Probe primer set for RNA in situ detection and application thereof
By designing probe primer sets and rolling circle amplification technology for in situ RNA detection, the problems of limited gene detection capacity and insufficient sensitivity in existing methods have been solved, achieving efficient multiplex in situ RNA detection, especially for spatial feature gene expression region labeling and cell type identification at single-cell or subcellular resolution.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- XIAMEN SEERNA BIOSCIENCE CO LTD
- Filing Date
- 2022-05-16
- Publication Date
- 2026-07-07
AI Technical Summary
Existing RNA in situ detection methods have limitations in the number of genes they can detect and are difficult to achieve high sensitivity and multiplex detection, especially for spatially characteristic gene expression region labeling and cell type identification at single-cell or subcellular resolution.
A probe-primer set for in situ RNA detection was designed, including circular probes and multiple detection probes. Signal amplification was achieved through rolling circle amplification technology, and multiplex detection was performed using different tag sequences and reporter markers. Anchoring primers were combined to improve ligation efficiency and fluorescence signal.
It improves the sensitivity of detection and the ability to detect multiplex RNA in situ, enhances the connection efficiency between the detection probe and the anchoring primer, and achieves better specificity and multiplex RNA in situ detection.
Smart Images

Figure CN114921527B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of spatial transcriptomics technology, specifically relating to a probe primer set for in situ RNA detection and its application. Background Technology
[0002] Spatial transcriptomics technology can locate and differentiate the active expression of functional genes in specific tissue regions, thus providing important information for basic research and clinical diagnosis. As a groundbreaking new omics research technology, it enables us to detect gene activity in different microenvironments within tissue samples and map the spatial distribution of active gene expression. Current spatial transcriptomics methods are mainly divided into two categories: sequencing-based methods and microscopic imaging-based methods. The former involves a series of primer-encoded spatial information methods, which add location information tags to cDNA and then sequence it to determine the spatial location of the gene. The latter involves in situ sequencing or multiple rounds of single-molecule fluorescence in situ hybridization and imaging at the original location of RNA in cells or tissues, thereby obtaining a series of signals encoded by different fluorescent colors to detect different genes and directly obtain the spatial location information of the detected gene.
[0003] In situ sequencing is a targeted spatial transcriptomics technique that uses probe circularization and rolling circle amplification to target known genes, thus detecting a relatively small number of genes. However, due to its single-cell and even subcellular resolution, it helps identify spatially characteristic gene expression regions and cell types. In situ sequencing utilizes rolling circle amplification (RCA) to amplify the signal. RCA is a multi-primer in vitro nucleic acid exponential amplification technique inspired by the rolling circle replication mechanism of pathogenic organisms. It can directly amplify specific DNA and RNA molecules while simultaneously amplifying the target nucleic acid signal, with a sensitivity up to one copy of a nucleic acid molecule. The RCA amplification products contain DNA barcodes corresponding to different genes; sequencing chemical decoding reveals the type of gene being detected by the RCA product. Summary of the Invention
[0004] The purpose of this invention is to provide a probe primer set for in situ RNA detection.
[0005] Another object of the present invention is to provide an RNA in situ detection kit.
[0006] Another object of the present invention is to provide the application of probe primer sets in in situ RNA detection for non-diagnostic and therapeutic purposes.
[0007] Another object of the present invention is to provide an in situ RNA detection method for non-diagnostic and therapeutic purposes.
[0008] The technical solution of the present invention is as follows:
[0009] A probe primer set for in situ RNA detection, wherein the sample for in situ RNA detection is cells cultured in vitro and cells in tissue sections, includes at least one circularizing probe for forming a rolling circle amplification product and a first to fourth detection probe set capable of hybridizing with the rolling circle amplification product.
[0010] Each circular probe corresponds to a target sequence, and its 5' and 3' ends are specifically hybridized and complementary to the target sequence. Furthermore, it has a first tag sequence and a second tag sequence between its 5' and 3' ends. The first tag sequence is located at the 3' end of the 5' end sequence that is specifically hybridized and complementary to the target sequence, and the second tag sequence is located at the 5' end of the 3' end sequence that is specifically hybridized and complementary to the target sequence. The first tag sequence consists of a first fixed tag sequence and a first variable tag sequence, and the second tag sequence consists of a second fixed tag sequence and a second variable tag sequence. Both the first variable tag sequence and the second variable tag sequence are sequences of four bases in length composed of two dibasic tag sequences.
[0011] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is completely identical to one of the dibase tag sequences of the first fixed tag sequence and the first variable tag sequence. The remaining dibases are degenerate sequences. The first detection probes corresponding to different dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same.
[0012] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence, and the second detection probe in a second detection probe subgroup is exactly the same as another dibasic tag sequence of the first fixed tag sequence and the first variable tag sequence. The remaining dibasic sequence is a degenerate sequence. The second detection probes corresponding to different other dibasic tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0013] The third detection probe group consists of several third detection probe subgroups, wherein the length of each third detection probe is the same as that of the first tag sequence. The third detection probe in a third detection probe subgroup is exactly the same as one of the dibase tag sequences of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are degenerate sequences. The third detection probes corresponding to different dibase tag sequences are modified with different report tags, and the report tags modified by the third detection probes in the same third detection probe subgroup are the same.
[0014] The fourth detection probe group consists of several fourth detection probe subgroups, wherein the length of each fourth detection probe is the same as that of the second tag sequence. The fourth detection probe in a fourth detection probe subgroup is completely identical to another dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are degenerate sequences. The fourth detection probes corresponding to different dibase tag sequences are modified with different report tags, and the report tags modified by the fourth detection probes in the same fourth detection probe subgroup are the same.
[0015] Preferably, the first variable tag sequence consists of a first dibase tag sequence and a second dibase tag sequence, wherein the first dibase tag sequence is cw, as, ts, or gw, and the second dibase tag is cw, as, ts, or gw; the second variable tag sequence consists of a third dibase tag sequence and a fourth dibase tag sequence, wherein the third dibase tag sequence is cw, as, ts, or gw, and the fourth dibase tag is cw, as, ts, or gw.
[0016] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is exactly the same as the first dibase tag sequence in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The first detection probes corresponding to different first dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same.
[0017] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence. The second detection probes in a second detection probe subgroup are completely identical to the second dibase tag sequences in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The second detection probes corresponding to different second dibase tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0018] The third detection probe group consists of several third detection probe subgroups, wherein the length of each third detection probe is the same as that of the second tag sequence. The third detection probe in a third detection probe subgroup is exactly the same as the third dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The third detection probes corresponding to different third dibase tag sequences are modified with different report tags, and the report tags modified by the third detection probes in the same third detection probe subgroup are the same.
[0019] The fourth detection probe group consists of several fourth detection probe subgroups, wherein the length of each fourth detection probe is the same as that of the second tag sequence. The fourth detection probe in a fourth detection probe subgroup is exactly the same as the fourth dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The fourth detection probes corresponding to different fourth dibase tag sequences are modified with different report tags, and the report tags modified by the fourth detection probes in the same fourth detection probe subgroup are the same.
[0020] In a preferred embodiment of the present invention, the ring-forming probe is a dual-connection probe or a locking probe.
[0021] More preferably, the circulating probe is a dual-connector probe, and further includes a clip primer that cooperates with the dual-connector probe to form a circumference after hybridization.
[0022] More preferably, the device also includes a first anchoring primer and a second anchoring primer. The first anchoring primer is strictly complementary to the rolling circle amplification product and can be linked to the first and second detection probes after hybridization under the action of DNA polymerase. The second anchoring primer is strictly complementary to the rolling circle amplification product and can be linked to the third and fourth detection probes after hybridization under the action of DNA polymerase.
[0023] In a preferred embodiment of the present invention, the reporting mark is a fluorescent mark, a colorimetric mark, a radioactive mark, a magnetic mark, or a luminous density mark.
[0024] Another technical solution of the present invention is as follows:
[0025] An RNA in situ detection kit, comprising at least one circularizing probe for forming a rolling circle amplification product and a first to fourth set of detection probes capable of hybridizing with the rolling circle amplification product;
[0026] Each circular probe corresponds to a target sequence, and its 5' and 3' ends are specifically hybridized and complementary to the target sequence. Furthermore, it has a first tag sequence and a second tag sequence between its 5' and 3' ends. The first tag sequence is located at the 3' end of the 5' end sequence that is specifically hybridized and complementary to the target sequence, and the second tag sequence is located at the 5' end of the 3' end sequence that is specifically hybridized and complementary to the target sequence. The first tag sequence consists of a first fixed tag sequence and a first variable tag sequence, and the second tag sequence consists of a second fixed tag sequence and a second variable tag sequence. Both the first variable tag sequence and the second variable tag sequence are sequences of four bases in length composed of two dibasic tag sequences.
[0027] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is completely identical to one of the dibase tag sequences of the first fixed tag sequence and the first variable tag sequence. The remaining dibases are degenerate sequences. The first detection probes corresponding to different dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same.
[0028] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence, and the second detection probe in a second detection probe subgroup is exactly the same as another dibasic tag sequence of the first fixed tag sequence and the first variable tag sequence. The remaining dibasic sequence is a degenerate sequence. The second detection probes corresponding to different other dibasic tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0029] The third detection probe group consists of several third detection probe subgroups, wherein the length of each third detection probe is the same as that of the first tag sequence. The third detection probe in a third detection probe subgroup is exactly the same as one of the dibase tag sequences of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are degenerate sequences. The third detection probes corresponding to different dibase tag sequences are modified with different report tags, and the report tags modified by the third detection probes in the same third detection probe subgroup are the same.
[0030] The fourth detection probe group consists of several fourth detection probe subgroups, wherein the length of each fourth detection probe is the same as that of the second tag sequence. The fourth detection probe in a fourth detection probe subgroup is completely identical to another dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are degenerate sequences. The fourth detection probes corresponding to different dibase tag sequences are modified with different report tags, and the report tags modified by the fourth detection probes in the same fourth detection probe subgroup are the same.
[0031] Preferably, the first variable tag sequence consists of a first dibase tag sequence and a second dibase tag sequence, wherein the first dibase tag sequence is cw, as, ts, or gw, and the second dibase tag is cw, as, ts, or gw; the second variable tag sequence consists of a third dibase tag sequence and a fourth dibase tag sequence, wherein the third dibase tag sequence is cw, as, ts, or gw, and the fourth dibase tag is cw, as, ts, or gw.
[0032] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is exactly the same as the first dibase tag sequence in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The first detection probes corresponding to different first dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same.
[0033] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence. The second detection probes in a second detection probe subgroup are completely identical to the second dibase tag sequences in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The second detection probes corresponding to different second dibase tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0034] The third detection probe group consists of several third detection probe subgroups, wherein the length of each third detection probe is the same as that of the second tag sequence. The third detection probe in a third detection probe subgroup is exactly the same as the third dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The third detection probes corresponding to different third dibase tag sequences are modified with different report tags, and the report tags modified by the third detection probes in the same third detection probe subgroup are the same.
[0035] The fourth detection probe group consists of several fourth detection probe subgroups, wherein the length of each fourth detection probe is the same as that of the second tag sequence. The fourth detection probe in a fourth detection probe subgroup is exactly the same as the fourth dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The fourth detection probes corresponding to different fourth dibase tag sequences are modified with different report tags, and the report tags modified by the fourth detection probes in the same fourth detection probe subgroup are the same.
[0036] In a preferred embodiment of the present invention, the ring-forming probe is a dual-connection probe or a locking probe.
[0037] More preferably, the circulating probe is a dual-connector probe, and further includes a clip primer that cooperates with the dual-connector probe to form a circumference after hybridization.
[0038] More preferably, the device also includes a first anchoring primer and a second anchoring primer. The first anchoring primer is strictly complementary to the rolling circle amplification product and can be linked to the first and second detection probes after hybridization under the action of DNA polymerase. The second anchoring primer is strictly complementary to the rolling circle amplification product and can be linked to the third and fourth detection probes after hybridization under the action of DNA polymerase.
[0039] In a preferred embodiment of the present invention, the reporting mark is a fluorescent mark, a colorimetric mark, a radioactive mark, a magnetic mark, or a luminous density mark.
[0040] Another technical solution of the present invention is as follows:
[0041] The application of probe primer sets in in situ RNA detection for non-diagnostic and therapeutic purposes, wherein the samples for in situ RNA detection are cells cultured in vitro and cells in tissue sections, and the probe primer set includes at least one circular probe for forming rolling circle amplification products and a first to fourth detection probe set capable of hybridizing with the rolling circle amplification products.
[0042] Each circular probe corresponds to a target sequence, and its 5' and 3' ends are specifically hybridized and complementary to the target sequence. Furthermore, it has a first tag sequence and a second tag sequence between its 5' and 3' ends. The first tag sequence is located at the 3' end of the 5' end sequence that is specifically hybridized and complementary to the target sequence, and the second tag sequence is located at the 5' end of the 3' end sequence that is specifically hybridized and complementary to the target sequence. The first tag sequence consists of a first fixed tag sequence and a first variable tag sequence, and the second tag sequence consists of a second fixed tag sequence and a second variable tag sequence. Both the first variable tag sequence and the second variable tag sequence are sequences of four bases in length composed of two dibasic tag sequences.
[0043] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is completely identical to one of the dibase tag sequences of the first fixed tag sequence and the first variable tag sequence. The remaining dibases are degenerate sequences. The first detection probes corresponding to different dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same.
[0044] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence, and the second detection probe in a second detection probe subgroup is exactly the same as another dibasic tag sequence of the first fixed tag sequence and the first variable tag sequence. The remaining dibasic sequence is a degenerate sequence. The second detection probes corresponding to different other dibasic tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0045] The third detection probe group consists of several third detection probe subgroups, wherein the length of each third detection probe is the same as that of the first tag sequence. The third detection probe in a third detection probe subgroup is exactly the same as one of the dibase tag sequences of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are degenerate sequences. The third detection probes corresponding to different dibase tag sequences are modified with different report tags, and the report tags modified by the third detection probes in the same third detection probe subgroup are the same.
[0046] The fourth detection probe group consists of several fourth detection probe subgroups, wherein the length of each fourth detection probe is the same as that of the second tag sequence. The fourth detection probe in a fourth detection probe subgroup is completely identical to another dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are degenerate sequences. The fourth detection probes corresponding to different dibase tag sequences are modified with different report tags, and the report tags modified by the fourth detection probes in the same fourth detection probe subgroup are the same.
[0047] Preferably, the first variable tag sequence consists of a first dibase tag sequence and a second dibase tag sequence, wherein the first dibase tag sequence is cw, as, ts, or gw, and the second dibase tag is cw, as, ts, or gw; the second variable tag sequence consists of a third dibase tag sequence and a fourth dibase tag sequence, wherein the third dibase tag sequence is cw, as, ts, or gw, and the fourth dibase tag is cw, as, ts, or gw.
[0048] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is exactly the same as the first dibase tag sequence in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The first detection probes corresponding to different first dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same.
[0049] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence. The second detection probes in a second detection probe subgroup are completely identical to the second dibase tag sequences in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The second detection probes corresponding to different second dibase tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0050] The third detection probe group consists of several third detection probe subgroups, wherein the length of each third detection probe is the same as that of the second tag sequence. The third detection probe in a third detection probe subgroup is exactly the same as the third dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The third detection probes corresponding to different third dibase tag sequences are modified with different report tags, and the report tags modified by the third detection probes in the same third detection probe subgroup are the same.
[0051] The fourth detection probe group consists of several fourth detection probe subgroups, wherein the length of each fourth detection probe is the same as that of the second tag sequence. The fourth detection probe in a fourth detection probe subgroup is exactly the same as the fourth dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The fourth detection probes corresponding to different fourth dibase tag sequences are modified with different report tags, and the report tags modified by the fourth detection probes in the same fourth detection probe subgroup are the same.
[0052] In a preferred embodiment of the present invention, the ring-forming probe is a dual-connection probe or a locking probe.
[0053] More preferably, the circulating probe is a dual-connector probe, and further includes a clip primer that cooperates with the dual-connector probe to form a circumference after hybridization.
[0054] More preferably, the device also includes a first anchoring primer and a second anchoring primer. The first anchoring primer is strictly complementary to the rolling circle amplification product and can be linked to the first and second detection probes after hybridization under the action of DNA polymerase. The second anchoring primer is strictly complementary to the rolling circle amplification product and can be linked to the third and fourth detection probes after hybridization under the action of DNA polymerase.
[0055] In a preferred embodiment of the present invention, the reporting mark is a fluorescent mark, a colorimetric mark, a radioactive mark, a magnetic mark, or a luminous density mark.
[0056] Another technical solution of the present invention is as follows:
[0057] A method for in situ detection of RNA for non-diagnostic and therapeutic purposes, comprising the following steps:
[0058] (1) Design at least one loop probe:
[0059] Each circular probe corresponds to a target sequence, and its 5' and 3' ends are specifically hybridized and complementary to the target sequence. Furthermore, it has a first tag sequence and a second tag sequence between its 5' and 3' ends. The first tag sequence is located at the 3' end of the 5' end sequence that is specifically hybridized and complementary to the target sequence, and the second tag sequence is located at the 5' end of the 3' end sequence that is specifically hybridized and complementary to the target sequence. The first tag sequence consists of a first fixed tag sequence and a first variable tag sequence, and the second tag sequence consists of a second fixed tag sequence and a second variable tag sequence. Both the first variable tag sequence and the second variable tag sequence are sequences of four bases in length composed of two dibasic tag sequences.
[0060] (2) Design the first to fourth detection probe groups:
[0061] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is completely identical to one of the dibase tag sequences of the first fixed tag sequence and the first variable tag sequence. The remaining dibases are degenerate sequences. The first detection probes corresponding to different dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same.
[0062] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence, and the second detection probe in a second detection probe subgroup is exactly the same as another dibasic tag sequence of the first fixed tag sequence and the first variable tag sequence. The remaining dibasic sequence is a degenerate sequence. The second detection probes corresponding to different other dibasic tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0063] The third detection probe group consists of several third detection probe subgroups, wherein the length of each third detection probe is the same as that of the first tag sequence. The third detection probe in a third detection probe subgroup is exactly the same as one of the dibase tag sequences of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are degenerate sequences. The third detection probes corresponding to different dibase tag sequences are modified with different report tags, and the report tags modified by the third detection probes in the same third detection probe subgroup are the same.
[0064] The fourth detection probe group consists of several fourth detection probe subgroups, wherein the length of each fourth detection probe is the same as that of the second tag sequence. The fourth detection probe in a fourth detection probe subgroup is completely identical to another dibasic tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibasic sequence is a degenerate sequence. The fourth detection probes corresponding to different dibasic tag sequences are modified with different report tags, and the report tags modified by the fourth detection probes in the same fourth detection probe subgroup are the same.
[0065] (3) After the above-mentioned at least one circular probe is specifically bound to at least one target sequence in the sample to be tested, the 3' end and 5' end of the at least one circular probe are adjacent to each other. They are then connected by DNA ligase to form at least one circular template, and then rolling circle amplification is performed to obtain at least one rolling circle amplification product.
[0066] (4) Hybridize the at least one rolling circle amplification product with the first detection probe set for detection to obtain a first signal;
[0067] (5) Remove the first signal and then hybridize it with the second detection probe group to obtain the second signal;
[0068] (6) Remove the second signal and then hybridize it with the second detection probe group for detection to obtain the third signal;
[0069] (7) Remove the third signal and then hybridize it with the second detection probe group for detection to obtain the fourth signal;
[0070] (8) Based on the permutation and combination of the first to fourth signals above, at least one signal code corresponding to the above at least one target sequence is obtained.
[0071] Preferably, the first variable tag sequence consists of a first dibase tag sequence and a second dibase tag sequence, wherein the first dibase tag sequence is cw, as, ts, or gw, and the second dibase tag is cw, as, ts, or gw; the second variable tag sequence consists of a third dibase tag sequence and a fourth dibase tag sequence, wherein the third dibase tag sequence is cw, as, ts, or gw, and the fourth dibase tag is cw, as, ts, or gw.
[0072] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is exactly the same as the first dibase tag sequence in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The first detection probes corresponding to different first dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same.
[0073] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence. The second detection probes in a second detection probe subgroup are completely identical to the second dibase tag sequences in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The second detection probes corresponding to different second dibase tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0074] The third detection probe group consists of several third detection probe subgroups, wherein the length of each third detection probe is the same as that of the second tag sequence. The third detection probe in a third detection probe subgroup is exactly the same as the third dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The third detection probes corresponding to different third dibase tag sequences are modified with different report tags, and the report tags modified by the third detection probes in the same third detection probe subgroup are the same.
[0075] The fourth detection probe group consists of several fourth detection probe subgroups, wherein the length of each fourth detection probe is the same as that of the second tag sequence. The fourth detection probe in a fourth detection probe subgroup is exactly the same as the fourth dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The fourth detection probes corresponding to different fourth dibase tag sequences are modified with different report tags, and the report tags modified by the fourth detection probes in the same fourth detection probe subgroup are the same.
[0076] In a preferred embodiment of the present invention, the ring-forming probe is a dual-connection probe or a locking probe.
[0077] More preferably, the circular probe is a dual-linked probe, and step (3) is as follows: after the above-mentioned at least one circular probe specifically binds to at least one target sequence in the sample to be tested, the 3' end and 5' end of the at least one circular probe are made to be adjacent to each other by adding a splint sequence, and then the probe is linked by DNA ligase to form at least one circular template, and then rolling circle amplification is performed to obtain at least one rolling circle amplification product.
[0078] More preferably, in steps (4) and (5), a first anchoring primer is added for hybridization. The first anchoring primer is strictly complementary to the rolling circle amplification product and is linked to the first and second detection probes after hybridization under the action of DNA polymerase.
[0079] More preferably, in steps (6) and (7), a second anchoring primer is added for hybridization. This second anchoring primer is strictly complementary to the rolling circle amplification product and is linked to the third and fourth detection probes after hybridization under the action of DNA polymerase.
[0080] In a preferred embodiment of the present invention, the reporting mark is a fluorescent mark, a colorimetric mark, a radioactive mark, a magnetic mark, or a luminous density mark.
[0081] The beneficial effects of the present invention are: the present invention can improve the connection efficiency of the detection probe and the anchoring primer, enhance the fluorescence signal, preferably fix the GC content of the variable tag sequence at 50%, and also have better specificity, and can realize multiplex RNA in situ detection. Attached Figure Description
[0082] Figure 1 This is a schematic diagram of the reaction principle of the probe decoding process of the present invention.
[0083] Figure 2 This is a schematic diagram of an embodiment of the present invention.
[0084] Figure 3 The figure shows the experimental results of Example 1 of the present invention. Scale bar: 100μm.
[0085] Figure 4 The figure shows the experimental results of Example 2 of the present invention. Scale bar: 10μm.
[0086] Figure 5 The figure shows the experimental results of Example 3 of the present invention. Scale bar: 10μm.
[0087] Figure 6 This is a comparison diagram of the principles of dibasic encoding and tribasic encoding in Example 4 of the present invention.
[0088] Figure 7 The figure shows the experimental results of Example 4 of the present invention. Scale bar: 50 μm.
[0089] Figure 8 This is a frozen section image of a mouse brain coronal section, as shown in Example 5 of the present invention, where the dibase encoding is applied. Detailed Implementation
[0090] The technical solution of the present invention will be further explained and described below with reference to specific embodiments and accompanying drawings.
[0091] The following embodiments employ dual-connection probes.
[0092] The explanations for single-base coding, two-base coding, and three-base coding are as follows:
[0093] (1) In single-base coding:
[0094] Each circular probe corresponds to a target sequence, with its 5' and 3' ends specifically hybridizing and complementary to the target sequence. It also has a first tag sequence and a second tag sequence between its 5' and 3' ends. The first tag sequence is located at the 3' end of the sequence specifically hybridizing and complementary to the target sequence at its 5' end, and the second tag sequence is located at the 5' end of the sequence specifically hybridizing and complementary to the target sequence at its 3' end. The first tag sequence consists of a first fixed tag sequence and a first variable tag sequence, and the second tag sequence consists of a second fixed tag sequence and a second variable tag sequence. Both the first variable tag sequence and the second variable tag sequence are four-base sequences. The ends of the first variable tag sequence and the second variable tag sequence far from the end of the first fixed tag sequence are both two-base sequences composed of two single-base tag sequences.
[0095] Taking the first detection probe group and the first detection probe group as examples:
[0096] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence, and the first detection probe in a first detection probe subgroup is exactly the same as one of the single-base tag sequences of the first fixed tag sequence and the first variable tag sequence. The first detection probes corresponding to different single-base tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same.
[0097] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence. The second detection probe in a second detection probe subgroup is completely identical to another single-base tag sequence of the first fixed tag sequence and the first variable tag sequence. The second detection probes corresponding to different other single-base tag sequences are modified with different reporting tags, and the reporting tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0098] (2) In dibasic coding:
[0099] Each circular probe corresponds to a target sequence, and its 5' and 3' ends are specifically hybridized and complementary to the target sequence. Furthermore, it has a first tag sequence and a second tag sequence between its 5' and 3' ends. The first tag sequence is located at the 3' end of the 5' end sequence that is specifically hybridized and complementary to the target sequence, and the second tag sequence is located at the 5' end of the 3' end sequence that is specifically hybridized and complementary to the target sequence. The first tag sequence consists of a first fixed tag sequence and a first variable tag sequence, and the second tag sequence consists of a second fixed tag sequence and a second variable tag sequence. Both the first variable tag sequence and the second variable tag sequence are sequences of four bases in length composed of two dibasic tag sequences.
[0100] Taking the first detection probe group and the second detection probe group as examples:
[0101] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is exactly the same as one of the dibasic tag sequences of the first fixed tag sequence and the first variable tag sequence. The remaining dibasic sequences are degenerate sequences. The first detection probes corresponding to different dibasic tag sequences are modified with different reporting tags, and the reporting tags modified by the first detection probes in the same first detection probe subgroup are the same.
[0102] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence. The second detection probe in a second detection probe subgroup is completely identical to another dibase tag sequence of the first fixed tag sequence and the first variable tag sequence. The remaining dibases are degenerate sequences. The second detection probes corresponding to different dibase tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0103] Preferably, the first variable tag sequence is composed of a first dibase tag sequence and a second dibase tag sequence, wherein the first dibase tag sequence is cw, as, ts or gw, the second dibase tag is cw, as, ts or gw, the second variable tag sequence is composed of a third dibase tag sequence and a fourth dibase tag sequence, wherein the third dibase tag sequence is cw, as, ts or gw, the fourth dibase tag is cw, as, ts or gw, and w represents a / t and s represents g / c.
[0104] Taking the first detection probe group and the second detection probe group as examples:
[0105] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is exactly the same as the first dibase tag sequence in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The first detection probes corresponding to different first dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same.
[0106] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence. The second detection probes in a second detection probe subgroup are completely identical to the second dibase tag sequences in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The second detection probes corresponding to different second dibase tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0107] The third and fourth detection probe groups, and the corresponding third and fourth dibasic tag sequences of the second variable tag sequence are set according to the above:
[0108] More specifically in the embodiments, the first variable tag sequence is composed of a first dibase tag sequence and a second dibase tag sequence, wherein the first dibase tag sequence is ct, ag, tc, or ga, and the second dibase tag is ct, ag, tc, or ga; the second variable tag sequence is composed of a third dibase tag sequence and a fourth dibase tag sequence, wherein the third dibase tag sequence is ct, ag, tc, or ga, and the fourth dibase tag is ct, ag, tc, or ga.
[0109] Furthermore, taking the first detection probe group and the second detection probe group as examples:
[0110] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is exactly the same as the first dibase tag sequence in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are ct, ag, tc or ga. The first detection probes corresponding to different first dibase tag sequences are modified with different report tags, and the first detection probes in the same first detection probe subgroup are modified with the same report tags.
[0111] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence. The second detection probes in a second detection probe subgroup are completely identical to the second dibase tag sequences in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are ct, ag, tc or ga. The second detection probes corresponding to different second dibase tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0112] The third and fourth detection probe groups, and the corresponding third and fourth dibasic tag sequences of the second variable tag sequence are set according to the above:
[0113] (3) In tribase coding:
[0114] Each circular probe corresponds to a target sequence, and its 5' and 3' ends are specifically hybridized and complementary to the target sequence. Furthermore, it has a first tag sequence and a second tag sequence between its 5' and 3' ends. The first tag sequence is located at the 3' end of the 5' end sequence that is specifically hybridized and complementary to the target sequence, and the second tag sequence is located at the 5' end of the 3' end sequence that is specifically hybridized and complementary to the target sequence. The first tag sequence consists of a first fixed tag sequence and a first variable tag sequence, and the second tag sequence consists of a second fixed tag sequence and a second variable tag sequence. Both the first variable tag sequence and the second variable tag sequence are six-base sequences composed of two- or three-base tag sequences.
[0115] Taking the first detection probe group and the second detection probe group as examples:
[0116] The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is completely identical to one of the three-base tag sequences of the first fixed tag sequence and the first variable tag sequence. The first detection probes corresponding to different three-base tag sequences are modified with different reporting tags, and the reporting tags modified by the first detection probes in the same first detection probe subgroup are the same.
[0117] The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence, and the second detection probe in a second detection probe subgroup is exactly the same as another three-base tag sequence of the first fixed tag sequence and the first variable tag sequence. The second detection probes corresponding to different other three-base tag sequences are modified with different reporting tags, and the reporting tags modified by the second detection probes in the same second detection probe subgroup are the same.
[0118] Example 1: Comparison of single-base coding sequencing and dual-base coding sequencing on MCF-7 cell slices.
[0119] (I) Cell Culture and Fixation:
[0120] Human breast adenocarcinoma cells MCF-7 were cultured in RPMI 1640 (containing 10% FBS) for 24-48 h (human breast cancer cells were cultured in DMEM (containing 10% FBS) for 24-48 h), then treated with trypsin to form a cell suspension, and seeded onto sterile glass slides with poly-L-lysine on the surface, and recultured for 12-24 h. After washing with DEPC-PBS (3×3 min), the cells were fixed with 4% PFA prepared in DEPC-PBS at room temperature for 30 min; after washing twice more with DEPC-PBS, the cells were dehydrated by gradient treatment with 70%, 85%, and 100% ethanol for 5 min each. The cells were then air-dried.
[0121] (II) Pretreatment of cell samples
[0122] Cell membranes were permeabilized and perforated. 0.1M HCl was added to the sample and incubated at room temperature for 5 min. The sample was washed twice with DEPC-PBS containing 0.1% (v / v) Tween 20, followed by two more washes with DEPC-PBS.
[0123] (III) In-situ nucleic acid testing, which includes the following steps:
[0124] (1) Recognition hybridization between the probe and the target gene:
[0125] Add a hybridization reaction mixture containing 10% formamide, 6×SSC, and 0.1 μM probe to the sample and incubate at 37°C for 3–4 h to allow the probe to directly and specifically hybridize and complement the mRNA molecule in situ. After the reaction, wash three times with DEPC-PBS-Tween 20 for 3 min each time, followed by three more washes with DEPC-PBS. The 5' ends of the two double-linked probes that hybridize with the target gene each have a recognition sequence specifically complementary to the target sequence.
[0126] For comparison, the sequences of the single-base-encoding sequencing double-linked probes (starting with SINGLE) and the double-base-encoding double-linked probes of the present invention (starting with DOUBLE) are shown in Table 1 below (the sequences are numbered from top to bottom as SEQ ID NO. 0001 to SEQ ID NO. 0072).
[0127] Table 1
[0128]
[0129]
[0130]
[0131] (2) The above-mentioned dual-connection probe is used for the first step of connection:
[0132] After washing three times with DEPC-PBS-Tween 20, 50 μL of ligation reaction mixture containing 25% glycerol, 0.2 μg / μL BSA, 1×SplintR buffer (NEB), 0.1 U / μL SplintR ligase (NEB), and 1 U / μL RiboLock RNase inhibitor (Thermo) was added to the sample, and the mixture was incubated at 37°C for 30 min.
[0133] (3) Clamping primer recognition hybridization:
[0134] After washing three times with DEPC-PBS-Tween 20, 50 μL of hybridization mixture containing 6x SSC, 10% formamide, and 0.5 μM splice primers was added to the sample, and the mixture was incubated at 30 °C for 30 min. The sequence of the splice primers was: 5'-ggctccactaaatagacgca-3' (SEQ ID NO. 0073), Reverse primer.
[0135] (4) Probe closure and rolling circle amplification:
[0136] After washing three times with DEPC-PBS-Tween 20, add 50 μL of hybridization mixture containing 5% glycerol, 0.2 μg / μL BSA, 1×Phi29 polymerase buffer (Thermo), 1 mM dNTPs, 0.1 U / μL LT4 DNA ligase (Thermo), and 1 u / μL Phi29 DNA polymerase (Thermo) to the sample. Incubate at 37°C for 3 h and transfer to 30°C for overnight reaction.
[0137] (iv) Four rounds of in situ RNA sequencing, the specific principle of which is as follows: Figure 1 and Figure 2 As shown, the details are as follows:
[0138] (1) Anchor primer hybridization and fluorescent probe ligation
[0139] Add 50 μL of sequencing reaction mixture containing 0.2 μM specific primers, 0.2 μM each fluorescent probe, 1×T4 DNA ligase buffer, 1 mM ATP, and 0.1 u / μL T4 DNA ligase to the sample, and incubate at 30 °C for 45 min. Wash three times with DEPC-PBS-Tween 20 and air dry. Finally, add GoldAntifade Mountan mounting medium (Fermantas) containing 0.5 μg / mL DAPI and incubate at room temperature for 10 min before fluorescence microscopy detection and photography.
[0140] (2) Elution of fluorescent probes
[0141] After imaging the slides, incubate them in 5x SSC or PBS, then wash away the coverslip and mounting medium. Next, add elution buffer (80% formamide, 0.1% Triton-X) to the reaction zone and incubate at 37°C for 10 min, repeating this process 6 times. Finally, wash the samples three times with DEPC-PBS-Tween 20.
[0142] (3) Repeat steps (1) and (2) three more times. The above anchoring primer and fluorescent probe sequences are shown in Table 2 below (the sequences are numbered from top to bottom as SEQ ID NO.0074 to SEQ ID NO.0107, where SEQ ID NO.0074-0075 correspond to the anchoring primer, SEQ ID NO.0076-0091 correspond to the double-base encoded dual-linked probe of the present invention, and correspond to the first to fourth detection probe groups in sequence; SEQ ID NO.0092-0107 correspond to the single-base encoded sequencing dual-linked probe used as a comparison):
[0143] Table 2
[0144]
[0145]
[0146] Experimental results are as follows Figure 3 As shown, A represents the results of four rounds of sequencing for dual-base coding, B represents the results of four rounds of sequencing for single-base coding, and C compares the cumulative signal intensity of the top 30% of signal points for both dual-base and single-base coding. Numbers 1 to 4 represent the intensity comparison from the first to the fourth round of detection. FAM, TXR, CY3, and CY5 represent different channels. The intensity on the left represents the signal intensity of dual-base coding, and the intensity on the right represents that of single-base coding. It can be seen that the overall intensity of dual-base coding is significantly higher than that of single-base coding.
[0147] Example 2: In situ detection of lncRNA NEAT1 in MCF-7 cell smear assay to examine the specificity differences between single-base-coding and double-base-coding probes.
[0148] (I) Culture and fixation of MCF-7 cells:
[0149] Human breast adenocarcinoma cells MCF-7 were cultured in DMEM (containing 10% FBS) for 24-48 hours, then treated with trypsin to form suspension cells, and seeded onto sterile glass slides with poly-L-lysine on the surface, and cultured again for 12-24 hours.
[0150] Wash with DEPC-PBS for 3 x 3 min; fix with 4% PFA prepared with DEPC-PBS at room temperature for 30 min; wash twice more with DEPC-PBS, then dehydrate with gradient ethanol (70%, 85%, 100%) for 5 min each, air dry, and store at -80℃ for later use.
[0151] (II) Pretreatment of MCF-7 cell smears:
[0152] Remove the cell slide from -80℃ and thaw at room temperature for no more than 10 minutes. Add 1 ml of 0.1 M HCl to the slide to cover the tissue. After 5 minutes, discard the liquid on the slide. Wash the slide twice with PBS for 2 minutes each time. After the slide dries, draw reaction cells in the selected area using an immunohistochemistry pen. After drawing the reaction cells, rinse three times with DEPC-PBS-Tween 20.
[0153] (III) In situ RNA detection:
[0154] (1) Double-connected probe hybridization:
[0155] Add 50 μL of hybridization solution containing 6x SSC, 10% formamide, and 0.1 μM of each double-linked probe to a glass slide and incubate at 37°C for 2–3 h to allow each double-linked probe pair to fully hybridize with the target sequence of the corresponding gene. The double-linked probe sequences are shown in Table 3 below (from top to bottom as SEQ ID NO. 0108-0115):
[0156] Table 3
[0157]
[0158]
[0159] (2) The above-mentioned dual-connection probe is used for the first step of connection:
[0160] After washing three times with DEPC-PBS-Tween 20, 50 μL of ligation reaction mixture containing 25% glycerol, 0.2 μg / μL BSA, 1×SplintR buffer (NEB), 0.1 U / μL LplintR ligase (NEB), and 1 U / μL RiboLock RNase inhibitor (Thermo) was added to the sample and incubated at 37°C for 30 min.
[0161] (3) Clamping primer recognition hybridization:
[0162] After washing three times with DEPC-PBS-Tween 20, 50 μL of hybridization mixture containing 6x SSC, 10% formamide, and 0.5 μM splice primers was added to the sample, and the mixture was incubated at 30 °C for 30 min. The sequence of the splice primers was: 5'-ggctccactaaatagacgca-3' (SEQ ID NO. 0073), Reverse primer.
[0163] (4) Probe closure and rolling circle amplification:
[0164] After washing three times with DEPC-PBS-Tween 20, add 50 μL of hybridization mixture containing 5% glycerol, 0.2 μg / μL BSA, 1×Phi29 polymerase buffer (Thermo), 1 mM dNTPs, 0.1 U / μL LT4 DNA ligase (Thermo), and 1 u / μL Phi29 DNA polymerase (Thermo) to the sample. Incubate at 37°C for 3 h and transfer to 30°C for overnight reaction.
[0165] (5) Third round of anchoring primer hybridization and fluorescent probe ligation
[0166] Add 50 μL of sequencing reaction mixture containing 0.2 μM anchoring primers, 0.2 μM of each fluorescent probe, 1×T4 DNA ligase buffer, 1 mM ATP, and 0.1 u / μL T4 DNA ligase to the sample, and incubate at 30 °C for 45 min. Wash three times with DEPC-PBS-Tween 20 and air dry. Finally, add GoldAntifade Mountan mounting medium (Fermantas) containing 0.5 μg / mL DAPI and incubate at room temperature for 10 min before fluorescence microscopy detection and photography. The sequences of the anchoring primers and fluorescent probes are shown in Table 2 of Example 1.
[0167] The results are as follows Figure 4As shown, A represents the third round of in-situ detection results for single-base encoded probes DLP-NEAT1-L1 and DLP-NEAT1-R1, where 1: MCF-7 cell nucleus, 2: NEAT1 signal in MCF-7, and 3: erroneous detection signal in another fluorescence channel; B represents the third round of in-situ detection results for single-base encoded probes DLP-NEAT1-L2 and DLP-NEAT1-R2, where 1: MCF-7 cell nucleus, 2: NEAT1 signal point in MCF-7, and 3: erroneous detection signal in another fluorescence channel; C represents the third round of in-situ detection results for single-base encoded probes DLP-NEAT1-L3 and DLP-NEAT1-R3, where 1: MCF-7 cell nucleus, 2: NEAT1 signal in MCF-7, and 3: erroneous detection signal in another fluorescence channel. D shows the results of the third round of in situ detection using the dual-base encoded probes DLP-NEAT1-L-1 and DLP-NEAT1-R-1. 1: MCF-7 cell nucleus; 2: NEAT1 signal in MCF-7 cells; 3: no detection signal in other fluorescence channels. E shows the statistical results of in situ detection using the three single-base encoded probes and dual-base encoded probes. When performing in situ RNA detection in MCF-7 cell slides, single-base encoding can lead to mismatches in some detection probes. Dual-base encoding can effectively reduce mismatches and avoid erroneous signals.
[0168] Example 3: In situ detection of lncRNA NEAT1 using paraffin-embedded breast cancer tissue sections as experimental samples to investigate the specificity differences between single-base-coding probes and dual-base-coding probes.
[0169] (a) Pretreatment of paraffin tissue:
[0170] Paraffin-embedded tissue sections were baked in an oven at 65°C for 30 minutes. Immediately after baking, they were immersed in a staining jar containing xylene for 10 minutes, then the xylene was replaced and the sections were immersed for another 10 minutes. The slides were then removed from a second staining jar containing xylene and immediately immersed in a staining jar containing anhydrous ethanol for 2 minutes, then the anhydrous ethanol was replaced and the sections were immersed for another 2 minutes. After removal, the slides were immediately immersed in a staining jar containing 95% ethanol for 2 minutes, then the 95% ethanol was replaced and the sections were immersed for another 2 minutes. After removal, the slides were immediately immersed in a staining jar containing 85% ethanol for 2 minutes, then the 85% ethanol was replaced and the sections were immersed for another 2 minutes. After removal, the slides were immediately immersed in a staining jar containing 70% ethanol for 2 minutes, then the 70% ethanol was replaced and the sections were immersed for another 2 minutes.
[0171] Remove the slides from the ethanol solution and immerse them in DEPC-H2O for 5 min, then in DEPC-PBS for 2 min to wash away residual ethanol. Add 4% PFA dissolved in DEPC-PBS to the slides, completely covering the tissue sample. Incubate at room temperature for 10 min, then wash with DEPC-PBS. Preheat 30 mL of 0.1 M HCl to 37 °C in a staining jar, add 30 μL of 0.1 mg / mL pepsin, mix well, and immediately immerse the slides in the solution. Incubate at 37 °C for 30 min. Remove the slides and immerse them in DEPC-H2O for 5 min, then in DEPC-PBS for 2 min to wash. Dehydrate the slides using a gradient of ethanol (70%, 85%, and 100%) for 2 min each, then air dry. Finally, wash three times with DEPC-PBS-Tween 20 before use.
[0172] (II) In-situ nucleic acid testing:
[0173] (1) Double-connected probe hybridization:
[0174] Add 50 μL of hybridization mixture containing 6x SSC, 10% formamide, and 0.1 μM of each dual-linked probe to a glass slide and incubate at 37°C for 2-3 h to allow each recognition probe pair to fully hybridize with the target sequence of the corresponding gene. The linker probe sequences are shown in Table 3(1) of Example 2:
[0175] (2) The above-mentioned dual-connection probe is used for the first step of connection:
[0176] After washing three times with DEPC-PBS-Tween 20, 50 μL of ligation reaction mixture containing 25% glycerol, 0.2 μg / μL BSA, 1×SplintR buffer (NEB), 0.1 U / μL SplintR ligase (NEB), and 1 U / μL RiboLock RNase inhibitor (Thermo) was added to the sample and incubated at 37°C for 30 min.
[0177] (3) Clamping primer recognition hybridization:
[0178] After washing three times with DEPC-PBS-Tween 20, 50 μL of hybridization mixture containing 6x SSC, 10% formamide, and 0.5 μM splice primers was added to the sample, and the mixture was incubated at 30 °C for 30 min. The sequence of the splice primers was: 5'-ggctccactaaatagacgca-3' (SEQ ID NO. 0073), Reverse primer.
[0179] (4) Probe closure and rolling circle amplification:
[0180] After washing three times with DEPC-PBS-Tween 20, add 50 μL of hybridization mixture containing 5% glycerol, 0.2 μg / μL BSA, 1×Phi29 polymerase buffer (Thermo), 1 mM dNTPs, 0.1 U / μL LT4 DNA ligase (Thermo), and 1 u / μL Phi29 DNA polymerase (Thermo) to the sample. Incubate at 37°C for 3 h and transfer to 30°C for overnight reaction.
[0181] (5) Third round of anchoring primer hybridization and fluorescent probe ligation
[0182] Add 50 μL of sequencing reaction mixture containing 0.2 μM anchoring primers, 0.2 μM of each fluorescent probe, 1×T4 DNA ligase buffer, 1 mM ATP, and 0.1 u / μL T4 DNA ligase to the sample, and incubate at 30 °C for 45 min. Wash three times with DEPC-PBS-Tween 20 and air dry. Finally, add GoldAntifade Mountan mounting medium (Fermantas) containing 0.5 μg / mLDAPI and incubate at room temperature for 10 min before fluorescence microscopy detection and imaging. The sequences of the anchoring primers and fluorescent probes are shown in Table 2 of Example 1.
[0183] Experimental results are as follows Figure 5 As shown, the results of the third round of in situ detection of single-base encoded probes and dual-base encoded probes in breast cancer tissue are as follows: A shows the results of the third round of in situ detection of single-base encoded probes DLP-NEAT1-L1 and DLP-NEAT1-R1, where 1 represents breast cancer tissue, 2 represents the NEAT1 signal in breast cancer tissue, and 3 represents the presence of a false detection signal in another fluorescence channel. B shows the results of the third round of in situ detection of dual-base encoded probes DLP-NEAT1-L-1 and DLP-NEAT1-R-1, where 1 represents breast cancer tissue, 2 represents the NEAT1 signal in breast cancer tissue, and 3 represents the absence of a detection signal in other fluorescence channels. C shows the statistical results of in situ detection of single-base encoded probes and dual-base encoded probes. The figures show that when performing in situ RNA detection in paraffin-embedded tissue sections, the single-base encoding method can lead to mismatches in some detection probes, while the dual-base encoding method can effectively reduce the occurrence of mismatches in some detection probes and avoid the generation of false signals.
[0184] Example 4: Comparison of two-base coding sequencing and three-base coding sequencing on MCF-7 cell slices.
[0185] The principles of di-base encoding and tri-base encoding in this invention are as follows: Figure 6 The specific process is shown below.
[0186] (I) Culture and fixation of MCF-7 cells:
[0187] Human breast adenocarcinoma cells MCF-7 were cultured in DMEM (containing 10% FBS) for 24-48 hours, then treated with trypsin to form suspension cells, and seeded onto sterile glass slides with poly-L-lysine on the surface, and cultured again for 12-24 hours. The cells were then washed with DEPC-PBS (3×3 min); fixed with 4% PFA prepared in DEPC-PBS at room temperature for 30 min; washed twice more with DEPC-PBS; and then dehydrated with a gradient of 70%, 85%, and 100% ethanol for 5 min each, air-dried, and stored at -80℃ for later use.
[0188] (II) Pretreatment of MCF-7 cell smears:
[0189] Remove the cell slide from -80℃ and thaw at room temperature for no more than 10 minutes. Add 1 ml of 0.1 M HCl to the slide to cover the tissue. After 5 minutes, discard the liquid on the slide. Wash the slide twice with PBS for 2 minutes each time. After the slide dries, draw reaction cells in the selected area using an immunohistochemistry pen. After drawing the reaction cells, rinse three times with DEPC-PBS-Tween 20.
[0190] (III) In situ RNA detection:
[0191] (1) Double-connected probe hybridization:
[0192] Add 50 μL of hybridization mixture containing 6x SSC, 10% formamide and 0.05 μM of each dual-linked probe to a glass slide and incubate at 37°C for 2-3 h to allow each recognition probe pair to fully hybridize with the target sequence of the corresponding gene.
[0193] For comparison, the sequences of the tribase-encoding sequencing double-linked probe (starting with TRIPLE) and the double-base-encoding double-linked probe of the present invention (starting with DOUBLE) are shown in Table 4 below (the sequences are numbered from top to bottom as SEQ ID NO. 0116 to SEQ ID NO. 0183):
[0194] Table 4
[0195]
[0196]
[0197]
[0198]
[0199] (2) The above-mentioned dual-connection probe is used for the first step of connection:
[0200] After washing three times with DEPC-PBS-Tween 20, 50 μL of ligation reaction mixture containing 25% glycerol, 0.2 μg / μL BSA, 1×SplintR buffer (NEB), 0.1 U / μL SplintR ligase (NEB), and 1 U / μL RiboLock RNase inhibitor (Thermo) was added to the sample and incubated at 37°C for 30 min.
[0201] (3) Clamping primer recognition hybridization:
[0202] After washing three times with DEPC-PBS-Tween 20, 50 μL of hybridization mixture containing 6x SSC, 10% formamide, and 0.5 μM splice primers was added to the sample, and the mixture was incubated at 30 °C for 30 min. The sequence of the splice primers was: 5'-ggctccactaaatagacgca-3' (SEQ ID NO. 0073), Reverse primer.
[0203] (4) Probe closure and rolling circle amplification:
[0204] After washing three times with DEPC-PBS-Tween 20, add 50 μL of hybridization mixture containing 5% glycerol, 0.2 μg / μL BSA, 1×Phi29 polymerase buffer (Thermo), 1 mM dNTPs, 0.1 U / μL LT4 DNA ligase (Thermo), and 1 u / μL Phi29 DNA polymerase (Thermo) to the sample. Incubate at 37°C for 3 h and transfer to 30°C for overnight reaction.
[0205] (5) Anchor primer hybridization and fluorescent probe ligation
[0206] Add 50 μL of sequencing reaction mixture containing 0.2 μM anchoring primers, 0.2 μM of each fluorescent probe, 1×T4 DNA ligase buffer, 1 mM ATP, and 0.1 u / μL T4 DNA ligase to the sample, and incubate at 30 °C for 45 min. Wash three times with DEPC-PBS-Tween 20 and air dry. Finally, add GoldAntifade Mountan mounting medium (Fermantas) containing 0.5 μg / mL DAPI and incubate at room temperature for 10 min before fluorescence microscopy detection and photography. The anchoring primer and fluorescent probe sequences are shown in Table 5 below (from top to bottom: SEQ ID NO. 0074, 0076-0079 and SEQ ID NO. 0184 to 0187, where SEQ ID NO. 0074 corresponds to the anchoring primer, SEQ ID NO. 0076-0079 corresponds to the two-base-encoded dual-linked probe of the present invention; SEQ ID NO. 0184-0187 corresponds to the three-base-encoded sequencing dual-linked probe for comparison):
[0207] Table 5
[0208]
[0209]
[0210] Experimental results are as follows Figure 7 As shown, A is the result of two-base coding sequencing, B is the result of three-base coding sequencing, and C is a comparison of the fluorescence signals of the top 30% of the cumulative fluorescence intensity of single signal points of two-base coding and three-base coding. In each figure, the left curve represents two bases and the right curve represents three bases. It can be seen that the fluorescence intensity of two bases is higher than that of three bases.
[0211] Example 5: In situ detection of 36 mRNAs using frozen sections of the coronal surface of mouse brain as experimental samples to investigate the dual-base coding sequencing method.
[0212] (I) Obtaining and embedding mouse brain tissue: Record the age and weight of the mice, and euthanize them by quickly severing their necks. Using dissecting scissors, cut the mouse's skin from the abdomen to the head, carefully cutting open the meninges. If this is difficult, the mouse's head can be severed from the neck to facilitate brain extraction. Clean the extracted brain tissue with physiological saline or PBS to remove blood stains, and then blot away excess water with gauze. Add a small amount of OCT to the embedding cassette, place the brain tissue in the cassette in a specific orientation, and add OCT until it covers the brain tissue. Quick-freeze with dry ice and store at -80°C. To obtain tissue with as much RNA integrity as possible, cardiac perfusion of the mice is not required before brain tissue extraction, and PFA fixation and sucrose dehydration are not required after extraction. Furthermore, the brain should be embedded quickly and promptly after extraction to prevent brain liquefaction and RNA degradation over time.
[0213] (II) Preparation of Mouse Brain Sections: The OCT embedding block containing the mouse brain is fixed in a specific orientation on the cold head of the cryostat. The mouse brain section thickness is 10-12 μm. After slicing, the tissue section is attached to the slide with the front side facing down and the back side facing up. After attachment, the tissue is fixed in place by pressing the tissue onto the back of the slide with your fingers. After attachment, the sections are stored at -80°C. They can be temporarily stored in dry ice and then transferred to a -80°C freezer. The slides should be pre-cooled for at least half an hour beforehand to prevent wrinkles from forming during tissue mounting due to excessively high slide temperature.
[0214] (III) Pretreatment of frozen tissue sections: Remove the frozen sections from -80℃ and thaw at room temperature. The thawing time should not exceed 10 minutes. Take 1 ml of 4% PFA and drop it onto the slide to cover the tissue. Avoid direct contact of the droplet with the tissue to prevent tissue detachment. After 5 minutes, pour off the liquid on the slide. Wash the slide twice with PBS for 2 minutes each time. After the slide dries, draw reaction cells around the tissue with an immunohistochemistry pen. The reaction cells should be drawn at a certain distance from the tissue. After drawing the reaction cells, rinse three times with DEPC-PBS-Tween 20.
[0215] (iv) In situ RNA detection:
[0216] (1) Double-connected probe hybridization:
[0217] Add 50 μL of hybridization solution containing 6x SSC, 10% formamide, and 0.05 μM of each dual-linked probe to a glass slide and incubate at 37°C for 2-3 h to allow each recognition probe pair to fully hybridize with the target sequence of the corresponding gene. The dual-linked probe sequences are shown in Table 6 below (sequences are numbered from top to bottom as SEQ ID NO.0188 to SEQ ID NO.0547):
[0218] Table 6
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
[0230]
[0231]
[0232] (2) The above-mentioned dual-connection probe is used for the first step of connection:
[0233] After washing three times with DEPC-PBS-Tween 20, 50 μL of ligation reaction mixture containing 25% glycerol, 0.2 μg / μL BSA, 1×SplintR buffer (NEB), 0.1 U / μL SplintR ligase (NEB), and 1 U / μL RiboLock RNase inhibitor (Thermo) was added to the sample, and the mixture was incubated at 37°C for 30 min.
[0234] (3) Clamping primer recognition hybridization:
[0235] After washing three times with DEPC-PBS-Tween 20, 50 μL of hybridization mixture containing 6x SSC, 10% formamide, and 0.5 μM splice primers was added to the sample, and the mixture was incubated at 30 °C for 30 min. The sequence of the splice primers was: 5'-ggctccactaaatagacgca-3' (SEQ ID NO. 0073), Reverse primer.
[0236] (4) Probe closure and rolling circle amplification:
[0237] After washing three times with DEPC-PBS-Tween 20, add 50 μL of hybridization mixture containing 5% glycerol, 0.2 μg / μL BSA, 1×Phi29 polymerase buffer (Thermo), 1 mM dNTPs, 0.1 U / μL LT4 DNA ligase (Thermo), and 1 u / μL Phi29 DNA polymerase (Thermo) to the sample. Incubate at 37°C for 3 h and transfer to 30°C for overnight reaction.
[0238] (V) Four rounds of in situ RNA sequencing, the specific principle of which is as follows: Figure 1 As shown, the details are as follows:
[0239] (1) Anchor primer hybridization and fluorescent probe ligation
[0240] Add 50 μL of sequencing reaction mixture containing 0.2 μM anchoring primers, 0.2 μM of each fluorescent probe, 1×T4 DNA ligase buffer, 1 mM ATP, and 0.1 u / μL T4 DNA ligase to the sample, and incubate at 30 °C for 45 min. Wash three times with DEPC-PBS-Tween 20 and air dry. Finally, add GoldAntifade Mountan mounting medium (Fermantas) containing 0.5 μg / mL DAPI and incubate at room temperature for 10 min before fluorescence microscopy detection and photography.
[0241] (2) Elution of fluorescent probes
[0242] After imaging the sample, place the slide in 5×SSC or PBS for incubation, then wash away the coverslip and mounting medium. Next, add elution buffer to the reaction zone at a final concentration of 80% formamide and 0.1% Triton-X, and incubate at 37°C for 10 min, repeating this process 6 times. Finally, wash the sample three times with DEPC-PBS-Tween 20.
[0243] (3) Repeat steps (1) and (2) three more times. The above anchoring primer and fluorescent probe sequences are shown in Table 2 of Example 1.
[0244] (4) Gene analysis
[0245] By combining the signals from four rounds of sequencing, each signal point yields a color sequence from the four rounds. This sequence, corresponding to the base sequence on the previously designed probe, indicates the gene at which the signal originates. Figure 8 As shown.
[0246] The above description is merely a preferred embodiment of the present invention, and therefore should not be construed as limiting the scope of the present invention. All equivalent changes and modifications made in accordance with the scope of the patent and the contents of the specification should still fall within the scope of the present invention. sequence list <110> Huaqiao University <120> A probe primer set for in situ RNA detection and its applications <160> 547 <170> SIPOSequenceListing 1.0 <210> 1 <211> 45 <212> DNA <213> Artificial Sequence <400> 1 cgagaccacg ctcaaaaaaa aaattcctat cacgctgcgt ctatt 45 <210> 2 <211> 45 <212> DNA <213> Artificial Sequence <400> 2 tagtggagcc cgctctatcc ttaaaaaaag gtccagttag cagtc 45 <210> 3 <211> 45 <212> DNA <213> Artificial Sequence <400> 3 tcgctctgtc tcgctcaaaa aaattcctat caccatgcgt ctatt 45 <210> 4 <211> 45 <212> DNA <213> Artificial Sequence <400> 4 tagtggagcc ctctctatcc ttaaaaaaag gtcagattgc gttgc 45 <210> 5 <211> 45 <212> DNA <213> Artificial Sequence <400> 5 cgagtccaag gtgaacaaaa aaattcctat caccttgcgt ctatt 45 <210> 6 <211> 45 <212> DNA <213> Artificial Sequence <400> 6 tagtggagcc tcctctatcc ttaaaaaaat attgcaagaa aaaga 45 <210> 7 <211> 45 <212> DNA <213> Artificial Sequence <400> 7 aggtgagctc cgactcaaaa aaattcctat caccttgcgt ctatt 45 <210> 8 <211> 45 <212> DNA <213> Artificial Sequence <400> 8 tagtggagcc acctctatcc ttaaaaaaac cgtccttgct gaaac 45 <210> 9 <211> 45 <212> DNA <213> Artificial Sequence <400> 9 cgctggatag cctccaaaaa aaattcctat cactatgcgt ctatt 45 <210> 10 <211> 45 <212> DNA <213> Artificial Sequence <400> 10 tagtggagcc tactctatcc ttaaaaaaac tgaatctttg gagta 45 <210> 11 <211> 45 <212> DNA <213> Artificial Sequence <400> 11 agccacacag tgctttaaaa aaattcctat cacgttgcgt ctatt 45 <210> 12 <211> 45 <212> DNA <213> Artificial Sequence <400> 12 tagtggagcc aactctatcc ttaaaaaaat gaacaccgct tattc 45 <210> 13 <211> 45 <212> DNA <213> Artificial Sequence <400> 13 tcctccccgc actcgtaaaa aaattcctat cacactgcgt ctatt 45 <210> 14 <211> 45 <212> DNA <213> Artificial Sequence <400> 14 tagtggagcc ggctctatcc ttaaaaaaag cctcccatct caaac 45 <210> 15 <211> 45 <212> DNA <213> Artificial Sequence <400> 15 tgcgtcggcg tggcagaaaa aaattcctat cacagtgcgt ctatt 45 <210> 16 <211> 45 <212> DNA <213> Artificial Sequence <400> 16 tagtggagcc agctctatcc ttaaaaaaac gtgcagagag gggtc 45 <210> 17 <211> 45 <212> DNA <213> Artificial Sequence <400> 17 ttgttcccca gaaaagaaaa aaattcctat caccctgcgt ctatt 45 <210> 18 <211> 45 <212> DNA <213> Artificial Sequence <400> 18 tagtggagcc gactctatcc ttaaaaaaag acttggagtc acctc 45 <210> 19 <211> 45 <212> DNA <213> Artificial Sequence <400> 19 ccttgttctt cttcttcaaa aaattcctat cactatgcgt ctatt 45 <210> 20 <211> 45 <212> DNA <213> Artificial Sequence <400> 20 tagtggagcc ggctctatcc ttaaaaaaat ttactgcaac accac 45 <210> twenty one <211> 39 <212> DNA <213> Artificial Sequence <400> twenty one tggaataaat ctgcgtgttc ctatcacagt gcgtctatt 39 <210> twenty two <211> 38 <212> DNA <213> Artificial Sequence <400> twenty two tagtggagcc ctctctatcc ttccagttgt tgtttcac 38 <210> twenty three <211> 38 <212> DNA <213> Artificial Sequence <400> twenty three agagctcttg tgtgtgttcc tatctccttg cgtctatt 38 <210> twenty four <211> 38 <212> DNA <213> Artificial Sequence <400> twenty four tagtggagcc cgctctatcc ttgtgatgtt ggagataa 38 <210> 25 <211> 38 <212> DNA <213> Artificial Sequence <400> 25 ctgtgctcgc ggggcgttcc tatctcgatg cgtctatt 38 <210> 26 <211> 39 <212> DNA <213> Artificial Sequence <400> 26 tagtggagcc acctctatcc tttcggcaaa ggcgaggct 39 <210> 27 <211> 38 <212> DNA <213> Artificial Sequence <400> 27 attctcctcg gtgtccttcc tatctctttg cgtctatt 38 <210> 28 <211> 39 <212> DNA <213> Artificial Sequence <400> 28 tagtggagcc cactctatcc ttggtgttcg cctcttgac 39 <210> 29 <211> 38 <212> DNA <213> Artificial Sequence <400> 29 tttgccatcc actatcttcc tatctcattg cgtctatt 38 <210> 30 <211> 38 <212> DNA <213> Artificial Sequence <400> 30 tagtggagcc tcctctatcc tttggtctca gacaccac 38 <210> 31 <211> 39 <212> DNA <213> Artificial Sequence <400> 31 gtagctctcg aacatgtttc ctatctcgct gcgtctatt 39 <210> 32 <211> 38 <212> DNA <213> Artificial Sequence <400> 32 tagtggagcc ggctctatcc ttgcctaagg ttgttgat 38 <210> 33 <211> 39 <212> DNA <213> Artificial Sequence <400> 33 ctcatcggat tttgcagttc ctatctcgtt gcgtctatt 39 <210> 34 <211> 39 <212> DNA <213> Artificial Sequence <400> 34 tagtggagcc ccctctatcc ttctttatactt ggcggcagt 39 <210> 35 <211> 39 <212> DNA <213> Artificial Sequence <400> 35 agttctcgaa gtctgacttc ctatctcact gcgtctatt 39 <210> 36 <211> 38 <212> DNA <213> Artificial Sequence <400> 36 tagtggagcc gcctctatcc ttgctccaaa ttccctgg 38 <210> 37 <211> 45 <212> DNA <213> Artificial Sequence <400> 37 cgagaccacg ctcaaaaaaa aaattcactc agacttgcgt ctatt 45 <210> 38 <211> 45 <212> DNA <213> Artificial Sequence <400> 38 tagtggagcc ctgaactcac ttaaaaaaag gtccagttag cagtc 45 <210> 39 <211> 45 <212> DNA <213> Artificial Sequence <400> 39 tcgctctgtc tcgctcaaaa aaattcactc actagtgcgt ctatt 45 <210> 40 <211> 45 <212> DNA <213> Artificial Sequence <400> 40 tagtggagcc cttcactcac ttaaaaaaag gtcagattgc gttgc 45 <210> 41 <211> 45 <212> DNA <213> Artificial Sequence <400> 41 cgagtccaag gtgaacaaaa aaattcactc acttctgcgt ctatt 45 <210> 42 <211> 45 <212> DNA <213> Artificial Sequence <400> 42 tagtggagcc tcctactcac ttaaaaaaat attgcaagaa aaaga 45 <210> 43 <211> 45 <212> DNA <213> Artificial Sequence <400> 43 aggtgagctc cgactcaaaa aaattcactc acttctgcgt ctatt 45 <210> 44 <211> 45 <212> DNA <213> Artificial Sequence <400> 44 tagtggagcc agctactcac ttaaaaaaac cgtccttgct gaaac 45 <210> 45 <211> 45 <212> DNA <213> Artificial Sequence <400> 45 cgctggatag cctccaaaaa aaattcactc atcagtgcgt ctatt 45 <210> 46 <211> 45 <212> DNA <213> Artificial Sequence <400> 46 tagtggagcc tcagactcac ttaaaaaaac tgaatctttg gagta 45 <210> 47 <211> 45 <212> DNA <213> Artificial Sequence <400> 47 agccacacag tgctttaaaa aaattcactc agatctgcgt ctatt 45 <210> 48 <211> 45 <212> DNA <213> Artificial Sequence <400> 48 tagtggagcc agagactcac ttaaaaaaat gaacaccgct tattc 45 <210> 49 <211> 45 <212> DNA <213> Artificial Sequence <400> 49 tcctccccgc actcgtaaaa aaattcactc aagcttgcgt ctatt 45 <210> 50 <211> 45 <212> DNA <213> Artificial Sequence <400> 50 tagtggagcc gagaactcac ttaaaaaaag cctcccatct caaac 45 <210> 51 <211> 45 <212> DNA <213> Artificial Sequence <400> 51 tgcgtcggcg tggcagaaaa aaattcactc aaggatgcgt ctatt 45 <210> 52 <211> 45 <212> DNA <213> Artificial Sequence <400> 52 tagtggagcc aggaactcac ttaaaaaaac gtgcagagag gggtc 45 <210> 53 <211> 45 <212> DNA <213> Artificial Sequence <400> 53 ttgttcccca gaaaagaaaa aaattcactc actcttgcgt ctatt 45 <210> 54 <211> 45 <212> DNA <213> Artificial Sequence <400> 54 tagtggagcc gaagactcac ttaaaaaaag acttggagtc acctc 45 <210> 55 <211> 45 <212> DNA <213> Artificial Sequence <400> 55 ccttgttctt cttcttcaaa aaattcactc atcagtgcgt ctatt 45 <210> 56 <211> 45 <212> DNA <213> Artificial Sequence <400> 56 tagtggagcc gagaactcac ttaaaaaaat ttactgcaac accac 45 <210> 57 <211> 39 <212> DNA <213> Artificial Sequence <400> 57 tggaataaat ctgcgtgttc actcaaggat gcgtctatt 39 <210> 58 <211> 37 <212> DNA <213> Artificial Sequence <400> 58 tagtggagcc cttcactcac ttccagttgt tgtttca 37 <210> 59 <211> 38 <212> DNA <213> Artificial Sequence <400> 59 agagctcttg tgtgtgttca ctcacttctg cgtctatt 38 <210> 60 <211> 38 <212> DNA <213> Artificial Sequence <400> 60 tagtggagcc ctgaactcac ttgtgatgtt ggagataa 38 <210> 61 <211> 38 <212> DNA <213> Artificial Sequence <400> 61 ctgtgctcgc ggggcgttca ctcagaagtg cgtctatt 38 <210> 62 <211> 39 <212> DNA <213> Artificial Sequence <400> 62 tagtggagcc agctactcac tttcggcaaa ggcgaggct 39 <210> 63 <211> 38 <212> DNA <213> Artificial Sequence <400> 63 attctcctcg gtgtccttca ctcatctctg cgtctatt 38 <210> 64 <211> 39 <212> DNA <213> Artificial Sequence <400> 64 tagtggagcc ctagactcac ttggtgttcg cctcttgac 39 <210> 65 <211> 38 <212> DNA <213> Artificial Sequence <400> 65 tttgccatcc actatcttca ctcaagtctg cgtctatt 38 <210> 66 <211> 38 <212> DNA <213> Artificial Sequence <400> 66 tagtggagcc tcctactcac tttggtctca gacaccac 38 <210> 67 <211> 39 <212> DNA <213> Artificial Sequence <400> 67 gtagctctcg aacatgtttc actcagactt gcgtctatt 39 <210> 68 <211> 38 <212> DNA <213> Artificial Sequence <400> 68 tagtggagcc gagaactcac ttgcctaagg ttgttgat 38 <210> 69 <211> 39 <212> DNA <213> Artificial Sequence <400> 69 ctcatcggat tttgcagttc actcagatct gcgtctatt 39 <210> 70 <211> 39 <212> DNA <213> Artificial Sequence <400> 70 tagtggagcc ctctactcac ttctttatactt ggcggcagt 39 <210> 71 <211> 39 <212> DNA <213> Artificial Sequence <400> 71 agttctcgaa gtctgacttc actcaagctt gcgtctatt 39 <210> 72 <211> 38 <212> DNA <213> Artificial Sequence <400> 72 tagtggagcc gactactcac ttgctccaaa ttccctgg 38 <210> 73 <211> 20 <212> DNA <213> Artificial Sequence <400> 73 ggctccacta aatagacgca 20 <210> 74 <211> 15 <212> DNA <213> Artificial Sequence <400> 74 tgcgtctatt tagtg 15 <210> 75 <211> 15 <212> DNA <213> Artificial Sequence <400> 75 ctatttagtg gagcc 15 <210> 76 <211> 9 <212> DNA <213> Artificial Sequence <400> 76 actcaagnn 9 <210> 77 <211> 9 <212> DNA <213> Artificial Sequence <400> 77 actcatcnn 9 <210> 78 <211> 9 <212> DNA <213> Artificial Sequence <400> 78 actcactnn 9 <210> 79 <211> 9 <212> DNA <213> Artificial Sequence <400> 79 actcagann 9 <210> 80 <211> 9 <212> DNA <213> Artificial Sequence <400> 80 actcannag 9 <210> 82 <211> 9 <212> DNA <213> Artificial Sequence <400> 82 actcannct 9 <210> 81 <211> 9 <212> DNA <213> Artificial Sequence <400> 81 actcanntc 9 <210> 83 <211> 9 <212> DNA <213> Artificial Sequence <400> 83 actcannga 9 <210> 84 <211> 9 <212> DNA <213> Artificial Sequence <400> 84 nnagactca 9 <210> 85 <211> 9 <212> DNA <213> Artificial Sequence <400> 85 nntcactca 9 <210> 86 <211> 9 <212> DNA <213> Artificial Sequence <400> 86 nnctactca 9 <210> 87 <211> 9 <212> DNA <213> Artificial Sequence <400> 87 nngaactca 9 <210> 88 <211> 9 <212> DNA <213> Artificial Sequence <400> 88 agnnactca 9 <210> 89 <211> 9 <212> DNA <213> Artificial Sequence <400> 89 tcnnactca 9 <210> 90 <211> 9 <212> DNA <213> Artificial Sequence <400> 90 ctnnactca 9 <210> 91 <211> 9 <212> DNA <213> Artificial Sequence <400> 91 gannactca 9 <210> 92 <211> 9 <212> DNA <213> Artificial Sequence <400> 92 ctatcnnan 9 <210> 93 <211> 9 <212> DNA <213> Artificial Sequence <400> 93 ctatcnntn 9 <210> 94 <211> 9 <212> DNA <213> Artificial Sequence <400> 94 ctatcnncn 9 <210> 95 <211> 9 <212> DNA <213> Artificial Sequence <400> 95 ctatcnngn 9 <210> 96 <211> 9 <212> DNA <213> Artificial Sequence <400> 96 ctatcnnna 9 <210> 97 <211> 9 <212> DNA <213> Artificial Sequence <400> 97 ctatcnnnt 9 <210> 98 <211> 9 <212> DNA <213> Artificial Sequence <400> 98 ctatcnnnc 9 <210> 99 <211> 9 <212> DNA <213> Artificial Sequence <400> 99 ctatcnnng 9 <210> 100 <211> 9 <212> DNA <213> Artificial Sequence <400> 100 annnctatc 9 <210> 101 <211> 9 <212> DNA <213> Artificial Sequence <400> 101 tnnnctatc 9 <210> 102 <211> 9 <212> DNA <213> Artificial Sequence <400> 102 cnnnctatc 9 <210> 103 <211> 9 <212> DNA <213> Artificial Sequence <400> 103 gnnnctatc 9 <210> 104 <211> 9 <212> DNA <213> Artificial Sequence <400> 104 nannctatc 9 <210> 105 <211> 9 <212> DNA <213> Artificial Sequence <400> 105 ntnnctatc 9 <210> 106 <211> 9 <212> DNA <213> Artificial Sequence <400> 106 ncnnctatc 9 <210> 107 <211> 9 <212> DNA <213> Artificial Sequence <400> 107 ngnnctatc 9 <210> 108 <211> 45 <212> DNA <213> Artificial Sequence <400> 108 taccaccccc accaccaaaa aaattcctat ctcgttgcgt ctatt 45 <210> 109 <211> 45 <212> DNA <213> Artificial Sequence <400> 109 tagtggagcc aactctatcc ttaaaaaaat tcaacctgca tttcc 45 <210> 110 <211> 45 <212> DNA <213> Artificial Sequence <400> 110 taccaccccc accaccaaaa aaattcctat ctctttgcgt ctatt 45 <210> 111 <211> 45 <212> DNA <213> Artificial Sequence <400> 111 tagtggagcc aactctatcc ttaaaaaaat tcaacctgca tttcc 45 <210> 112 <211> 45 <212> DNA <213> Artificial Sequence <400> 112 taccaccccc accaccaaaa aaattcctat ctcgttgcgt ctatt 45 <210> 113 <211> 45 <212> DNA <213> Artificial Sequence <400> 113 tagtggagcc tactctatcc ttaaaaaaat tcaacctgca tttcc 45 <210> 114 <211> 45 <212> DNA <213> Artificial Sequence <400> 114 taccaccccc accaccaaaa aaattcactc agatctgcgt ctatt 45 <210> 115 <211> 45 <212> DNA <213> Artificial Sequence <400> 115 tagtggagcc agagactcac ttaaaaaaat tcaacctgca tttcc 45 <210> 116 <211> 38 <212> DNA <213> Artificial Sequence <400> 116 agagctcttg tgtgtgttct cactatcatg cgtctatt 38 <210> 117 <211> 38 <212> DNA <213> Artificial Sequence <400> 117 tagtggagcc ctagatactc ttgtgatgtt ggagataa 38 <210> 118 <211> 38 <212> DNA <213> Artificial Sequence <400> 118 ctgtgctcgc ggggcgttct cagatagttg cgtctatt 38 <210> 119 <211> 39 <212> DNA <213> Artificial Sequence <400> 119 tagtggagcc agtctaactc tttcggcaaa ggcgaggct 39 <210> 120 <211> 38 <212> DNA <213> Artificial Sequence <400> 120 attctcctcg gtgtccttct catcatcatg cgtctatt 38 <210> 121 <211> 39 <212> DNA <213> Artificial Sequence <400> 121 tagtggagcc ctaagtactc ttggtgttcg cctcttgac 39 <210> 122 <211> 38 <212> DNA <213> Artificial Sequence <400> 122 tttgccatcc actatcttct caagttcatg cgtctatt 38 <210> 123 <211> 38 <212> DNA <213> Artificial Sequence <400> 123 tagtggagcc tcactaactc tttggtctca gacaccac 38 <210> 124 <211> 39 <212> DNA <213> Artificial Sequence <400> 124 gtagctctcg aacatgtttc tcagatctat gcgtctatt 39 <210> 125 <211> 38 <212> DNA <213> Artificial Sequence <400> 125 tagtggagcc gatgatactc ttgcctaagg ttgttgat 38 <210> 126 <211> 39 <212> DNA <213> Artificial Sequence <400> 126 ctcatcggat tttgcagttc tcagattcat gcgtctatt 39 <210> 127 <211> 39 <212> DNA <213> Artificial Sequence <400> 127 tagtggagcc ctactaactc ttctttatactt ggcggcagt 39 <210> 128 <211> 39 <212> DNA <213> Artificial Sequence <400> 128 agttctcgaa gtctgacttc tcaagtctat gcgtctatt 39 <210> 129 <211> 38 <212> DNA <213> Artificial Sequence <400> 129 tagtggagccgatctaactcttgctccaaa ttccctgg 38 <210> 130 <211> 45 <212> DNA <213> Artificial Sequence <400> 130 ttgttcccca gaaaagaaaa aaattctcac tactatgcgt ctatt 45 <210> 131 <211> 45 <212> DNA <213> Artificial Sequence <400> 131 tagtggagcc gatagtactc ttaaaaaaag acttggagtc acctc 45 <210> 132 <211> 45 <212> DNA <213> Artificial Sequence <400> 132 ccttgttctt cttcttcaaa aaattctcat caagttgcgt ctatt 45 <210> 133 <211> 45 <212> DNA <213> Artificial Sequence <400> 133 tagtggagcc gatgatactc ttaaaaaaat ttactgcaac accac 45 <210> 134 <211> 45 <212> DNA <213> Artificial Sequence <400> 134 cgagaccacg ctcaaaaaaa aaattctcag atctatgcgt ctatt 45 <210> 135 <211> 45 <212> DNA <213> Artificial Sequence <400> 135 tagtggagcc ctagatactc ttaaaaaaag gtccagttag cagtc 45 <210> 136 <211> 45 <212> DNA <213> Artificial Sequence <400> 136 tcgctctgtc tcgctcaaaa aaattctcac taagttgcgt ctatt 45 <210> 137 <211> 45 <212> DNA <213> Artificial Sequence <400> 137 tagtggagcc ctatcaactc ttaaaaaaag gtcagattgc gttgc 45 <210> 138 <211> 45 <212> DNA <213> Artificial Sequence <400> 138 cgagtccaag gtgaacaaaa aaattctcac tatcatgcgt ctatt 45 <210> 139 <211> 45 <212> DNA <213> Artificial Sequence <400> 139 tagtggagcc tcactaactc ttaaaaaaat attgcaagaa aaaga 45 <210> 140 <211> 45 <212> DNA <213> Artificial Sequence <400> 140 aggtgagctc cgactcaaaa aaattctcac tatcatgcgt ctatt 45 <210> 141 <211> 45 <212> DNA <213> Artificial Sequence <400> 141 tagtggagcc agtctaactc ttaaaaaaac cgtccttgct gaaac 45 <210> 142 <211> 45 <212> DNA <213> Artificial Sequence <400> 142 cgctggatag cctccaaaaa aaattctcat caagttgcgt ctatt 45 <210> 143 <211> 45 <212> DNA <213> Artificial Sequence <400> 143 tagtggagcc tcaagtactc ttaaaaaaac tgaatctttg gagta 45 <210> 144 <211> 45 <212> DNA <213> Artificial Sequence <400> 144 agccacacag tgctttaaaa aaattctcag attcatgcgt ctatt 45 <210> 145 <211> 45 <212> DNA <213> Artificial Sequence <400> 145 tagtggagcc agtagtactc ttaaaaaaat gaacaccgct tattc 45 <210> 146 <211> 45 <212> DNA <213> Artificial Sequence <400> 146 tcctccccgc actcgtaaaa aaattctcaa gtctatgcgt ctatt 45 <210> 147 <211> 45 <212> DNA <213> Artificial Sequence <400> 147 tagtggagcc gatgatactc ttaaaaaaag cctcccatct caaac 45 <210> 148 <211> 45 <212> DNA <213> Artificial Sequence <400> 148 tgcgtcggcg tggcagaaaa aaattctcaa gtgattgcgt ctatt 45 <210> 149 <211> 45 <212> DNA <213> Artificial Sequence <400> 149 tagtggagcc agtgatactc ttaaaaaaac gtgcagagag gggtc 45 <210> 150 <211> 45 <212> DNA <213> Artificial Sequence <400> 150 cgagaccacg ctcaaaaaaa aaattcactc agacttgcgt ctatt 45 <210> 151 <211> 45 <212> DNA <213> Artificial Sequence <400> 151 tagtggagcc ctgaactcac ttaaaaaaag gtccagttag cagtc 45 <210> 152 <211> 45 <212> DNA <213> Artificial Sequence <400> 152 tcgctctgtc tcgctcaaaa aaattcactc actagtgcgt ctatt 45 <210> 153 <211> 45 <212> DNA <213> Artificial Sequence <400> 153 tagtggagcc cttcactcac ttaaaaaaag gtcagattgc gttgc 45 <210> 154 <211> 45 <212> DNA <213> Artificial Sequence <400> 154 cgagtccaag gtgaacaaaa aaattcactc acttctgcgt ctatt 45 <210> 155 <211> 45 <212> DNA <213> Artificial Sequence <400> 155 tagtggagcc tcctactcac ttaaaaaaat attgcaagaa aaaga 45 <210> 156 <211> 45 <212> DNA <213> Artificial Sequence <400> 156 aggtgagctc cgactcaaaa aaattcactc acttctgcgt ctatt 45 <210> 157 <211> 45 <212> DNA <213> Artificial Sequence <400> 157 tagtggagcc agctactcac ttaaaaaaac cgtccttgct gaaac 45 <210> 158 <211> 45 <212> DNA <213> Artificial Sequence <400> 158 cgctggatag cctccaaaaa aaattcactc atcagtgcgt ctatt 45 <210> 159 <211> 45 <212> DNA <213> Artificial Sequence <400> 159 tagtggagcc tcagactcac ttaaaaaaac tgaatctttg gagta 45 <210> 160 <211> 45 <212> DNA <213> Artificial Sequence <400> 160 agccacacag tgctttaaaa aaattcactc agatctgcgt ctatt 45 <210> 161 <211> 45 <212> DNA <213> Artificial Sequence <400> 161 tagtggagcc agagactcac ttaaaaaaat gaacaccgct tattc 45 <210> 162 <211> 45 <212> DNA <213> Artificial Sequence <400> 162 tcctccccgc actcgtaaaa aaattcactc aagcttgcgt ctatt 45 <210> 163 <211> 45 <212> DNA <213> Artificial Sequence <400> 163 tagtggagcc gagaactcac ttaaaaaaag cctcccatct caaac 45 <210> 164 <211> 45 <212> DNA <213> Artificial Sequence <400> 164 tgcgtcggcg tggcagaaaa aaattcactc aaggatgcgt ctatt 45 <210> 165 <211> 45 <212> DNA <213> Artificial Sequence <400> 165 tagtggagcc aggaactcac ttaaaaaaac gtgcagagag gggtc 45 <210> 166 <211> 45 <212> DNA <213> Artificial Sequence <400> 166 ttgttcccca gaaaagaaaa aaattcactc actcttgcgt ctatt 45 <210> 167 <211> 45 <212> DNA <213> Artificial Sequence <400> 167 tagtggagcc gaagactcac ttaaaaaaag acttggagtc acctc 45 <210> 168 <211> 45 <212> DNA <213> Artificial Sequence <400> 168 ccttgttctt cttcttcaaa aaattcactc atcagtgcgt ctatt 45 <210> 169 <211> 45 <212> DNA <213> Artificial Sequence <400> 169 tagtggagcc gagaactcac ttaaaaaaat ttactgcaac accac 45 <210> 170 <211> 38 <212> DNA <213> Artificial Sequence <400> 170 agagctcttg tgtgtgttca ctcacttctg cgtctatt 38 <210> 171 <211> 38 <212> DNA <213> Artificial Sequence <400> 171 tagtggagcc ctgaactcac ttgtgatgtt ggagataa 38 <210> 172 <211> 38 <212> DNA <213> Artificial Sequence <400> 172 ctgtgctcgc ggggcgttca ctcagaagtg cgtctatt 38 <210> 173 <211> 39 <212> DNA <213> Artificial Sequence <400> 173 tagtggagcc agctactcac tttcggcaaa ggcgaggct 39 <210> 174 <211> 38 <212> DNA <213> Artificial Sequence <400> 174 attctcctcg gtgtccttca ctcatctctg cgtctatt 38 <210> 175 <211> 39 <212> DNA <213> Artificial Sequence <400> 175 tagtggagcc ctagactcac ttggtgttcg cctcttgac 39 <210> 176 <211> 38 <212> DNA <213> Artificial Sequence <400> 176 tttgccatcc actatcttca ctcaagtctg cgtctatt 38 <210> 177 <211> 38 <212> DNA <213> Artificial Sequence <400> 177 tagtggagcc tcctactcac tttggtctca gacaccac 38 <210> 178 <211> 39 <212> DNA <213> Artificial Sequence <400> 178 gtagctctcg aacatgtttc actcagactt gcgtctatt 39 <210> 179 <211> 38 <212> DNA <213> Artificial Sequence <400> 179 tagtggagcc gagaactcac ttgcctaagg ttgttgat 38 <210> 180 <211> 39 <212> DNA <213> Artificial Sequence <400> 180 ctcatcggat tttgcagttc actcagatct gcgtctatt 39 <210> 181 <211> 39 <212> DNA <213> Artificial Sequence <400> 181 tagtggagcc ctctactcac ttctttatactt ggcggcagt 39 <210> 182 <211> 39 <212> DNA <213> Artificial Sequence <400> 182 agttctcgaa gtctgacttc actcaagctt gcgtctatt 39 <210> 183 <211> 38 <212> DNA <213> Artificial Sequence <400> 183 tagtggagcc gactactcac ttgctccaaa ttccctgg 38 <210> 184 <211> 9 <212> DNA <213> Artificial Sequence <400> 184 tcaagtnnn 9 <210> 185 <211> 9 <212> DNA <213> Artificial Sequence <400> 185 tcatcannn 9 <210> 186 <211> 9 <212> DNA <213> Artificial Sequence <400> 186 tcactannn 9 <210> 187 <211> 9 <212> DNA <213> Artificial Sequence <400> 187 tcagatnnn 9 <210> 188 <211> 45 <212> DNA <213> Artificial Sequence <400> 188 cgtgctgtct gcgtataaaa aaattcactc agacttgcgt ctatt 45 <210> 189 <211> 45 <212> DNA <213> Artificial Sequence <400> 189 tagtggagcc ctgaactcac ttaaaaaaaa cacagggaca ggaaa 45 <210> 190 <211> 45 <212> DNA <213> Artificial Sequence <400> 190 tgccaattcc caattaaaaa aaattcactc agacttgcgt ctatt 45 <210> 191 <211> 45 <212> DNA <213> Artificial Sequence <400> 191 tagtggagcc ctgaactcac ttaaaaaaag attttgcggt tggtc 45 <210> 192 <211> 45 <212> DNA <213> Artificial Sequence <400> 192 atctggttgc agctctaaaa aaattcactc agacttgcgt ctatt 45 <210> 193 <211> 45 <212> DNA <213> Artificial Sequence <400> 193 tagtggagcc ctgaactcac ttaaaaaaag aggtaggaag catgc 45 <210> 194 <211> 45 <212> DNA <213> Artificial Sequence <400> 194 cctttcccca gacagtaaaa aaattcactc agacttgcgt ctatt 45 <210> 195 <211> 45 <212> DNA <213> Artificial Sequence <400> 195 tagtggagcc ctgaactcac ttaaaaaaac tgggatgcaa acgac 45 <210> 196 <211> 45 <212> DNA <213> Artificial Sequence <400> 196 aatggagagg gcacacaaaa aaattcactc agacttgcgt ctatt 45 <210> 197 <211> 45 <212> DNA <213> Artificial Sequence <400> 197 tagtggagcc ctgaactcac ttaaaaaaag ttttctctaa gagcc 45 <210> 198 <211> 45 <212> DNA <213> Artificial Sequence <400> 198 tggcgatgct caaagtaaaa aaattcactc atccttgcgt ctatt 45 <210> 199 <211> 45 <212> DNA <213> Artificial Sequence <400> 199 tagtggagcc tcctactcac ttaaaaaaag tccatctgca ggccc 45 <210> 200 <211> 45 <212> DNA <213> Artificial Sequence <400> 200 acgtcatcac cagctcaaaa aaattcactc atccttgcgt ctatt 45 <210> 201 <211> 45 <212> DNA <213> Artificial Sequence <400> 201 tagtggagcc tcctactcac ttaaaaaaaa cgacgtacaa gatac 45 <210> 202 <211> 45 <212> DNA <213> Artificial Sequence <400> 202 agcgccttgg ccaccaaaaa aaattcactc atccttgcgt ctatt 45 <210> 203 <211> 45 <212> DNA <213> Artificial Sequence <400> 203 tagtggagcc tcctactcac ttaaaaaaac aacggatagg acagc 45 <210> 204 <211> 45 <212> DNA <213> Artificial Sequence <400> 204 cgatgacgaa gatggcaaaa aaattcactc atccttgcgt ctatt 45 <210> 205 <211> 45 <212> DNA <213> Artificial Sequence <400> 205 cgatgacgaa gatggcaaaa aaattcactc atccttgcgt ctatt 45 <210> 206 <211> 45 <212> DNA <213> Artificial Sequence <400> 206 ctgaatggct gtgaaaaaaa aaattcactc atccttgcgt ctatt 45 <210> 207 <211> 45 <212> DNA <213> Artificial Sequence <400> 207 tagtggagcc tcctactcac ttaaaaaaac tgtagattcc aagca 45 <210> 208 <211> 45 <212> DNA <213> Artificial Sequence <400> 208 aaacccctct tcaaacaaaa aaattcactc agaagtgcgt ctatt 45 <210> 209 <211> 45 <212> DNA <213> Artificial Sequence <400> 209 tagtggagcc agctactcac ttaaaaaaag gtcgtggggc aggtc 45 <210> 210 <211> 45 <212> DNA <213> Artificial Sequence <400> 210 ccaggacact ccactgaaaa aaattcactc agaagtgcgt ctatt 45 <210> 211 <211> 45 <212> DNA <213> Artificial Sequence <400> 211 tagtggagcc agctactcac ttaaaaaaat agctgagcag gaata 45 <210> 212 <211> 45 <212> DNA <213> Artificial Sequence <400> 212 tccaccttgt tggtttaaaa aaattcactc agaagtgcgt ctatt 45 <210> 213 <211> 45 <212> DNA <213> Artificial Sequence <400> 213 tagtggagcc agctactcac ttaaaaaaac tgttctttgt acgtc 45 <210> 214 <211> 45 <212> DNA <213> Artificial Sequence <400> 214 tgtaacgtgt ccttggaaaa aaattcactc agaagtgcgt ctatt 45 <210> 215 <211> 45 <212> DNA <213> Artificial Sequence <400> 215 tagtggagcc agctactcac ttaaaaaaat actattacaa aatcc 45 <210> 216 <211> 45 <212> DNA <213> Artificial Sequence <400> 216 caagatacat ttacaaaaaa aaattcactc agaagtgcgt ctatt 45 <210> 217 <211> 45 <212> DNA <213> Artificial Sequence <400> 217 tagtggagcc agctactcac ttaaaaaaaa cagagtcagc agcac 45 <210> 218 <211> 45 <212> DNA <213> Artificial Sequence <400> 218 tgctgcggag atcttaaaaa aaattcactc acttctgcgt ctatt 45 <210> 219 <211> 45 <212> DNA <213> Artificial Sequence <400> 219 tagtggagcc ctgaactcac ttaaaaaaat gcagctggag tgctc 45 <210> 220 <211> 45 <212> DNA <213> Artificial Sequence <400> 220 atttcctggt tcgtggaaaa aaattcactc acttctgcgt ctatt 45 <210> 221 <211> 45 <212> DNA <213> Artificial Sequence <400> 221 tagtggagcc ctgaactcac ttaaaaaaat ggttatcgtg aatcc 45 <210> 222 <211> 45 <212> DNA <213> Artificial Sequence <400> 222 ccatgcgtac cacagcaaaa aaattcactc acttctgcgt ctatt 45 <210> 223 <211> 45 <212> DNA <213> Artificial Sequence <400> 223 tagtggagcc ctgaactcac ttaaaaaaat gtttcccact ggaga 45 <210> 224 <211> 45 <212> DNA <213> Artificial Sequence <400> 224 caccaacaac ctgttgaaaa aaattcactc acttctgcgt ctatt 45 <210> 225 <211> 45 <212> DNA <213> Artificial Sequence <400> 225 tagtggagcc ctgaactcac ttaaaaaaaa agcaccaagc atgtc 45 <210> 226 <211> 45 <212> DNA <213> Artificial Sequence <400> 226 ccatgctaca aagtgtaaaa aaattcactc acttctgcgt ctatt 45 <210> 227 <211> 45 <212> DNA <213> Artificial Sequence <400> 227 tagtggagcc ctgaactcac ttaaaaaaaa gggggagggt tgttc 45 <210> 228 <211> 45 <212> DNA <213> Artificial Sequence <400> 228 agaaagcacg cagcataaaa aaattcactc actagtgcgt ctatt 45 <210> 229 <211> 45 <212> DNA <213> Artificial Sequence <400> 229 tagtggagcc agtcactcac ttaaaaaaaa atgtcgaccc tcttc 45 <210> 230 <211> 45 <212> DNA <213> Artificial Sequence <400> 230 atgttagggg cgctctaaaa aaattcactc actagtgcgt ctatt 45 <210> 231 <211> 45 <212> DNA <213> Artificial Sequence <400> 231 tagtggagcc agtcactcac ttaaaaaaac agcagccgca gccgc 45 <210> 232 <211> 45 <212> DNA <213> Artificial Sequence <400> 232 cgcagcctgg tcgtgcaaaa aaattcactc actagtgcgt ctatt 45 <210> 233 <211> 45 <212> DNA <213> Artificial Sequence <400> 233 tagtggagcc agtcactcac ttaaaaaaac gcggaaaaag ttagc 45 <210> 234 <211> 45 <212> DNA <213> Artificial Sequence <400> 234 agtttcctgt tgctgtaaaa aaattcactc actagtgcgt ctatt 45 <210> 235 <211> 45 <212> DNA <213> Artificial Sequence <400> 235 tagtggagcc agtcactcac ttaaaaaaac ccgataatct ccatc 45 <210> 236 <211> 45 <212> DNA <213> Artificial Sequence <400> 236 tcttccactg cagctcaaaa aaattcactc actagtgcgt ctatt 45 <210> 237 <211> 45 <212> DNA <213> Artificial Sequence <400> 237 tagtggagcc agtcactcac ttaaaaaaac ctcaagaatg aattc 45 <210> 238 <211> 45 <212> DNA <213> Artificial Sequence <400> 238 ttatgcagcc gatgaaaaaa aaattcactc aagtctgcgt ctatt 45 <210> 239 <211> 45 <212> DNA <213> Artificial Sequence <400> 239 tagtggagcc gatcactcac ttaaaaaaac ttttgatctt gctgc 45 <210> 240 <211> 45 <212> DNA <213> Artificial Sequence <400> 240 ggatcgagac cagaaaaaaa aaattcactc aagtctgcgt ctatt 45 <210> 241 <211> 45 <212> DNA <213> Artificial Sequence <400> 241 tagtggagcc gatcactcac ttaaaaaaaa ttgtaatgag cggtg 45 <210> 242 <211> 45 <212> DNA <213> Artificial Sequence <400> 242 ccgtgtagat cgtgtcaaaa aaattcactc aagtctgcgt ctatt 45 <210> 243 <211> 45 <212> DNA <213> Artificial Sequence <400> 243 tagtggagcc gatcactcac ttaaaaaaac ggtccatgtc gcagc 45 <210> 244 <211> 45 <212> DNA <213> Artificial Sequence <400> 244 ccatccatcc atccataaaa aaattcactc aagtctgcgt ctatt 45 <210> 245 <211> 45 <212> DNA <213> Artificial Sequence <400> 245 tagtggagcc gatcactcac ttaaaaaaaa gtattaacat cccta 45 <210> 246 <211> 45 <212> DNA <213> Artificial Sequence <400> 246 taagtggtgg gggaataaaa aaattcactc aagtctgcgt ctatt 45 <210> 247 <211> 45 <212> DNA <213> Artificial Sequence <400> 247 tagtggagcc gatcactcac ttaaaaaaaa aatttcagct gtctc 45 <210> 248 <211> 45 <212> DNA <213> Artificial Sequence <400> 248 tctgaggggc tccaggaaaa aaattcactc aaggatgcgt ctatt 45 <210> 249 <211> 45 <212> DNA <213> Artificial Sequence <400> 249 tagtggagcc ctgaactcac ttaaaaaaac tctcacagcc tgcac 45 <210> 250 <211> 45 <212> DNA <213> Artificial Sequence <400> 250 cgaagttgga gacagcaaaa aaattcactc aaggatgcgt ctatt 45 <210> 251 <211> 45 <212> DNA <213> Artificial Sequence <400> 251 tagtggagcc ctgaactcac ttaaaaaaac ggtacagatc gtagc 45 <210> 252 <211> 45 <212> DNA <213> Artificial Sequence <400> 252 cagaggggca acaaagaaaa aaattcactc aaggatgcgt ctatt 45 <210> 253 <211> 45 <212> DNA <213> Artificial Sequence <400> 253 tagtggagcc ctgaactcac ttaaaaaaat cccataggac ttctc 45 <210> 254 <211> 45 <212> DNA <213> Artificial Sequence <400> 254 caagccgtat cgtaagaaaa aaattcactc aaggatgcgt ctatt 45 <210> 255 <211> 45 <212> DNA <213> Artificial Sequence <400> 255 tagtggagcc ctgaactcac ttaaaaaaaa gttgagatca gagtc 45 <210> 256 <211> 45 <212> DNA <213> Artificial Sequence <400> 256 ctcgaaagca gccctgaaaa aaattcactc aaggatgcgt ctatt 45 <210> 257 <211> 45 <212> DNA <213> Artificial Sequence <400> 257 tagtggagcc ctgaactcac ttaaaaaaac cccctcttca ttcca 45 <210> 258 <211> 45 <212> DNA <213> Artificial Sequence <400> 258 ccttgcccag ttcaccaaaa aaattcactc aagtctgcgt ctatt 45 <210> 259 <211> 45 <212> DNA <213> Artificial Sequence <400> 259 tagtggagcc gactactcac ttaaaaaaat gctgttcctt cttga 45 <210> 260 <211> 45 <212> DNA <213> Artificial Sequence <400> 260 tctgggttcc catctgaaaa aaattcactc aagtctgcgt ctatt 45 <210> 261 <211> 45 <212> DNA <213> Artificial Sequence <400> 261 tagtggagcc gactactcac ttaaaaaaac tggcctgagg ggtgc 45 <210> 262 <211> 45 <212> DNA <213> Artificial Sequence <400> 262 gtcctgaggg ctgatgaaaa aaattcactc aagtctgcgt ctatt 45 <210> 263 <211> 45 <212> DNA <213> Artificial Sequence <400> 263 45. tagtggagcc gactactcac ttaaaaaaag catggccata atagg <210> 264 <211> 45 <212> DNA <213> Artificial Sequence <400> 264 ttgctctcca aggagaaaaa aaattcactc aagtctgcgt ctatt <210> 265 <211> 45 <212> DNA <213> Artificial Sequence <400> 265 44. tagccc ttaaaaaaag tagcacacgg gcccc <210> 266 <211> 45 <212> DNA <213> Artificial Sequence <400> 266 cgtactttat tagtaaaa aaattcactc aagtctgcgt ctatt <210> 267 <211> 45 <212> DNA <213> Artificial Sequence <400> 267 tagtggagcc gactactcac ttaaaaaat ggggagacag agcta <210> 268 <211> 45 <212> DNA <213> Artificial Sequence <400> 268 aaatcgttgc agcaagaaaa aaattcactc acttctgcgt ctatt 45 <210> 269 <211> 45 <212> DNA <213> Artificial Sequence <400> 269 tagtggagcc ctagactcac ttaaaaaaat catcttccca ggagc 45 <210> 270 <211> 45 <212> DNA <213> Artificial Sequence <400> 270 tagaaagctt cactgcaaaa aaattcactc acttctgcgt ctatt 45 <210> 271 <211> 45 <212> DNA <213> Artificial Sequence <400> 271 tagtggagcc ctagactcac ttaaaaaaac ctgcaggctc tgtgc 45 <210> 272 <211> 45 <212> DNA <213> Artificial Sequence <400> 272 tcagaaccga ggctataaaa aaattcactc acttctgcgt ctatt 45 <210> 273 <211> 45 <212> DNA <213> Artificial Sequence <400> 273 tagtggagcc ctagactcac ttaaaaaaag agaaggtccc ggtcc 45 <210> 274 <211> 45 <212> DNA <213> Artificial Sequence <400> 274 ccttcaaacc cacagcaaaa aaattcactc acttctgcgt ctatt 45 <210> 275 <211> 45 <212> DNA <213> Artificial Sequence <400> 275 tagtggagcc ctagactcac ttaaaaaaag tttgagacct taata 45 <210> 276 <211> 45 <212> DNA <213> Artificial Sequence <400> 276 ccatcacctc ctcaaaaaaa aaattcactc acttctgcgt ctatt 45 <210> 277 <211> 45 <212> DNA <213> Artificial Sequence <400> 277 tagtggagcc ctagactcac ttaaaaaaag accactcagt ctcac 45 <210> 278 <211> 45 <212> DNA <213> Artificial Sequence <400> 278 aaccttccag tctgggaaaa aaattcactc agatctgcgt ctatt 45 <210> 279 <211> 45 <212> DNA <213> Artificial Sequence <400> 279 tagtggagcc agctactcac ttaaaaaaaa ggcagtcttt ggacc 45 <210> 280 <211> 45 <212> DNA <213> Artificial Sequence <400> 280 tggttcttgt acaagcaaaa aaattcactc agatctgcgt ctatt 45 <210> 281 <211> 45 <212> DNA <213> Artificial Sequence <400> 281 tagtggagcc agctactcac ttaaaaaaac cttgaggacg gctac 45 <210> 282 <211> 45 <212> DNA <213> Artificial Sequence <400> 282 tttgccccaa gactgtaaaa aaattcactc agatctgcgt ctatt 45 <210> 283 <211> 45 <212> DNA <213> Artificial Sequence <400> 283 tagtggagcc agctactcac ttaaaaaaag aaggtttttc tgtcc 45 <210> 284 <211> 45 <212> DNA <213> Artificial Sequence <400> 284 cagagcctgt gacttgaaaa aaattcactc agatctgcgt ctatt 45 <210> 285 <211> 45 <212> DNA <213> Artificial Sequence <400> 285 tagtggagcc agctactcac ttaaaaaaaa ggatggcagg gaagc 45 <210> 286 <211> 45 <212> DNA <213> Artificial Sequence <400> 286 cggccagtcg tttgtaaaaa aaattcactc agatctgcgt ctatt 45 <210> 287 <211> 45 <212> DNA <213> Artificial Sequence <400> 287 tagtggagcc agctactcac ttaaaaaaaa ttctgcagcg gtgca 45 <210> 288 <211> 45 <212> DNA <213> Artificial Sequence <400> 288 ccttccatct gctccaaaaa aaattcactc acttctgcgt ctatt 45 <210> 289 <211> 45 <212> DNA <213> Artificial Sequence <400> 289 tagtggagcc cttcactcac ttaaaaaaat ccgtggttcc ataga 45 <210> 290 <211> 45 <212> DNA <213> Artificial Sequence <400> 290 ctgcacctgc tcgtccaaaa aaattcactc acttctgcgt ctatt 45 <210> 291 <211> 45 <212> DNA <213> Artificial Sequence <400> 291 tagtggagcc cttcactcac ttaaaaaaac attccagtgt gtaaa 45 <210> 292 <211> 45 <212> DNA <213> Artificial Sequence <400> 292 agtaactggt ggattgaaaa aaattcactc acttctgcgt ctatt 45 <210> 293 <211> 45 <212> DNA <213> Artificial Sequence <400> 293 tagtggagcc cttcactcac ttaaaaaaat aacccaccca tctgc 45 <210> 294 <211> 45 <212> DNA <213> Artificial Sequence <400> 294 caggcaggga agggtcaaaa aaattcactc acttctgcgt ctatt 45 <210> 295 <211> 45 <212> DNA <213> Artificial Sequence <400> 295 tagtggagcc cttcactcac ttaaaaaaag tagtggttgg agaaa 45 <210> 296 <211> 45 <212> DNA <213> Artificial Sequence <400> 296 ccatgagatc tttcgtaaaa aaattcactc acttctgcgt ctatt 45 <210> 297 <211> 45 <212> DNA <213> Artificial Sequence <400> 297 tagtggagcc cttcactcac ttaaaaaaat tctgctcgat gttgc 45 <210> 298 <211> 45 <212> DNA <213> Artificial Sequence <400> 298 tcgctgtcct gcctgaaaaa aaattcactc aagtctgcgt ctatt 45 <210> 299 <211> 45 <212> DNA <213> Artificial Sequence <400> 299 tagtggagcc ctgaactcac ttaaaaaaac ggagcttctg gaatc 45 <210> 300 <211> 45 <212> DNA <213> Artificial Sequence <400> 300 ttgcactgct ccatgtaaaa aaattcactc aagtctgcgt ctatt 45 <210> 301 <211> 45 <212> DNA <213> Artificial Sequence <400> 301 tagtggagcc ctgaactcac ttaaaaaaac cgcgttatactt ggggc 45 <210> 302 <211> 45 <212> DNA <213> Artificial Sequence <400> 302 aaagagggac ccattcaaaa aaattcactc aagtctgcgt ctatt 45 <210> 303 <211> 45 <212> DNA <213> Artificial Sequence <400> 303 tagtggagcc ctgaactcac ttaaaaaaaa ctgccctcgg aaggc 45 <210> 304 <211> 45 <212> DNA <213> Artificial Sequence <400> 304 cgctgaagca aggcaaaaaa aaattcactc aagtctgcgt ctatt 45 <210> 305 <211> 45 <212> DNA <213> Artificial Sequence <400> 305 tagtggagcc ctgaactcac ttaaaaaaag ttctcccagc tgtcc 45 <210> 306 <211> 45 <212> DNA <213> Artificial Sequence <400> 306 aggtacaagc cagtccaaaa aaattcactc aagtctgcgt ctatt 45 <210> 307 <211> 45 <212> DNA <213> Artificial Sequence <400> 307 tagtggagcc ctgaactcac ttaaaaaaat gggctcgcag gtggc 45 <210> 308 <211> 45 <212> DNA <213> Artificial Sequence <400> 308 catctggagg caacataaaa aaattcactc acttctgcgt ctatt 45 <210> 309 <211> 45 <212> DNA <213> Artificial Sequence <400> 309 tagtggagcc gaagactcac ttaaaaaaat cttctagtcc tgttc 45 <210> 310 <211> 45 <212> DNA <213> Artificial Sequence <400> 310 ttatctggac cccaacaaaa aaattcactc acttctgcgt ctatt 45 <210> 311 <211> 45 <212> DNA <213> Artificial Sequence <400> 311 tagtggagcc gaagactcac ttaaaaaaag tttccccagt gcacc 45 <210> 312 <211> 45 <212> DNA <213> Artificial Sequence <400> 312 agttcacagc tggcttaaaa aaattcactc acttctgcgt ctatt 45 <210> 313 <211> 45 <212> DNA <213> Artificial Sequence <400> 313 tagtggagcc gaagactcac ttaaaaaaac attctcacac aaagc 45 <210> 314 <211> 45 <212> DNA <213> Artificial Sequence <400> 314 tttgggaaag gatgaaaaaa aaattcactc acttctgcgt ctatt 45 <210> 315 <211> 45 <212> DNA <213> Artificial Sequence <400> 315 tagtggagcc gaagactcac ttaaaaaaac agcagatagg aaggc 45 <210> 316 <211> 45 <212> DNA <213> Artificial Sequence <400> 316 cagggacaag attggcaaaa aaattcactc acttctgcgt ctatt 45 <210> 317 <211> 45 <212> DNA <213> Artificial Sequence <400> 317 tagtggagcc gaagactcac ttaaaaaaag tgcaatctgt gggca 45 <210> 318 <211> 45 <212> DNA <213> Artificial Sequence <400> 318 cattgtcgca caccagaaaa aaattcactc acttctgcgt ctatt 45 <210> 319 <211> 45 <212> DNA <213> Artificial Sequence <400> 319 tagtggagcc gatcactcac ttaaaaaaat tacagagccc agagc 45 <210> 320 <211> 45 <212> DNA <213> Artificial Sequence <400> 320 caagtccaga cgcatgaaaa aaattcactc acttctgcgt ctatt 45 <210> 321 <211> 45 <212> DNA <213> Artificial Sequence <400> 321 tagtggagcc gatcactcac ttaaaaaaat gagatctcgg ccagc 45 <210> 322 <211> 45 <212> DNA <213> Artificial Sequence <400> 322 gaatgatttg gaaaggaaaa aaattcactc acttctgcgt ctatt 45 <210> 323 <211> 45 <212> DNA <213> Artificial Sequence <400> 323 tagtggagcc gatcactcac ttaaaaaaat caaagctttg ggcag 45 <210> 324 <211> 45 <212> DNA <213> Artificial Sequence <400> 324 cgcatgcata tccatgaaaa aaattcactc acttctgcgt ctatt 45 <210> 325 <211> 45 <212> DNA <213> Artificial Sequence <400> 325 tagtggagcc gatcactcac ttaaaaaaat gcaagttaaa agtca 45 <210> 326 <211> 45 <212> DNA <213> Artificial Sequence <400> 326 tgataggcaa aggaacaaaa aaattcactc acttctgcgt ctatt 45 <210> 327 <211> 45 <212> DNA <213> Artificial Sequence <400> 327 tagtggagcc gatcactcac ttaaaaaaat ctgtagttcc cattc 45 <210> 328 <211> 45 <212> DNA <213> Artificial Sequence <400> 328 ccttgcctag ggagataaaa aaattcactc aagagtgcgt ctatt 45 <210> 329 <211> 45 <212> DNA <213> Artificial Sequence <400> 329 tagtggagcc ctgaactcac ttaaaaaaac ctacacaaat atgaa 45 <210> 330 <211> 45 <212> DNA <213> Artificial Sequence <400> 330 agcatccagg actttgaaaa aaattcactc aagagtgcgt ctatt 45 <210> 331 <211> 45 <212> DNA <213> Artificial Sequence <400> 331 tagtggagcc ctgaactcac ttaaaaaaac agggctgcct cggac 45 <210> 332 <211> 45 <212> DNA <213> Artificial Sequence <400> 332 cgatttggtg tccagtaaaa aaattcactc aagagtgcgt ctatt 45 <210> 333 <211> 45 <212> DNA <213> Artificial Sequence <400> 333 tagtggagcc ctgaactcac ttaaaaaaac aagtgtcttc cagta 45 <210> 334 <211> 45 <212> DNA <213> Artificial Sequence <400> 334 atcttcctga gctgctaaaa aaattcactc aagagtgcgt ctatt 45 <210> 335 <211> 45 <212> DNA <213> Artificial Sequence <400> 335 tagtggagcc ctgaactcac ttaaaaaaaa agaatgcttc acggc 45 <210> 336 <211> 45 <212> DNA <213> Artificial Sequence <400> 336 tactgtgcat ctacagaaaa aaattcactc aagagtgcgt ctatt 45 <210> 337 <211> 45 <212> DNA <213> Artificial Sequence <400> 337 tagtggagcc ctgaactcac ttaaaaaaat gctctgggaa aacac 45 <210> 338 <211> 45 <212> DNA <213> Artificial Sequence <400> 338 tggaagaagt tcctccaaaa aaattcactc aagtctgcgt ctatt 45 <210> 339 <211> 45 <212> DNA <213> Artificial Sequence <400> 339 tagtggagcc ctagactcac ttaaaaaaaa gccagaggaa ggttc 45 <210> 340 <211> 45 <212> DNA <213> Artificial Sequence <400> 340 cacttgtaga tggccgaaaa aaattcactc aagtctgcgt ctatt 45 <210> 341 <211> 45 <212> DNA <213> Artificial Sequence <400> 341 tagtggagcc ctagactcac ttaaaaaaag aagttgtccg tgatc 45 <210> 342 <211> 45 <212> DNA <213> Artificial Sequence <400> 342 tccagtgagc tcagctaaaa aaattcactc aagtctgcgt ctatt 45 <210> 343 <211> 45 <212> DNA <213> Artificial Sequence <400> 343 tagtggagcc ctagactcac ttaaaaaaag cttagctcca gaccc 45 <210> 344 <211> 45 <212> DNA <213> Artificial Sequence <400> 344 ttgggcttga gggaacaaaa aaattcactc aagtctgcgt ctatt 45 <210> 345 <211> 45 <212> DNA <213> Artificial Sequence <400> 345 tagtggagcc ctagactcac ttaaaaaaag tgcttttgcc aatcc 45 <210> 346 <211> 45 <212> DNA <213> Artificial Sequence <400> 346 cccagttaag tcttagaaaa aaattcactc aagtctgcgt ctatt 45 <210> 347 <211> 45 <212> DNA <213> Artificial Sequence <400> 347 tagtggagcc ctagactcac ttaaaaaaaa gccgggcatc ctttc 45 <210> 348 <211> 45 <212> DNA <213> Artificial Sequence <400> 348 cgtagaggag gtctgtaaaa aaattcactc aagtctgcgt ctatt 45 <210> 349 <211> 45 <212> DNA <213> Artificial Sequence <400> 349 tagtggagcc cttcactcac ttaaaaaaaa tgtcatttga gccca 45 <210> 350 <211> 45 <212> DNA <213> Artificial Sequence <400> 350 tcaggtcctt gctcctaaaa aaattcactc aagtctgcgt ctatt 45 <210> 351 <211> 45 <212> DNA <213> Artificial Sequence <400> 351 tagtggagcc cttcactcac ttaaaaaaac tgcggaaagc atgtc 45 <210> 352 <211> 45 <212> DNA <213> Artificial Sequence <400> 352 cttggtcagt ttcctcaaaa aaattcactc aagtctgcgt ctatt 45 <210> 353 <211> 45 <212> DNA <213> Artificial Sequence <400> 353 tagtggagcc cttcactcac ttaaaaaaaa gtggtactgt ttacc 45 <210> 354 <211> 45 <212> DNA <213> Artificial Sequence <400> 354 aattcctagc ccctggaaaa aaattcactc aagtctgcgt ctatt 45 <210> 355 <211> 45 <212> DNA <213> Artificial Sequence <400> 355 tagtggagcc cttcactcac ttaaaaaaag taggacgaag ctgac 45 <210> 356 <211> 45 <212> DNA <213> Artificial Sequence <400> 356 attttactgg aaggccaaaa aaattcactc aagtctgcgt ctatt 45 <210> 357 <211> 45 <212> DNA <213> Artificial Sequence <400> 357 tagtggagcc cttcactcac ttaaaaaaac aatagctgtg ttaac 45 <210> 358 <211> 45 <212> DNA <213> Artificial Sequence <400> 358 ttcaggcagg gctgccaaaa aaattcactc atcagtgcgt ctatt 45 <210> 359 <211> 45 <212> DNA <213> Artificial Sequence <400> 359 tagtggagcc tcgaactcac ttaaaaaaac tccttggctg tttcc 45 <210> 360 <211> 45 <212> DNA <213> Artificial Sequence <400> 360 ataatagggt gtgccaaaaa aaattcactc atcagtgcgt ctatt 45 <210> 361 <211> 45 <212> DNA <213> Artificial Sequence <400> 361 tagtggagcc tcgaactcac ttaaaaaaac atttcttgac acatc 45 <210> 362 <211> 45 <212> DNA <213> Artificial Sequence <400> 362 gcctcttccc atcattaaaa aaattcactc atcagtgcgt ctatt 45 <210> 363 <211> 45 <212> DNA <213> Artificial Sequence <400> 363 tagtggagcc tcgaactcac ttaaaaaaat cagctctgcc cagag 45 <210> 364 <211> 45 <212> DNA <213> Artificial Sequence <400> 364 tacccttgca gaaagcaaaa aaattcactc atcagtgcgt ctatt 45 <210> 365 <211> 45 <212> DNA <213> Artificial Sequence <400> 365 tagtggagcc tcgaactcac ttaaaaaaaa attttcctcg attgc 45 <210> 366 <211> 45 <212> DNA <213> Artificial Sequence <400> 366 atagcacacg cagaaaaaaa aaattcactc atcagtgcgt ctatt 45 <210> 367 <211> 45 <212> DNA <213> Artificial Sequence <400> 367 tagtggagcc tcgaactcac ttaaaaaaat ctagtttaca catcc 45 <210> 368 <211> 45 <212> DNA <213> Artificial Sequence <400> 368 aaagcggagg ttctgcaaaa aaattcactc agaagtgcgt ctatt 45 <210> 369 <211> 45 <212> DNA <213> Artificial Sequence <400> 369 tagtggagcc agtcactcac ttaaaaaaac aacatcgtag agatc 45 <210> 370 <211> 45 <212> DNA <213> Artificial Sequence <400> 370 tctaccgcaa aggaaaaaaa aaattcactc agaagtgcgt ctatt 45 <210> 371 <211> 45 <212> DNA <213> Artificial Sequence <400> 371 tagtggagcc agtcactcac ttaaaaaaag aaggtactct ctgac 45 <210> 372 <211> 45 <212> DNA <213> Artificial Sequence <400> 372 ctggatttgg gtgtgaaaaa aaattcactc agaagtgcgt ctatt 45 <210> 373 <211> 45 <212> DNA <213> Artificial Sequence <400> 373 tagtggagcc agtcactcac ttaaaaaaat ctatacccaca gtccc 45 <210> 374 <211> 45 <212> DNA <213> Artificial Sequence <400> 374 gccatgagga aggtgtaaaa aaattcactc agaagtgcgt ctatt 45 <210> 375 <211> 45 <212> DNA <213> Artificial Sequence <400> 375 tagtggagcc agtcactcac ttaaaaaaac tgggtgtgaa tggtg 45 <210> 376 <211> 45 <212> DNA <213> Artificial Sequence <400> 376 tgtgcacaca tgtaccaaaa aaattcactc agaagtgcgt ctatt 45 <210> 377 <211> 45 <212> DNA <213> Artificial Sequence <400> 377 tagtggagcc agtcactcac ttaaaaaaat gccaatgtca ccatc 45 <210> 378 <211> 45 <212> DNA <213> Artificial Sequence <400> 378 tggattttag ggcccaaaaa aaattcactc aagagtgcgt ctatt 45 <210> 379 <211> 45 <212> DNA <213> Artificial Sequence <400> 379 tagtggagcc gactactcac ttaaaaaaat ttctctgggg agcgc 45 <210> 380 <211> 45 <212> DNA <213> Artificial Sequence <400> 380 atctatggtt ccccgaaaaa aaattcactc aagagtgcgt ctatt 45 <210> 381 <211> 45 <212> DNA <213> Artificial Sequence <400> 381 tagtggagcc gactactcac ttaaaaaaac ccagttcagt ctatc 45 <210> 382 <211> 45 <212> DNA <213> Artificial Sequence <400> 382 agtcgagaaa ggggtgaaaa aaattcactc aagagtgcgt ctatt 45 <210> 383 <211> 45 <212> DNA <213> Artificial Sequence <400> 383 tagtggagcc gactactcac ttaaaaaaac tcagcactgg gtatc 45 <210> 384 <211> 45 <212> DNA <213> Artificial Sequence <400> 384 gacaccgctc actcataaaa aaattcactc aagagtgcgt ctatt 45 <210> 385 <211> 45 <212> DNA <213> Artificial Sequence <400> 385 tagtggagcc gactactcac ttaaaaaaag acaggcatca tccag 45 <210> 386 <211> 45 <212> DNA <213> Artificial Sequence <400> 386 aaaatgcaaa gcagtcaaaa aaattcactc aagagtgcgt ctatt 45 <210> 387 <211> 45 <212> DNA <213> Artificial Sequence <400> 387 tagtggagcc gactactcac ttaaaaaaaa taggtagaag agccc 45 <210> 388 <211> 45 <212> DNA <213> Artificial Sequence <400> 388 taaaaccact tccaagaaaa aaattcactc actgatgcgt ctatt 45 <210> 389 <211> 45 <212> DNA <213> Artificial Sequence <400> 389 tagtggagcc gatcactcac ttaaaaaaac acgacacatt ctcac 45 <210> 390 <211> 45 <212> DNA <213> Artificial Sequence <400> 390 gtattttaag ccacagaaaa aaattcactc actgatgcgt ctatt 45 <210> 391 <211> 45 <212> DNA <213> Artificial Sequence <400> 391 tagtggagcc gatcactcac ttaaaaaaaa ttgctagtgg gcatg 45 <210> 392 <211> 45 <212> DNA <213> Artificial Sequence <400> 392 tgacaatggg aaacacaaaa aaattcactc actgatgcgt ctatt 45 <210> 393 <211> 45 <212> DNA <213> Artificial Sequence <400> 393 tagtggagcc gatcactcac ttaaaaaaaa gtgggatctt caggc 45 <210> 394 <211> 45 <212> DNA <213> Artificial Sequence <400> 394 tgaacctact gcccttaaaa aaattcactc actgatgcgt ctatt 45 <210> 395 <211> 45 <212> DNA <213> Artificial Sequence <400> 395 tagtggagcc gatcactcac ttaaaaaaat agagacattc ttgcc 45 <210> 396 <211> 45 <212> DNA <213> Artificial Sequence <400> 396 ctgtcccttt cttagtaaaa aaattcactc actgatgcgt ctatt 45 <210> 397 <211> 45 <212> DNA <213> Artificial Sequence <400> 397 tagtggagcc gatcactcac ttaaaaaaat ggttgattga tagcc 45 <210> 398 <211> 45 <212> DNA <213> Artificial Sequence <400> 398 tacggactca tctgcaaaaa aaattcactc actcttgcgt ctatt 45 <210> 399 <211> 45 <212> DNA <213> Artificial Sequence <400> 399 tagtggagcc tcctactcac ttaaaaaaat tttggccatg ctgcc 45 <210> 400 <211> 45 <212> DNA <213> Artificial Sequence <400> 400 atggtctccg tcaggcaaaa aaattcactc actcttgcgt ctatt 45 <210> 401 <211> 45 <212> DNA <213> Artificial Sequence <400> 401 tagtggagcc tcctactcac ttaaaaaaag gcaacgtttg aggtc 45 <210> 402 <211> 45 <212> DNA <213> Artificial Sequence <400> 402 gatgtgcatt gctaggaaaa aaattcactc actcttgcgt ctatt 45 <210> 403 <211> 45 <212> DNA <213> Artificial Sequence <400> 403 tagtggagcc tcctactcac ttaaaaaaaa ctataggcaa aatgg 45 <210> 404 <211> 45 <212> DNA <213> Artificial Sequence <400> 404 caaaacttga agctcaaaaa aaattcactc actcttgcgt ctatt 45 <210> 405 <211> 45 <212> DNA <213> Artificial Sequence <400> 405 tagtggagcc tcctactcac ttaaaaaaag tgaacccttc ctcca 45 <210> 406 <211> 45 <212> DNA <213> Artificial Sequence <400> 406 accacaaagc cctatcaaaa aaattcactc actcttgcgt ctatt 45 <210> 407 <211> 45 <212> DNA <213> Artificial Sequence <400> 407 tagtggagcc tcctactcac ttaaaaaaac caggggtaat cattc 45 <210> 408 <211> 45 <212> DNA <213> Artificial Sequence <400> 408 cgagtagccc acagggaaaa aaattcactc actgatgcgt ctatt 45 <210> 409 <211> 45 <212> DNA <213> Artificial Sequence <400> 409 tagtggagcc tcagactcac ttaaaaaaat ttcacagtgg atgcc 45 <210> 410 <211> 45 <212> DNA <213> Artificial Sequence <400> 410 caccttgaag gtcttcaaaa aaattcactc actgatgcgt ctatt 45 <210> 411 <211> 45 <212> DNA <213> Artificial Sequence <400> 411 tagtggagcc tcagactcac ttaaaaaaac gtcgaggctg taagc 45 <210> 412 <211> 45 <212> DNA <213> Artificial Sequence <400> 412 tgtgggctac cttgtaaaaa aaattcactc actgatgcgt ctatt 45 <210> 413 <211> 45 <212> DNA <213> Artificial Sequence <400> 413 tagtggagcc tcagactcac ttaaaaaaat gcacaccatc atcac 45 <210> 414 <211> 45 <212> DNA <213> Artificial Sequence <400> 414 ctctgaaatc ccctggaaaa aaattcactc actgatgcgt ctatt 45 <210> 415 <211> 45 <212> DNA <213> Artificial Sequence <400> 415 tagtggagcc tcagactcac ttaaaaaaaa aagggtgaag ggcaa 45 <210> 416 <211> 45 <212> DNA <213> Artificial Sequence <400> 416 cagtgcaagg gtcaagaaaa aaattcactc actgatgcgt ctatt 45 <210> 417 <211> 45 <212> DNA <213> Artificial Sequence <400> 417 tagtggagcc tcagactcac ttaaaaaaat tgtcaactga ggctc 45 <210> 418 <211> 45 <212> DNA <213> Artificial Sequence <400> 418 ctttgctcag ctggaaaaaa aaattcactc atcgatgcgt ctatt 45 <210> 419 <211> 45 <212> DNA <213> Artificial Sequence <400> 419 tagtggagcc cttcactcac ttaaaaaaat ctgttttgcg gctga 45 <210> 420 <211> 45 <212> DNA <213> Artificial Sequence <400> 420 tgacaggtgg tccaggaaaa aaattcactc atcgatgcgt ctatt 45 <210> 421 <211> 45 <212> DNA <213> Artificial Sequence <400> 421 tagtggagcc cttcactcac ttaaaaaaaa gggaaggcaa tagac 45 <210> 422 <211> 45 <212> DNA <213> Artificial Sequence <400> 422 aggagatgct tgcaaaaaaa aaattcactc atcgatgcgt ctatt 45 <210> 423 <211> 45 <212> DNA <213> Artificial Sequence <400> 423 tagtggagcc cttcactcac ttaaaaaaag cacatcctgg tcttc 45 <210> 424 <211> 45 <212> DNA <213> Artificial Sequence <400> 424 cacaaggttg tcatggaaaa aaattcactc atcgatgcgt ctatt 45 <210> 425 <211> 45 <212> DNA <213> Artificial Sequence <400> 425 tagtggagcc cttcactcac ttaaaaaaat cagctccttg gaaac 45 <210> 426 <211> 45 <212> DNA <213> Artificial Sequence <400> 426 gaagcttatg aactgaaaaa aaattcactc atcgatgcgt ctatt 45 <210> 427 <211> 45 <212> DNA <213> Artificial Sequence <400> 427 tagtggagcc cttcactcac ttaaaaaaag ctccagagct ctatg 45 <210> 428 <211> 45 <212> DNA <213> Artificial Sequence <400> 428 cctcaagctc caacagaaaa aaattcactc agatctgcgt ctatt 45 <210> 429 <211> 45 <212> DNA <213> Artificial Sequence <400> 429 tagtggagcc agtcactcac ttaaaaaaat ccgtttgttt ctctc 45 <210> 430 <211> 45 <212> DNA <213> Artificial Sequence <400> 430 acgttggggt cgtcttaaaa aaattcactc agatctgcgt ctatt 45 <210> 431 <211> 45 <212> DNA <213> Artificial Sequence <400> 431 tagtggagcc agtcactcac ttaaaaaaac tcacttctga tttcc 45 <210> 432 <211> 45 <212> DNA <213> Artificial Sequence <400> 432 ttgaacgtcc tcccttaaaa aaattcactc agatctgcgt ctatt 45 <210> 433 <211> 45 <212> DNA <213> Artificial Sequence <400> 433 tagtggagcc agtcactcac ttaaaaaaaa ttaaactcgc tggtc 45 <210> 434 <211> 45 <212> DNA <213> Artificial Sequence <400> 434 tgacttcgtg caagttaaaa aaattcactc agatctgcgt ctatt 45 <210> 435 <211> 45 <212> DNA <213> Artificial Sequence <400> 435 tagtggagcc agtcactcac ttaaaaaaat ccaccacgaa ctctc 45 <210> 436 <211> 45 <212> DNA <213> Artificial Sequence <400> 436 tacgagatcc aaaatgaaaa aaattcactc agatctgcgt ctatt 45 <210> 437 <211> 45 <212> DNA <213> Artificial Sequence <400> 437 tagtggagcc agtcactcac ttaaaaaaaa gccatggtgg tcatc 45 <210> 438 <211> 45 <212> DNA <213> Artificial Sequence <400> 438 cccaatgtag aggaagaaaa aaattcactc aaggatgcgt ctatt <210> 439 <211> 45 <212> DNA <213> Artificial Sequence <400> 439 45. tagtggagcc cttcactcac ttaaaaaaaa cagggacacg atgtc <210> 440 <211> 45 <212> DNA <213> Artificial Sequence <400> 440 tgaatgagga tgtccgaaaa aaattcactc aaggatgcgt ctatt <210> 441 <211> 45 <212> DNA <213> Artificial Sequence <400> 441 45. tagtggagcc cttcactcac ttaaaaaaag gacaccagct ttgtc <210> 442 <211> 44 <212> DNA <213> Artificial Sequence <400> 442 agatttctcc accgtaaaaa aattcactca aggtgcgtc tatt <210> 443 <211> 45 <212> DNA <213> Artificial Sequence <400> 443 tagtggagcc cttcactcac ttaaaaaaat ttctacccac agctc 45 <210> 444 <211> 45 <212> DNA <213> Artificial Sequence <400> 444 ctccaagagc ttccttaaaa aaattcactc aaggatgcgt ctatt 45 <210> 445 <211> 45 <212> DNA <213> Artificial Sequence <400> 445 tagtggagcc cttcactcac ttaaaaaaat aatcccaggc tggtc 45 <210> 446 <211> 45 <212> DNA <213> Artificial Sequence <400> 446 tcactctcat ccgaggaaaa aaattcactc aaggatgcgt ctatt 45 <210> 447 <211> 45 <212> DNA <213> Artificial Sequence <400> 447 tagtggagcc cttcactcac ttaaaaaaat gtagtgatga gtctc 45 <210> 448 <211> 45 <212> DNA <213> Artificial Sequence <400> 448 cggatatcaa ggaatcaaaa aaattcactc aagagtgcgt ctatt 45 <210> 449 <211> 45 <212> DNA <213> Artificial Sequence <400> 449 tagtggagcc cttcactcac ttaaaaaaaa ttgtccttgg tgaga 45 <210> 450 <211> 45 <212> DNA <213> Artificial Sequence <400> 450 cacatggcaa aacattaaaa aaattcactc aagagtgcgt ctatt 45 <210> 451 <211> 45 <212> DNA <213> Artificial Sequence <400> 451 tagtggagcc cttcactcac ttaaaaaaat cacttgttca ggttc 45 <210> 452 <211> 45 <212> DNA <213> Artificial Sequence <400> 452 acacacccaa aaaaggaaaa aaattcactc aagagtgcgt ctatt 45 <210> 453 <211> 45 <212> DNA <213> Artificial Sequence <400> 453 tagtggagcc cttcactcac ttaaaaaaaa gctgcattcc taagc 45 <210> 454 <211> 45 <212> DNA <213> Artificial Sequence <400> 454 caaatgcttt tcccccaaaa aaattcactc aagagtgcgt ctatt 45 <210> 455 <211> 45 <212> DNA <213> Artificial Sequence <400> 455 tagtggagcc cttcactcac ttaaaaaaaa agtgacaaag ttttc 45 <210> 456 <211> 45 <212> DNA <213> Artificial Sequence <400> 456 aaggagtttt ctcagcaaaa aaattcactc aagagtgcgt ctatt 45 <210> 457 <211> 45 <212> DNA <213> Artificial Sequence <400> 457 tagtggagcc cttcactcac ttaaaaaaac ttgacccctt gatgc 45 <210> 458 <211> 45 <212> DNA <213> Artificial Sequence <400> 458 ccatcaggga cggagaaaaa aaattcactc atcgatgcgt ctatt 45 <210> 459 <211> 45 <212> DNA <213> Artificial Sequence <400> 459 tagtggagcc agctactcac ttaaaaaaag gtttagacga gaatc 45 <210> 460 <211> 45 <212> DNA <213> Artificial Sequence <400> 460 tgtagaagtg tcgcctaaaa aaattcactc atcgatgcgt ctatt 45 <210> 461 <211> 45 <212> DNA <213> Artificial Sequence <400> 461 tagtggagcc agctactcac ttaaaaaaag cgcagcccaa acatc 45 <210> 462 <211> 45 <212> DNA <213> Artificial Sequence <400> 462 aggaaccatt tctgctaaaa aaattcactc atcgatgcgt ctatt 45 <210> 463 <211> 45 <212> DNA <213> Artificial Sequence <400> 463 tagtggagcc agctactcac ttaaaaaaag tgtgatgagg tgtcc 45 <210> 464 <211> 45 <212> DNA <213> Artificial Sequence <400> 464 cgtttggccc ttctgcaaaa aaattcactc atcgatgcgt ctatt 45 <210> 465 <211> 45 <212> DNA <213> Artificial Sequence <400> 465 tagtggagcc agctactcac ttaaaaaaag tgatgcttgg gacta 45 <210> 466 <211> 45 <212> DNA <213> Artificial Sequence <400> 466 ggaacgtgtg tgtgtgaaaa aaattcactc atcgatgcgt ctatt 45 <210> 467 <211> 45 <212> DNA <213> Artificial Sequence <400> 467 tagtggagcc agctactcac ttaaaaaaat gtaggtggtt gaatg 45 <210> 468 <211> 45 <212> DNA <213> Artificial Sequence <400> 468 ctgttatccc tcccacaaaa aaattcactc atcgatgcgt ctatt 45 <210> 469 <211> 45 <212> DNA <213> Artificial Sequence <400> 469 tagtggagcc ctagactcac ttaaaaaaag gtgctgcaga attgc 45 <210> 470 <211> 45 <212> DNA <213> Artificial Sequence <400> 470 aaatagcgag cagactaaaa aaattcactc atcgatgcgt ctatt 45 <210> 471 <211> 45 <212> DNA <213> Artificial Sequence <400> 471 tagtggagcc ctagactcac ttaaaaaaat gagtagccat gtacc 45 <210> 472 <211> 45 <212> DNA <213> Artificial Sequence <400> 472 cactgatgga gacctcaaaa aaattcactc atcgatgcgt ctatt 45 <210> 473 <211> 45 <212> DNA <213> Artificial Sequence <400> 473 tagtggagcc ctagactcac ttaaaaaaat ctaaggtcgt agagc 45 <210> 474 <211> 44 <212> DNA <213> Artificial Sequence <400> 474 gcttgaagca ggtcaaaaaa aattcactca tcgatgcgtc tatt 44 <210> 475 <211> 45 <212> DNA <213> Artificial Sequence <400> 475 tagtggagcc ctagactcac ttaaaaaaaa tcctgttgga cgttg 45 <210> 476 <211> 45 <212> DNA <213> Artificial Sequence <400> 476 taactggggt tacattaaaa aaattcactc atcgatgcgt ctatt 45 <210> 477 <211> 45 <212> DNA <213> Artificial Sequence <400> 477 tagtggagcc ctagactcac ttaaaaaaaa ttcttcacac gtcac 45 <210> 478 <211> 45 <212> DNA <213> Artificial Sequence <400> 478 gatgtgtgcc tggtggaaaa aaattcactc actgatgcgt ctatt 45 <210> 479 <211> 45 <212> DNA <213> Artificial Sequence <400> 479 tagtggagcc tctcactcac ttaaaaaaac aggtggcgct tgaag 45 <210> 480 <211> 45 <212> DNA <213> Artificial Sequence <400> 480 catgttttct ggggggaaaa aaattcactc actgatgcgt ctatt 45 <210> 481 <211> 45 <212> DNA <213> Artificial Sequence <400> 481 tagtggagcc tctcactcac ttaaaaaaag caggctcact tggtc 45 <210> 482 <211> 45 <212> DNA <213> Artificial Sequence <400> 482 atttgatgga ggcacaaaaa aaattcactc actgatgcgt ctatt 45 <210> 483 <211> 45 <212> DNA <213> Artificial Sequence <400> 483 tagtggagcc tctcactcac ttaaaaaaaa tctccagggg tcaac 45 <210> 484 <211> 45 <212> DNA <213> Artificial Sequence <400> 484 cgtccaaaca gggcacaaaa aaattcactc actgatgcgt ctatt 45 <210> 485 <211> 45 <212> DNA <213> Artificial Sequence <400> 485 tagtggagcc tctcactcac ttaaaaaaac tctctctcaa gtgaa 45 <210> 486 <211> 45 <212> DNA <213> Artificial Sequence <400> 486 aggggaagcc aacagaaaaa aaattcactc actgatgcgt ctatt 45 <210> 487 <211> 45 <212> DNA <213> Artificial Sequence <400> 487 tagtggagcc tctcactcac ttaaaaaaaa agggtttcct gtacc 45 <210> 488 <211> 45 <212> DNA <213> Artificial Sequence <400> 488 gaacgggttg gactaaaaaa aaattcactc atcgatgcgt ctatt 45 <210> 489 <211> 45 <212> DNA <213> Artificial Sequence <400> 489 tagtggagcc agagactcac ttaaaaaaac agggccttta tggag 45 <210> 490 <211> 45 <212> DNA <213> Artificial Sequence <400> 490 ctccagcgat tcaaccaaaa aaattcactc atcgatgcgt ctatt 45 <210> 491 <211> 45 <212> DNA <213> Artificial Sequence <400> 491 tagtggagcc agagactcac ttaaaaaaaa gaactggatc tcctc 45 <210> 492 <211> 45 <212> DNA <213> Artificial Sequence <400> 492 ttcgagtcct taatgaaaaa aaattcactc atcgatgcgt ctatt 45 <210> 493 <211> 45 <212> DNA <213> Artificial Sequence <400> 493 tagtggagcc agagactcac ttaaaaaaag tccttgtgct cctgc 45 <210> 494 <211> 45 <212> DNA <213> Artificial Sequence <400> 494 tgccaagtgc tgagaaaaaa aaattcactc atcgatgcgt ctatt 45 <210> 495 <211> 45 <212> DNA <213> Artificial Sequence <400> 495 tagtggagcc agagactcac ttaaaaaaac ttatgccata gatcc 45 <210> 496 <211> 45 <212> DNA <213> Artificial Sequence <400> 496 tacctgccca ccaatcaaaa aaattcactc atcgatgcgt ctatt 45 <210> 497 <211> 45 <212> DNA <213> Artificial Sequence <400> 497 tagtggagcc agagactcac ttaaaaaaat gctcaatgtc ttccc 45 <210> 498 <211> 45 <212> DNA <213> Artificial Sequence <400> 498 aggccatcca cagacgaaaa aaattcactc aagagtgcgt ctatt 45 <210> 499 <211> 45 <212> DNA <213> Artificial Sequence <400> 499 tagtggagcc gagaactcac ttaaaaaaag ctgtgatgaa cagac 45 <210> 500 <211> 45 <212> DNA <213> Artificial Sequence <400> 500 ctgttcctgg gtagcgaaaa aaattcactc aagagtgcgt ctatt 45 <210> 501 <211> 45 <212> DNA <213> Artificial Sequence <400> 501 tagtggagcc gagaactcac ttaaaaaaat cggattggga atgtc 45 <210> 502 <211> 45 <212> DNA <213> Artificial Sequence <400> 502 catctctgtg gctgtgaaaa aaattcactc aagagtgcgt ctatt 45 <210> 503 <211> 45 <212> DNA <213> Artificial Sequence <400> 503 tagtggagcc gagaactcac ttaaaaaaag aacagtaact gtggc 45 <210> 504 <211> 45 <212> DNA <213> Artificial Sequence <400> 504 aagttcaagg agccctaaaa aaattcactc aagagtgcgt ctatt 45 <210> 505 <211> 45 <212> DNA <213> Artificial Sequence <400> 505 tagtggagcc gagaactcac ttaaaaaaac agtcctcgaa ggagc 45 <210> 506 <211> 45 <212> DNA <213> Artificial Sequence <400> 506 tcctggagtg ctgtgaaaaa aaattcactc aagagtgcgt ctatt 45 <210> 507 <211> 45 <212> DNA <213> Artificial Sequence <400> 507 tagtggagcc gagaactcac ttaaaaaaat cagagatcca cctgc 45 <210> 508 <211> 45 <212> DNA <213> Artificial Sequence <400> 508 cttggatttg gggaagaaaa aaattcactc atcagtgcgt ctatt 45 <210> 509 <211> 45 <212> DNA <213> Artificial Sequence <400> 509 tagtggagcc cttcactcac ttaaaaaaat ctggtggtag cgtta 45 <210> 510 <211> 45 <212> DNA <213> Artificial Sequence <400> 510 ccaatttcaa gtgagaaaaa aaattcactc atcagtgcgt ctatt 45 <210> 511 <211> 45 <212> DNA <213> Artificial Sequence <400> 511 tagtggagcc cttcactcac ttaaaaaaat acatcaaacc tgtgc 45 <210> 512 <211> 45 <212> DNA <213> Artificial Sequence <400> 512 cgacaatggg aaatgtaaaa aaattcactc atcagtgcgt ctatt 45 <210> 513 <211> 45 <212> DNA <213> Artificial Sequence <400> 513 tagtggagcc cttcactcac ttaaaaaaat gtggtgagtg agaaa 45 <210> 514 <211> 45 <212> DNA <213> Artificial Sequence <400> 514 tttcaggcac aggaccaaaa aaattcactc atcagtgcgt ctatt 45 <210> 515 <211> 45 <212> DNA <213> Artificial Sequence <400> 515 tagtggagcc cttcactcac ttaaaaaaag tagaaccaag ccccc 45 <210> 516 <211> 45 <212> DNA <213> Artificial Sequence <400> 516 acagtagctt cgggtcaaaa aaattcactc atcagtgcgt ctatt 45 <210> 517 <211> 45 <212> DNA <213> Artificial Sequence <400> 517 tagtggagcc cttcactcac ttaaaaaaag tgttcattca cacac 45 <210> 518 <211> 45 <212> DNA <213> Artificial Sequence <400> 518 tgccggaact ccatggaaaa aaattcactc atcgatgcgt ctatt 45 <210> 519 <211> 45 <212> DNA <213> Artificial Sequence <400> 519 tagtggagcc ctgaactcac ttaaaaaaac ttccgaaact cctcc 45 <210> 520 <211> 45 <212> DNA <213> Artificial Sequence <400> 520 atggcaagca gggtataaaa aaattcactc atcgatgcgt ctatt 45 <210> 521 <211> 45 <212> DNA <213> Artificial Sequence <400> 521 tagtggagcc ctgaactcac ttaaaaaaaa tttgctccag atgcc 45 <210> 522 <211> 45 <212> DNA <213> Artificial Sequence <400> 522 cccagagatg gcaaagaaaa aaattcactc atcgatgcgt ctatt 45 <210> 523 <211> 45 <212> DNA <213> Artificial Sequence <400> 523 tagtggagcc ctgaactcac ttaaaaaaaa gtggttcacg ttaaa 45 <210> 524 <211> 45 <212> DNA <213> Artificial Sequence <400> 524 ctttcagggg agtctgaaaa aaattcactc atcgatgcgt ctatt 45 <210> 525 <211> 45 <212> DNA <213> Artificial Sequence <400> 525 tagtggagcc ctgaactcac ttaaaaaaaa acaagcggag aacga 45 <210> 526 <211> 45 <212> DNA <213> Artificial Sequence <400> 526 cgtcacagag acagacaaaa aaattcactc atcgatgcgt ctatt 45 <210> 527 <211> 45 <212> DNA <213> Artificial Sequence <400> 527 tagtggagcc ctgaactcac ttaaaaaaag gcagggcagg attta 45 <210> 528 <211> 45 <212> DNA <213> Artificial Sequence <400> 528 tcaaggaaac tgtcccaaaa aaattcactc aagcttgcgt ctatt 45 <210> 529 <211> 45 <212> DNA <213> Artificial Sequence <400> 529 tagtggagcc gatcactcac ttaaaaaaat ccacgctgag agttc 45 <210> 530 <211> 45 <212> DNA <213> Artificial Sequence <400> 530 cgaaagattt tccactaaaa aaattcactc aagcttgcgt ctatt 45 <210> 531 <211> 45 <212> DNA <213> Artificial Sequence <400> 531 tagtggagcc gatcactcac ttaaaaaaag gttcgtggaa aggcc 45 <210> 532 <211> 45 <212> DNA <213> Artificial Sequence <400> 532 tcatccactg gacattaaaa aaattcactc aagcttgcgt ctatt 45 <210> 533 <211> 45 <212> DNA <213> Artificial Sequence <400> 533 tagtggagcc gatcactcac ttaaaaaaat tccaactgct cttgc 45 <210> 534 <211> 45 <212> DNA <213> Artificial Sequence <400> 534 tactcaccag cccctaaaaa aaattcactc aagcttgcgt ctatt 45 <210> 535 <211> 45 <212> DNA <213> Artificial Sequence <400> 535 tagtggagcc gatcactcac ttaaaaaaaa agaaagctat taccc 45 <210> 536 <211> 45 <212> DNA <213> Artificial Sequence <400> 536 atggattgat tctggaaaaa aaattcactc aagcttgcgt ctatt 45 <210> 537 <211> 45 <212> DNA <213> Artificial Sequence <400> 537 tagtggagcc gatcactcac ttaaaaaaat caaaagcgaa ctcac 45 <210> 538 <211> 45 <212> DNA <213> Artificial Sequence <400> 538 ctctcctcgg tgaatcaaaa aaattcactc agaagtgcgt ctatt 45 <210> 539 <211> 45 <212> DNA <213> Artificial Sequence <400> 539 tagtggagcc tcgaactcac ttaaaaaaat tctcttcttt ccagc 45 <210> 540 <211> 46 <212> DNA <213> Artificial Sequence <400> 540 tcgtgtgtga gtccttgaaa aaaattcact cagaagtgcg tctatt 46 <210> 541 <211> 45 <212> DNA <213> Artificial Sequence <400> 541 tagtggagcc tcgaactcac ttaaaaaaac cataatgggt agttc 45 <210> 542 <211> 45 <212> DNA <213> Artificial Sequence <400> 542 ttggcggtgt gcctgtaaaa aaattcactc agaagtgcgt ctatt 45 <210> 543 <211> 45 <212> DNA <213> Artificial Sequence <400> 543 tagtggagcc tcgaactcac ttaaaaaaac atgctctctg gctcc 45 <210> 544 <211> 45 <212> DNA <213> Artificial Sequence <400> 544 agagggacag cacgagaaaa aaattcactc agaagtgcgt ctatt 45 <210> 545 <211> 45 <212> DNA <213> Artificial Sequence <400> 545 tagtggagcc tcgaactcac ttaaaaaaaa ccatgagaag tggcc 45 <210> 546 <211> 45 <212> DNA <213> Artificial Sequence <400> 546 ctggagggca aacactaaaa aaattcactc agaagtgcgt ctatt 45 <210> 547 <211> 45 <212> DNA <213> Artificial Sequence <400> 547 tagtggagcc tcgaactcac ttaaaaaaaa ggtcgttcag tcaca 45
Claims
1. A probe primer set for in situ RNA detection, wherein the sample for in situ RNA detection is cells cultured in vitro or cells in tissue sections, characterized in that: It includes at least one circulating probe for forming rolling circle amplification products, a first to fourth detection probe set capable of hybridizing with the rolling circle amplification products, a splice primer, a first anchoring primer and a second anchoring primer, wherein the circulating probe is a dual-connected probe, and the splice primer is used to cooperate with the circulating probe to form a circumference after hybridization. Each looping probe corresponds to a target sequence, and its 5' and 3' ends are specifically hybridized and complementary to the target sequence. It also has a first tag sequence and a second tag sequence between its 5' and 3' ends. The first tag sequence is located at the 3' end of the 5' end sequence that is specifically hybridized and complementary to the target sequence, and the second tag sequence is located at the 5' end of the 3' end sequence that is specifically hybridized and complementary to the target sequence. The first tag sequence consists of a first fixed tag sequence and a first variable tag sequence; the second tag sequence consists of a second fixed tag sequence and a second variable tag sequence; the first variable tag sequence consists of a first dibase tag sequence and a second dibase tag sequence, wherein the first dibase tag sequence is cw, as, ts, or gw, and the second dibase tag sequence is cw, as, ts, or gw; the second variable tag sequence consists of a third dibase tag sequence and a fourth dibase tag sequence, wherein the third dibase tag sequence is cw, as, ts, or gw, and the fourth dibase tag sequence is cw, as, ts, or gw. The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is completely identical to the first dibase tag sequence in the first fixed tag sequence and the first dibase tag sequence. The remaining dibases are cw, as, ts or gw. The first detection probes corresponding to different first dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same. The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence, and the second detection probe in a second detection probe subgroup is exactly the same as the second dibase tag sequence in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The second detection probes corresponding to different second dibase tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same. The third detection probe group consists of several third detection probe subgroups, wherein the length of each third detection probe is the same as that of the second tag sequence. The third detection probe in a third detection probe subgroup is exactly the same as the third dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The third detection probes corresponding to different third dibase tag sequences are modified with different report tags, and the report tags modified by the third detection probes in the same third detection probe subgroup are the same. The fourth detection probe group consists of several fourth detection probe subgroups, wherein the length of each fourth detection probe is the same as that of the second tag sequence. The fourth detection probe in a fourth detection probe subgroup is exactly the same as the fourth dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The fourth detection probes corresponding to different fourth dibase tag sequences are modified with different report tags, and the report tags modified by the fourth detection probes in the same fourth detection probe subgroup are the same. The first anchoring primer is strictly complementary to the rolling circle amplification product and can be linked to the first and second detection probes after hybridization under the action of DNA polymerase. The second anchoring primer is strictly complementary to the rolling circle amplification product and can be linked to the third and fourth detection probes after hybridization under the action of DNA polymerase.
2. An RNA in situ detection kit, characterized in that: It has at least one circulating probe for forming rolling circle amplification products, a first to fourth set of detection probes capable of hybridizing with the rolling circle amplification products, a splice primer, a first anchoring primer and a second anchoring primer, the circulating probe being a dual-connected probe, and the splice primer being used to cooperate with the circulating probe to form a circumference after hybridization. Each looping probe corresponds to a target sequence, and its 5' and 3' ends are specifically hybridized and complementary to the target sequence. It also has a first tag sequence and a second tag sequence between its 5' and 3' ends. The first tag sequence is located at the 3' end of the 5' end sequence that is specifically hybridized and complementary to the target sequence, and the second tag sequence is located at the 5' end of the 3' end sequence that is specifically hybridized and complementary to the target sequence. The first tag sequence consists of a first fixed tag sequence and a first variable tag sequence. The second tag sequence consists of a second fixed tag sequence and a second variable tag sequence. The first variable tag sequence consists of a first dibasic tag sequence and a second dibasic tag sequence. The first dibasic tag sequence is cw, as, ts, or gw. The second dibasic tag sequence is cw, as, ts, or gw. The second variable tag sequence consists of a third dibasic tag sequence and a fourth dibasic tag sequence. The third dibasic tag sequence is cw, as, ts, or gw. The fourth dibasic tag sequence is cw, as, ts, or gw. The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is completely identical to the first dibase tag sequence in the first fixed tag sequence and the first dibase tag sequence. The remaining dibases are cw, as, ts or gw. The first detection probes corresponding to different first dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same. The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence, and the second detection probe in a second detection probe subgroup is exactly the same as the second dibase tag sequence in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The second detection probes corresponding to different second dibase tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same. The third detection probe group consists of several third detection probe subgroups, wherein the length of each third detection probe is the same as that of the second tag sequence. The third detection probe in a third detection probe subgroup is exactly the same as the third dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The third detection probes corresponding to different third dibase tag sequences are modified with different report tags, and the report tags modified by the third detection probes in the same third detection probe subgroup are the same. The fourth detection probe group consists of several fourth detection probe subgroups, wherein the length of each fourth detection probe is the same as that of the second tag sequence. The fourth detection probe in a fourth detection probe subgroup is exactly the same as the fourth dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The fourth detection probes corresponding to different fourth dibase tag sequences are modified with different report tags, and the report tags modified by the fourth detection probes in the same fourth detection probe subgroup are the same. The first anchoring primer is strictly complementary to the rolling circle amplification product and can be linked to the first and second detection probes after hybridization under the action of DNA polymerase. The second anchoring primer is strictly complementary to the rolling circle amplification product and can be linked to the third and fourth detection probes after hybridization under the action of DNA polymerase.
3. The application of probe-primer sets in in situ RNA detection for non-diagnostic and therapeutic purposes, wherein the samples for in situ RNA detection are cells cultured in vitro and cells in tissue sections, characterized in that: The probe primer set includes at least one circulating probe for forming rolling circle amplification products, a first to fourth detection probe set capable of hybridizing with the rolling circle amplification products, a clip primer, a first anchor primer and a second anchor primer. The circulating probe is a dual-connected probe, and the clip primer is used to cooperate with the circulating probe to form a circumference after hybridization. Each looping probe corresponds to a target sequence, and its 5' and 3' ends are specifically hybridized and complementary to the target sequence. It also has a first tag sequence and a second tag sequence between its 5' and 3' ends. The first tag sequence is located at the 3' end of the 5' end sequence that is specifically hybridized and complementary to the target sequence, and the second tag sequence is located at the 5' end of the 3' end sequence that is specifically hybridized and complementary to the target sequence. The first tag sequence consists of a first fixed tag sequence and a first variable tag sequence. The second tag sequence consists of a second fixed tag sequence and a second variable tag sequence. The first variable tag sequence consists of a first dibasic tag sequence and a second dibasic tag sequence. The first dibasic tag sequence is cw, as, ts, or gw. The second dibasic tag sequence is cw, as, ts, or gw. The second variable tag sequence consists of a third dibasic tag sequence and a fourth dibasic tag sequence. The third dibasic tag sequence is cw, as, ts, or gw. The fourth dibasic tag sequence is cw, as, ts, or gw. The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is completely identical to the first dibase tag sequence in the first fixed tag sequence and the first dibase tag sequence. The remaining dibases are cw, as, ts or gw. The first detection probes corresponding to different first dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same. The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence, and the second detection probe in a second detection probe subgroup is exactly the same as the second dibase tag sequence in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The second detection probes corresponding to different second dibase tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same. The third detection probe group consists of several third detection probe subgroups, wherein the length of each third detection probe is the same as that of the second tag sequence. The third detection probe in a third detection probe subgroup is exactly the same as the third dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The third detection probes corresponding to different third dibase tag sequences are modified with different report tags, and the report tags modified by the third detection probes in the same third detection probe subgroup are the same. The fourth detection probe group consists of several fourth detection probe subgroups, wherein the length of each fourth detection probe is the same as that of the second tag sequence. The fourth detection probe in a fourth detection probe subgroup is exactly the same as the fourth dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The fourth detection probes corresponding to different fourth dibase tag sequences are modified with different report tags, and the report tags modified by the fourth detection probes in the same fourth detection probe subgroup are the same. The first anchoring primer is strictly complementary to the rolling circle amplification product and can be linked to the first and second detection probes after hybridization under the action of DNA polymerase. The second anchoring primer is strictly complementary to the rolling circle amplification product and can be linked to the third and fourth detection probes after hybridization under the action of DNA polymerase.
4. A method for in situ detection of RNA for non-diagnostic and therapeutic purposes, characterized in that: Includes the following steps: (1) Design at least one looping probe, which is a double-connected probe: Each looping probe corresponds to a target sequence, and its 5' and 3' ends are specifically hybridized and complementary to the target sequence. It also has a first tag sequence and a second tag sequence between its 5' and 3' ends. The first tag sequence is located at the 3' end of the 5' end sequence that is specifically hybridized and complementary to the target sequence, and the second tag sequence is located at the 5' end of the 3' end sequence that is specifically hybridized and complementary to the target sequence. The first tag sequence consists of a first fixed tag sequence and a first variable tag sequence. The second tag sequence consists of a second fixed tag sequence and a second variable tag sequence. The first variable tag sequence consists of a first dibasic tag sequence and a second dibasic tag sequence. The first dibasic tag sequence is cw, as, ts, or gw. The second dibasic tag sequence is cw, as, ts, or gw. The second variable tag sequence consists of a third dibasic tag sequence and a fourth dibasic tag sequence. The third dibasic tag sequence is cw, as, ts, or gw. The fourth dibasic tag sequence is cw, as, ts, or gw. (2) Design the first to fourth detection probe groups: The first detection probe group consists of several first detection probe subgroups, wherein the length of each first detection probe is the same as that of the first tag sequence. The first detection probe in a first detection probe subgroup is completely identical to the first dibase tag sequence in the first fixed tag sequence and the first dibase tag sequence. The remaining dibases are cw, as, ts or gw. The first detection probes corresponding to different first dibase tag sequences are modified with different report tags, and the report tags modified by the first detection probes in the same first detection probe subgroup are the same. The second detection probe group consists of several second detection probe subgroups, wherein the length of each second detection probe is the same as that of the first tag sequence, and the second detection probe in a second detection probe subgroup is exactly the same as the second dibase tag sequence in the first fixed tag sequence and the first variable tag sequence. The remaining dibases are cw, as, ts or gw. The second detection probes corresponding to different second dibase tag sequences are modified with different report tags, and the report tags modified by the second detection probes in the same second detection probe subgroup are the same. The third detection probe group consists of several third detection probe subgroups, wherein the length of each third detection probe is the same as that of the second tag sequence. The third detection probe in a third detection probe subgroup is exactly the same as the third dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The third detection probes corresponding to different third dibase tag sequences are modified with different report tags, and the report tags modified by the third detection probes in the same third detection probe subgroup are the same. The fourth detection probe group consists of several fourth detection probe subgroups, wherein the length of each fourth detection probe is the same as that of the second tag sequence. The fourth detection probe in a fourth detection probe subgroup is exactly the same as the fourth dibase tag sequence of the second fixed tag sequence and the second variable tag sequence. The remaining dibases are cw, as, ts or gw. The fourth detection probes corresponding to different fourth dibase tag sequences are modified with different report tags, and the report tags modified by the fourth detection probes in the same fourth detection probe subgroup are the same. (3) After the at least one circular probe specifically binds to at least one target sequence in the sample to be tested, the 3' and 5' ends of the at least one circular probe are made to be adjacent to each other by adding a clamping sequence, and then the probe is ligated by DNA ligase to form at least one circular template. Then, rolling circle amplification is performed to obtain at least one rolling circle amplification product. (4) Hybridize the at least one rolling circle amplification product with the first detection probe set for detection to obtain a first signal; (5) Remove the first signal and then hybridize it with the second detection probe group to obtain the second signal; In steps (4) and (5) above, a first anchoring primer is added for hybridization. The first anchoring primer is strictly complementary to the rolling circle amplification product and is linked to the first and second detection probes after hybridization under the action of DNA polymerase. (6) Remove the second signal and then hybridize it with the second detection probe group to obtain the third signal; (7) Remove the third signal and then hybridize it with the second detection probe group for detection to obtain the fourth signal; In steps (6) and (7) above, a second anchoring primer is added for hybridization. The second anchoring primer is strictly complementary to the rolling circle amplification product and is linked to the third and fourth detection probes after hybridization under the action of DNA polymerase. (8) Based on the permutation and combination of the first to fourth signals, at least one signal code corresponding to the at least one target sequence is obtained.