or
[0726] 5'TCGTCGTTTCGTCGTTTTGTCGTT 3'(SEQ ID NO:6), or
[0727] 5'TCGTCGTTTTGTCGTTTTTTTCGA 3' (SEQ ID NO:7).
[0728] In any of these sequences, all bonds may be phosphorothioate bonds. In another embodiment, in any of these sequences, one or more bonds may be phosphodiester, preferably between the "C" and "G" of the CpG motif to produce a semi-soft CpG oligonucleotide. In any of these sequences, ethyl-uridine or a halogen may replace the 5'T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.
[0729] Some non-limiting examples of Class B oligonucleotides include:
[0730] 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*G*C*T*T*T*T 3'(SEQ ID NO:8), or
[0731] 5'T*C*G*T*C*G*T*T*T*T*T*C*G*G*T*C*G*T*T*T*T 3'(SEQ ID NO:9), or
[0732] 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'(SEQ ID NO:10), or
[0733] 5'T*C*G*T*C*G*T*T*T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'(SEQ ID NO:11), or
[0734] 5'T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*T*T*T*C*G*A 3' (SEQ ID NO: 12).
[0735] Wherein “*” represents a phosphorothioate bond.
[0736] In an embodiment of the invention, the immunogenic composition disclosed herein comprises a C-class CpG oligonucleotide.
[0737] In one embodiment, the "C-class" CpG oligonucleotide of the present invention has the following nucleic acid sequence:
[0738] 5'TCGCGTCGTTCGGCGCGCGCCG 3' (SEQ ID NO:13), or
[0739] 5'TCGTCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:14), or
[0740] 5'TCGGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:15), or
[0741] 5'TCGGACGTTCGGCGCGCCG 3' (SEQ ID NO:16), or
[0742] 5'TCGCGTCGTTCGGCGCGCCG 3' (SEQ ID NO:17), or
[0743] 5'TCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:18), or
[0744] 5'TCGACGTTCGGCGCGCCG 3' (SEQ ID NO:19), or
[0745] 5'TCGCGTCGTTCGGCGCCG 3' (SEQ ID NO:20), or
[0746] 5'TCGCGACGTTCGGCGCGCGCCG 3' (SEQ ID NO:21), or
[0747] 5'TCGTCGTTTTCGGCGCGCGCCG 3' (SEQ ID NO:22), or
[0748] 5'TCGTCGTTTTCGGCGGCCGCCG 3' (SEQ ID NO:23), or
[0749] 5'TCGTCGTTTTACGGCGCCGTGCCG 3' (SEQ ID NO:24), or
[0750] 5'TCGTCGTTTCGGCGCGCGCCGT 3' (SEQ ID NO: 25).
[0751] In any of these sequences, all bonds may be phosphorothioate bonds. In another embodiment, in any of these sequences, one or more bonds may be phosphodiester, preferably between the "C" and "G" of the CpG motif to produce a semi-soft CpG oligonucleotide.
[0752] Some non-limiting examples of Class C oligonucleotides include:
[0753] 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:26), or
[0754] 5'T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:27), or
[0755] 5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:28), or
[0756] 5'T*C_G*G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3'(SEQ ID NO:29), or
[0757] 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3'(SEQ ID NO:30), or
[0758] 5'T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:31), or
[0759] 5'T*C_G*A*C_G*T*T*C_G*G*C*G*C*G*C*C*G 3'(SEQ ID NO:32), or
[0760] 5'T*C_G*C_G*T*C_G*T*T*C_G*G*C*G*C*C*G 3'(SEQ ID NO:33), or
[0761] 5'T*C_G*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G 3'(SEQ ID NO:34), or
[0762] 5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G 3'(SEQ ID NO:35), or
[0763] 5'T*C*G*T*C*G*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G 3'(SEQ ID NO:36), or
[0764] 5'T*C*G*T*C_G*T*T*T*T*A*C_G*G*C*G*C*C_G*T*G*C*C*G 3'(SEQ ID NO:37),
[0765] or
[0766] 5'T*C_G*T*C*G*T*T*T*T*C*G*G*C*G*C*G*C*G*C*C*G*T 3' (SEQ ID NO: 38).
[0767] Wherein "*" refers to a phosphorothioate bond and "_" refers to a phosphodiester bond.
[0768] In any of these sequences, ethyl-uridine or a halogen may be substituted for the 5'T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.
[0769] In an embodiment of the present invention, the immunogenic composition disclosed herein comprises a P-class CpG oligonucleotide. In one embodiment, the CpG oligonucleotide used in the present invention is a P-class CpG oligonucleotide containing a 5'TLR activation domain and at least two palindromic regions, one palindromic region being a 5' palindromic region of at least 6 nucleotides in length and connected to a 3' palindromic region of at least 8 nucleotides in length (directly connected or connected through a spacer), wherein the oligonucleotide includes at least one YpR dinucleotide. In one embodiment, the oligonucleotide is not T*C_G*T*C_G*A*C_G*T*T*C_G*G*C*G*C_G*C*G*C*C*G (SEQ ID NO: 27). In one embodiment, the P-class CpG oligonucleotide includes at least one unmethylated CpG dinucleotide. In another embodiment, the TLR activation domain is TCG, TTCG, TTTCG, TYpR, TTYpR, TTTYpR, UCG, UUCG, UUUCG, TTT, or TTTT. In another embodiment, the TLR activation domain is within the 5' palindrome region. In another embodiment, the TLR activation domain is immediately adjacent to the 5' palindrome region at the 5' end.
[0770] In one embodiment, the "P-class" CpG oligonucleotide of the present invention has the following nucleic acid sequence: 5'TCGTCGACGATCGGCGCGCGCCG 3' (SEQ ID NO: 39).
[0771] In the described sequences, all bonds may be phosphorothioate bonds. In another embodiment, one or more bonds may be phosphodiester, preferably between the "C" and "G" of the CpG motif to produce a semi-soft CpG oligonucleotide. In any of these sequences, ethyl-uridine or a halogen may be substituted for the 5'T; examples of halogen substitutions include, but are not limited to, bromo-uridine or iodo-uridine substitutions.
[0772] Non-limiting examples of P-class oligonucleotides include:
[0773] 5'T*C_G*T*C_G*A*C_G*A*T*C_G*G*C*G*C_G*C*G*C*C*G 3' (SEQ ID NO: 40).
[0774] Wherein "*" refers to a phosphorothioate bond and "_" refers to a phosphodiester bond.
[0775] In one embodiment, the oligonucleotide comprises at least one phosphorothioate bond. In another embodiment, the bonds between all nucleotides of the oligonucleotide are phosphorothioate bonds. In another embodiment, the oligonucleotide comprises at least one phosphodiester-like bond. In another embodiment, the phosphodiester-like bond is a phosphodiester bond. In another embodiment, the lipophilic group is conjugated to the oligonucleotide. In one embodiment, the lipophilic group is cholesterol.
[0776] In one embodiment, the bonds between all nucleotides of the CpG oligonucleotides disclosed herein are phosphodiester bonds ("soft" oligonucleotides, as disclosed in WO 2007 / 026190). In another embodiment, the CpG oligonucleotides of the present invention impart resistance to degradation (e.g., stabilized). "Stabilized oligonucleotides" refer to oligonucleotides that are relatively resistant to degradation in vivo (e.g., degradation by exonucleases or endonucleases). Stabilization of nucleic acids can be achieved by backbone modification. Oligonucleotides with phosphorothioate bonds provide maximum activity and prevent oligonucleotides from being degraded by intracellular exonucleases or endonucleases.
[0777] The immunostimulatory oligonucleotide can have a chimeric backbone having a combination of a phosphodiester and a thiophosphate bond. For purposes of the present invention, a chimeric backbone refers to a partially stabilized backbone wherein the bond between at least one nucleotide is a phosphodiester or phosphodiester-like bond, and wherein the bond between at least another nucleotide is a bond between stabilized nucleotides, wherein the at least one phosphodiester or phosphodiester-like bond and the at least one stabilized bond are different. When the phosphodiester bond is preferably located within a CpG motif, such molecules are referred to as "semi-soft," as described in WO 2007 / 026190.
[0778] Other modified oligonucleotides include combinations of phosphodiester, phosphorothioate, methylphosphonate, methylphosphorothioate, phosphorodithioate, and / or p-ethoxy linkages.
[0779] Mixed backbone-modified ODNs can be synthesized as described in WO 2007 / 026190.
[0780] In some embodiments, the CpG oligonucleotides of the present invention are oligonucleotides having a length of 6 to 100 nucleotides, preferably 8 to 30 nucleotides. ...
[0781] In one embodiment, the CpG oligonucleotides disclosed herein comprise substitutions or modifications in the base and / or sugar as described in paragraphs 134 to 147 of WO 2007 / 026190.
[0782] In one embodiment, the CpG oligonucleotides of the present invention are chemically modified. Examples of chemical modifications are known to those skilled in the art and are described, for example, in Uhlmann et al. (1990) Chem. Rev. 90: 543; S. Agrawal, Ed., Humana Press, Totowa, USA 1993; Crooke et al. (1996) Annu. Rev. Pharmacol. Toxicol. 36: 107-129; and Hunziker et al. (1995) Mod. Synth. Methods 7: 331-417. The oligonucleotides of the present invention may have one or more modifications, each of which is located at a specific phosphodiester internucleotide bridge and / or at a specific β-D-ribose unit and / or at a specific natural nucleotide base position (compared to an oligonucleotide of the same sequence consisting of natural DNA or RNA).
[0783] In some embodiments of the invention, the CpG-containing nucleic acid can be simply mixed with an immunogenic carrier according to methods known to those skilled in the art (see, eg, WO 03 / 024480).
[0784] In a specific embodiment of the invention, any immunogenic composition disclosed herein comprises 2 μg to 100 mg of CpG oligonucleotide, preferably 0.1 mg to 50 mg of CpG oligonucleotide, preferably 0.2 mg to 10 mg of CpG oligonucleotide, preferably 0.3 mg to 5 mg of CpG oligonucleotide, preferably 0.3 mg to 5 mg of CpG oligonucleotide, more preferably 0.5 to 2 mg of CpG oligonucleotide, more preferably 0.75 to 1.5 mg of CpG oligonucleotide. In a preferred embodiment, any immunogenic composition disclosed herein comprises approximately 1 mg of CpG oligonucleotide.
[0785] 5. Preparation
[0786] The immunogenic compositions of the present invention can be formulated in liquid form (i.e., solution or suspension) or in lyophilized form. Liquid formulations can advantageously be administered directly from their packaged form and are therefore ideal for injection without the need for reconstitution in an aqueous medium (as is required for the lyophilized compositions of the present invention).
[0787] The preparation of the immunogenic compositions of the present invention can be achieved using methods known in the art. For example, each pneumococcal conjugate can be formulated with a physiologically acceptable carrier to prepare a composition. Examples of such carriers include, but are not limited to, water, buffered saline, polyols (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and dextrose solution.
[0788] The present disclosure provides immunogenic compositions comprising any combination of the glycoconjugates disclosed herein and a pharmaceutically acceptable excipient, carrier, or diluent.
[0789] In one embodiment, the immunogenic composition of the invention is in the form of a liquid, preferably an aqueous liquid.
[0790] The immunogenic compositions of the present disclosure may include one or more of the following: a buffer, a salt, a divalent cation, a non-ionic detergent, a cryoprotectant such as a sugar, and an antioxidant such as a free radical scavenger or a chelating agent, or any combination thereof.
[0791] In one embodiment, the immunogenic composition of the present invention comprises a buffer. In one embodiment, the buffer has a pKa of about 3.5 to about 7.5. In some embodiments, the buffer is phosphate, succinate, histidine, or citrate. In certain embodiments, the buffer is succinate at a final concentration of 1 mM to 10 mM. In a specific embodiment, the final concentration of the succinate buffer is about 5 mM.
[0792] In one embodiment, the immunogenic composition of the present invention comprises a salt. In some embodiments, the salt is selected from the group consisting of magnesium chloride, potassium chloride, sodium chloride, and combinations thereof. In a specific embodiment, the salt is sodium chloride. In a specific embodiment, the immunogenic composition of the present invention comprises 150 mM sodium chloride.
[0793] In one embodiment, the immunogenic composition of the present invention comprises a surfactant. In one embodiment, the surfactant is selected from the group consisting of polysorbate 20 (TWEEN TM 20), Polysorbate 40 (TWEEN TM 40), Polysorbate 60 (TWEENTM 60), polysorbate 65 (TWEEN TM 65), Polysorbate 80 (TWEEN TM 80), polysorbate 85 (TWEEN TM 85) TRITON TM N-101, TRITON TM X-100, Octoxynol 40, Nonoxynol-9, Triethanolamine, Triethanolamine Polypeptide Oleate, Polyoxyethylene-660 Hydroxystearate (PEG-15, Solutol H 15), Polyoxyethylene-35-Ricinoleate ( EL), soy lecithin and poloxamer. In a specific embodiment, the surfactant is polysorbate 80. In some of the embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.0001% to 10% weight to weight (w / w) polysorbate 80. In some of the embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.001% to 1% weight to weight (w / w) polysorbate 80. In some of the embodiments, the final concentration of polysorbate 80 in the formulation is at least 0.01% to 1% weight to weight (w / w) polysorbate 80. In other embodiments, the final concentration of polysorbate 80 in the formulation is 0.01%, 0.02%, 0.03%, 0.04%, 0.05%, 0.06%, 0.07%, 0.08%, 0.09%, or 0.1% (w / w) polysorbate 80. In another embodiment, the final concentration of polysorbate 80 in the formulation is 1% (w / w) polysorbate 80.
[0794] In certain embodiments, the immunogenic compositions of the invention have a pH of 5.5 to 7.5, more preferably a pH of 5.6 to 7.0, more preferably a pH of 5.8 to 6.0.
[0795] In one embodiment, the present invention provides a container filled with any of the immunogenic compositions disclosed herein. In one embodiment, the container is selected from the group consisting of a vial, a syringe, a flask, a fermenter, a bioreactor, a bag, a can, an ampoule, a box, and a disposable pen. In certain embodiments, the container is siliconized.
[0796] In one embodiment, the container of the present invention is made of glass, metal (such as steel, stainless steel, aluminum, etc.) and / or polymer (such as thermoplastic, elastomer, thermoplastic elastomer).In one embodiment, the container of the present invention is made of glass.
[0797] In one embodiment, the present invention provides a syringe filled with any of the immunogenic compositions disclosed herein. In certain embodiments, the syringe is siliconized and / or made of glass.
[0798] A typical dose of the immunogenic composition of the invention for injection has a volume of 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL, more preferably about 0.5 mL.
[0799] The container or syringe defined above is thus filled with a volume of 0.1 mL to 2 mL, more preferably 0.2 mL to 1 mL, more preferably about 0.5 mL of any immunogenic composition defined herein.
[0800] 6. Uses of the Immunogenic Compositions of the Present Invention
[0801] In one embodiment, the immunogenic compositions disclosed herein are used for pharmaceutical purposes.
[0802] The immunogenic compositions described herein can be used in various therapeutic or prophylactic methods to prevent, treat, or alleviate bacterial infections, diseases, or symptoms in a subject. Specifically, the immunogenic compositions described herein can be used to prevent, treat, or alleviate Streptococcus pneumoniae infections, diseases, or symptoms in a subject.
[0803] Thus, in one aspect, the present invention provides a method for preventing, treating or ameliorating an infection, disease or symptom associated with S. pneumoniae in a subject, comprising administering to the subject an immunologically effective amount of an immunogenic composition of the present invention.
[0804] In some such embodiments, the infection, disease, or condition is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess.
[0805] In one embodiment, the present invention provides a method of inducing an immune response against S. pneumoniae in a subject, comprising administering to the subject an immunologically effective amount of an immunogenic composition of the present invention.
[0806] In one embodiment, the immunogenic compositions disclosed herein are used as vaccines. In such embodiments, the immunogenic compositions as described herein can be used to prevent infection in a subject with Streptococcus pneumoniae. Thus, in one aspect, the present invention provides a method for preventing Streptococcus pneumoniae infection in a subject, comprising administering to the subject an immunologically effective amount of the immunogenic composition of the present invention. In some such embodiments, the infection is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess. In one aspect, the subject to be vaccinated is a mammal, such as a human, cat, sheep, pig, horse, cattle, or dog.
[0807] In one aspect, the immunogenic compositions disclosed herein are used to prevent, treat, or alleviate an infection, disease, or condition associated with Streptococcus pneumoniae in a subject. In some such embodiments, the infection, disease, or condition is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess.
[0808] In one embodiment, the immunogenic compositions disclosed herein are used as vaccines. In such embodiments, the immunogenic compositions as described herein can be used to prevent infection in a subject with Streptococcus pneumoniae. Thus, in one aspect, the immunogenic compositions disclosed herein are used in a method for preventing Streptococcus pneumoniae infection in a subject. In some such embodiments, the infection is selected from the group consisting of pneumonia, sinusitis, otitis media, acute otitis media, meningitis, bacteremia, sepsis, empyema, conjunctivitis, osteomyelitis, septic arthritis, endocarditis, peritonitis, pericarditis, mastoiditis, cellulitis, soft tissue infection, and brain abscess. In one aspect, the subject to be vaccinated is a mammal, such as a human, cat, sheep, pig, horse, cattle, or dog.
[0809] The immunogenic compositions of the present invention can be used to protect or treat humans susceptible to pneumococcal infection by administering the immunogenic composition systemically or via a mucosal route. In one embodiment, the immunogenic compositions disclosed herein are administered intramuscularly, intraperitoneally, intradermally, or subcutaneously. In one embodiment, the immunogenic compositions disclosed herein are administered by intramuscular, intraperitoneal, intradermal, or subcutaneous injection. In one embodiment, the immunogenic compositions disclosed herein are administered by intramuscular or subcutaneous injection.
[0810] In one embodiment, an immunogenic composition of the present disclosure comprising at least one saccharide conjugate from S. pneumoniae serotype 15B (such as the saccharide conjugates of Section 1.3.4 above), when administered to a subject, is capable of inducing the formation of antibodies that are capable of binding to S. pneumoniae serotypes 15B, 15A and...
Claims
1. An immunogenic composition comprising at least one saccharide conjugate from Streptococcus pneumoniae (S. pneumoniae) serotype 8, wherein the serotype 8 saccharide conjugate comprises a S. pneumoniae serotype 8 capsular polysaccharide having a molecular weight of 100 kDa to 500 kDa, wherein the molecular weight of the serotype 8 saccharide conjugate is 4000 kDa to 10000 kDa, wherein the weight ratio of serotype 8 capsular polysaccharide to carrier protein in the serotype 8 saccharide conjugate is 0.4 to 1.5, wherein the serotype 8 saccharide conjugate is prepared in DMSO using reductive amination, and wherein the carrier protein of the serotype 8 saccharide conjugate is CRM 197 .
2. The immunogenic composition of claim 1, wherein the weight ratio of serotype 8 capsular polysaccharide to carrier protein in the serotype 8 saccharide conjugate is from 0.4 to 1.
2.
3. The immunogenic composition of claim 1, wherein the weight ratio of serotype 8 capsular polysaccharide to carrier protein in the serotype 8 saccharide conjugate is from 0.8 to 1.
15.
4. The immunogenic composition of any one of claims 1 to 3, wherein the serotype 8 saccharide conjugate comprises a S. pneumoniae serotype 8 capsular polysaccharide having a molecular weight of 200 kDa to 300 kDa.
5. The immunogenic composition of any one of claims 1 to 3, wherein the degree of conjugation of the serotype 8 saccharide conjugate is from 2 to 20.
6. The immunogenic composition of any one of claims 1 to 3, wherein the degree of conjugation of the serotype 8 saccharide conjugate is from 6 to 14.
7. The immunogenic composition of claim 1, wherein the serotype 8 saccharide conjugate comprises a S. pneumoniae serotype 8 capsular polysaccharide having a molecular weight of 200 kDa to 300 kDa, and wherein the serotype 8 saccharide conjugate has a degree of conjugation of 6 to 14.
8. The immunogenic composition of any one of claims 1 to 3 or 7, further comprising a saccharide conjugate from Streptococcus pneumoniae serotype 22F.
9. The immunogenic composition of any one of claims 1 to 3 or 7, further comprising a saccharide conjugate from Streptococcus pneumoniae serotype 15B.
10. The immunogenic composition of any one of claims 1 to 3 or 7, further comprising a saccharide conjugate from Streptococcus pneumoniae serotype 33F.
11. The immunogenic composition of any one of claims 1 to 3 or 7, further comprising a saccharide conjugate from Streptococcus pneumoniae serotype 12F.
12. The immunogenic composition of any one of claims 1-2 or 7, further comprising a saccharide conjugate from Streptococcus pneumoniae serotype 10A.
13. The immunogenic composition of any one of claims 1 to 3 or 7, further comprising a saccharide conjugate from Streptococcus pneumoniae serotype 11A.
14. The immunogenic composition of any one of claims 1 to 3 or 7, further comprising a saccharide conjugate from Streptococcus pneumoniae serotype 15B, a saccharide conjugate from Streptococcus pneumoniae serotype 22F, a saccharide conjugate from Streptococcus pneumoniae serotype 33F, a saccharide conjugate from Streptococcus pneumoniae serotype 12F, a saccharide conjugate from Streptococcus pneumoniae serotype 10A, and a saccharide conjugate from Streptococcus pneumoniae serotype 11A.
15. The immunogenic composition of any one of claims 1-3 or 7, further comprising a saccharide conjugate from S. pneumoniae serotypes 4, 6B, 9V, 14, 18C, 19F and 23F.
16. The immunogenic composition of any one of claims 1 to 3 or 7, further comprising a saccharide conjugate from S. pneumoniae serotypes 1, 5 and 7F.
17. The immunogenic composition of any one of claims 1 to 3 or 7, further comprising saccharide conjugates from S. pneumoniae serotypes 6A and 19A.
18. The immunogenic composition of any one of claims 1 to 3 or 7, further comprising at least one saccharide conjugate from Streptococcus pneumoniae serotype 3.
19. The immunogenic composition of any one of claims 1 to 3 or 7, further comprising a saccharide conjugate from the following S. pneumoniae serotypes: 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F and 23F.
20. The immunogenic composition of any one of claims 1-3 or 7, further comprising a saccharide conjugate from the following S. pneumoniae serotypes: 1, 3, 4, 5, 6A, 6B, 7F, 9V, 14, 18C, 19A, 19F, 22F, 23F, and 33F.
21. The immunogenic composition of any one of claims 1-3 or 7, further comprising a saccharide conjugate from the following S. pneumoniae serotypes: 1, 3, 4, 5, 6A, 6B, 7F, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F, and 33F.
22. The immunogenic composition of any one of claims 1 to 3 or 7, which is a composition of an 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20-valent pneumococcal conjugate.
23. The immunogenic composition of any one of claims 1 to 3 or 7, which is a composition of a 20-valent pneumococcal conjugate.
24. The immunogenic composition of claim 21 which is a 20-valent pneumococcal conjugate composition.
25. The immunogenic composition of claim 21, wherein the capsular polysaccharides of the serotypes are independently conjugated to CRM 197 .
26. The immunogenic composition of claim 24, wherein capsular polysaccharides of all serotypes are independently conjugated to CRM 197 .
27. The immunogenic composition of any one of claims 1 to 3 or 7, further comprising saccharide conjugates from the following S. pneumoniae serotypes: 1, 3, 4, 5, 6A, 6B, 7F, 9V, 10A, 11A, 12F, 14, 15B, 18C, 19A, 19F, 22F, 23F and 33F, wherein the capsular polysaccharides of all said serotypes are independently conjugated to the CRM 197 , and wherein the composition is a 20-valent pneumococcal conjugate composition.
28. The immunogenic composition of claim 26, wherein each dose comprises 1 to 10 μg of polysaccharide of each serotype.
29. The immunogenic composition of claim 26, wherein each dose comprises 10 μg to 150 μg of carrier protein.
30. The immunogenic composition of claim 26, wherein each dose comprises 25 μg, 26 μg, 27 μg, 28 μg, 29 μg, 30 μg, 31 μg, 32 μg, 33 μg, 34 μg, 35 μg, 36 μg, 37 μg, 38 μg, 39 μg, 40 μg, 41 μg, 42 μg, 43 μg, 44 μg, 45 μg, 46 μg, 47 μg, 48 μg, 49μg, 50μg, 51μg, 52μg, 53μg, 54μg, 55μg, 56μg, 57μg, 58μg, 59μg, 60μg, 61μg, 62μ g, 63μg, 64μg, 65μg, 66μg, 67μg, 68μg, 69μg, 70μg, 71μg, 72μg, 73μg, 74μg or 75μg of carrier protein.
31. The immunogenic composition of any one of claims 1-3 or 7, wherein the immunogenic composition further comprises at least one adjuvant.
32. The immunogenic composition of claim 27, wherein the immunogenic composition further comprises at least one adjuvant selected from the group consisting of aluminum phosphate, aluminum sulfate, and aluminum hydroxide.
33. The immunogenic composition of any one of claims 1-3 or 7, comprising one or more of the following: a buffer, a salt, a non-ionic detergent, a cryoprotectant, and an antioxidant, or any combination thereof.
34. The immunogenic composition of claim 33, comprising a divalent cation.
35. The immunogenic composition of claim 27, comprising a buffer.
36. The immunogenic composition of claim 28, comprising a salt.
37. The immunogenic composition of claim 29, comprising a surfactant.
38. Use of the immunogenic composition of any one of claims 1 to 3 or 7 in the preparation of a medicament.
39. Use of the immunogenic composition of any one of claims 1 to 3 or 7 in the preparation of a vaccine.
40. Use of the immunogenic composition of any one of claims 1 to 3 or 7 in the preparation of a medicament for preventing, treating or ameliorating a Streptococcus pneumoniae infection in a subject.
41. Use of the immunogenic composition of any one of claims 1 to 3 or 7 in the preparation of a vaccine for preventing, treating or ameliorating a Streptococcus pneumoniae infection in a subject.
42. Use of the immunogenic composition of any one of claims 1 to 3 or 7 in the preparation of a medicament for preventing a Streptococcus pneumoniae infection in a subject.
43. Use of the immunogenic composition of any one of claims 1 to 3 or 7 in the preparation of a vaccine for preventing a Streptococcus pneumoniae infection in a subject.
44. Use of the immunogenic composition of any one of claims 1 to 3 or 7 in the preparation of a medicament for protecting against or treating a human susceptible to infection by S. pneumoniae by administering the immunogenic composition by systemic or mucosal route.
45. Use of the immunogenic composition of any one of claims 1 to 3 or 7 in the preparation of a vaccine for protecting or treating a human susceptible to infection with Streptococcus pneumoniae by administering the immunogenic composition by systemic or mucosal route.
Citation Information
Patent Citations
Synthetic antigens, method for their preparation and their use
EP0372501A2
Synthetic peptides and their use as universal carriers for the preparation of immunogenic conjugates suitable for the development of synthetic vaccines
EP0378881A1
Synthetic peptides useful as universal carriers for the preparation of immunogenic conjugates and their use in the development of synthetic vaccines
EP0427347A1
Filamentous hemagglutinin of bordetella pertussis as a carrier molecule for conjugate vaccines
EP0471177A2
PROTEIN D - AN IgD-BINDING PROTEIN OF HAEMOPHILUS INFLUENZAE
EP0594610A1