A urine PCR kit for predicting renal function progression of IgA nephropathy

By detecting the expression level of miRNA-142-3p in the urine of patients with IgA nephropathy, a non-invasive PCR kit and prediction model are provided, which solves the complexity and risks of renal biopsy and enables early and accurate assessment of renal function progression.

CN114921541BActive Publication Date: 2026-02-03THE FIRST MEDICAL CENT CHINESE PLA GENERAL HOSPITAL
View PDF 10 Cites 0 Cited by

Patent Information

Application Number
CN202210573995.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-05-24
Publication Date
2026-02-03
Estimated Expiration
2042-05-24

AI Technical Summary

Technical Problem

Existing prognostic assessment methods for IgA nephropathy rely on invasive renal biopsy, which is complex to perform, has many contraindications, many complications, high economic costs, and cannot provide early non-invasive assessment, thus making it impossible to adjust treatment plans in a timely manner.

Method used

By detecting the relative expression level of miRNA-142-3p in the urine of patients with IgA nephropathy, a novel predictive model is provided for non-invasive assessment of whether patients have experienced endpoint events, such as a 50% decrease in glomerular filtration rate or progression to end-stage renal disease, using a PCR kit.

Benefits of technology

It enables non-invasive and accurate prediction of renal function progression in patients with IgA nephropathy, improving prediction accuracy and safety, applicable to all patients, and reducing detection risks and economic costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003659978440000081
    Figure BDA0003659978440000081
  • Figure BDA0003659978440000091
    Figure BDA0003659978440000091
  • Figure BDA0003659978440000092
    Figure BDA0003659978440000092
Patent Text Reader

Abstract

The present application relates to the technical field of detection reagent kit, and particularly relates to a urine PCR reagent kit for predicting renal function progression of IgA nephropathy. The urine PCR reagent kit provided by the present application takes patient urine as a sample, detects the relative expression amount of miRNA-142-3p in urine, and uses the relative expression amount as an index in an IgA nephropathy prediction model, so as to improve the prediction accuracy of IgA nephropathy progression and prognosis. The urine PCR reagent kit provided by the present application solves the technical problems of long detection time, great damage to the body, limited application range, complex detection steps and difficulty in popularization caused by the need for renal biopsy in the current prediction model. The urine PCR reagent kit provided by the present application can be used to realize an IgA nephropathy prognosis evaluation method without body trauma, short detection time, wide application range and simple detection steps.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of detection kit technology, and specifically to a urine PCR kit for predicting the progression of renal function in IgA nephropathy. Background Technology

[0002] IgA nephropathy is one of the most common primary glomerulonephritis worldwide and a leading cause of uremia. As the disease progresses, patients with IgA nephropathy not only experience a gradual deterioration of kidney function but also develop numerous complications such as hypertension, cardiovascular disease, cerebrovascular disease, and metabolic disorders, leading to premature loss of working life and even death for many. Early, non-invasive prognostic assessment of IgA nephropathy is crucial for improving patient prognosis and delaying disease progression to uremia.

[0003] Currently, the prognostic assessment of IgA nephropathy still relies on a predictive model that combines the pathological grading (Oxford classification) obtained after traditional renal biopsy with clinical indicators. A study published in JAMA Intern Med in 2019 introduced a new predictive model for IgA nephropathy progression—IIgANPT (JAMA Intern Med. 2019; 179(7):942-952.). The predictive endpoint of this model is defined as the development of end-stage renal disease (glomerular filtration rate less than 15 ml / min / 1.73 ml / min). 2 The formula describes a 50% decrease in glomerular filtration rate (GFR) compared to the time of kidney biopsy (i.e., the patient was admitted to dialysis or underwent kidney transplantation). The formula is divided into a clinical predictive model (containing only baseline GFR, mean arterial pressure, and proteinuria), a restricted model (adding the MEST classification of IgA nephropathy from the Oxford pathological classification to the clinical model), and a full model with or without race (further adding age, sex, race, crescent body mass index, ACEI / ARB use at kidney biopsy, and immunosuppressant use to the restricted model). The full model including race predicts a C-statistic (also known as the concordance statistic, which measures the model's ability to distinguish between individuals who have or have not experienced the event. Essentially, the C-statistic assesses the model's confidence in determining that the predicted patient has experienced the event) of 0.82 (95% CI 0.81–0.82).

[0004] Currently, this predictive model is recommended by the most authoritative international guideline, the Kidney Disease Improvement Global Organization (KDIGO), for assessing the prognosis and progression of IgA nephropathy patients. In addition, IgA nephropathy renal tissue miRNA-150-5p has also been reported to predict IgA nephropathy progression and prognosis, but the predictive power of a single indicator still cannot exceed that of the IigANPT predictive model, and it is also derived from renal tissue (Kidney Int. 2021; 99(5):1127-1139.).

[0005] Whether it's the restricted or full model in the IIgANPT prediction model, or the expression level of miRNA-150-5p in kidney tissue, both require invasive renal biopsy to obtain kidney tissue. After a series of fixation and staining processes, changes in nephrons are observed under a light or electron microscope to determine the specific pathological type. However, renal biopsy has significant drawbacks, such as:

[0006] (1) Kidney biopsy is a relatively complex procedure, and the process of pathological sectioning, slide preparation and staining after the kidney tissue is removed requires a high level of expertise in pathology.

[0007] (2) There are many contraindications for renal biopsy. Absolute contraindications include significant bleeding tendency, uncontrolled severe hypertension, mental illness or inability to cooperate, solitary kidney, small kidney, etc.; relative contraindications include active kidney or urinary tract infections (such as active pyelonephritis, renal tuberculosis, renal abscess), renal tumors or renal artery aneurysms, polycystic kidney disease, excessive obesity, chronic renal failure, severe ascites, heart failure, pregnancy, etc. Therefore, not every patient with kidney disease can undergo renal biopsy for timely and effective disease assessment.

[0008] (3) Renal biopsy is an invasive procedure. It is generally not recommended for patients in the early stages of kidney disease with relatively normal renal function and low urinary protein levels (below 0.5g / 24h). Furthermore, when the patient's condition worsens or relapses, requiring reassessment of renal pathology, repeated biopsies not only exacerbate kidney damage but also carry the risk of complications such as bleeding and infection, making repeated procedures difficult. In addition, patients need to discontinue anticoagulants before the procedure, which is disadvantageous for patients with cardiovascular disease who require long-term anticoagulant use.

[0009] (4) Renal biopsy has many complications. The most common are hematuria and perirenal hematoma, especially in patients with massive proteinuria and poor coagulation function. Other complications include perirenal abscess, back pain and discomfort, fever, and arteriovenous fistula.

[0010] (5) From a socioeconomic perspective, a renal biopsy often requires 7-10 days of hospitalization, or even longer, from completing preoperative examinations to preparing pathological slides and interpreting the slides for pathological classification. This not only delays early treatment for patients but also incurs significant economic costs. Summary of the Invention

[0011] The purpose of this invention is to provide a single indicator that can predict the progression and prognosis of IgA nephropathy non-invasively and accurately.

[0012] This invention is the first to discover a strong correlation between the urinary expression of miRNA-142-3p in patients with IgA nephropathy and the prognosis of renal function in IgA nephropathy patients. The relative expression level of miRNA-142-3p in the urine of IgA nephropathy patients can be used to predict whether patients will experience an endpoint event (glomerular filtration rate less than 15 ml / min / 1.73 ml / min). 2 The occurrence of an endpoint event (where the glomerular filtration rate decreased by 50% compared to the time of kidney biopsy) indicates that the patient's renal function has significantly deteriorated and that the patient is about to enter or has already entered end-stage renal disease, requiring the initiation of dialysis or kidney transplantation.

[0013] More specifically, patients who experienced the endpoint event had a renal function decline of at least 50% from baseline, but not all of them necessarily progressed to end-stage renal disease (glomerular filtration rate less than 15 ml / min / 1.73 ml / min). 2 For example, a patient's baseline glomerular filtration rate is 120, and when the endpoint event occurs, the glomerular filtration rate is 57, but the patient has not yet entered end-stage renal disease.

[0014] Therefore, accurately determining whether a patient has experienced an endpoint event allows for timely adjustments to the patient's treatment plan.

[0015] Specifically, in a first aspect, the present invention provides a PCR kit for predicting the progression of renal function in IgA nephropathy, the PCR kit containing primer sequences for amplifying miRNA-142-3p; the primer sequences are shown in SEQ ID NO.1.

[0016] The PCR kit provided by this invention is used to detect the relative expression level of miRNA-142-3p in urine samples from patients with IgA nephropathy.

[0017] The PCR kit provided by this invention can detect the relative expression level of miRNA-142-3p by quantitative real-time PCR.

[0018] The PCR kit provided by this invention also contains primer sequences for the housekeeping gene U6, as shown in SEQ ID NO.2.

[0019] The PCR kit provided by this invention includes the following reagents: RNA extraction reagent, miRNA cDNA first-strand synthesis reagent, and enhanced miRNA fluorescence quantitative detection reagent.

[0020] The PCR kit provided by this invention extracts RNA from urine sediment in urine samples from patients with IgA nephropathy and reverse transcribes it to synthesize cDNA. The relative expression level of miRNA-142-3p in the cDNA is obtained based on SYBR Green quantitative PCR.

[0021] The critical value for the relative expression level of miRNA-142-3p in the PCR kit provided by this invention is 0.5114.

[0022] Based on the understanding of those skilled in the art, this invention seeks to protect the application of the relative expression level of miRNA-142-3p in the urine of patients with IgA nephropathy in improving the predictive accuracy of IgA nephropathy prediction models.

[0023] Secondly, the present invention provides a novel predictive model for the progression of IgA nephropathy. The detection indicators of the predictive model for the progression of IgA nephropathy include the patient's baseline glomerular filtration rate, mean arterial pressure, proteinuria, and relative expression level of urinary miRNA-142-3p.

[0024] This invention also claims protection for the use of the above-described PCR kit or the above-described IgA nephropathy prediction model in improving the accuracy of predicting IgA nephropathy endpoint events.

[0025] The beneficial effects of this invention are as follows:

[0026] (1) This invention is the first to discover that when the area under the maximum ROC curve for predicting the endpoint event of IgA nephropathy is 0.847, the sensitivity is 79.2% and the specificity is 76.7%, and the critical value for miRNA-142-3p expression level is higher than 0.1717. When the critical value for miRNA-142-3p expression level is higher than 0.5114, the specificity is 100% and the sensitivity is 60.4%.

[0027] (2) The evaluation model provided by the present invention has a C-statistic of 0.894 after adding the relative expression level of miRNA-142-3p as an evaluation index, which is higher than the C-statistic of the existing evaluation model in the prior art.

[0028] (3) The assessment model provided by this invention can non-invasively and accurately predict endpoint events in patients with IgA nephropathy. Because the sample used for detecting the relative expression level of miRNA-142-3p is the patient's morning urine, the assessment model provided by this invention has a significant advantage over current predictive models that require renal biopsy to obtain pathological classification. It allows for repeated or continuous collection and testing as needed based on changes in the disease condition, enabling real-time assessment of disease progression and prognosis. Furthermore, the urine collection process does not cause any damage or risk to the patient, making it very safe and reliable.

[0029] (4) The evaluation model provided by this invention is applicable to all patients because the sample for detecting the relative expression level of miRNA-142-3p is patient urine and there are no obvious contraindications during the detection. Attached Figure Description

[0030] Figure 1 This invention compares the expression levels of miRNA-142-3p between the IgA nephropathy progression group and the non-progression group.

[0031] Figure 2 The ROC curve is used to predict the endpoint events of IgA nephropathy according to this invention.

[0032] Figure 3 This invention provides a comparison of survival curves between the IgA nephropathy progression group and the non-progression group. Detailed Implementation

[0033] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention.

[0034] Example 1: Expression profile of miRNAs in urinary sediment

[0035] Urinary sediment miRNA sequencing was performed on patients with progressive IgA nephropathy, non-progressive IgA nephropathy, and a normal control group. The results showed that the expression level of miRNA-142-3p in the progressive IgA nephropathy group was significantly higher than that in the non-progressive IgA nephropathy group (Fold Change log2 = 2.489, P = 0.0000207). Furthermore, the expression level of miRNA-142-3p in all IgA nephropathy groups (including both progressive and non-progressive groups) was significantly higher than that in the normal control group (Fold Change log2 = 4.680, P = 1.61 × 10⁻⁶). -8 ).

[0036] Example 2: Detection of miRNA-142-3p expression level

[0037] 1) Collection and preservation of morning urine

[0038] Collect 50-100ml of morning urine from patients with IgA nephropathy and healthy individuals using sterile centrifuge tubes, 1-2 tubes per patient, and store in an ice box or at 4°C before transporting back to the laboratory for processing.

[0039] 2) Separation of urine sediment

[0040] The collected morning urine was centrifuged at 3000g for 30 minutes at 4°C. The supernatant of the urine was discarded, and the small amount of supernatant remaining at the bottom of the tube was carefully aspirated with a pipette tip, while retaining the urine sediment.

[0041] 3) Extraction of total RNA from urine sediment (TRIzol method)

[0042] Add 500 μL of pre-chilled TRIzol (4°C) to the urine sediment and mix thoroughly by pipetting. Transfer the liquid to a new 1.5 mL RNase-free EP tube and incubate at room temperature for 5 min. Add 200 μL of room temperature chloroform (trichloromethane) and vigorously vortex for 15 s until the chloroform is completely mixed. Incubate at room temperature for 3 min. Centrifuge at 12,000 rpm for 15 min at 4°C. The liquid in the EP tube will separate into three layers (upper clear aqueous phase: RNA; middle white phase: protein; lower pink phase: DNA). Carefully transfer the upper clear aqueous phase to a sterilized 1.5 mL RNase-free EP tube, avoiding aspirating the middle protein layer and the lower DNA layer as much as possible. Add an equal volume of -20°C isopropanol and incubate on ice for 20 min (to precipitate the RNA from the liquid to a solid). Centrifuge at 12,000 rpm for 15 min at 4°C and discard the supernatant. Add 1 mL of 75% DEPC ethanol and mix by inverting. Centrifuge at 4℃, 12000 rpm, for 5 min, and discard the supernatant. Carefully aspirate the liquid with a pipette tip, and air dry for 5-15 min (until it turns from white to transparent). Add 10-15 μl of DECP water, gently vortex to mix, and incubate on ice for 30 min to form an RNA solution. Take 1-2 μl of the RNA solution, measure the RNA concentration in a Nanodrop 2000c instrument, and record the concentration.

[0043] 4) Reverse transcription to synthesize cDNA

[0044] Total RNA was reverse transcribed into cDNA using reagents from the TIANGEN miRcute Enhanced miRNA cDNA First-Strand Synthesis Kit. The miRNA RT Enzyme Mix, stored at -20°C, was kept on ice. The frozen 2× miRNA RT Reaction Buffer was thawed and gently inverted to mix. The total RNA mass was fixed at 500 ng (total system 500 ng), and the volume of RNA solution to be added (Total RNA) was calculated based on the measured concentration. A new RNase-free 0.5 ml EP tube was prepared, and 10 μL of 2× miRNA RT Reaction Buffer, the calculated RNA solution volume, and 8 μL of RNase-free double-distilled water (minus the required RNA solution volume) were added sequentially. Finally, the miRNA RT Enzyme Mix was added. After brief centrifugation, the reaction was carried out at 42°C for 60 min (miRNA A-tailing reaction and reverse transcription reaction) and at 95°C for 3 min (enzyme inactivation reaction).

[0045] 5) Detect the expression level of miRNA:

[0046] The expression level of miRNA-142-3p in the synthesized cDNA was detected using SYBR Green real-time PCR technology, with the TIANGEN miRcute enhanced miRNA real-time detection kit. 2×miRcutePlus miRNA Premix and Reverse Primer were thawed at room temperature; the thawed 2×miRcute Plus miRNA Premix was then inverted to mix thoroughly and gently centrifuged before use. The synthesized cDNA, RNase-free double-distilled water, and other reaction reagents were placed on ice; the reaction mixture was prepared as follows: 10 μL 2×miRcute Plus miRNA Premix, 0.4 μL miRNA-142-3p or U6 primer, 0.4 μL Reverse Primer, 2 μL miRNA first-strand cDNA, and 7.2 μL RNase-free double-distilled water. The final volume was increased to 20 μL. The reactions were performed using various PCR instruments under the following conditions: 1× (1 cycle) – 95℃, 15 min (initial template denaturation); followed by 40-45× (40 to 45 cycles) – 94℃, 20 sec (template denaturation during PCR cycles) and 60℃, 34 sec (annealing, extension). Two auxiliary wells were provided for each sample containing miRNA-142-3p and U6 (i.e., two additional replicates were performed under the same conditions). The housekeeping gene (U6) was amplified simultaneously with the test sample to determine the expression level of the target gene in the sample.

[0047] 6)2 -Δct The expression levels of miRNA-142-3p were compared between the progressive and non-progressive IgA nephropathy groups using relative quantification.

[0048] Using SPSS statistical software, 2 -Δct The expression levels of miRNA-142-3p were compared using a relative quantification method, i.e., 2 -[(IgA肾病进展组目的基因CT值—IgA肾病进展组管家基因CT值)] ,2 -Δct This indicates the expression level of miRNA-142-3p of the internal reference gene U6snRNA in different groups of IgA nephropathy patients.

[0049] Example 3: miRNA-142-3p is an independent risk factor for the prognosis of IgA nephropathy.

[0050] The prognostic endpoint for IgA nephropathy is defined as the development of end-stage renal disease (glomerular filtration rate less than 15 ml / min / 1.73 ml / min). 2The endpoint is defined as a 50% decrease in glomerular filtration rate (GFR) compared to the time of renal biopsy, indicating the need for dialysis or kidney transplantation. This definition is one of the most commonly used definitions of renal function progression both domestically and internationally, and it is also the endpoint event used in current predictive models for IgA nephropathy progression. This study included 131 patients with IgA nephropathy, with a median follow-up time of 60.92 months (range 23.65-86.73). Based on whether the endpoint event occurred, patients with IgA nephropathy were divided into a progression group and a non-progression group, with 35 patients in the progression group and 96 patients in the non-progression group.

[0051] Compared with the non-progressive group, patients in the IgA nephropathy progression group had a lower proportion of males, lower serum albumin and baseline glomerular filtration rate (GFR), and higher serum creatinine, serum uric acid, serum cystatin C, and urinary protein levels (Table 1). Univariate Cox regression analysis revealed (Table 2) that miRNA-142-3p, serum creatinine, serum uric acid, serum cystatin C, and urinary protein levels were risk factors for IgA nephropathy prognosis, while serum albumin and baseline glomerular filtration rate were protective factors. Incorporating the above seven factors into a multivariate Cox regression analysis revealed that miRNA-142-3p (HR = 23.625, 95% CI 3.055–182.662, P = 0.002) and serum cystatin C (HR = 2.747, 95% CI 1.073–7.033, P = 0.035) were independent risk factors for IgA nephropathy prognosis, while baseline eGFR (HR = 0.973, 95% CI 0.949–0.996, P = 0.025) was an independent protective factor for IgA nephropathy prognosis.

[0052] Table 1 Comparison of baseline characteristics between the progression group and the non-progression group

[0053]

[0054] The values ​​of age, systolic blood pressure, diastolic blood pressure, serum albumin, baseline serum creatinine, serum cystatin C, baseline eGFR, and 24-hour urine protein quantification in the table are expressed as medians (interquartiles) because they do not conform to a normal distribution; while mean arterial pressure and serum uric acid conform to a normal distribution and are expressed as median ± standard deviation.

[0055] Table 2. Univariate Cox regression analysis of endpoint events in IgA nephropathy

[0056]

[0057] Example 4: The role of miRNA-142-3p in assessing the prognosis of IgA nephropathy

[0058] The expression level of miRNA-142-3p in the IgA nephropathy progression group was significantly higher than that in the non-progression group (0.086 vs 0.417, P<0.001). Figure 1 ).

[0059] Using a mean follow-up time of 5 years as the cutoff point, and considering the occurrence of endpoint events in IgA nephropathy patients as a binary variable, the area under the largest ROC curve (same as the C statistic) for predicting endpoint events in IgA nephropathy was 0.847, with a sensitivity of 79.2%, a specificity of 76.7%, and a cutoff value of miRNA-142-3p expression levels above 0.1717 (Table 3 and 142-3p). Figure 2 The critical value for maximum specificity was a miRNA-142-3p expression level above 0.5114, with a specificity of 100% and a sensitivity of 60.4% (Table 4).

[0060] Based on the optimal cutoff value (0.1717), this invention divided IgA nephropathy patients into a high-expression group and a low-expression group of miRNA-142-3p, and compared the differences in survival curves between the two groups. The results showed that the renal function prognosis (occurrence of endpoint events) in the high-expression group was significantly worse than that in the low-expression group (Log-Rank, P = 0.001). Figure 3 ).

[0061] Table 3. Area under the largest ROC curve for predicting endpoint events in IgA nephropathy

[0062]

[0063] Table 4. Sensitivity and specificity for predicting endpoint events in IgA nephropathy

[0064]

[0065]

[0066] Example 5: miRNA-142-3p significantly improves the IgA nephropathy prediction model

[0067] Combining the existing clinical model (which includes baseline glomerular filtration rate, mean arterial pressure, and proteinuria) with miRNA-142-3p in the IgA nephropathy prediction model yielded a C-statistic of 0.894 (95% CI 0.871–0.916), which was significantly higher than that of the clinical model and the full model (P<0.001). The net reclassification index (NRI) was 0.64 (95% CI 0.17–0.96).

[0068] Example 6: Kit and Method for Assessing the Prognosis of IgA Nephropathy

[0069] This embodiment provides a kit for assessing the prognosis of IgA nephropathy, the main materials of which include:

[0070] 1) Extract TRIzol from total RNA;

[0071] 2) miRcute Enhanced miRNA cDNA First Strand Synthesis Kit: Model KR211, manufactured by TIANGEN;

[0072] 3) Primers: The primer sequence for the main indicator miRNA-142-3p is: UGUAGUGUUUCCUACUUUAUGGA (SEQ ID NO.1), and the primer sequence for the housekeeping gene U6snRNA is: AAAGCAGGCUUUAAAGGAACCU (SEQ ID NO.2);

[0073] 4) miRcute Enhanced miRNA Quantitative Detection Kit (SYBR Green): Model FP411, manufactured by TIANGEN.

[0074] 5) Other reagents: chloroform, isopropanol, DEPC water, and RNase-free double-distilled water.

[0075] The main equipment includes:

[0076] 1) Various PCR instruments.

[0077] 2) Various types of benchtop low-temperature high-speed centrifuges.

[0078] 3) SPSS software: Any version of SPSS software is acceptable.

[0079] This embodiment also provides a method for assessing the prognosis of IgA nephropathy, including:

[0080] 1) Sample collection and preservation

[0081] Collect 50-100 ml of morning urine from IgA nephropathy patients and healthy individuals using 50 ml sterile centrifuge tubes, 1-2 tubes per patient, and store in an ice box or at 4°C before transporting back to the laboratory for processing.

[0082] 2) Separation of urine sediment

[0083] The collected morning urine was centrifuged at 3000g for 30 minutes at 4°C. The supernatant of the urine was discarded, and the small amount of supernatant remaining at the bottom of the tube was carefully aspirated with a pipette tip, while retaining the urine sediment.

[0084] 3) Extraction of total RNA from urine sediment (TRIzol method)

[0085] Add 500 μl of TRIzol pre-chilled at 4°C to the total urine sediment, mix well by pipetting, transfer the liquid to a new 1.5 ml EP tube without RNase, and let stand at room temperature for 5 min.

[0086] Add 200 μl of chloroform (trichloromethane) at room temperature, shake vigorously for 15 seconds until the chloroform is completely mixed, and let stand at room temperature for 3 minutes.

[0087] Centrifuge at 4℃ and 12000rpm for 15 minutes. The liquid in the EP tube can be seen to separate into 3 layers (the upper transparent aqueous phase is RNA, the middle white phase is protein, and the lower pink phase is DNA).

[0088] Carefully transfer the upper clear aqueous phase to a sterilized RNase-free 1.5ml EP tube, avoiding aspirating the middle protein layer as much as possible.

[0089] Add an equal volume of isopropanol at -20°C and incubate on ice for 20 minutes (to precipitate the RNA from the liquid to a solid).

[0090] Centrifuge at 4℃ and 12000rpm for 15 minutes, then discard the supernatant;

[0091] Add 1 ml of 75% DEPC ethanol and mix by inverting.

[0092] Centrifuge at 4℃, 12000 rpm, for 5 min, and discard the supernatant;

[0093] Carefully aspirate the liquid with a pipette tip, air dry for 5-15 minutes (from white to transparent), add 10-15 μL of DECP water, gently vortex to mix, and incubate on ice for 30 minutes to form an RNA solution.

[0094] Take 1-2 μl of RNA solution and measure the RNA concentration using a NANODROP 2000c.

[0095] 4) Reverse transcription to synthesize cDNA

[0096] Total RNA extracted was reverse transcribed into cDNA using the TIANGEN miRcute enhanced miRNA cDNA first-strand synthesis kit.

[0097] Place the miRNART Enzyme Mix frozen at -20℃ on ice for later use. Thaw the frozen 2×miRNA RTReaction Buffer and gently invert to mix.

[0098] The total RNA mass of the sample was fixed at 500 ng (total system 500 ng), and the volume of RNA solution (Total RNA) added was calculated based on the measured concentration.

[0099] Prepare a new RNase-free 0.5ml EP tube, add 10μl of 2×miRNA RT Reaction Buffer, the calculated RNA solution volume, and 8ul of RNase-free double-distilled water minus the required RNA solution volume; finally, add miRNA RTEnzyme Mix.

[0100] After a brief centrifugation, the reaction was carried out at 42°C for 60 min (miRNA A-tailing reaction and reverse transcription reaction), and then at 95°C for 3 min (enzyme inactivation reaction).

[0101] 5) Detect the expression level of miRNA-142-3p:

[0102] The expression level of miRNA-142-3p in the synthesized cDNA was detected using SYBR Green real-time PCR technology, and the kit used was the miRcute enhanced miRNA real-time detection kit from TIANGEN.

[0103] Melt 2×miRcute Plus miRNA Premix and Reverse Primer at room temperature; mix the melted 2×miRcute Plus miRNA Premix by inverting the container, centrifuge slightly, and set aside.

[0104] Place the synthesized cDNA, RNase-free double-distilled water, and other reaction reagents on ice; prepare the reaction system as follows: 10 μl 2×miRcute Plus miRNA Premix, 0.4 μl miRNA-142-3p or U6 primer, 0.4 μl Reverse Primer, 2 μl miRNA first-strand cDNA, and 7.2 μl RNase-free double-distilled water. Add the reaction system to a final volume of 20 μl.

[0105] The reactions were performed using various PCR instruments under the following conditions: 1× (1 cycle) – 95℃, 15 min (initial template denaturation); followed by 40-45× (40 to 45 cycles) – 94℃, 20 sec (template denaturation during PCR cycles) and 60℃, 34 sec (annealing, extension). Two auxiliary wells were provided for each sample containing miRNA-142-3p and U6 (i.e., two additional replicates were performed under the same conditions). The housekeeping gene (U6) was amplified simultaneously with the test sample to determine the expression level of the target gene in the sample.

[0106] 6)2 -Δct The expression levels of miRNA-142-3p were compared between the progressive and non-progressive IgA nephropathy groups using relative quantification.

[0107] Using SPSS statistical software, 2 -Δct The expression levels of miRNA-142-3p were compared using a relative quantification method, i.e., 2 -[(IgA肾病进展组目的基因CT值—IgA肾病进展组管家基因CT值)] ,2 -Δct The value represents the expression level of miRNA-142-3p of the internal reference gene U6snRNA in different groups of IgA nephropathy patients.

[0108] 7) C-statistic for miRNA-142-3p in predicting the progression of IgA nephropathy:

[0109] The C-statistic (95% CI) was 0.847 (0.774, 0.919), which was significantly higher than the 0.82 (95% CI 0.81-0.82) of the current prediction model IIGANPT full model.

[0110] Comparative Example 1

[0111] In analyzing the miRNA expression profile of urinary sediment, this invention revealed that several miRNAs with significantly higher expression levels in the progressive IgA nephropathy group were compared to those in the non-progressive IgA nephropathy group. This comparative study provides an experimental investigation into the correlation between miRNAs and prognostic endpoint events in IgA nephropathy, with the following results:

[0112] By comparing the urinary sediment miRNA expression profiles of patients with progressive and non-progressive IgA nephropathy, this invention identified 61 differentially expressed miRNAs, of which 17 miRNAs were significantly elevated in the non-progressive group and 44 miRNAs were significantly elevated in the progressive group. This invention validated 11 of these miRNAs (miRNA-98-5p, miRNA-92a-3p, miRNA-425-5p, miRNA-204-5p, miRNA-19a-3p, miRNA-197-3p, miRNA-194-5p, miRNA-185-5p, miRNA-17-5p, miRNA-142-3p, and miRNA-140-3p) in a large cohort (35 patients in the progressive IgA nephropathy group and 96 patients in the non-progressive group).

[0113] Because the time from the onset of IgA nephropathy to the occurrence of the endpoint event is very long, this invention validated 11 miRNAs in an IgA nephropathy cohort and then conducted a 5-year (median) long-term follow-up of the cohort. A total of 35 IgA nephropathy patients experienced the endpoint event and were classified as the progression group. The remaining 96 IgA nephropathy patients did not experience the endpoint event at the end of the 5-year follow-up and were classified as the non-progression group.

[0114] In addition to miRNA-142-3p, differences were also found between miRNA-204-5p and miRNA-185-5p in the progressive and non-progressive groups of IgA nephropathy.

[0115] In the IgA nephropathy progression group (n=35), the relative expression level of miRNA-204-5p was significantly lower than that in the non-progression group (n=96) (0.0486 vs 0.0817, P=0.048). Conversely, the relative expression level of miRNA-185-5p in the IgA nephropathy progression group was significantly higher than that in the non-progression group (0.0143 vs 0.0280, P=0.033). However, neither univariate nor multivariate logistic regression analysis identified miRNA-204-5p and miRNA-185-5p as risk factors for IgA nephropathy progression.

[0116] Using the average follow-up time of 5 years as the cutoff point, and considering whether IgA nephropathy patients experienced endpoint events as a binary variable, the area under the ROC curve for miRNA-204-5p in predicting IgA nephropathy endpoint events was only 0.581 (same as the C statistic), with a P value of 0.139, which was not statistically significant.

[0117] The area under the largest ROC curve (AUC) for miRNA-185-5p in predicting IgA nephropathy endpoints (same as the C statistic) was only 0.624, with a P-value of 0.033. Its sensitivity was 57.6%, specificity was 72.7%, and the cutoff value was a relative expression level of miRNA-185-5p above 0.0229. Its predictive value and accuracy were significantly lower than miRNA-142-3p and the IgA nephropathy prediction model IIgANPT.

[0118] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention. sequence list <110> The First Medical Center of the General Hospital of the Chinese People's Liberation Army <120> A urine PCR kit for predicting the progression of renal function in IgA nephropathy <130> KHP221114592.7 <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty three <212> RNA <213> Artificial Sequence <400> 1 uguaguguuu ccuacuuuau gga 23 <210> 2 <211> 22 <212> RNA <213> Artificial Sequence <400> 2 aaagcaggcu uuaaaggaac cu 22

Claims

1. The application of primer combinations in the preparation of a PCR kit for predicting the progression of renal function in IgA nephropathy, characterized in that, The primer combination includes primer sequences for amplifying miRNA-142-3p and primer sequences for amplifying housekeeping gene U6; the primer sequence for amplifying miRNA-142-3p is shown in SEQ ID NO.1, and the primer sequence for amplifying housekeeping gene U6 is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that, The PCR kit is used to detect the relative expression level of miRNA-142-3p in urine samples from patients with IgA nephropathy by quantitative real-time PCR.

3. The application according to claim 2, characterized in that, The reagents in the kit include: RNA extraction reagent, miRNA cDNA first-strand synthesis reagent, and enhanced miRNA fluorescence quantitative detection reagent.

4. The application according to any one of claims 1-3, characterized in that, The method described is as follows: RNA is extracted from urine sediment in urine samples from patients with IgA nephropathy and reverse transcribed to synthesize cDNA. The relative expression level of miRNA-142-3p in the cDNA is obtained based on SYBR Green quantitative PCR.

5. The application according to claim 4, characterized in that, The critical value for the relative expression level of miRNA-142-3p was 0.5114.

Citation Information

Patent Citations

  • System and method used for detection of IgA nephropathy and establishment of the method

    CN104975075A

  • System and method for detecting IgA nephropathy and establishment of method

    CN114015764A

  • System and method for detecting IgA nephropathy and establishment of method

    CN114015765A

  • System and method for detecting IgA nephropathy and establishment of method

    CN114150048A

  • System and method for detecting IgA nephropathy and establishment of method

    CN114150049A