Primer and probe set and kit for detecting porcine parvovirus type 4 and type 6 by duplex fluorescent quantitative PCR

By designing a dual-fluorescent quantitative PCR method using specific primer and probe combinations, the problem of the inability to simultaneously and efficiently detect PPV4 and PPV6 in existing technologies has been solved, achieving rapid detection with high sensitivity and specificity, and is suitable for rapid detection of porcine parvovirus.

CN114908189BActive Publication Date: 2026-03-27LONGYAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-03-31
Publication Date
2026-03-27

AI Technical Summary

Technical Problem

Current technology has not yet established an effective dual-fluorescence quantitative PCR detection method to simultaneously identify porcine parvovirus types 4 and 6. Conventional PCR methods have low sensitivity and require gel electrophoresis experiments, which cannot meet the needs of efficient and rapid detection.

Method used

We designed specific primer and probe combinations to establish a dual real-time PCR detection method for porcine parvovirus types 4 and 6. We used TaqMan probes and specific primers to detect PPV6 and PPV4. We optimized reaction conditions using TaqMan multiplex qPCR master mix to achieve high sensitivity and specificity detection.

Benefits of technology

It achieves high-sensitivity detection of 7.7 copies/μl for PPV6 and 9.3 copies/μl for PPV4, and can complete the detection of large batches of samples within 1 hour. It has good specificity and stability, is not affected by other viruses, and has a short detection time.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN114908189B_ABST
    Figure CN114908189B_ABST
Patent Text Reader

Abstract

The application discloses a primer and probe set and a kit for detecting porcine parvovirus type 4 and type 6 by duplex fluorescent quantitative PCR, wherein the primer and probe set is composed of an upstream primer PPV6-F, a downstream primer PPV6-R and a probe PPV6-P of PPV6 and an upstream primer PPV4-F, a downstream primer PPV4-R and a probe PPV4-P of PPV4, and the nucleotide sequences are shown in SEQ ID NO:1-6. The duplex fluorescent quantitative PCR detection method established by the application has a detection sensitivity of 7.7 copies / ul for porcine parvovirus type 6 and a detection sensitivity of 9.3 copies / ul for porcine parvovirus type 4, and the detection time for a single sample is 1 hour, so that large batches of samples can be simultaneously detected, and the method has good specificity, sensitivity and stability, and can realize rapid detection of porcine parvovirus type 6 and porcine parvovirus type 4.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and particularly relates to a primer and probe set and a kit for detecting porcine parvovirus type 4 and type 6 by duplex fluorescent quantitative PCR. BACKGROUND

[0002] Porcine parvovirus (PPV) is a single-stranded linear DNA virus without envelope, and the genome length is about 4.0-6.1 kb. In 1965, PPV1 was first isolated in Germany and was considered to be one of the main causes of pig reproductive failure worldwide, and often mixedly infected with PCV-2 to jointly cause porcine circovirus-associated disease (PCVAD). PPV4 was first found in North Carolina, USA, and had a high co-infection rate with PCV2. In 2014, Ni et al. identified PPV6 from the tissue samples of aborted fetuses, and the tissue samples did not contain other pathogens that could cause reproductive failure, including PRV, PRRSV, PPV1, PCV2, CSFV, SIV and Brucella. Subsequently, Schirtzinger et al. detected PPV6 in PRRSV-positive samples in the United States. Currently, PPV4 and PPV6 have been found in aborted fetuses and have a high infection rate.

[0003] Although relevant multiplex PCR methods have been established for PPV4 and PPV6, no duplex fluorescent quantitative PCR detection method based on TaqMan probes for PPV4 and PPV6 has been found. The ordinary PCR method has the disadvantages of low sensitivity and the need for gel electrophoresis experiment for identification of products. Therefore, there is an urgent need for a duplex fluorescent quantitative PCR detection method that can simultaneously identify PPV4 and PPV6. SUMMARY

[0004] In view of the high infection rate of PPV4 and PPV6 and the lack of detection technology for PPV4 and PPV6, the application provides a primer and probe set and a kit for detecting porcine parvovirus type 4 and type 6 by duplex fluorescent quantitative PCR. The established duplex fluorescent quantitative PCR detection method has a detection sensitivity of 7.7 copies / μl for porcine parvovirus type 6 and 9.3 copies / μl for porcine parvovirus type 4, and the detection time for a single sample is 1 hour. The method can simultaneously detect a large number of samples and has good specificity, sensitivity and stability, and can realize rapid detection of porcine parvovirus type 6 and porcine parvovirus type 4.

[0005] In order to achieve the above purpose, the application adopts the following technical solutions:

[0006] 4 and 6 type porcine parvovirus double fluorescent quantitative PCR detection primer and probe group, which is composed of PPV6 upstream primer PPV6-F, downstream primer PPV6-R and probe PPV6-P, and PPV4 upstream primer PPV4-F, downstream primer PPV4-R and probe PPV4-P, the nucleotide sequences and modifications of PPV6-F, PPV6-R, PPV6-P, PPV4-F, PPV4-R, PPV4-P are as follows:

[0007] PPV6-F: TCCCGTTTCAAGACATTGTGA (SEQ ID NO: 1)

[0008] PPV6-R: GCCTTAGCACATTCAACCAC (SEQ ID NO: 2)

[0009] PPV6-P: FAM-TTCCTTCCTCCCACCAACCCA-BHQ1 (SEQ ID NO: 3)

[0010] PPV4-F: AAACATTCCGCTTTTGAGTTCCA (SEQ ID NO: 4)

[0011] PPV4-R: CCCACTTGGCAGTTTACCTC (SEQ ID NO: 5)

[0012] PPV4-P: VIC-AATGCCAGGTCACCCGTCACA-BHQ1 (SEQ ID NO: 6)

[0013] The probe carries a detectable label, which is a self-quenching probe, and the 5' end of PPV6-P and PPV4-P carries FAM and VIC fluorescent emitter groups respectively, and the 3' end carries BHQ1 fluorescent quenching group

[0014] 4 and 6 type porcine parvovirus double fluorescent quantitative PCR detection kit, including the above PPV6-F, PPV6-R, PPV6-P, PPV4-F, PPV4-R, PPV4-P, positive control, standard plasmid pMD-PPV6 and pMD-PPV4, negative control, double distilled water, probe fluorescent quantitative premix reagent TaqMan multiplex qPCR master mix.

[0015] The copy number of the standard plasmid pMD-PPV6 is 7.7 x 10 9 copies / μl, and the copy number of the standard plasmid pMD-PPV4 is 9.3 x 10 9 copies / μl.

[0016] The negative control is Rnase-free ddH2O, and the positive control is a mixed recombinant plasmid of PPV4 and PPV6 gene fragments.

[0017] The method for using the kit comprises the following steps

[0018] (1) extracting sample DNA

[0019] (2) configuring a duplex fluorescent quantitative PCR reaction system, and the system is as follows:

[0020] TaqMan multiplex qPCR master mix 10 μl;

[0021] PPV6-F 0.5 μl, final concentration 10 μM;

[0022] PPV6-R 0.5 μl, final concentration 10 μM;

[0023] PPV6-P 1 μl, final concentration 10 μM;

[0024] PPV4-F 0.5 μl, final concentration 10 μM;

[0025] PPV4-R 0.5 μl, final concentration 10 μM;

[0026] PPV4-P 0.5 μl, final concentration 10 μM;

[0027] Template DNA 1.5 μl, add double distilled water to make up the system to 20 μl;

[0028] (3) The duplex fluorescent quantitative PCR reaction condition is: 95 ℃ pre-denaturation for 5 min; the cycle reaction includes 95 ℃ for 10 s, 58 ℃ for 30 s, a total of 45 cycles, and the fluorescence signal is collected at 60 ℃ for the last second.

[0029] The application provides a primer and probe set and a kit for double fluorescent quantitative PCR capable of simultaneously detecting PPV6 and PPV4. BRIEF DESCRIPTION OF DRAWINGS

[0030] Figure 1 Figure 2 is a single PCR amplification result of pig parvovirus 6 and pig parvovirus 4 positive materials, wherein M represents DNA molecular mass standard; 1 represents a negative control; 2 represents pig parvovirus 4 positive material amplification result; and 3 represents pig parvovirus 6 positive material amplification result.

[0031] Figure 2 Figure 3 is a standard curve of double real-time fluorescent quantitative PCR, wherein A represents a PPV6 standard curve; B represents a PPV4 standard curve; 1 represents 1.0x10 -3 dilution mixed standard; 2 represents 1.0x10 -4 dilution mixed standard; 3 represents 1.0x10 -5 dilution mixed standard; 4 represents 1.0x10 -6 dilution mixed standard; 5 represents 1.0x10 -7 dilution mixed standard; 6 represents 1.0x10 -8 dilution mixed standard; 7 represents 1.0x10 -9 dilution mixed standard; and 8 represents a negative control.

[0032] Figure 3 Specificity test of duplex real-time fluorescent quantitative PCR detection method, wherein 1: PPV6 and PPV4 double positive nucleic acid; 2: PRV positive nucleic acid; 3: TGEV, PEDV, PRoV triple positive nucleic acid; 4: CSFV positive nucleic acid; 5: PRRSV positive nucleic acid; 6: JEV positive nucleic acid; 7: PPV1 positive nucleic acid; 8: negative control.

[0033] Figure 4 Sensitivity test of duplex real-time fluorescent quantitative PCR detection method, wherein A: PPV6 qPCR sensitivity test; B: PPV4 qPCR sensitivity test; C: conventional duplex PCR sensitivity test; 1: 1.0 × 10 -2 dilution mixed standard; 2: 1.0 × 10 -3 dilution mixed standard; 3: 1.0 × 10 -4 dilution mixed standard; 4: 1.0 × 10 -5 dilution mixed standard; 5: 1.0 × 10 -6 dilution mixed standard; 6: 1.0 × 10 -7 dilution mixed standard; 7: 1.0 × 10 -8 dilution mixed standard; 8: 1.0 × 10 -9 dilution mixed standard; 9: 1.0 × 10 -10 dilution mixed standard; 10: negative control. DETAILED DESCRIPTION

[0034] 1. Materials and methods

[0035] 1.1 Virus strain and clinical sample source

[0036] PPV6 and PPV4 positive samples were stored at -80°C by the Animal Medicine Institute of Longyan University; Pseudorabies virus (PRV) live vaccine, Transmissible gastroenteritis virus (TGEV) attenuated Huazhu strain, Porcine epidemic diarrheavirus (PEDV) CV777 strain and Porcine rotavirus (PRoV) NX strain were purchased from Jilin Zhengye Biological Products Co., Ltd.; Japanese encephalitis virus (JEV) inactivated vaccine and Porcine parvovirus (PPV) type 1 inactivated vaccine were purchased from Shandong Lvdou Biological Products Co., Ltd.; Porcine reproductive and respiratory syndrome virus (PRRSV) CH-1R strain was purchased from Harbin Weike Biological Technology Co., Ltd.; Classical swine fever virus (CSFV) rabbitized attenuated strain was purchased from Guangdong Yongshun Biological Pharmaceutical Co., Ltd.

[0037] 1.2 Main reagents and instruments

[0038] Column method virus total nucleic acid (DNA / RNA) extraction kit (product number D3191-02C) was purchased from Guangzhou Meiji Biological Technology Co., Ltd.; 2x TaqMan multiplex qPCR master mix (product number 1120ES) was purchased from Yixing Biological Technology Co., Ltd.; 2x Taq Master Mix, plasmid small amount extraction kit (product number DC201-01), DH5a competent cells, reverse transcription reagent (product number 312-01 / 02) and pMD-19T vector were purchased from Nanjing Nuowezan Biological Technology Co., Ltd.; DL500 DNA Marker was purchased from Baobioengineering (Dalian) Co., Ltd.; Roche LightCycler480 II real-time fluorescent quantitative PCR instrument was purchased from Roche Company of Switzerland; ABI Veriti 96-well gradient PCR instrument was purchased from ABI Company; NanoDrop ND-2000C microspectrophotometer was purchased from Thermo Fisher Biological Company.

[0039] 1.3 Primer design and synthesis

[0040] The MEGA7 software was used to align the PPV6 and PPV4 whole gene sequences published in Genbank, and a pair of specific primers and probes were designed for the conserved sequences of PPV6 and PPV4 genomes. The primers were synthesized by Shanghai Shengong Bioengineering Co., Ltd. The primers and probes were diluted to 10 μmol / L for standby. The primer and probe information is shown in Table 1.

[0041] Table 1 Primer information

[0042]

[0043] 1.4 Virus nucleic acid extraction

[0044] According to the instruction of the column method virus total nucleic acid (DNA / RNA) extraction kit (item number D3191-02C), the genomic DNA / RNA of PPV6 and PPV4 positive samples and PRV, TGEV, PEDV, PRoV, CSFV, PRRSV, JEV, PPV1 vaccine was extracted. The DNA was stored at -20℃. According to the instruction of the reverse transcription reagent, the extracted TGEV, PEDV, PRoV, CSFV, PRRSV and JEV genomic RNA was reverse transcribed into cDNA, which was stored at -20℃.

[0045] 1.5 Amplification and cloning of target fragments

[0046] The extracted PPV6 and PPV4 positive sample genomic DNA was used as the template, and the PPV6-F / R and PPV4-F / R primers were used for single PCR amplification of PPV6 and PPV4 positive samples, respectively. The reaction system was as follows: 2×Taq Master Mix 12.5 μl, primer pair 2 μl, sample DNA 2 μl, ddH2O 8.5 μl, and the total reaction system was 25 μl. The reaction program was as follows: 95℃ pre-denaturation for 5 min; the cycle reaction included 95℃ for 30 s, 58℃ for 30 s, and 72℃ for 30 s, a total of 35 cycles; 72℃ for 10 min for full extension. The PCR products were identified by 2% agarose gel electrophoresis experiment. According to the instruction of the product purification kit (item number DC301-01), the positive amplification products were recovered, and the positive amplification products were linked to the pMD-19T vector to construct recombinant plasmids pMD-PPV6 and pMD-PPV4. The recombinant plasmid was transformed into DH5α competent cells, and the positive strain was sent to Guangdong Ruibo Xingke Biological Technology Co., Ltd. for sequencing.

[0047] 1.6 Preparation of standard

[0048] The strains with correct sequencing results were cultured overnight, and the recombinant plasmids were extracted according to the instructions of the plasmid mini-extraction kit (item number DC201-01). The concentration of the recombinant plasmid was measured using a NanoDrop ND-2000C microspectrophotometer, and its copy number was calculated according to the formula [copy number = plasmid concentration × 10 -9 × 6.02 × 10 23 / (660 × recombinant plasmid length)]. Equal volumes of recombinant plasmids pMD-PPV6 and pMD-PPV4 were mixed, and 10-fold gradient dilutions were prepared and stored at -20°C for later use.

[0049] 1.7 Optimization of the duplex real-time fluorescent quantitative PCR detection method

[0050] Equal volumes of PPV6 and PPV4 standard samples with a dilution factor of 10 -7 were mixed and used as the template for the duplex real-time fluorescent quantitative PCR reaction. The primer concentration (0.25-1.0 μmol / L), probe concentration (0.25-1.0 μmol / L), extension temperature (56-62°C), extension time (15-35 s), and template amount (0.5-2 μl) were optimized using the square array method.

[0051] 1.8 Specificity test of the duplex real-time fluorescent quantitative PCR method

[0052] The optimized PPV6 / PPV4 duplex real-time fluorescent quantitative PCR method was used to evaluate the specificity of the established duplex real-time fluorescent quantitative PCR method, with the nucleic acids of PRV, TGEV, PEDV, PRoV, CSFV, PRRSV, JEV, and PPV1 as the template, and with positive and negative controls.

[0053] 1.9 Sensitivity test of the duplex real-time fluorescent quantitative PCR detection method

[0054] The mixed recombinant plasmid with a dilution factor of 10 -2 -10 -10 was used as the template, and the optimized duplex real-time fluorescent quantitative PCR method was used for amplification to evaluate the sensitivity of the established duplex real-time fluorescent quantitative PCR method. The mixed plasmid with a dilution factor of 10 -3 -10 -9 was used for conventional PCR detection to compare and evaluate the minimum detection limit of the two methods.

[0055] 1.10 Reproducibility test of the duplex real-time fluorescent quantitative PCR

[0056] The mixed recombinant plasmid with a dilution factor of 10 -3 -10 -6 was used as the template, and the optimized duplex real-time fluorescent quantitative PCR method was used for amplification to evaluate the sensitivity of the established duplex real-time fluorescent quantitative PCR method. The mixed plasmid with a dilution factor of 10 -3 -10 -9 was used for conventional PCR detection to compare and evaluate the minimum detection limit of the two methods.The mixed recombinant plasmid was used as template, and divided into three batches, each batch with three repeats. The optimized double real-time fluorescent quantitative PCR detection method was used for amplification, and the coefficient of variation (CV) was calculated according to the obtained Ct value to verify the repeatability of the established method.

[0057] 2 Results

[0058] 2.1 Construction of positive standard plasmid

[0059] A 25 μl reaction system was established, and PPV6-F / R and PPV4-F / R primers were used for single PCR amplification of PPV4 and PPV6 positive samples, respectively. The single PCR amplification products appeared specific bands at about 85 bp and 139 bp ( Figure 1 ), which were consistent with the expected fragment size. The single PCR amplification products were recovered and linked to pMD-19T vector, and positive monoclonal was selected for sequencing. The sequencing results showed that NCBI Blast comparison showed that the cloned target fragments had the highest homology with PCV2 and PPV2 existing strain sequences, both 100%, which proved that the recombinant plasmid was correctly constructed, and was named as pMD-PPV6 and pMD-PPV4, respectively. The concentration of the sequencing correct recombinant plasmid was measured by NanoDrop ND-2000C microspectrophotometer, and the copy number of pMD-PPV6 and pMD-PPV4 mixed at 1:1 was calculated as 7.7×10 9 copies / μl and 9.3×10 9 copies / μl, respectively.

[0060] 2.2 Reaction condition optimization

[0061] The annealing temperature, annealing time, primer concentration, cycle number and template amount of double real-time fluorescent quantitative PCR reaction were optimized, and the final reaction system was determined as 20 μl: TaqMan multiplex qPCR master mix 10 μl, PPV6 upper and lower primers (10 μM) 0.5 μl each, PPV4 upper and lower primers (10 μM) 0.5 μl each, PPV6 probe (10 μM) 1 μl, PPV4 probe (10 μM) 0.5 μl, template DNA 1.5 μl, and double distilled water was added to make up the system to 20 μl. The reaction program was: 95℃ pre-denaturation for 5 min; the cycle reaction included 95℃ for 10 s, 58℃ for 30 s, a total of 45 cycles, and the fluorescence signal was collected at 60℃ for the last second.

[0062] 2.3 Construction of standard curve

[0063] The dilution of 10 -3 -10 -9Using the recombinant plasmid as a template, dual real-time quantitative PCR was performed under optimized reaction conditions. A standard curve was plotted with the logarithm of copy number on the x-axis and Ct value on the y-axis. Figure 2 The results showed that the concentrations of both plasmid templates had a good linear relationship with their Ct values. The linear relationship for pMD-PPV6 was expressed as Y1 = -3.3934 + 36.834, Rt. 2 -PPV6 = 0.9996, E = 97.10%; the linear relationship expression of pMD-PPV4 is Y2 = -3.2443 + 35.728, R 2 -PPV4 = 0.9998, E = 103.34%. This dual real-time fluorescence quantitative method exhibits good amplification efficiency and correlation coefficient, indicating the reliability of the established standard curve.

[0064] 2.4 Specificity test

[0065] The dual real-time quantitative PCR method established in this study was used to detect the nucleic acids of PRV, TGEV, PEDV, PRoV, CSFV, PRRSV, JEV, and PPV1. The results showed that only PPV6 and PPV4 showed amplification curves, while the other pathogens did not. Figure 3 ).

[0066] 2.5 Sensitivity Test

[0067] Select dilution 10 -2 ~10 -10 Using a mixed standard plasmid as a template, the optimized dual real-time quantitative PCR method was applied for detection. Results showed ( Figure 4 ), for a dilution of 10 -10 The mixed standard plasmids still showed amplification curves, but the detection CT value was >38, and the stability was poor. Therefore, the minimum detection limits of the dual real-time quantitative PCR method established in this study for the pMD-PPV6 and pMD-PPV4 recombinant standard plasmids were determined to be 7.7 copies / μl and 9.3 copies / μl, respectively. A dilution of 10 was selected. -3 ~10 -9 Using the mixed standard plasmids as templates, conventional PCR detection was performed. The results showed that the lowest detection limit for the pMD-PPV6 and pMD-PPV4 recombinant standard plasmids by conventional PCR was 7.7 × 10⁻⁶. 2 Copy / μl and 9.3×10 2 The result was 100 copies / μl, indicating that the dual real-time quantitative PCR method established in this study has high sensitivity, which is 100 times that of conventional PCR.

[0068] 2.6 Repeatability Test

[0069] Select dilution 10 -3 ~10 -6 The mixed standard plasmid with dilution of 10 was used as template, and the optimized duplex real-time fluorescent quantitative PCR method was used for repeated test. The same batch was set with three repeated verification groups, and the coefficient of variation was calculated. The results showed that the intra-group variation coefficients of PPV6 and PPV4 were less than 0.94%, and the inter-group variation coefficients were less than 1.53%, indicating that the duplex real-time fluorescent quantitative PCR detection method established in this study had good repeatability and stability.

[0070] Table 2 Results of repeatability test

[0071] SEQUENCE LISTING <110> Longyan University <120> Primer and probe group and kit for detecting porcine parvovirus type 4 and type 6 by duplex fluorescent quantitative PCR <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 21 <212> DNA <213> Artificial Sequence <400> 1 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <400> 3 <210> 4 <211> 23 <212> DNA <213> Artificial Sequence <400> 4 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <400> 6

Claims

1. A primer and probe set for detecting porcine parvovirus type 1.4 and 6 by duplex real-time PCR, characterized in that, It consists of the upstream primer PPV6-F, the downstream primer PPV6-R and the probe PPV6-P of PPV6, and the upstream primer PPV4-F, the downstream primer PPV4-R and the probe PPV4-P of PPV4, the nucleotide sequences and modifications of the PPV6-F, PPV6-R, PPV6-P, PPV4-F, PPV4-R, PPV4-P are as follows: PPV6-F: TCCCGTTTCAAGACATTGTGA; PPV6-R: GCCTTAGCACATTCAACCAC; PPV6-P: FAM-TTCCTTCCTCCCACCAACCCA-BHQ1; PPV4-F: AAACATTCCGCTTTTGAGTTCCA; PPV4-R: CCCACTTGGCAGTTTACCTC; PPV4-P: VIC-AATGCCAGGTCACCCGTCACA-BHQ1.

2. The double fluorescent quantitative PCR detection kit for porcine parvovirus type 4 and 6, characterized in that, It includes the primer and probe group of claim 1, positive control, standard plasmid pMD-PPV6 and pMD-PPV4, negative control, double distilled water, probe method fluorescence quantitative premix reagent TaqMan multiplex qPCR master mix.

3. The dual fluorescent quantitative PCR detection kit for porcine parvovirus type 4 and 6 according to claim 2, characterized in that, The copy number of the standard plasmid pMD-PPV6 was 7.7 x 10 9 The copy number of the standard plasmid pMD-PPV4 was 9.3 x 10 9 copies / μl.

4. The dual fluorescent quantitative PCR detection kit for type 4 and type 6 porcine parvovirus according to claim 2, characterized in that, The negative control is Rnase-free ddH2O, and the positive control is a mixed recombinant plasmid of PPV4 and PPV6 gene fragments.

5. The method for using the dual fluorescent quantitative PCR detection kit for porcine parvovirus type 4 and 6 according to claim 2, which is not for the purpose of diagnosis or treatment of disease, characterized in that, It includes the following steps: (1) Extract sample DNA (2) Configure double fluorescence quantitative PCR reaction system, the system is as follows: TaqMan multiplex qPCR master mix 10 μl; PPV6-F 0.5 μl, final concentration 10 μM; PPV6-R 0.5 μl, final concentration 10 μM; PPV6-P 1 μl, final concentration 10 μM; PPV4-F 0.5 μl, final concentration 10 μM; PPV4-R 0.5 μl, final concentration 10 μM; PPV4-P 0.5 μl, final concentration 10 μM; Template DNA 1.5 μl, add double distilled water to make up the system to 20 μl; (3) The double fluorescence quantitative PCR reaction condition is: 95℃ pre-denaturation 5min; The cycle reaction includes 95℃ 10s, 58℃ 30s, a total of 45 cycles, and the fluorescence signal is collected at 60℃ for the last second.