RNAi agent for inhibiting complement factor B (CFB) expression, pharmaceutical composition thereof, and method of use

Abstract

This disclosure relates to RNAi agents capable of inhibiting complement factor B (CFB) gene expression. Pharmaceutical compositions containing CFB RNAi agents and methods of use thereof are also disclosed. The CFB RNAi agents disclosed herein may be conjugated to a targeted ligand containing an N-acetyl-galactosamine ligand to facilitate in vivo delivery to hepatocytes. RNAi agents can be used in methods of treating diseases, disorders, or conditions partially mediated by CFB gene expression, including IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD) including early and / or intermediate-stage AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated disorders.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims priority to U.S. Provisional Patent Application No. 63 / 491,505, filed on 21 March 2023, and U.S. Provisional Patent Application No. 63 / 566,013, filed on 15 March 2024, the contents of each of these applications incorporated herein by reference in their entirety.

[0002] This disclosure relates to RNA interference (RNAi) agents for inhibiting complement factor B (CFB) gene expression, such as double-stranded RNAi agents including chemically modified small interfering RNA (siRNA), pharmaceutical compositions containing CFB RNAi agents, and methods of using them for treating CFB-related diseases and disorders.

[0003] Sequence List This application includes a sequence listing (in accordance with standard ST26) submitted in XML format, which is incorporated herein by reference in its entirety. The XML sequence listing file is named 30719-WO_SeqListing.xml, created on 18 March 2024, and has a size of 5066 KB. [Background technology]

[0004] The complement cascade is a vital part of the innate immune system, providing the first line of defense against infection and regulating the removal of apoptotic cells and debris by marking them for disposal (Defendi et al., Clin Rev Allergy Immunol. 2020, 58(2):229-51). However, dysregulated activation of the complement system can lead to the progression of certain renal diseases, either by playing a direct pathogenic role or by amplifying or exacerbating the inflammatory and damaging effects of non-complemental disease triggers (Schroder-Braunstein et al., Mol Immunol. 2019, 114:299-311).

[0005] The complement system can be activated via three distinct pathways: the alternative pathway, the classical pathway, and the lectin pathway. Each of these three pathways of complement activity has important physiological functions and can play a role in the pathogenesis of various diseases. Complement system activation ultimately converges on the formation of membrane attack complexes (MACs), the cytotoxic units of this system, but fragments of complement proteins produced during activation can act as opsonins or pro-inflammatory chemotherapeutic agents. An overview of the complement system is provided in Garred et al., Pharmacol. Rev. 2021, 73:792-827 (see, for example, Figure 1 therein).

[0006] Complement factor B (CFB) is a central component of the alternative pathways in the complement system. It has been previously identified as a potential therapeutic target for diseases associated with complement dysregulation with alternative pathways, including IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD) including early and / or intermediate-stage AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases (van Lookeren et al., Immunobiology). 2016,221:733-739;Casiraghi et al.,Am.J.Transplantation 2017,17:2312-2325;Wong&Kavanaugh,Seminars in Immunopathology 2018,40:49-64;Holers&Banda,Frontiers in Immunology 2018,9:1057 Poppelaars&Thurman,Molecular Immunology,2020,188:175-187,Crowley et al.,Human Molecular Genetics,2023,32(2):204-217;Blakey et al.,Int'l J.Women's Cardiovascular Health 2023,32:43-49;Hoppe&Gregory-Ksander Int'l (J.Med.Sci.2024,25:2307). However, despite considerable interest in developing complement-targeted therapies for the treatment of one or more of these conditions, there remains a significant unmet medical need.

[0007] For example, current management of IgAN and C3G is limited to supportive care (including lifestyle modifications and renal protective agents targeting the renin-angiotensin system) and broad-acting immunosuppressants (including corticosteroids and mycophenolate mofetil), which have significant limitations due to a lack of specificity to the underlying disease process and / or an unfavorable side effect profile with long-term use (Gleeson & O'Shaugnessy, Nephrol Dial Transplant, 2023, 38:2464-2473). Despite the widely recognized role of complement dysregulation in its pathophysiology, complement-targeted therapies for IgAN or C3G are not approved. In PNH, drugs targeting alternative complement pathways have shown improved clinical outcomes compared to existing, more broadly acting therapies, leading to their approval and highlighting the potential benefits of therapies that more precisely and specifically target the pathophysiology of the disease and complement dysregulation (Hillmen et al., NEJMED 2021, 384:1028-37; Peffault de Latour et al., NEJMED 2022, 390:994-1008).

[0008] Complement inhibitors targeting alternative pathways are being developed as potential treatments for several complement-mediated diseases, but their development faces significant limitations and challenges. For example, drugs that broadly inhibit the complement cascade can greatly increase the risk of infection and other adverse events. In diseases where dysregulation of alternative pathways is specifically involved, it would be far preferable to selectively target this pathway while leaving the classical and lectin pathways intact. Among the CFB inhibitors currently under development, delivery and adherence issues are also a concern. Some CFB inhibitors are large molecules, such as monoclonal antibodies, that typically require intravenous administration and have limited tissue permeability. Alternatively, there are certain orally delivered small molecule CFB inhibitors under development that simplify delivery but require frequent administration as often as twice daily (BID), which can increase the drug burden on patients and increase the likelihood of rebound effects if doses are missed.

[0009] Furthermore, specifically targeting CFB offers potential advantages over targeting other complement components due to its central role in complement activation and its well-characterized association with disease susceptibility. Targeted CFB inhibition may leave other complement pathways intact and reduce patient susceptibility to infections caused by inhibition of classical and lectin pathways. Approaches utilizing RNAi mechanisms to target CFB also offer potential advantages in terms of the simplicity of subcutaneous administration and infrequent dosing. While various publications have proposed siRNA or other oligonucleotide molecules for targeting CFB, none of the previously disclosed inhibitory molecules have demonstrated the necessary combination of gene silencing, a suitable safety profile, and stability and long-term inhibitory activity to necessitate frequent dosing to address any adherence issues in specific patients with problems with existing therapies or known therapeutic candidates. [Prior art documents] [Non-patent literature]

[0010] [Non-Patent Document 1] Defendi et al.,Clin Rev Allergy Immunol.2020,58(2):229-51 [Non-Patent Document 2] Schroder-Braunstein et al.,Mol Immunol.2019,114:299-311 [Non-Patent Document 3] Garred et al.,Pharmacol.Rev.2021,73:792-827 [Non-Patent Document 4] van Lookeren et al., Immunobiology 2016,221:733-739 [Non-Patent Document 5] Casiraghi et al.,Am.J.Transplantation 2017,17:2312-2325 [Non-Patent Document 6] Wong&Kavanaugh, Seminars in Immunopathology 2018, 40:49-64

Non-Patent Document 7

Non-Patent Document 8

Non-Patent Document 9

Non-Patent Document 10

Non-Patent Document 11

Non-Patent Document 12

Non-Patent Document 13

Summary of the Invention

[0011] There is a need for novel RNA interference (RNAi) agents (referred to as RNAi agents, RNAi triggers, or triggers) that can selectively and efficiently inhibit CFB gene expression, such as double-stranded RNAi agents. Further, by way of non-limiting example, for the treatment of diseases or disorders associated with dysregulation of the alternative complement pathway, including but not limited to IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T cell-mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD) including early and / or intermediate AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), preeclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases (van Lookeren et al., 2016, Casiraghi et al., 2017, Wong & Kavanaugh 2018, Holers & Banda 2018, Poppelaars & Thurman 2020, Crowley et al., 2023, Blakey et al., 2023, Hoppe & Gregory-Ksander 2,024), there remains a need for compositions of novel CFB-specific RNAi agents for use as a treatment or medicament.

[0012] The nucleotide sequences and chemical modifications of the CFB RNAi agents disclosed herein are different from those previously disclosed or known in the art. The CFB RNAi agents disclosed herein provide a very specific, potent, and efficient in vivo inhibition of CFB gene expression.

[0013] In some embodiments, the sense strand comprises a nucleotide sequence of at least 15 consecutive nucleotides that differs from any one of the sense strand sequences of Table 2, Table 4A, Table 4B, or Table 5C by 0 or 1 nucleotide, and the sense strand has a region of at least 85% complementarity over 15 consecutive nucleotides to the antisense strand.

[0014] In some embodiments, at least one nucleotide of the RNAi agent comprises a modified internucleoside linkage.

[0015] In some embodiments, the modified nucleotides of the CFB RNAi agents disclosed herein are selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seco nucleotide mimics, locked nucleotides, 2'-F-arabinonucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholine-containing nucleotides (such as replacing the ribose ring with a methylene morpholine ring), vinylphosphonate-containing nucleotides, cyclopropylphosphonate-containing nucleotides, and 3'-O-methyl nucleotides.

[0016] In other embodiments, all or substantially all of the modified nucleotides of the RNAi agents disclosed herein are 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or combinations thereof.

[0017] In some embodiments, the antisense strand consists of, consists essentially of, or comprises the nucleotide sequence of any one of the modified antisense strand sequences of Table 3.

[0018] In some embodiments, the sense strand consists of, consists essentially of, or comprises the nucleotide sequence of any one of the modified sense strand sequences of Table 4A or Table 4B.

[0019] In some embodiments, the antisense strand comprises the nucleotide sequence of any one of the modified sequences of Table 3 and the sense strand comprises the nucleotide sequence of any one of the modified sequences of Table 4A or Table 4B.

[0020] The RNAi agents disclosed herein are ligated to a targeting ligand containing N-acetyl-galactosamine. In further embodiments, the targeting ligand is ligated to the sense strand. In some embodiments, the targeting ligand is ligated to the 5' end of the sense strand.

[0021] In some embodiments, the sense strand is 15 to 30 nucleotides long, and the antisense strand is 18 to 30 nucleotides long. In other embodiments, the sense strand and antisense strand are each 19 to 27 nucleotides long. In yet another embodiment, the sense strand and antisense strand are each 21 to 24 nucleotides long. In yet another embodiment, the sense strand and antisense strand are each 21 nucleotides long.

[0022] In some embodiments, the RNAi agent has two blunt ends.

[0023] In some embodiments, the sense strand includes one or two terminal caps. In other embodiments, the sense strand includes one or two inverted debase residues.

[0024] In some embodiments, the RNAi agent consists of a sense strand and an antisense strand that form a double-stranded sequence of the double-stranded structure shown in Table 5C.

[0025] In some embodiments, the sense strand further includes an inverted debase residue at the 3' end of the nucleotide sequence, the 5' end of the nucleotide sequence, or both.

[0026] In further embodiments, the targeted ligand is [ka] Includes. In some embodiments, the CFB RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): AAAGUACUCAGACACCACAGC(Sequence ID 1275); UAGAAAACCCAAAUCCUCAUC(Sequence ID 1283); UAAGUACUCAGACACUACAGC (Sequence ID 1332); UAAGUACUCAGACACCAUAGC(Sequence ID 1333); UAAGUACUCAGACACCACAGC(Sequence ID 1326); UCAAUGACAGUAAUUGGGUCC(Sequence ID 1310); AAAGUACUCAGACACCACA(Sequence ID 359); UAGAAAACCCAAAUCCUCA(Sequence ID 474); UAAGUACUCAGACACUACA(Sequence ID 367); UAAGUACUCAGACACCAUA(Sequence ID 361); UAAGUACUCAGACACCACA(SEQ ID NO: 360); or UCAAUGACAGUAAUUGGGU (Sequence ID 246) It includes an antisense strand consisting of, essentially, or containing a nucleic acid base sequence that differs from one of the others by only 0 or 1 nucleic acid base.

[0027] In some embodiments, the CFB RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): AAAGUACUCAGACACCACAGC(Sequence ID 1275); UAGAAAACCCAAAUCCUCAUC(Sequence ID 1283); UAAGUACUCAGACACUACAGC (Sequence ID 1332); UAAGUACUCAGACACCAUAGC(Sequence ID 1333); UAAGUACUCAGACACCACAGC(Sequence ID 1326); UCAAUGACAGUAAUUGGGUCC(Sequence ID 1310); AAAGUACUCAGACACCACA(Sequence ID 359); UAGAAAACCCAAAUCCUCA(Sequence ID 474); UAAGUACUCAGACACUACA(Sequence ID 367); UAAGUACUCAGACACCAUA(Sequence ID 361); UAAGUACUCAGACACCACA(SEQ ID NO: 360); or UCAAUGACAGUAAUUGGGU(Sequence code 246); It includes an antisense strand consisting of, essentially, or containing a nucleotide sequence that differs from one of the others by only one nucleotide or less, All or substantially all of the nucleotides are modified nucleotides.

[0028] In some embodiments, the CFB RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): AAAGUACUCAGACACCACAGC(Sequence ID 1275); UAGAAAACCCAAAUCCUCAUC(Sequence ID 1283); UAAGUACUCAGACACUACAGC (Sequence ID 1332); UAAGUACUCAGACACCAUAGC(Sequence ID 1333); UAAGUACUCAGACACCACAGC(Sequence ID 1326); UCAAUGACAGUAAUUGGGUCC(Sequence ID 1310); AAAGUACUCAGACACCACA(Sequence ID 359); UAGAAAACCCAAAUCCUCA(Sequence ID 474); UAAGUACUCAGACACUACA(Sequence ID 367); UAAGUACUCAGACACCAUA(Sequence ID 361); UAAGUACUCAGACACCACA(SEQ ID NO: 360); or UCAAUGACAGUAAUUGGGU (Sequence ID 246) It includes an antisense strand consisting of, essentially, or containing a nucleic acid base sequence that differs from one of the following by only 0 or 1 nucleic acid base, The nucleotide sequence is located at positions 1 to 21 (5'→3') of the antisense strand.

[0029] In some embodiments, the CFB RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): AAAGUACUCAGACACCACAGC(Sequence ID 1275); UAGAAAACCCAAAUCCUCAUC(Sequence ID 1283); UAAGUACUCAGACACUACAGC (Sequence ID 1332); UAAGUACUCAGACACCAUAGC(Sequence ID 1333); UAAGUACUCAGACACCACAGC(Sequence ID 1326); UCAAUGACAGUAAUUGGGUCC(Sequence ID 1310); AAAGUACUCAGACACCACA(Sequence ID 359); UAGAAAACCCAAAUCCUCA(Sequence ID 474); UAAGUACUCAGACACUACA(Sequence ID 367); UAAGUACUCAGACACCAUA(Sequence ID 361); UAAGUACUCAGACACCACA(SEQ ID NO: 360); or UCAAUGACAGUAAUUGGGU(Sequence code 246); It includes an antisense strand consisting of, essentially, or containing a nucleotide sequence that differs from one of the others by only 0 or 1 nucleotides, The CFB RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, and all or substantially all of the nucleotides in both the antisense and sense strands are modified nucleotides.

[0030] In some embodiments, the CFB RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): AAAGUACUCAGACACCACAGC(Sequence ID 1275); UAGAAAACCCAAAUCCUCAUC(Sequence ID 1283); UAAGUACUCAGACACUACAGC (Sequence ID 1332); UAAGUACUCAGACACCAUAGC(Sequence ID 1333); UAAGUACUCAGACACCACAGC(Sequence ID 1326); UCAAUGACAGUAAUUGGGUCC(Sequence ID 1310); AAAGUACUCAGACACCACA(Sequence ID 359); UAGAAAACCCAAAUCCUCA(Sequence ID 474); UAAGUACUCAGACACUACA(Sequence ID 367); UAAGUACUCAGACACCAUA(Sequence ID 361); UAAGUACUCAGACACCACA(SEQ ID NO: 360); or UCAAUGACAGUAAUUGGGU(Sequence code 246); It includes an antisense strand consisting of, essentially, or containing a nucleotide sequence that differs from one of the others by only 0 or 1 nucleotides, The CFB RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, wherein all or substantially all of the nucleotides in both the antisense and sense strands are modified nucleotides, and the sense strand further comprises inverted debase residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently bound to its 5' end, wherein the targeting ligand comprises a compound having affinity for the asialoclycoprotein receptor, and preferably the targeting ligand comprises N-acetyl-galactosamine.

[0031] In some embodiments, the CFB RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): AAAGUACUCAGACACCACAGC(Sequence ID 1275); UAGAAAACCCAAAUCCUCAUC(Sequence ID 1283); UAAGUACUCAGACACUACAGC (Sequence ID 1332); UAAGUACUCAGACACCAUAGC(Sequence ID 1333); UAAGUACUCAGACACCACAGC(Sequence ID 1326); UCAAUGACAGUAAUUGGGUCC(Sequence ID 1310); AAAGUACUCAGACACCACA(Sequence ID 359); UAGAAAACCCAAAUCCUCA(Sequence ID 474); UAAGUACUCAGACACUACA(Sequence ID 367); UAAGUACUCAGACACCAUA(Sequence ID 361); UAAGUACUCAGACACCACA(SEQ ID NO: 360); or UCAAUGACAGUAAUUGGGU(Sequence code 246); The CFB RNAi agent comprises an antisense strand consisting of, essentially, or containing a nucleotide sequence that differs from one of the antisense strands by only 0 or 1 nucleotide, further comprising a sense strand at least partially complementary to the antisense strand, wherein all or substantially all of the nucleotides in both the antisense and sense strands are modified nucleotides, and the sense strand further comprises inverted debase residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently bonded to its 5' end, the targeting ligand comprising a compound having affinity for the asialoclycoprotein receptor, preferably comprising N-acetyl-galactosamine, and each antisense strand sequence is located at positions 1 to 21 of the antisense strand.

[0032] In some embodiments, the CFB RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and sense strand have the following nucleotide sequence (5'→3') pairs: AAAGUACUCAGACACCACAGC (Sequence ID 1275) and GCUGUGGUGUCUGAGUACUUU (Sequence ID 1355); UAGAAAACCCAAAUCCUCAUC (Sequence ID 1283) and GAUGAGGAUUUGGGUUUUCUA (Sequence ID 1363); UAAGUACUCAGACACUACAGC (Sequence ID 1332) and GCUGUGUGUCUGAGUACUUA (Sequence ID 1406); UAAGUACUCAGACACCAUAGC (Sequence ID 1333) and GCUGUGUGUCUGAGUACUUA (Sequence ID 1406); UAAGUACUCAGACACCACAGC (Sequence ID 1326) and GCUGUGUGUGUUUGAGUACUUA (Sequence ID 1409); UCAAUGACAGUAAUUGGGUCC (Sequence ID 1310) and GGACCCAAUUACUGUCAUUGA (Sequence ID 1390); AAAGUACUCAGACACCACA (SEQ ID NO: 359) and UGUGGUGUCUGAGUACUUU (SEQ ID NO: 1410); UAGAAAACCCAAAUCCUCA (SEQ ID NO: 474) and UGAGGAUUUGGGUUUUCUA (SEQ ID NO: 1408); UAAGUACUCAGACACUACA (sequence number 367) and UGUGGUGUCUGAGUACUUA (sequence number 779); UAAGUACUCAGACACCAUA (sequence number 361) and UGUGGUGUCUGAGUACUUA (sequence number 779); or UAAGUACUCAGACACCACA (Sequence ID 360) and UGUGGUGUUUGAGUACUUA (Sequence ID 1439) UCAAUGACAGUAAUUGGGU (sequence number 246) and ACCCAAUUACUGUCAUUGA (sequence number 665); Consists of, essentially consists of, or includes a nucleotide sequence that differs from one of the others by only 0 or 1 nucleotide, All or substantially all of the nucleotides in both the antisense and sense strands are modified nucleotides.

[0033] In some embodiments, the CFB RNAi agents disclosed herein comprise an antisense strand and a sense strand, wherein the antisense strand and sense strand have the following nucleotide sequence (5'→3') pairs: AAAGUACUCAGACACCACAGC (Sequence ID 1275) and GCUGUGGUGUCUGAGUACUUU (Sequence ID 1355); UAGAAAACCCAAAUCCUCAUC (Sequence ID 1283) and GAUGAGGAUUUGGGUUUUCUA (Sequence ID 1363); UAAGUACUCAGACACUACAGC (Sequence ID 1332) and GCUGUGUGUCUGAGUACUUA (Sequence ID 1406); UAAGUACUCAGACACCAUAGC (Sequence ID 1333) and GCUGUGUGUCUGAGUACUUA (Sequence ID 1406); UAAGUACUCAGACACCACAGC (Sequence ID 1326) and GCUGUGUGUGUUUGAGUACUUA (Sequence ID 1409); UCAAUGACAGUAAUUGGGUCC (Sequence ID 1310) and GGACCCAAUUACUGUCAUUGA (Sequence ID 1390); AAAGUACUCAGACACCACA (SEQ ID NO: 359) and UGUGGUGUCUGAGUACUUU (SEQ ID NO: 1410); UAGAAAACCCAAAUCCUCA (SEQ ID NO: 474) and UGAGGAUUUGGGUUUUCUA (SEQ ID NO: 1408); UAAGUACUCAGACACUACA (sequence number 367) and UGUGGUGUCUGAGUACUUA (sequence number 779); UAAGUACUCAGACACCAUA (sequence number 361) and UGUGGUGUCUGAGUACUUA (sequence number 779); or UAAGUACUCAGACACCACA (Sequence ID 360) and UGUGGUGUUUGAGUACUUA (Sequence ID 1439) UCAAUGACAGUAAUUGGGU (sequence number 246) and ACCCAAUUACUGUCAUUGA (sequence number 665); Consists of, essentially consists of, or includes a nucleotide sequence that differs from one of the others by only 0 or 1 nucleotide, All or substantially all of the nucleotides in both the antisense and sense strands are modified nucleotides, and the sense strand further includes inverted debase residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also includes a covalently bonded targeting ligand at its 5' end, the targeting ligand being a compound having affinity for the asialoclycoprotein receptor, preferably the targeting ligand being N-acetyl-galactosamine.

[0034] In some embodiments, the CFB RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): asAfsaguaCfucagAfcAfcCfacagsc(Sequence ID 983); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc(Sequence ID 913); usAfsgsaAfaacccaAfaUfcCfucausc(Sequence ID 915); usAfsaguaCfucagAfcAfcUfacagsc(Sequence ID 1013); usAfsaguaCfucagAfcAfcCfauagsc(Sequence ID 1014); usAfsaguaCfucagAfcAfcCfacagsc(sequence number 994); or usCfsaaugAfcaguAfaUfuGfggucsc(Sequence code 1022); It includes an antisense strand consisting of, essentially, or containing one modified nucleotide sequence that differs from the other by only one nucleotide or less, In the formula, a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate bond, with the sense strand being at least substantially complementary to the antisense strand. As those skilled in the art will clearly understand, the inclusion of phosphorothioate bonds in the modified nucleotide sequences disclosed herein replaces phosphodiester bonds that are typically present in oligonucleotides.

[0035] In some embodiments, the CFB RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): asAfsaguaCfucagAfcAfcCfacagsc(Sequence ID 983); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc(Sequence ID 913); usAfsgsaAfaacccaAfaUfcCfucausc(Sequence ID 915); usAfsaguaCfucagAfcAfcUfacagsc(Sequence ID 1013); usAfsaguaCfucagAfcAfcCfauagsc(Sequence ID 1014); usAfsaguaCfucagAfcAfcCfacagsc(sequence number 994); or usCfsaaugAfcaguAfaUfuGfggucsc(Sequence code 1022); It includes an antisense strand consisting of, essentially, or containing one modified nucleotide sequence that differs from the other by only one nucleotide or less, In the formula, a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage; and the sense strand is at least substantially complementary to the antisense strand; and all or substantially all of the nucleotides in the sense strand are modified nucleotides.

[0036] In some embodiments, the CFB RNAi agents disclosed herein have the following nucleotide sequence (5'→3'): asAfsaguaCfucagAfcAfcCfacagsc(Sequence ID 983); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc(Sequence ID 913); usAfsgsaAfaacccaAfaUfcCfucausc(Sequence ID 915); usAfsaguaCfucagAfcAfcUfacagsc(Sequence ID 1013); usAfsaguaCfucagAfcAfcCfauagsc(Sequence ID 1014); usAfsaguaCfucagAfcAfcCfacagsc(sequence number 994); or usCfsaaugAfcaguAfaUfuGfggucsc(Sequence code 1022); It includes an antisense strand consisting of, essentially, or containing one modified nucleotide sequence that differs from the other by only one nucleotide or less, The CFB RNAi agent further comprises a sense strand that is at least partially complementary to the antisense strand, wherein all or substantially all of the nucleotides of the sense strand are modified nucleotides, and all or substantially all of the nucleotides of both the antisense strand and the sense strand are modified nucleotides, and the sense strand further comprises inverted debase residues at the 3' and 5' ends of the nucleotide sequence, and the sense strand also comprises a targeting ligand covalently bound to the 5' end, the targeting ligand comprising a compound having affinity for the asialoclycoprotein receptor, preferably the targeting ligand comprising N-acetyl-galactosamine.

[0037] In some embodiments, the CFB RNAi agents disclosed herein are the following nucleotide sequence pair (5'→3'): asAfsaguaCfucagAfcAfcCfacagsc (sequence number 983) and gcugugguGfUfCfugaguacuuu (sequence number 1176); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc (sequence number 913) and gaugaggaUfUfUfggguuuucua (sequence number 1184); usAfsgsaAfaacccaAfaUfcCfucausc (sequence number 915) and gaugaggaUfuUfGfgguuuucua (sequence number 1185); usAfsaguaCfucagAfcAfcUfacagsc (sequence number 1013) and gcugugguGfUfCfugaguacuua (sequence number 1235); usAfsaguaCfucagAfcAfcCfauagsc (sequence number 1014) and gcugugguGfUfCfugaguacuua (sequence number 1235); usAfsaguaCfucagAfcAfcCfacagsc (sequence number 994) and gcugugguGfUfUfugaguacuua (sequence number 1248); or usCfsaaugAfcaguAfaUfuGfggucsc (sequence number 1022) and ggacccAfaUfuAfcugucauuga (sequence number 1251); Consists of, essentially comprises, or includes one of, an antisense chain and a sense chain, In the formula, a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; and s represents a phosphorothioate linkage; and the sense chain also includes a targeted ligand having affinity for the asialoglycoprotein receptor, preferably N-acetylgalactosamine, and the targeted ligand may be ligated to the 5' end of the sense chain.

[0038] In some embodiments, the CFB RNAi agents disclosed herein are the following sequence pair (5'→3'): asAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO: 983) and (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuus(invAb)(SEQ ID NO: 1077); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc (sequence number 913) and (NAG37)s(invAb)sgaugaggaUfUfUfggguuuucuas(invAb)(sequence number 1085); usAfsgsaAfaacccaAfaUfcCfucausc (sequence number 915) and (NAG37)s(invAb)sgaugaggaUfuUfGfgguuuucuas(invAb) (sequence number 1086); usAfsaguaCfucagAfcAfcUfacagsc (sequence number 1013) and (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuas(invAb)(sequence number 1136); usAfsaguaCfucagAfcAfcCfauagsc (SEQ ID NO: 1014) and (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuas(invAb)(SEQ ID NO: 1136); usAfsaguaCfucagAfcAfcCfacagsc (sequence number 994) and (NAG37)s(invAb)sgcugugguGfUfUfugaguacuuas(invAb)(sequence number 1149); or usCfsaaugAfcaguAfaUfuGfggucsc (sequence number 1022) and (NAG37)s(invAb)sggacccAfaUfuAfcugucauugas(invAb)(sequence number 1152); The antisense strand and sense strand consist of, essentially consist of, or include one of the modified nucleotide sequences that differ by 0 or 1 nucleotide or less from the sense strand, In the formula, a, c, g, and u represent 2'-O-methyladenosine, cytidine, guanosine, and uridine, respectively; Af, Cf, Gf, and Uf represent 2'-fluoroadenosine, cytidine, guanosine, and uridine, respectively; (NAG37)s represents a tridentate N-acetylgalactosamine hepatocyte-targeting ligand having the chemical structure shown in Table 6; (invAb) represents an inverse nonbasic deoxyribonucleotide (see also Table 6); and s represents a phosphorothioate linkage.

[0039] Compositions comprising the disclosed RNAi agent, further comprising pharmaceutically acceptable excipients, are also disclosed herein.

[0040] Furthermore, this specification provides a method for inhibiting CFB gene expression in human hepatocytes in vivo, comprising introducing an effective amount of a disclosed CFB RNAi agent or a disclosed composition into the target.

[0041] A method for treating CFB-related diseases, disorders, or symptoms, comprising administering a therapeutically effective amount of a disclosed composition to a human subject in need thereof, is further provided herein.

[0042] In some embodiments, the disease is PNH, IgAN, C3G, AMD including early and / or intermediate AMD, aHUS, GA, IC-MPGN, LN, anti-GBM, RA, Doyne honeycomb retinal dystrophy, and / or other complement-mediated renal diseases.

[0043] In some embodiments, the RNAi agent is administered in a dose of approximately 0.05 mg / kg to approximately 6.0 mg / kg of the human subject's body weight. In some embodiments, the CFB RNAi agents disclosed herein are administered in fixed single-injection doses containing approximately 25 mg, approximately 50 mg, approximately 100 mg, approximately 200 mg, approximately 300 mg, or approximately 400 mg of the CFB RNAi agent.

[0044] Methods of use of the disclosed RNAi agents or compositions for treating diseases, disorders, or symptoms that are at least partially mediated by CFB gene expression are also provided herein.

[0045] The disclosed RNAi agents or methods of use of the disclosed compositions are further provided herein for preparing pharmaceutical compositions for treating diseases, disorders, or symptoms that are at least partially mediated by CFB gene expression. [Brief explanation of the drawing]

[0046] [Figure 1] Figure 1 is a graph plotting normalized relative serum cCFB protein levels in cynomolgus monkeys relative to pre-administration levels. The syringe indicates the timing of injection. (See Example 12).

[0047] [Figure 2] Figure 2 is a graph plotting the normalized relative Wieslab® AP (Alternative Route) assay results in cynomolgus monkeys relative to baseline. The syringe indicates the timing of injection. (See Example 12).

[0048] [Figure 3] Figure 3 is a graph plotting normalized relative serum cCFB protein levels in cynomolgus monkeys relative to pre-administration levels. The syringe indicates the timing of injection. (See Example 13).

[0049] [Figure 4] Figure 4 is a graph plotting normalized relative serum cBb levels in cynomolgus monkeys relative to pre-administration levels. The syringe indicates the timing of injection. (See Example 13).

[0050] [Figure 5] Figure 5 is a graph plotting the results of a normalized relative AP50 hemolysis assay (alternative route) in cynomolgus monkeys relative to pre-administration levels. The syringe indicates the timing of injection. (See Example 13).

[0051] [Figure 6] Figure 6 is a graph plotting the normalized relative Wieslab® AP (Alternative Route) assay results in cynomolgus monkeys relative to baseline. The syringe indicates the timing of injection. (See Example 13).

[0052] [Figure 7] Figure 7 is a graph plotting the results of a normalized relative CH50 hemolysis assay (classical route) in cynomolgus monkeys relative to pre-administration levels. The syringe indicates the timing of injection. (See Example 13).

[0053] [Figure 8]Figure 8 is a graph plotting the results of the normalized relative Wieslab® CP (classical route) assay in cynomolgus monkeys relative to pre-administration. The syringe indicates the timing of injection. (See Example 13).

[0054] [Figure 9] Figure 9 is a graph plotting the relative serum cCFB protein levels achieved with the CFB RNAi agent in cynomolgus monkeys, normalized to pre-administration levels. The syringe indicates the timing of injection of the CFB RNAi agent AD13933. (See Example 16).

[0055] [Figure 10] Figure 10 is a graph plotting the relative serum cBb levels achieved with the CFB RNAi agent AD13933 in cynomolgus monkeys, normalized to pre-administration levels. The syringe indicates the timing of injection of the CFB RNAi agent AD13933. (See Example 16).

[0056] [Figure 11] Figure 11 is a graph plotting the results of a relative AP50 hemolysis assay (alternative route) achieved with the CFB RNAi agent AD13933 in cynomolgus monkeys, normalized to pre-administration levels. The syringe indicates the timing of injection of the CFB RNAi agent AD13933. (See Example 16).

[0057] [Figure 12] Figure 12 is a graph plotting the relative Wieslab® AP (alternative route) assay results achieved with the CFB RNAi agent AD13933 in cynomolgus monkeys, normalized to baseline. The syringe indicates the timing of injection of the CFB RNAi agent AD13933. (See Example 16).

[0058] [Figure 13]Figure 13 is a graph plotting the results of a normalized relative CH50 hemolysis assay (classical route) against pre-administration levels in cynomolgus monkeys. The syringe indicates the timing of injection of the CFB RNAi agent AD13933. (See Example 16).

[0059] [Figure 14] Figure 14 is a graph plotting the results of the normalized relative Wieslab® CP (classical route) assay in cynomolgus monkeys relative to pre-administration. The syringe indicates the timing of injection of the CFB RNAi agent AD13933. (See Example 16).

[0060] [Figure 15A] Figure 15A shows the chemical structure of the CFB RNAi agent AD12096, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 913 / 1085), as a free acid. [Figure 15B] Figure 15B shows the chemical structure of the CFB RNAi agent AD12096, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 913 / 1085), as a free acid. [Figure 15C] Figure 15C shows the chemical structure of the CFB RNAi agent AD12096, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 913 / 1085), as a free acid. [Figure 15D] Figure 15D shows the chemical structure of the CFB RNAi agent AD12096, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 913 / 1085), as a free acid.

[0061] [Figure 16A] Figure 16A shows the chemical structure of the CFB RNAi agent AD12096, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 913 / 1085), as its sodium salt. [Figure 16B]Figure 16B shows the chemical structure of the CFB RNAi agent AD12096, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 913 / 1085), as a sodium salt. [Figure 16C] Figure 16C shows the chemical structure of the CFB RNAi agent AD12096, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 913 / 1085), as a sodium salt. [Figure 16D] Figure 16D shows the chemical structure of the CFB RNAi agent AD12096, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 913 / 1085), as a sodium salt.

[0062] [Figure 17A] Figure 17A shows the chemical structure of the CFB RNAi agent AD13126, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 983 / 1077), as a free acid. [Figure 17B] Figure 17B shows the chemical structure of the CFB RNAi agent AD13126, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 983 / 1077), as a free acid. [Figure 17C] Figure 17C shows the chemical structure of the CFB RNAi agent AD13126, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 983 / 1077), as a free acid. [Figure 17D] Figure 17D shows the chemical structure of the CFB RNAi agent AD13126, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 983 / 1077), as a free acid.

[0063] [Figure 18A] Figure 18A shows the chemical structure of the CFB RNAi agent AD13126, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 983 / 1077), as its sodium salt. [Figure 18B] Figure 18B shows the chemical structure of the CFB RNAi agent AD13126, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 983 / 1077), as a sodium salt. [Figure 18C] Figure 18C shows the chemical structure of the CFB RNAi agent AD13126, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 983 / 1077), as its sodium salt. [Figure 18D] Figure 18D shows the chemical structure of the CFB RNAi agent AD13126, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 983 / 1077), as its sodium salt.

[0064] [Figure 19A] Figure 19A shows the chemical structure of the CFB RNAi agent AD13933, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 1013 / 1136), as a free acid. [Figure 19B] Figure 19B shows the chemical structure of the CFB RNAi agent AD13933, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 1013 / 1136), as a free acid. [Figure 19C] Figure 19C shows the chemical structure of the CFB RNAi agent AD13933, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 1013 / 1136), as a free acid. [Figure 19D] Figure 19D shows the chemical structure of the CFB RNAi agent AD13933, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 1013 / 1136), as a free acid.

[0065] [Figure 20A]Figure 20A shows the chemical structure of the CFB RNAi agent AD13933, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 1013 / 1136), as a sodium salt. [Figure 20B] Figure 20B shows the chemical structure of the CFB RNAi agent AD13933, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 1013 / 1136), as a sodium salt. [Figure 20C] Figure 20C shows the chemical structure of the CFB RNAi agent AD13933, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 1013 / 1136), as a sodium salt. [Figure 20D] Figure 20D shows the chemical structure of the CFB RNAi agent AD13933, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 1013 / 1136), as a sodium salt.

[0066] [Figure 21A] Figure 21A shows the chemical structure of the CFB RNAi agent AD13935, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 994 / 1149), as a free acid. [Figure 21B] Figure 21B shows the chemical structure of the CFB RNAi agent AD13935, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 994 / 1149), as a free acid. [Figure 21C] Figure 21C shows the chemical structure of the CFB RNAi agent AD13935, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 994 / 1149), as a free acid. [Figure 21D] Figure 21D shows the chemical structure of the CFB RNAi agent AD13935, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 994 / 1149), as a free acid.

[0067] [Figure 22A] Figure 22A shows the chemical structure of the CFB RNAi agent AD13935, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 994 / 1149), as a sodium salt. [Figure 22B] Figure 22B shows the chemical structure of the CFB RNAi agent AD13935, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 994 / 1149), as a sodium salt. [Figure 22C] Figure 22C shows the chemical structure of the CFB RNAi agent AD13935, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 994 / 1149), as a sodium salt. [Figure 22D] Figure 22D shows the chemical structure of the CFB RNAi agent AD13935, which has a targeted ligand (NAG37) ligated to the 5' end of the sense strand (SEQ ID NO: 994 / 1149), as a sodium salt. [Modes for carrying out the invention]

[0068] The disclosed CFB RNAi agents, their compositions, and methods of use can be more readily understood by referring to the following detailed description, which forms part of this disclosure. It should be understood that this disclosure is not limited to what is specifically described and / or shown herein, and that the terms used herein are for illustrative purposes only to illustrate specific embodiments and are not intended to limit them.

[0069] Certain features of the disclosures contained herein are described herein in the context of different embodiments for clarity, but it should be understood that they may also be provided in combination in a single embodiment. Conversely, various features of the disclosed methods described in the context of a single embodiment for brevity may be provided separately or in any partial combination.

[0070] definition

[0071] As used herein, “RNAi agent” means the chemical composition of a substance comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule capable of sequence-specifically degrading or inhibiting (e.g., degrading or inhibiting) the translation of a messenger RNA (mRNA) transcript of a target mRNA. As used herein, an RNAi agent may act by an RNA interference mechanism (i.e., by inducing RNA interference through interaction with the RNA interference pathway mechanism (RNA-induced silencing complex or RISC) in mammalian cells) or by any alternative mechanism or pathway. While an RNAi agent is considered to act primarily by an RNA interference mechanism as used herein, the disclosed RNAi agents are not constrained by or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein consist of a sense strand and an antisense strand and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the RNAi agent described herein is at least partially complementary to the targeted mRNA (i.e., CFB mRNA). The RNAi agent may contain one or more modified nucleotides and / or one or more non-phosphodiester bonds.

[0072] As used herein, the terms “silencing,” “reducing,” “inhibiting,” “downregulating,” or “knockdown,” when referring to the expression of a given gene, mean that the expression of the gene, as measured by the level of RNA transcribed from the gene or the level of polypeptides, proteins, or protein subunits translated from mRNA, in a cell, cell population, tissue, organ, or subject on which the gene is transcribed, is reduced compared to a second cell, cell population, tissue, organ, or subject that is not treated or is not treated in the same way, when the cell, cell population, tissue, organ, or subject is treated with an RNAi agent as described herein.

[0073] As used herein, the terms “sequence” and “nucleotide sequence” mean a sequence or order of nucleic acid bases or nucleotides written in consecutive letters using standard nomenclature. Nucleic acid molecules may contain unmodified and / or modified nucleotides. Nucleic acid sequences may contain unmodified and / or modified nucleotides.

[0074] As used herein, “base,” “nucleotide base,” or “nucleic acid base” are heterocyclic pyrimidines or purine compounds that are components of a nucleotide, and include adenine and guanine as the first purine base, and cytosine, thymine, and uracil as the first pyrimidine base. Nucleic acid bases may be further modified to include, but are not limited to, universal bases, hydrophobic bases, indiscriminate bases, size-expanded bases, and fluorinated bases. (See, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P.ed. Wiley-VCH, 2008). The synthesis of such modified nucleic acid bases (including phosphoramidite compounds containing modified nucleic acid bases) is known in the art.

[0075] As used herein, the term “nucleotide” has the same meaning as it is commonly understood in the art. Therefore, as used herein, the term “nucleotide” refers to a glycoside comprising a sugar moiety, a base moiety, and a covalent bonding group (binding group) such as a phosphate or phosphorothioate nucleoside linking group, and includes both naturally occurring nucleotides such as DNA or RNA, and non-naturally occurring nucleotides comprising modified sugar and / or base moieties, also referred herein as nucleotide analogs. In this specification, a single nucleotide may be referred to as a monomer or unit.

[0076] Where used herein, unless otherwise specified, the term “complementary” means, when used to describe a first nucleic acid base or nucleotide sequence (e.g., the sense strand of an RNAi agent or target mRNA) with respect to a second nucleic acid base or nucleotide sequence (e.g., the antisense strand of an RNAi agent or a single-stranded antisense oligonucleotide), the ability of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize with an oligonucleotide containing the second nucleotide sequence (forming base-pair hydrogen bonds under mammalian physiological conditions (or other suitable in vivo or in vitro conditions)) and to form a double-stranded or double-helical structure under specific standard conditions. Those skilled in the art will be able to select the set of conditions most suitable for hybridization testing. Complementary sequences include, at least, Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimeographs, as long as the above hybridization requirements are met. Sequence identity or complementarity is independent of modification. For example, a and Af as defined herein are complementary to U (or T) and are identical to A for the purpose of determining identity or complementarity.

[0077] As used herein, “fully complementary” or “sufficiently complementary” means that in a pair of hybridized nucleic acid bases or nucleotide sequence molecules, all (100%) of the bases in the contiguous sequence of the first oligonucleotide hybridize with the same number of bases in the contiguous sequence of the second oligonucleotide. The contiguous sequence may consist of all or part of the first or second nucleotide sequence.

[0078] As used herein, “partially complementary” means that in a pair of hybridized nucleic acid bases or nucleotide sequence molecules, at least 70% of the bases in the sequence of the first oligonucleotide hybridize with the same number of bases in the sequence of the second oligonucleotide, but not all of them. The sequence may consist of all or part of the first or second nucleotide sequence.

[0079] As used herein, “substantially complementary” means that in a pair of hybridized nucleic acid bases or nucleotide sequence molecules, at least 85% (but not all) of the bases in the sequence of the first oligonucleotide hybridize with the same number of bases in the sequence of the second oligonucleotide. The sequence may comprise all or part of the first or second nucleotide sequence.

[0080] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used in reference to nucleic acid base or nucleotide matching between the sense strand and antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of MUC5AC mRNA.

[0081] As used herein, the terms “substantially identical” or “substantially identical” applied to nucleic acid sequences mean that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% sequence identity, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences across a comparison window. The percentage is calculated by determining the number of positions where the same type of nucleic acid base occurs in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The inventions disclosed herein encompass nucleotide sequences that are substantially identical to those disclosed herein.

[0082] As used herein, the terms “individual,” “patient,” and “subject” are used interchangeably to refer to birds, humans and other primates, as well as members of any animal species, including but not limited to commercially relevant mammals or animal models, such as mice, rats, monkeys, cattle, pigs, horses, sheep, cats, and dogs. Preferably, the subject is human.

[0083] As used herein, the terms “to treat,” “treatment,” etc., mean a method or process performed to provide relief or reduction of the number, severity, and / or frequency of one or more symptoms of the disease in question. As used herein, “to treat” and “treatment” may include prevention, control, prophylactic treatment, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of the disease in question.

[0084] As used herein, the phrase “introduced into cells” when referring to RNAi agents means functionally delivering the RNAi agent to cells. The phrase “functional delivery” means delivering the RNAi agent to cells in a manner that enables the RNAi agent to have its expected biological activity, such as sequence-specific inhibition of gene expression.

[0085] Unless otherwise specified, the symbols used in this specification [ka] The use of means that any one or more bases in accordance with the scope of the invention described herein may be linked thereto.

[0086] As used herein, the term "isomer" refers to compounds having the same molecular formula but differing in the bonding properties or arrangement of their atoms or in the spatial arrangement of their atoms. Isomers that differ in the spatial arrangement of their atoms are called "stereoisomers." Stereoisomers that are not mirror images of each other are called "diastereomers," and stereoisomers that are mirror images that cannot be superimposed are called "enantiomers," or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."

[0087] Where used herein, unless specifically identified by a structure having a particular conformation, each structure disclosed herein is intended to represent all such possible isomers, including optically pure and racemic forms, for each structure that contains a chiral center and thus results in an enantiomer, diastereomer, or other stereoisomer configuration. For example, the structures disclosed herein are intended to cover mixtures of diastereomers as well as single stereoisomers.

[0088] As used in the claims of this specification, the phrase "consisting of" excludes elements, processes, or components not specified in the claims. As used in the claims of this specification, the phrase "consisting essentially of" limits the claims to specific materials or processes and not substantially affect the basic and novel features of the claimed invention.

[0089] Those skilled in the art will readily understand and recognize that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state, depending on the environment in which the compound or composition is placed. Therefore, when used herein, the structures disclosed herein assume that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH), as will be readily understood by those skilled in the art. Accordingly, compounds described herein that have an unstable proton or basic atom should be understood as representing a salt form of the corresponding compound. The compounds described herein may be in the form of free acids, free bases, or salts. pharmaceutically acceptable salts of the compounds described herein should be understood to be within the scope of the present invention.

[0090] As used herein, the terms “linked” or “conjugated” refer to a connection between two compounds or molecules, meaning that the two compounds or molecules are linked by a covalent bond. Unless otherwise specified herein, the terms “linked” and “conjugated” may refer to a connection between a first compound and a second compound, with or without intervening atoms or groups of atoms.

[0091] As used herein, the term “including” is used herein to mean the phrase “including but not limited to,” and is interchangeable with it. The term “or” is used herein to mean the term “and / or,” and is interchangeable with it, unless the context clearly indicates otherwise.

[0092] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art. Similar or equivalent methods and materials to those described herein may be used in carrying out or testing the present invention, but suitable methods and materials are listed below. All publications, patent applications, patents, and other references referenced herein are incorporated by reference in their entirety. In case of any conflict, this specification, including definitions, shall prevail. Furthermore, the materials, methods, and examples are illustrative and not intended to limit the scope of the invention.

[0093] Where a value is explicitly stated, it should be understood that a value of approximately the same quantity or amount as the stated value is also within the scope of this disclosure. Where a combination is disclosed, each partial combination of the elements of that combination is also specifically disclosed and within the scope of this disclosure. Conversely, where different elements or groups of elements are disclosed individually, their combinations are also disclosed. Where any element of this disclosure is disclosed as having multiple alternative forms, examples of disclosures in which each alternative form is excluded, either alone or in any combination with other alternative forms, are also disclosed herein, and two or more elements of this disclosure may have such exclusions, and all combinations of elements having such exclusions are disclosed herein.

[0094] Other objects, features, embodiments, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims.

[0095] Detailed explanation RNAi agents RNAi agents for inhibiting CFB gene expression are described herein. Each CFB RNAi agent comprises a sense strand and an antisense strand. The sense strand may be 15 to 49 nucleotides long. The antisense strand may be 18 to 30 nucleotides long. The sense strand and antisense strand may be the same length or of different lengths. In some embodiments, the sense strand and antisense strand are each independently 21 to 27 nucleotides long. In some embodiments, both the sense strand and antisense strand are each 21 to 26 nucleotides long. In some embodiments, the sense strand and antisense strand are each 21 to 24 nucleotides long. In some embodiments, the sense strand is about 19 nucleotides long and the antisense strand is about 21 nucleotides long. In some embodiments, the sense strand is about 21 nucleotides long and the antisense strand is about 23 nucleotides long. In some embodiments, the sense strand is 23 nucleotides long and the antisense strand is 21 nucleotides long. In some embodiments, both the sense strand and antisense strand are each 21 nucleotides long. In some embodiments, the RNAi agent antisense strands are each independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides long. In some embodiments, the RNAi agent sense strands are each independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides long. The sense strand and antisense strand are annealed to form a double helix, and in some embodiments, the double-stranded RNAi agent has a double helix length of approximately 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides.

[0096] Tables 2, 3, 4A, 4B, or 5C provide examples of nucleotide sequences used in the formation of CFB RNAi agents. Tables 5A, 5B, or 5C show examples of RNAi agent double helix containing the sense and antisense strand sequences from Tables 2, 3, 4A, 4B, or 5C.

[0097] In some embodiments, the region of complete, substantial, or partial complementarity between the sense strand and the antisense strand is 15–26 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides long and occurs at or near the 5' end of the antisense strand (for example, this region may be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not fully, substantially, or partially complementary).

[0098] The sense strand of the CFB RNAi agent described herein comprises at least 15 consecutive nucleotides having at least 85% identity with the core stretch sequence (hereinafter also referred to herein as the “core stretch” or “core sequence”) of the same number of nucleotides in the CFB mRNA. In some embodiments, the sense strand core stretch sequence is 100% (completely) complementary or at least about 85% (substantially) complementary to the antisense strand core stretch sequence, and therefore the sense strand core stretch sequence is typically completely identical or at least about 85% identical to a nucleotide sequence of the same length (sometimes referred to as the target sequence) present in the CFB mRNA target. In some embodiments, this sense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides long. In some embodiments, this sense strand core stretch is 17 nucleotides long. In some embodiments, this sense strand core stretch is 19 nucleotides long. In some embodiments, this sense strand core stretch is 21 nucleotides long.

[0099] The antisense strand of the CFB RNAi agent described herein comprises at least 15 consecutive nucleotides having at least 85% complementarity to the same number of nucleotides core stretch of the CFB mRNA and the same number of nucleotides core stretch of the corresponding sense strand. In some embodiments, the antisense strand core stretch is 100% (completely) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the CFB mRNA target (e.g., the target sequence). In some embodiments, this antisense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides long. In some embodiments, this antisense strand core stretch is 21 nucleotides long. In some embodiments, this antisense strand core stretch is 19 nucleotides long. The sense strand core stretch sequence may be the same length as the corresponding antisense core sequence or may be of a different length.

[0100] CFB RNAi agents form a double helix through annealing of the sense strand and antisense strand. The sense strand and antisense strand of a CFB RNAi agent may be partially, substantially, or completely complementary to each other. Within the complementary double helix region, the sense strand core stretch sequence is at least 85% or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides that is at least 85% or 100% complementary to the corresponding 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense strand core stretch sequences of a CFB RNAi agent have a region of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 nucleotides that is at least 85% or 100% base-paired).

[0101] In some embodiments, the antisense strand of the CFB RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2, Table 3, or Table 5C by only 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the CFB RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2, Table 4A, Table 4B, or Table 5C by only 0, 1, 2, or 3 nucleotides.

[0102] In some embodiments, the sense strand and / or antisense strand may optionally and independently contain an additional 1, 2, 3, 4, 5, or 6 nucleotides (extension) at the 3' end, 5' end, or both the 3' and 5' ends of the core stretch sequence. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the corresponding sequence of the CFB mRNA. The additional nucleotides of the sense strand, if present, may or may not be identical to the corresponding sequence of the CFB mRNA. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the corresponding additional nucleotides of the sense strand.

[0103] As used herein, the extension includes 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' ends of the sense strand core stretch sequence and / or antisense strand core stretch sequence. The extension nucleotides on the sense strand may or may not be complementary to any of the core stretch sequence nucleotides or extension nucleotides in the corresponding antisense strand. Conversely, the extension nucleotides on the antisense strand may or may not be complementary to any of the nucleotides (either core stretch nucleotides or extension nucleotides) in the corresponding sense strand. In some embodiments, both the sense and antisense strands of the RNAi agent include 3' and 5' extensions. In some embodiments, one or more 3' extension nucleotides on one strand base-pair with one or more 5' extension nucleotides on the other strand. In other embodiments, one or more 3' extension nucleotides on one strand do not base-pair with one or more 5' extension nucleotides on the other strand. In some embodiments, the CFB RNAi agent has an antisense strand having a 3' extension and a sense strand having a 5' extension. In some embodiments, the extension nucleotides are unpaired and form an overhang. As used herein and in the art, “overhang” refers to the extension of a stretch of one or more unpaired nucleotides located at the end of either the sense strand or the antisense strand that does not form a hybridize or part of the double-stranded portion of the RNAi agent disclosed herein.

[0104] In some embodiments, the CFB RNAi agent comprises an antisense strand having a 3' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the CFB RNAi agent comprises an antisense strand having a 3' extension of 1, 2, or 3 nucleotides in length. In some embodiments, one or more antisense strand extension nucleotides comprise nucleotides complementary to the corresponding CFB mRNA sequence. In some embodiments, one or more antisense strand extension nucleotides comprise nucleotides not complementary to the corresponding CFB mRNA sequence.

[0105] In some embodiments, the CFB RNAi agent comprises a sense strand having a 3' extension of 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more nucleotides of the sense strand extension comprise adenosine, uracil, or thymidine nucleotides, AT dinucleotides, or nucleotides corresponding to or identical to nucleotides in the CFB mRNA sequence. In some embodiments, the 3' sense strand extension comprises, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (each listed from 5' to 3').

[0106] The sense strand may have a 3' extension and / or a 5' extension. In some embodiments, the CFB RNAi agent includes a sense strand having a 5' extension of 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides include nucleotides that correspond to or are identical to nucleotides in the CFB mRNA sequence.

[0107] Tables 2, 3, 4A, 4B, or 5C show examples of sequences used to form CFB RNAi agents. In some embodiments, the CFB RNAi agent antisense strand contains one of the sequences in Tables 2, 3, or 5C. In certain embodiments, the CFB RNAi agent antisense strand contains or consists of one of the modified sequences in Table 3. In some embodiments, the CFB RNAi agent antisense strand contains the sequences of nucleotides 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 (5' end → 3' end) of any of the sequences in Tables 2, 3, or 5C. In some embodiments, the CFB RNAi agent sense strand contains one of the sequences in Tables 2, 4A, 4B, or 5C. In some embodiments, the CFB RNAi agent sense strand contains a sequence of nucleotides 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 (5' end → 3' end) of any of the sequences in Table 2, Table 4A, Table 4B, or Table 5C. In certain embodiments, the CFB RNAi agent sense strand contains or consists of one of the modified sequences in Table 4A or Table 4B.

[0108] In some embodiments, the sense and antisense strands of the RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense and antisense strands of the RNAi agent described herein contain different numbers of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a blunt end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a blunt end. In some embodiments, both ends of the RNAi agent form a blunt end. In some embodiments, neither end of the RNAi agent is a blunt end. As used herein, “blunt end” refers to the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).

[0109] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form a frayed end. In some embodiments, both ends of the RNAi agent form a frayed end. In some embodiments, neither end of the RNAi agent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi agent where the terminal nucleotides of the two annealed strands from a pair (i.e., not forming an overhang) are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi agent form an overhang. The unpaired nucleotides may be present on the sense strand or the antisense strand and result in either a 3' overhang or a 5' overhang. In some embodiments, the RNAi agent includes a blunt end and a frayed end, a blunt end and a 5' overhang end, a blunt end and a 3' overhang end, a frayed end and a 5' overhang end, a frayed end and a 3' overhang end, two 5' overhang ends, two 3' overhang ends, a 5' overhang end and a 3' overhang end, two frayed ends, or two blunt ends. Typically, if present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.

[0110] The CFB RNAi agents disclosed herein may also consist of one or more modified nucleotides. In some embodiments, substantially all of the nucleotides in the sense strand and substantially all of the nucleotides in the antisense strand of the CFB RNAi agent are modified nucleotides. The CFB RNAi agents disclosed herein may further consist of one or more modified internucleoside links, for example, one or more phosphorothioate links. In some embodiments, the CFB RNAi agent contains one or more modified nucleotides and one or more modified internucleoside links. In some embodiments, 2'-modified nucleotides are combined with modified internucleoside links.

[0111] In some embodiments, the CFB RNAi agent is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the CFB RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, the CFB RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms well known in the art are within the scope of the invention disclosed herein.

[0112] Modified nucleotides Modified nucleotides, when used in various oligonucleotide constructs, can maintain the activity of the compounds in cells while simultaneously increasing the serum stability of these compounds, and can minimize the potential for activating interferon activity in humans when the oligonucleotide constructs are administered.

[0113] In some embodiments, the CFB RNAi agent contains one or more modified nucleotides. As used herein, “modified nucleotide” is a nucleotide other than a ribonucleotide (2'-hydroxylnucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides may include, but are not limited to, deoxyribonucleotides, nucleotide mimes, debasalized nucleotides, 2'-modified nucleotides, inverted nucleotides, modified nucleic acid base-containing nucleotides, cross-linked nucleotides, peptide nucleic acids (PNAs), 2',3'-seconucleotide mimes (unlocked nucleic acid base analogs), locked nucleotides, 3'-O-methoxy(2'-nucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-Me,2'-fluoronucleotides, morpholine nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. Examples of 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at position 2' of a five-membered sugar ring) include, but are not limited to, 2'O-methyl nucleotide (also known herein or in the art as 2'-methoxy nucleotide), 2'-fluoro nucleotide (also known herein or in the art as 2'-deoxy-2'-fluoro nucleotide), 2'-deoxy nucleotide, 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotide (also known herein or in the art as 2'-MOE nucleotide), 2'-amino nucleotide, and 2'-alkyl nucleotide. It is not necessary for all positions of a given compound to be uniformly modified. Conversely, two or more modifications can be incorporated into a single CFB RNAi agent or into its single nucleotide. The sense and antisense strands of a CFB RNAi agent can be synthesized and / or modified by methods known in the art.Modifications in one nucleotide are independent of modifications in other nucleotides.

[0114] Modified nucleic acid bases include synthetic and natural nucleic acid bases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2,N-6 and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, adenine and guanine 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other adenine and guanine alkyl derivatives, and 2-thio Examples include uracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azouracil, 5-uracil (pseuduculacil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.

[0115] In some embodiments, the 5' and / or 3' ends of the antisense strand may contain a debasic residue (Ab), which may also be called a “debasic site” or “debasic nucleotide.” A debasic residue (Ab) is a nucleotide or nucleoside lacking a nucleic acid base at the 1' position of the sugar moiety. In some embodiments, the debasic residue may be located within a nucleotide sequence. In some embodiments, Ab or AbAb may be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand may contain one or more further debasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, a debasic deoxyribose residue may be replaced with a ribitol(debasic ribose) residue.

[0116] In some embodiments, all or substantially all of the nucleotides in an RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand, which are ribonucleotides (i.e., unmodified). As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the unmodified ribonucleotide sense strand. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand having two or fewer (i.e., 0, 1, or 2) nucleotides in the unmodified ribonucleotide antisense strand. In some embodiments, one or more nucleotides in an RNAi agent are unmodified ribonucleotides. The chemical structures of specific modified nucleotides are shown in Table 6 herein.

[0117] Modified internucleoside linkages In some embodiments, one or more nucleotides of the CFB RNAi agent are linked by non-standard linkages or a backbone (i.e., modified nucleoside linkages or a modified backbone). Modified nucleoside links or skeletons include, but are not limited to, phosphorothioate groups (represented herein by lowercase "s"), chiral phosphorothioate, thiophosphate, phosphorodithioate, phosphotryester, aminoalkyl-phosphotryester, alkylphosphonate (e.g., methylphosphonate or 3'-alkylenephosphonate), chiral phosphonate, phosphinate, phosphoramidate (e.g., 3'-aminophosphoramidate, aminoalkylphosphoramidate, or thionophosphoramidate), thionoalkyl-phosphonate, thionoalkylphosphotryester, morpholino linkage, boranophosphate having a normal 3'-5' linkage, 2'-5' linkage analogues of boranophosphate, or boranophosphate having reverse polarity in which adjacent pairs of nucleoside units are linked from 3'-5' to 5'-3' or from 2'-5' to 5'-2'. In some embodiments, the modified internucleoside linkages or skeletons lack a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar links, mixed heteroatoms and alkyl or cycloalkyl intersugar links, or one or more short-chain heteroatoms or heterocyclic intersugar links. In some embodiments, the modified internucleoside skeletons include, but are not limited to, siloxane skeletons, sulfide skeletons, sulfoxide skeletons, sulfone skeletons, formacetyl and thioformacetyl skeletons, methyleneformacetyl and thioformacetyl skeletons, alkene-containing skeletons, sulfamate skeletons, methyleneimino and methylenehydrazino skeletons, sulfonate and sulfonamide skeletons, amide skeletons, and other skeletons with mixed N, O, S and CH2 components.

[0118] In some embodiments, the sense strand of the CFB RNAi agent may contain phosphorothioate links 1, 2, 3, 4, 5, or 6, the antisense strand of the CFB RNAi agent may contain phosphorothioate links 1, 2, 3, 4, 5, or 6, or both the sense strand and the antisense strand may independently contain phosphorothioate links 1, 2, 3, 4, 5, or 6.

[0119] In some embodiments, the CFB RNAi agent sense strand contains at least two phosphorothioate nucleoside links. In some embodiments, the phosphorothioate nucleoside links are located between nucleotides at positions 1-3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate nucleoside link is located at the 5' end of the sense strand nucleotide sequence, and another phosphorothioate link is located at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate nucleoside links are located at the 5' end of the sense strand, and another phosphorothioate link is located at the 3' end of the sense strand. In some embodiments, the sense strand does not contain any phosphorothioate nucleoside links between nucleotides, but contains one, two, or three phosphorothioate links between both the 5' and 3' terminal nucleotides and optionally present inverted debase residue terminal caps. In some embodiments, the targeted ligand is linked to the sense strand via phosphorothioate links.

[0120] In some embodiments, the CFB RNAi agent antisense strand contains four phosphorothioate nucleoside linkages. In some embodiments, the four phosphorothioate nucleoside linkages are located between nucleotides at positions 1-3 from the 5' end of the antisense strand and between nucleotides at positions 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end. In some embodiments, three phosphorothioate nucleoside linkages are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphorothioate nucleoside linkage is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the CFB RNAi agent contains at least three or four phosphorothioate nucleoside linkages in the antisense strand.

[0121] Capping residue or portion In some embodiments, the sense strand may include one or more capping residues or portions, which may also be referred to in the art as “caps,” “terminal caps,” or “capping residues.” As used herein, “capping residues” are non-nucleotide compounds or other portions that can be incorporated into one or more ends of the nucleotide sequence of an RNAi agent disclosed herein. In some examples, capping residues can provide the RNAi agent with certain beneficial properties, such as protection against exonuclease degradation. In some embodiments, inverted debase residues (invAb) (also referred to in the art as “inverted debase sites”) are added as capping residues. (See, for example, F. Czauderna, Nucleic Acids Res. 2003; 31(11), 2705-16; U.S. Patent No. 5,998,203). Capping residues are commonly known in the art and include, for example, terminal CFBH7(propyl), C6H 13 (Hexyl) or C 12 H 25Similar to carbon chains such as (dodecyl) groups, it contains inverted debasing residues. In some embodiments, the capping residue is located at either the 5' or 3' end of the sense strand, or at both the 5' and 3' ends. In some embodiments, the 5' and / or 3' ends of the sense strand may contain two or more inverted debasing deoxyribose moieties as capping residues.

[0122] In some embodiments, one or more inverted debase residues (invAbs) are added to the 3' end of the sense strand. In some embodiments, one or more inverted debase residues (invAbs) are added to the 5' end of the sense strand. In some embodiments, one or more inverted debase residues or sites are inserted between the nucleotide sequence of the targeted ligand and the sense strand of the RNAi agent. In some embodiments, including one or more inverted debase residues or sites at or near the end of the sense strand of the RNAi agent can enhance the activity or other desired properties of the RNAi agent.

[0123] In some embodiments, one or more inverted debasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted debasic residues may be inserted between the nucleotide sequence of the targeted ligand and the sense strand of the RNAi agent. The inverted debasic residues may be linked via phosphate, phosphorothioate (e.g., indicated herein as (invAb)) or other internucleoside linkages. In some embodiments, including one or more inverted debasic residues at or near the end of the sense strand of the RNAi agent may enhance the activity or other desired properties of the RNAi agent. In some embodiments, the inverted debasic (deoxyribose) residue may be replaced with an inverted ribitol (debasic ribose) residue. In some embodiments, the 3' end of the antisense strand core stretch sequence or the 3' end of the antisense strand sequence may contain an inverted debasic residue. The chemical structures of the inverted nonbasic deoxyribose residues are shown in Table 6 below.

[0124] CFB RNAi agent The CFB RNAi agents disclosed herein are designed to target specific locations on the CFB gene (e.g., SEQ ID NO: 1). NM_001710.6 Homo sapiens complement factor B (CFB), mRNA transcript (SEQ ID NO: 1): 1 gggaagggaa tgtgaccagg tctaggtctg gagtttcagc ttggacactg agccaagcag 61 acaagcaaag caagccagga cacaccatcc tgccccaggc ccagcttctc tcctgccttc 121 caacgccatg gggagcaatc tcagccccca actctgcctg atgcccttta tcttgggcct 181 cttgtctgga ggtgtgacca ccactccatg gtctttggcc cggccccagg gatcctgctc 241 tctggagggg gtagagatca aaggcggctc cttccgactt ctccaagagg gccaggcact 301 ggagtacgtg tgtccttctg gcttctaccc gtaccctgtg cagacacgta cctgcagatc 361 tacggggtcc tggagcaccc tgaagactca agaccaaaag actgtcagga aggcagagtg 421 cagagcaatc cactgtccaa gaccacacga cttcgagaac ggggaatact ggccccggtc 481 tccctactac aatgtgagtg atgagatctc tttccactgc tatgacggtt acactctccg 541 gggctctgcc aatcgcacct gccaagtgaa tggccgatgg agtgggcaga cagcgatctg 601 tgacaacgga gcggggtact gctccaaccc gggcatcccc attggcacaa ggaaggtggg 661 cagccagtac cgccttgaag acagcgtcac ctaccactgc agccgggggc ttaccctgcg 721 tggctcccag cggcgaacgt gtcaggaagg tggctcttgg agcgggacgg agccttcctg 781 ccaagactcc ttcatgtacg acacccctca agaggtggcc gaagctttcc tgtcttccct 841 gacagagacc atagaaggag tcgatgctga ggatgggcac ggcccagggg aacaacagaa 901 gcggaagatc gtcctggacc cttcaggctc catgaacatc tacctggtgc tagatggatc 961 agacagcatt ggggccagca acttcacagg agccaaaaag tgtctagtca acttaattga 1021 gaaggtggca agttatggtg tgaagccaag atatggtcta gtgacatatg ccacataccc 1081 caaaatttgg gtcaaagtgt ctgaagcaga cagcagtaat gcagactggg tcacgaagca 1141 gctcaatgaa atcaattatg aagaccacaa gttgaagtca gggactaaca ccaagaaggc 1201 cctccaggca gtgtacagca tgatgagctg gccagatgac gtccctcctg aaggctggaa 1261 ccgcacccgc catgtcatca tcctcatgac tgatggattg cacaacatgg gcggggaccc 1321 attackgtc attgatgaga tccgggactt gctatacatt ggcaggatc gcaaaaccc 1381 aagggatt tatctgtg tctatgtgtt tggttcggg cctttgtga accaagtgaa 1441 catcaatgct tggctcca agaagacaa tgagcaacat gtgttcaag tcagat 1501 ggaaaacctg gagatgttt tctaccaat gatcgatgaa agccagctc tgagtctcg 1561 tggcatggtt tgggaacaca ggaagggtac cgattaccac aagcaaccat ggcaggccaa 1621 gatctcagtc attcgcctt caaagggaca cgagagctgt atggggctg tggtgtctga 1681 gtactttgtg ctgacagcag cacattgttt cactgtggat vakaaggaac actcaatcaa 1741 gtcagcgta ggaggggaga agcgggacct ggagatagaa gtagtcctat ttcacca 1801 CTACACATT ATGGAAAAAAAGAGCAG AATTCCTGATTATTAGACT ATGACGTTGAA 1861 cctgatcaag ctcagaata agctgaaata tggccagact atcaggcccca ttgtctccc 1921 ctgcaccgag ggacaactc gagctttgag gcttcctcca actaccactt gccacacaca 1981 aaggaag ctgctccctg cacaggatat aaagctctg ttgtgtctg aggaggaa 2041 aaagctgact cggaaggagg tctacatcaa gaatggggat aagaaaggca gctgtgagag 2101 agatgctcaa tatgccccag gctatgacaa agtcaaggac atctcagagg tggtcacccc 2161 tcggttcctt tgtactggag gagtgagtcc ctatgctgac cccaatactt gcagaggtga 2221 ttctggcggc cccttgatag ttcacaagag aagtcgtttc attcaagttg gtgtaatcag 2281 ctggggagta gtggatgtct gcaaaaacca gaagcggcaa aagcaggtac ctgctcacgc 2341 ccgagacttt cacatcaacc tctttcaagt gctgccctgg ctgaaggaga aactccaaga 2401 tgaggatttg ggttttctat aaggggtttc ctgctggaca ggggcgtggg attgaattaa 2461 aacagctgcg acaaca

[0125] As defined herein, an antisense strand sequence is designed to target the CFB gene at a given position on the gene when the 5' terminal nucleic acid base of the antisense strand aligns with a position 21 nucleotides downstream (towards the 3' end) from the position on the gene at which it base pairs with the gene. For example, as shown in Tables 1 and 2 herein, an antisense strand sequence designed to target the CFB gene at position 1667 requires that, when base-paired with the gene, the 5' terminal nucleic acid base of the antisense strand aligns with position 1687 on the CFB gene.

[0126] As provided herein, CFB RNAi agents do not require the nucleotide base at position 1 (5'→3') of the antisense strand to be complementary to the gene, provided that there is at least 85% complementarity between the antisense strand and the gene over a core stretch sequence of at least 15 consecutive nucleotides (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity). For example, in the case of a CFB RNAi agent disclosed herein designed to target position 307 of the CFB gene, the nucleotide base at the 5' end of the antisense strand of the CFB RNAi agent must align with position 325 of the gene. However, the 5' terminal nucleic acid base of the antisense strand may, but is not necessarily, be complementary to position 325 of the CFB gene, provided that there is at least 85% complementarity between the antisense strand and the gene over a core stretch sequence of at least 15 consecutive nucleotides (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity). In particular, as shown by the examples disclosed herein and as is well known in the art, the specific binding site of the gene by the antisense strand of the CFB RNAi agent (e.g., whether the CFB RNAi agent is designed to target the CFB gene at position 325, position 1667, position 2399, or any other position) is important for the level of inhibition achieved by the CFB RNAi agent and the toxicity profile achieved by the molecule. (For example, see Kamola et al., PLOS Computational Biology 2015;11(12), Figure 1).

[0127] In some embodiments, the CFB RNAi agents disclosed herein target CFB genes at or near the CFB gene sequences shown in Table 1. In some embodiments, the antisense strand of the CFB RNAi agents disclosed herein includes a core stretch sequence that is fully, substantially, or at least partially complementary to the target CFB 19mer sequence disclosed in Table 1. [Table 1-1] [Table 1-2]

[0128] In some embodiments, the CFB RNAi agent includes an antisense strand, and position 19 (5'→3') of the antisense strand can form a base pair with position 1 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the CFB RNAi agent includes an antisense strand, and position 11 (5'→3') of the antisense strand can form a base pair with position 19 of the 19-mer target sequence disclosed in Table 1.

[0129] In some embodiments, the CFB RNAi agent includes an antisense strand, and position 2 (5'→3') of the antisense strand can base-pair with position 18 of the 19-mer target sequence disclosed in Table 1. In some embodiments, the CFB RNAi agent includes an antisense strand, and positions 2-18 (5'→3') of the antisense strand can base-pair with each of the complementary bases located at positions 18-2 of the 19-mer target sequence disclosed in Table 1.

[0130] In the case of the RNAi agents disclosed herein, the nucleotide at position 1 (5' end → 3' end) of the antisense strand may be either perfectly complementary to the CFB gene or incompletely complementary to the CFB gene. In some embodiments, the nucleotide at position 1 (5' end → 3' end) of the antisense strand is U, A, or dT. In some embodiments, the nucleotide at position 1 (5' end → 3' end) of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0131] In some embodiments, the CFB RNAi antisense strand includes a sequence of nucleotides 2-18, 2-19, 2-20, or 2-21 (5' end → 3' end) of any of the antisense strand sequences in Table 2, Table 3, or Table 5C. In some embodiments, the CFB RNAi sense strand includes a sequence of nucleotides 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 (5' end → 3' end) of any of the sense strand sequences in Table 2, Table 4A, Table 4B, or Table 5C.

[0132] In some embodiments, the CFB RNAi antisense strand includes a sequence of 2-18, 2-19, 2-20, or 2-21 nucleotides (5' end → 3' end) from any of the antisense strand sequences in Table 2, Table 3, or Table 5C. In some embodiments, the CFB RNAi sense strand includes a sequence of 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 nucleotides (5' end → 3' end) from any of the sense strand sequences in Table 2, Table 4A, Table 4B, or Table 5C.

[0133] In some embodiments, the CFB RNAi agent comprises (i) an antisense strand containing a sequence of 2-18 or 2-19 nucleotides (5' end → 3' end) from any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand containing a sequence of 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 nucleotides (5' end → 3' end) from any of the sense strand sequences in Table 2, Table 4A, or Table 4B.

[0134] In some embodiments, the CFB RNAi agent comprises (i) an antisense strand containing a sequence of 2-18 or 2-19 nucleotides (5' end → 3' end) from any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand containing a sequence of 3-21, 2-21, 1-21, 3-20, 2-20, 1-20, 3-19, 2-19, 1-19, 3-18, 2-18, or 1-18 nucleotides (5' end → 3' end) from any of the sense strand sequences in Table 2, Table 4A, or Table 4B.

[0135] In some embodiments, the CFB RNAi agent contains the core 19-mer nucleotide sequence shown in Table 2 below. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12] [Table 2-13] [Table 2-14] [Table 2-15] [Table 2-16]

[0136] The sense and antisense strands of a CFB RNAi agent containing or consisting of the sequences in Table 2 may be modified nucleotides or unmodified nucleotides. In some embodiments, the sense and antisense strand sequences of a CFB RNAi agent containing or consisting of the sequences in Table 2 are all or substantially all modified nucleotides.

[0137] In some embodiments, the antisense strand of the CFB RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 2 by only 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the CFB RNAi agent disclosed herein differs from any of the sense strand sequences in Table 2 by only 0, 1, 2, or 3 nucleotides.

[0138] When used herein, each N listed in the sequences disclosed in Table 2 may be independently selected from any and all nucleic acid bases (including those found in both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleic acid bases complementary to the N nucleotide at the corresponding position in the other chain. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have nucleic acid bases that are not complementary to the N nucleotide at the corresponding position in the other chain. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have the same nucleic acid bases as the N nucleotide at the corresponding position in the other chain. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have different nucleic acid bases from the N nucleotide at the corresponding position in the other chain.

[0139] Table 3 shows specific modified CFB RNAi antisense strands and their underlying unmodified nucleic acid sequences. Table 4A or Table 4B provides specific modified CFB RNAi sense strands and their underlying unmodified nucleic acid sequences. In the formation of the CFB RNAi, each nucleotide in each of the underlying sequences listed in Tables 3, 4A, and 4B and Table 2 may be a modified nucleotide.

[0140] The CFB RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing the sequences listed in Table 2 or Table 4A or Table 4B can be hybridized to any antisense strand containing the sequences listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity across a sequence of 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.

[0141] In some embodiments, the CFB RNAi antisense strand includes a nucleotide sequence from either Table 2 or Table 3.

[0142] In some embodiments, the CFB RNAi agent comprises or consists of a double helix having the nucleic acid base sequences of the sense strand and antisense strand of any of the sequences in Table 2, Table 3, Table 4A, or Table 4B. In some embodiments, the CFB RNAi agent comprises or consists of a double helix sequence prepared or provided as a sodium salt, mixed salt, or free acid.

[0143] Examples of antisense strands containing modified nucleotides are provided in Tables 3 and 5C. Examples of sense strands containing modified nucleotides are provided in Tables 4A, 4B, and 5C.

[0144] When used in Tables 3, 4A, 4B, and 5C, the following notation is used to indicate modified nucleotides and linking groups. A = adenosine-3'-phosphate; C = cytidine-3'-phosphate; G = guanosine-3'-phosphorus; U = uridine-3'-phosphate I = Inosine-3'-phosphorus a=2'-O-methyladenosine-3'-phosphate as=2'-O-methyladenosine-3'-phosphothioate ass=2'-O-methyladenosine-3'-phosphodithioate c=2'-O-methylcytidine-3'-phosphate cs=2'-O-methylcytidine-3'-phosphorothioate css=2'-O-methylcytidine-3'-phosphodithioate g = 2'-O-methylguanosine-3'-phospho gs=2'-O-methylguanosine-3'-phosphothioate gss = 2'-O-methylguanosine-3'-phosphodithioate t=2'-O-methyl-5-methyluridine-3'-phosphate ts=2'-O-methyl-5-methyluridine-3'-phosphorothioate tss = 2'-O-methyl-5-methyluridine-3'-phosphorodithioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate uss = 2'-O-methyluridine-3'-phosphorodithioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate iss = 2'-O-methylinosine-3'-phosphorodithioate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dA = 2'-deoxyadenosine-3'-phosphate dAs = 2'-deoxyadenosine-3'-phosphorothioate dAss = 2'-deoxyadenosine-3'-phosphorodithioate dC = 2'-deoxycytidine-3'-phosphate dCs = 2'-deoxycytidine-3'-phosphorothioate dCss = 2'-deoxycytidine-3'-phosphorodithioate dG = 2'-deoxyguanosine-3'-phosphate dGs = 2'-Deoxyguanosine-3'-phosphorothioate dGss = 2'-Deoxyguanosine-3'-phosphorodithioate dT = 2'-Deoxy-5-methyluridine-3'-phosphate (or 2'-O-Deoxythymidine-3'-phosphate) dTs = 2'-Deoxy-5-methyluridine-3'-phosphorothioate (or 2'-O-Deoxythymidine-3'-phosphorothioate) dTss = 2'-Deoxy-5-methyluridine-3'-phosphorodithioate (or 2'-O-Deoxythymidine-3'-phosphorodithioate) A UNA = 2',3'-Seco-adenosine-3'-phosphate (see Table 6) A UNA s = 2',3'-Seco-adenosine-3'-phosphorothioate (see Table 6) C UNA = 2',3'-Seco-cytidine-3'-phosphate (see Table 6) C UNA s = 2',3'-Seco-cytidine-3'-phosphorothioate (see Table 6) G UNA = 2',3'-Seco-guanosine-3'-phosphate (see Table 6) G UNA s = 2',3'-Seco-guanosine-3'-phosphorothioate (see Table 6) U UNA = 2',3'-Seco-uridine-3'-phosphate (see Table 6) U UNA s = 2',3'-Seco-uridine-3'-phosphorothioate (see Table 6) a_2N = 2'-O-Methyl-2-aminoadenosine-3'-phosphate (see Table 6) a_2Ns = 2'-O-Methyl-2-aminoadenosine-3'-phosphorothioate (see Table 6) (invdA) = Inverted (3'-3' linkage) 2'-Deoxyadenosine (see Table 6) (invAb) = Inverted non-basic deoxyribonucleotide (see Table 6) (invAb)s = reverse nonbasic deoxyribonucleotide-5'-phosphothioate (see Table 6) cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 6) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphothioate (see Table 6) cPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 6) cPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphothioate (see Table 6) NAG37 = See Table 6. NAG37s = See Table 6.

[0145] As will be readily apparent to those skilled in the art, unless otherwise specifically indicated by the sequence (e.g., phosphorothioate bond "s"), nucleotide monomers in oligonucleotides are linked to each other by 5'-3'-phosphodiester bonds. As will be clearly apparent to those skilled in the art, the inclusion of phosphorothioate bonds shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester bonds typically present in oligonucleotides. Furthermore, those skilled in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl (-OH) group at the 3' position of each given monomer in ex vivo, instead of a phosphate moiety. Furthermore, in the embodiments disclosed herein, looking at each chain from 5' to 3', the inverted debasing residue is inserted such that the 3' position of the deoxyribose is linked to the 3' end of the preceding monomer on each chain (see, for example, Table 6). Furthermore, as will be readily understood and recognized by those skilled in the art, the phosphorothioate chemical structures shown herein typically represent anions on a sulfur atom, but the inventions disclosed herein encompass all phosphorothioate tautomers and resonance structures (for example, when the sulfur atom has a double bond and the anion is on an oxygen atom). Unless otherwise expressly indicated herein, such understanding of those skilled in the art will be used when describing the CFB RNAi agents and CFB RNAi agent compositions disclosed herein.

[0146] Table 6 below provides specific examples of targeted ligands, targeting groups, and linking groups used with the CFB RNAi agents disclosed herein. More specifically, examples of targeting groups and linking groups (which together can form targeted ligands) include (NAG37) and (plural) (NAG37), whose chemical structures are shown in Table 6 below. Each sense strand and / or antisense strand may have any of the targeted ligands, targeting groups, or linking groups listed herein, as well as other groups, conjugated at the 5' and / or 3' ends of the sequence. [Table 3-1] Table 3-2 Table 3-3 Table 3-4 Table 3-5 Table 3-6 Table 3-7 Table 4A-1 Table 4A-2 Table 4A-3 Table 4A-4

Table 4A-5

[0147] The CFB RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing the sequences listed in Table 2, Table 4A, Table 4B, or Table 5C can hybridize to any antisense strand containing the sequences listed in Table 2, Table 3, or Table 5C, provided that it has a region of at least 85% complementarity across a sequence of 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides.

[0148] In some embodiments, the antisense strand of the CFB RNAi agent disclosed herein differs from any of the antisense strand sequences in Table 3 or Table 5C by only 0, 1, 2, or 3 nucleotides. In some embodiments, the sense strand of the CFB RNAi agent disclosed herein differs from any of the sense strand sequences in Table 4A, Table 4B, or Table 5C by only 0, 1, 2, or 3 nucleotides.

[0149] In some embodiments, the CFB RNAi antisense strand contains a nucleotide sequence from any of the sequences in Table 2, Table 3, or Table 5C. In some embodiments, the CFB RNAi antisense strand contains a sequence of nucleotides 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 (5' end → 3' end) from any of the sequences in Table 2, Table 3, or Table 5C. In certain embodiments, the CFB RNAi antisense strand contains or consists of one of the modified sequences from Table 3 or Table 5C.

[0150] In some embodiments, the CFB RNAi agent sense strand contains a nucleotide sequence from any of the sequences in Table 2, Table 4A, Table 4B, or Table 5C. In some embodiments, the CFB RNAi agent sense strand contains a sequence of nucleotides 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, or 4-21 (5' end → 3' end) from any of the sequences in Table 2, Table 4A, Table 4B, or Table 5C. In certain embodiments, the CFB RNAi agent sense strand contains or consists of one of the modified sequences from any of the modified sequences in Table 4A, Table 4B, or Table 5C.

[0151] For the CFB RNAi agents disclosed herein, the nucleotide at position 1 (5' end → 3' end) of the antisense strand may be either perfectly complementary to the CFB gene or incomplementary to the CFB gene. In some embodiments, the nucleotide at position 1 (5' end → 3' end) of the antisense strand is U, A, or dT (or a modified version thereof). In some embodiments, the nucleotide at position 1 (5' end → 3' end) of the antisense strand forms an A:U or U:A base pair with the sense strand.

[0152] A sense strand containing sequences listed in Table 2, Table 4A, Table 4B, or Table 5C can hybridize to any antisense strand containing sequences listed in Table 2, Table 3, or Table 5C, provided that the two sequences have a region of at least 85% complementarity across a sequence of 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides. In some embodiments, a CFB RNAi agent comprises a sense strand consisting of a modified sequence of any of the modified sequences in Table 4A, Table 4B, or Table 5C, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3 or Table 5C. Specific representative sequence pairings are exemplified by the double-stranded ID numbers shown in Tables 5A, 5B, and 5C.

[0153] In some embodiments, the CFB RNAi agent comprises, consists of, or essentially consists of a double helix represented by one of the double helix ID numbers presented herein. In some embodiments, the CFB RNAi agent comprises the sense strand and antisense strand nucleotide sequences of either of the double helix represented by one of the double helix ID numbers presented herein. In some embodiments, the CFB RNAi agent comprises the sense strand and antisense strand nucleotide sequences of either of the double helix represented by one of the double helix ID numbers presented herein, and a targeting group and / or linking group, the targeting group and / or linking group being covalently bonded to (i.e., conjugated to) the sense strand or antisense strand. In some embodiments, the CFB RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of either of the double helix ID numbers presented herein. In some embodiments, the CFB RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of either of the double helix ID numbers presented herein, and a targeting group and / or linking group, the targeting group and / or linking group being covalently bonded to the sense strand or antisense strand.

[0154] In some embodiments, the CFB RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any of the antisense / sense strand duplexes in Table 2 or Tables 5A, 5B, and 5C, and further comprises a targeting group or a targeting ligand. In some embodiments, the CFB RNAi agent comprises an antisense strand and a sense strand having a nucleotide sequence of any of the antisense / sense strand duplexes in Table 2 or Tables 5A, 5B, and 5C, and further comprises an asialoclycoprotein receptor ligand targeting group.

[0155] With or without a linker, the targeting group may be attached to the 5' or 3' end of either the sense chain and / or antisense chain disclosed in Tables 2, 3, 4, or 5C. With or without a targeting group, the linker may be attached to the 5' or 3' end of either the sense chain and / or antisense chain disclosed in Tables 2, 3, 4, and 5C.

[0156] In some embodiments, the CFB RNAi agent comprises an antisense strand and a sense strand having any of the antisense / sense strand double helical nucleotide sequences of Table 2 or Tables 5A, 5B, and 5C, and further comprises a targeting ligand selected from the group consisting of (NAG37) and (multiple)(NAG37) as defined in Table 6.

[0157] In some embodiments, the CFB RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand and / or sense strand nucleotide sequences shown in Table 3, Table 4A, or Table 4B.

[0158] In some embodiments, the CFB RNAi agent comprises an antisense strand and a sense strand having any modified nucleotide sequence of the antisense strand and / or any sense strand nucleotide sequence of double-stranded table 5A, 5B, and 5C, and further comprises an asialoclycoprotein receptor ligand targeting group.

[0159] In some embodiments, the CFB RNAi agent comprises, consists of, or essentially consists of, one of the double hemispheres of Tables 5A, 5B, and 5C. [Table 5A-1] [Table 5A-2] [Table 5A-3] [Table 5A-4] [Table 5A-5] [Table 5A-6] [Table 5B-1] Table 5B-2 Table 5B-3 Table 5B-4 Table 5B-5 Table 5B-6 Table 5C-1

Table 5C-2

Table 5C-6

Table 5C-8

[0160] In some embodiments, the CFB RNAi agent is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the CFB RNAi agent is prepared or provided as a pharmaceutically acceptable salt such as a sodium salt or a potassium salt. In some embodiments, the CFB RNAi agent is prepared or provided as a sodium salt. When delivered to cells expressing the CFB gene, the RNAi agents described herein inhibit or knock down the expression of one or more CFB genes in vivo and / or in vitro.

[0161] Targeted ligand or group, linking group, and delivery vehicle In some embodiments, the CFB RNAi agent is conjugated to one or more non-nucleotide groups, including, but not limited to, targeting groups, linking groups, targeting ligands, delivery polymers, or delivery vehicles. The non-nucleotide groups can enhance the targeting, delivery, or adhesion of the RNAi agent. Examples of targeting and linking groups are provided in Table 6. The non-nucleotide groups can be covalently bonded to the 3' and / or 5' ends of either the sense strand and / or antisense strand. In some embodiments, the CFB RNAi agent contains non-nucleotide groups linked to the 3' and / or 5' ends of the sense strand. In some embodiments, the non-nucleotide groups are linked to the 5' end of the CFB RNAi agent sense strand. The non-nucleotide groups may be directly or indirectly linked to the RNAi agent via linker / linking groups. In some embodiments, the non-nucleotide groups are linked to the RNAi agent via unstable, cleavable, or reversible bonds or linkers.

[0162] In some embodiments, non-nucleotide groups enhance the pharmacokinetic or intracellular distribution characteristics of the RNAi agent or conjugate to which they are bound, thereby improving the cell- or tissue-specific distribution and cell-specific uptake of the RNAi agent or conjugate. In some embodiments, non-nucleotide groups enhance the endocytosis of the RNAi agent.

[0163] Targeting groups or targeting moieties enhance the pharmacokinetic or intracellular distribution characteristics of the conjugate or RNAi agent to which they are bound, thereby improving the cell-specific (and possibly organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. Targeting groups may be monovalent, divalent, trivalent, or tetravalent, or may have a higher valency relative to the target they are directed at. Typical targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimics with affinity for cell surface molecules.

[0164] In some embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker or one, two, or three debased and / or ribitol (debased ribose) residues, which may optionally act as a linker. In some embodiments, the targeting ligand comprises a galactose derivative cluster.

[0165] The CFB RNAi agents described herein can be synthesized to have a reactive group, such as an amino group (also referred to herein as an amine), at the 5' and / or 3' ends. The reactive group can then be used to conjugate the targeting moiety using methods typical in the art.

[0166] In some embodiments, the targeting group comprises an asialoglycoprotein receptor ligand. As used herein, an asialoglycoprotein receptor ligand is a ligand comprising a moiety having affinity for the asialoglycoprotein receptor. As described herein, the asialoglycoprotein receptor is highly expressed on hepatocytes. In some embodiments, the asialoglycoprotein receptor ligand comprises or consists of one or more galactose derivatives. As used herein, the term galactose derivative includes both galactose and derivatives of galactose having affinity for the asialoglycoprotein receptor greater than that of galactose. Galactose derivatives include, but are not limited to, galactose, galactosamine, N-formylgalactosamine, N-acetylgalactosamine, N-propionylgalactosamine, Nn-butanoylgalactosamine, and N-isobutanoylgalactosamine (see, for example, STIobst and K. Drickamer, JBC, 1996, 271, 6686). Galactose derivatives and clusters of galactose derivatives useful for in vivo targeting of oligonucleotides and other molecules in the liver are known in the art (see, for example, Baenziger and Fiete, 1980, Cell, 22, 611-620; Connolly et al., 1982, J. Biol. Chem., 257, 939-945).

[0167] Galactose derivatives have been used in vivo to target molecules to hepatocytes through their binding to asialoglycoprotein receptors expressed on the surface of hepatocytes. Binding of asialoglycoprotein receptor ligands to asialoglycoprotein receptors facilitates cell-specific targeting to hepatocytes and endocytosis of molecules to hepatocytes. Asialoglycoprotein receptor ligands can be monomeric (e.g., having a single galactose derivative, also called monovalent or monodentate) or polymeric (e.g., having multiple galactose derivatives). Galactose derivatives or galactose derivative clusters can be bound to the 3' or 5' end of the sense or antisense strand of an RNAi agent using methods known in the art.

[0168] The preparation of targeted ligands such as galactose derivative clusters is described, for example, in Arrowhead Pharmaceuticals, Inc.'s International Publication No. 2018 / 044350 and International Publication No. 2017 / 156012, both of which are incorporated herein by reference in their entirety.

[0169] As used herein, a galactose derivative cluster comprises a molecule having 2 to 4 terminal galactose derivatives. The terminal galactose derivatives are bonded to the molecule via their C-1 carbon. In some embodiments, the galactose derivative cluster is a galactose derivative trimer (also called a tribranched galactose derivative or trivalent galactose derivative). In some embodiments, the galactose derivative cluster comprises an N-acetyl-galactosamine moiety. In some embodiments, the galactose derivative cluster comprises three N-acetyl-galactosamine moieties. In some embodiments, the galactose derivative cluster is a galactose derivative tetramer (also called a tetrabranched galactose derivative or tetravalent galactose derivative). In some embodiments, the galactose derivative cluster comprises four N-acetyl-galactosamine moieties.

[0170] As used herein, a galactose derivative trimer comprises three galactose derivatives, each bound to a central branch point. As used herein, a galactose derivative tetramer comprises four galactose derivatives, each bound to a central branch point. Galactose derivatives can be bound to the central branch point via the C-1 carbon of a sugar. In some embodiments, galactose derivatives are linked to the branch point via a linker or spacer. In some embodiments, the linker or spacer is a flexible hydrophilic spacer such as a PEG group (see, for example, U.S. Patent No. 5,885,968, Biessen et al., J. Med. Chem. 1995 Vol. 39, pp. 1538-1546). In some embodiments, the PEG spacer is a PEG3 spacer. The branch point can be any small molecule that allows for the attachment of three galactose derivatives and further allows for the attachment of the branch point to an RNAi agent. Examples of branch point groups are dyridines or diglutamates. Attachment of the branch point to the RNAi agent can occur via a linker or spacer. In some embodiments, the linker or spacer includes, but is not limited to, a flexible hydrophilic spacer such as a PEG spacer. In some embodiments, the linker includes a rigid linker such as a cyclic group. In some embodiments, the galactose derivative includes or comprises N-acetyl-galactosamine. In some embodiments, the galactose derivative cluster consists of a galactose derivative tetramer, which may be, for example, an N-acetyl-galactosamine tetramer.

[0171] Embodiments of the present disclosure include pharmaceutical compositions for delivering CFB RNAi agents to hepatocytes in vivo. Such pharmaceutical compositions may include, for example, a CFB RNAi agent conjugated to a galactose derivative cluster. In some embodiments, the galactose derivative cluster comprises a galactose derivative trimer, which may be, for example, an N-acetyl-galactosamine trimer, or a galactose derivative tetramer, which may be, for example, an N-acetyl-galactosamine tetramer.

[0172] A targeted ligand or targeting group may be ligated to the 3' or 5' end of the sense or antisense strand of a CFB RNAi agent disclosed herein.

[0173] Examples of targeted ligands include, but are not limited to, (NAG37) and (NAG37) as defined in Table 6. Other targeted groups and targeted ligands, including galactose cluster targeted ligands, are known in the art.

[0174] In some embodiments, the linking group is conjugated to the RNAi agent. The linking group facilitates the covalent bonding of the drug to a target group, delivery polymer, or delivery vehicle. The linking group can be linked to the 3' and / or 5' ends of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is linked to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' or 3' end of the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' end of the RNAi agent sense strand. Examples of linking groups include, but are not limited to, reactive groups such as primary amines and alkynes, alkyl groups, debasalized nucleotides, ribitols (debasalized ribose), and / or PEG groups.

[0175] In some embodiments, the targeting group is internally linked to nucleotides on the sense and / or antisense strands of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker.

[0176] A linker or linking group is a link between two atoms that links one chemical group (such as an RNAi agent) or a segment of interest to another chemical group (such as a targeting group or a delivery polymer) or a segment of interest via one or more covalent bonds. Unstable linkages include unstable bonds. Linkages may optionally include spacers that increase the distance between the two bonded atoms. Spacers can further add flexibility and / or length to the linkage. Examples of spacers include, but are not limited to, alkyl groups, alkenyl groups, alkynyl groups, aryl groups, aralkyl groups, aralkenyl groups, and aralkyl groups, each of which may include one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the above list is not intended to limit the scope of the description.

[0177] In some embodiments, when two or more RNAi agents are contained in a single composition, each RNAi agent may be linked to the same targeting group or two different targeting groups (i.e., targeting groups having different chemical structures). In some embodiments, the targeting groups are linked to the CFB RNAi agents disclosed herein without the use of additional linkers. In some embodiments, the targeting groups themselves are designed to have linkers or other sites to facilitate readily available conjugations. In some embodiments, when two or more CFB RNAi agents are contained in a single molecule, each RNAi agent may utilize the same linker or different linkers (i.e., linkers having different chemical structures).

[0178] Any of the CFB RNAi agent nucleotide sequences listed in Tables 2, 3, 4A, 4B, or 5C, whether modified or unmodified, may contain 3' and / or 5' targeting or linking groups. Any of the CFB RNAi agent sequences listed in Tables 3 or 4, as otherwise described herein, that contain 3' or 5' targeting or linking groups may, alternatively, contain different 3' or 5' targeting or linking groups that do not contain 3' or 5' targeting or linking groups, or that include, but are not limited to, those shown in Table 6. Any of the CFB RNAi agent duplexes listed in Tables 5A, 5B, and 5C, whether modified or unmodified, may further contain targeting or linking groups, including, but not limited to, those shown in Table 6, and the targeting or linking groups may be fused to the 3' or 5' end of either the sense strand or antisense strand of the CFB RNAi agent duplex. Examples of targeting and linking groups (which can be combined to form targeted ligands) are shown in Table 6. Tables 4A, 4B, and 5C provide specific embodiments of CFB RNAi agent sense strands having a targeting group or linking group linked to the 5' or 3' end. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4]

[0179] In each of the structures shown in Table 6, NAG comprises N-acetyl-galactosamine. In some embodiments, the NAG shown in Table 6 above may comprise another galactose derivative having affinity for asialoclycoprotein receptors present on hepatocytes, as will be understood by those skilled in the art in light of the structures and descriptions provided herein. Other linking groups known in the art may be used.

[0180] In some embodiments, a delivery vehicle can be used to deliver RNAi agents to cells or tissues. The delivery vehicle is a compound that improves the delivery of RNAi agents to cells or tissues. The delivery vehicle may include, but is not limited to, polymers such as amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines. In some embodiments, the RNAi agent may be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art. RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to, cholesterol and cholesteryl derivatives), nanoparticles, polymers, liposomes, micelles, DPCs (see, for example, International Publication Nos. 2000 / 053722, 2008 / 0022309, 2011 / 104169, and 2012 / 083185, 2013 / 032829, and 2013 / 158141, each of which is incorporated herein by reference), hydrogels, cyclodextrins, biodegradable nanocapsules, and bioadhesive microspheres, protein vectors, or other delivery systems known and available in the art that are suitable for nucleic acid or oligonucleotide delivery.

[0181] Pharmaceutical composition The CFB RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as “pharmaceuticals”). In some embodiments, the pharmaceutical compositions comprise at least one CFB RNAi agent. These pharmaceutical compositions are particularly useful in inhibiting the expression of target mRNA in target cells, cell populations, tissues, or organisms.

[0182] The pharmaceutical composition can be used to treat subjects having a disease, disorder, or condition that would benefit from a reduction in the level of a target CFB mRNA or inhibition of the expression of a target gene. The pharmaceutical composition can be used to treat subjects at risk of developing a disease, disorder, symptom, or condition that would benefit from a reduction in the level of a target mRNA or inhibition of the expression of a target gene. In one embodiment, the method comprises administering a CFB RNAi agent linked to a targeted ligand as described herein to a subject to be treated. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to the pharmaceutical composition containing the CFB RNAi agent to form a pharmaceutical formulation or drug suitable for in vivo delivery to subjects including humans.

[0183] Pharmaceutical compositions comprising CFB RNAi agents and methods disclosed herein include administering a therapeutically effective amount of the CFB RNAi agent described herein to a subject, thereby reducing the level of target mRNA in cells, cell populations, cell groups, cell populations, tissues, organs, or subjects, including inhibiting the expression or translation of CFB mRNA in the subject. In some embodiments, the subject has been previously identified or diagnosed with IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD) including early and / or intermediate-stage AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated disorders. In some embodiments, the subject would benefit from reduced CFB gene expression in the subject's liver.

[0184] In some embodiments, the described pharmaceutical compositions comprising a CFB RNAi agent are used to treat or manage clinical symptoms associated with IgA nephropathy, C3 glomerulopathy, and / or paroxysmal nocturnal hemoglobinuria (PNH). Other diseases or conditions for which a CFB RNAi agent may be useful include immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate-stage AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases. In some embodiments, one or more therapeutic (including preventive) doses of pharmaceutical compositions are administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed CFB RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.

[0185] The described pharmaceutical compositions comprising CFB RNAi agents can be used to treat at least one symptom in subjects with a disease or disorder that would benefit from reduced or inhibited CFB mRNA expression and / or reduced CFB protein levels and / or reduced alternative complement pathway activity. Measurement of CFB levels and alternative complement pathway activity can be performed according to established methods known in the art, including those described in the examples herein.

[0186] In some embodiments, a subject is administered one or more therapeutically effective amounts of a pharmaceutical composition containing a CFB RNAi agent, thereby treating the symptoms. In other embodiments, a subject is administered one or more CFB RNAi agents in a prophylactically effective amount, thereby preventing or inhibiting at least one symptom.

[0187] The route of administration is the route through which the CFB RNAi agent comes into contact with the body. Generally, methods for administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The CFB RNAi agents disclosed herein can be administered via any suitable route in preparations appropriately tailored to a specific route. Therefore, the pharmaceutical compositions described herein can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intra-articularly, or intraperitoneally. In some embodiments, the pharmaceutical compositions described herein are administered by subcutaneous injection.

[0188] Pharmaceutical compositions comprising CFB RNAi agents as described herein can be delivered to cells, cell populations, tissues, or subjects using oligonucleotide delivery techniques known in the art. In general, any suitable method (in vitro or in vivo) recognized in the art for delivering nucleic acid molecules can be adapted for use with the compositions described herein. For example, delivery may be by local administration (e.g., direct injection, implantation, or local administration), systemic administration, or by intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or subcutaneous, intravenous, intraperitoneal, or parenteral routes, including local (including buccal and sublingual) administration. In certain embodiments, the composition is administered by subcutaneous or intravenous infusion or injection.

[0189] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.

[0190] When used herein, a pharmaceutical composition or pharmaceutically acceptable excipient comprises a pharmacologically effective amount of at least one described therapeutic compound and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., CFB RNAi agent) that is intentionally included in the drug delivery system. Excipients do not exert, or are not intended to exert, a therapeutic effect at the intended dose. Excipients may act to a) assist in the processing of the drug delivery system during manufacturing, b) protect, assist or enhance the stability, bioavailability or patient acceptability of the API, c) assist in product identification, and / or d) enhance any other attributes of the overall safety, efficacy, or delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.

[0191] Excipients include, but are not limited to, absorption enhancers, anti-adhesion agents, defoamers, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavoring agents, flow enhancers, humectants, lubricants, oils, polymers, preservatives, physiological saline, salts, solvents, sugars, surfactants, suspending agents, sustained-release matrices, sweeteners, thickeners, isotonic agents, vehicles, water repellents, and wetting agents.

[0192] Pharmaceutical compositions suitable for injection include sterile aqueous solutions (if water-soluble) or dispersions, and sterile powders for the immediate preparation of sterile injection solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). Suitable carriers should be stable under manufacturing and storage conditions and protected from contamination by microorganisms such as bacteria and fungi. Carriers may be solvents or dispersion media containing, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol) and suitable mixtures thereof. Appropriate fluidity can be maintained, for example, by the use of coatings such as lecithin, maintaining the required particle size in the case of dispersions, and using surfactants. In many cases, it is preferable to include isotonic agents, such as sugars, polyalcohols such as mannitol and sorbitol, and sodium chloride in the composition. Sustained absorption of injection compositions can be achieved by including absorption-delaying agents, such as aluminum monostearate and gelatin, in the composition.

[0193] Sterile injectable solutions can be prepared by incorporating the required amount of the active compound into a suitable solvent containing, if necessary, one or a combination of the components listed above, followed by filter sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle, which contains a basic dispersion medium and other necessary components from those listed above. In the case of sterile powders for the preparation of sterile injectable solutions, the preparation method includes vacuum drying and freeze-drying, thereby obtaining powders of the active ingredient and any additional desired components from its pre-sterilized filtered solution.

[0194] In some embodiments, pharmaceutical formulations containing the CFB RNAi agents disclosed herein that are suitable for subcutaneous administration can be prepared in aqueous sodium phosphate buffer (for example, CFB RNAi agents formulated in 0.5 mM monobasic sodium phosphate and 0.5 mM dibasic sodium phosphate in water). In some embodiments, pharmaceutical formulations containing the CFB RNAi agents disclosed herein that are suitable for subcutaneous administration can be prepared in sterile water for injection. CFB RNAi agents disclosed herein that are suitable for subcutaneous administration can be prepared in isotonic saline (0.9%).

[0195] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in the form of a microcrystalline form, such as an aqueous microcrystalline suspension. Drugs for both intra-articular and ocular administration can also be provided using liposomal formulations or biodegradable polymer systems.

[0196] Formulations suitable for oral administration of the CFB RNAi agents disclosed herein can also be prepared. In some embodiments, the CFB RNAi agents disclosed herein are administered orally. In some embodiments, the CFB RNAi agents disclosed herein are formulated into capsules for oral administration.

[0197] The active compound can be prepared using a carrier that protects the compound from rapid elimination from the body, such as controlled-release formulations including implants and microencapsulated delivery systems. Biodegradable and biocompatible polymers such as ethylene vinyl acetate, polyanhydride, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations will be obvious to those skilled in the art. Liposome suspensions can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.

[0198] CFB RNAi agents can be formulated into dosage unit formulations for ease of administration and uniformity of dosage. A dosage unit formulation refers to a physically distinct unit suitable as a unit dose for the target being treated. Each unit contains a predetermined amount of the active compound calculated to associate with the required pharmaceutical carrier to produce the desired therapeutic effect. The specifications of the dosage unit formulations in this disclosure are determined by and directly depend on the inherent characteristics of the active compound, the therapeutic effect to be achieved, and the limitations inherent in the techniques for formulating such active compounds for the treatment of an individual.

[0199] A pharmaceutical composition may contain other additional components commonly found in pharmaceutical compositions. Such additional components include, but are not limited to, antipruritic agents, astringents, topical anesthetics, analgesics, antihistamines, or anti-inflammatory agents (e.g., acetaminophen, NSAIDs, diphenhydramine, etc.). It is also conceivable that cells, tissues, or isolated organs expressing or containing RNAi agents as defined herein may be used as a “pharmaceutical composition.” As used herein, “pharmacologically effective amount,” “therapeutic effective amount,” or simply “effective amount” refers to the amount of RNAi agent that produces a pharmacological, therapeutic, or prophylactic effect.

[0200] In some embodiments, the methods disclosed herein further include the step of administering a second therapeutic agent or treatment in addition to administering the RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another CFB RNAi agent (e.g., a CFB RNAi agent targeting a different sequence within a CFB target). In other embodiments, the second therapeutic agent may be a small molecule drug, an antibody, an antibody fragment, or an aptamer.

[0201] In some embodiments, the described CFB RNAi agent may be combined with one or more additional therapeutic agents. The CFB RNAi agent and the additional therapeutic agents may be administered in a single composition or separately. In some embodiments, one or more additional therapeutic agents may be administered separately in a different dosage form from the RNAi agent (for example, the CFB RNAi agent may be administered by subcutaneous injection, and the additional therapeutic agents involved in the method of therapeutic dosing regimen may be administered orally). In some embodiments, the described CFB RNAi agents are administered via subcutaneous injection to subjects in need, and one or more optional additional therapeutic agents are administered orally. Together, these provide therapeutic regimens for diseases and conditions associated with complement system dysregulation, including IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD) (including early and / or intermediate-stage AMD), geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases. In some embodiments, the described CFB RNAi agent is administered to a subject requiring it via subcutaneous injection, and one or more optional additional therapeutic agents are administered via another subcutaneous injection. In some embodiments, the CFB RNAi agent and one or more additional therapeutic agents are combined into a single dosage form (e.g., a "cocktail" formulated into a single composition for subcutaneous injection). The CFB RNAi agent can be combined with one or more excipients, with or without one or more additional therapeutic agents, to form a pharmaceutical composition.

[0202] Generally, the effective dose of a CFB RNAi agent is in the range of about 0.1 to about 100 mg / kg body weight / dose, for example, about 1.0 to about 50 mg / kg body weight / dose. In some embodiments, the effective dose of the active compound may be in the range of about 0.25 to about 6 mg / kg body weight / dose. In some embodiments, the effective dose of the active ingredient may be in the range of about 0.5 to about 5 mg / kg body weight / dose. In some embodiments, the effective dose of a CFB RNAi agent may be a fixed dose. In some embodiments, the fixed dose is in the range of about 5 mg to about 1,000 mg of CFB RNAi agent. In some embodiments, the fixed dose is in the range of 25 to 400 mg of CFB RNAi agent. Dosage may be weekly, bi-weekly, monthly, quarterly, or at any other interval, depending on the dose of CFB RNAi agent administered, the activity level of the particular CFB RNAi agent, and the desired level of inhibition for the particular target. The examples herein show levels suitable for inhibition in specific animal species. The amount administered depends on variables such as the patient's or subject's overall health status, the relative biological efficacy of the compound being delivered, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. It should also be understood that the initial dose administered may be increased beyond the upper limit to rapidly achieve the desired blood or tissue level, or the initial dose may be lower than the optimal dose.

[0203] For the treatment of a disease, or for the formation of a pharmaceutical or composition for the treatment of a disease, the pharmaceutical composition described herein, comprising a CFB RNAi agent, may be combined with an excipient or a second therapeutic agent, or a treatment comprising, but not limited to, a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide and / or an aptamer.

[0204] The CFB RNAi agents described herein may be packaged in kits, containers, packs, or dispensers when added to pharmaceutically acceptable excipients or adjuvants. The pharmaceutical compositions described herein may be packaged in pre-filled syringes, pen injectors, auto-injectors, infusion bags / devices, or vials.

[0205] In some embodiments, the CFB RNAi drug substance is prepared or provided as a salt, a mixed salt, or a free acid. In some embodiments, the form is a sodium salt.

[0206] In some embodiments, the CFB RNAi agent is formulated with one or more pharmaceutically acceptable excipients to form a pharmaceutical composition suitable for administration to human subjects. In some embodiments, the CFB RNAi agent described herein is formulated at 200 mg / mL in aqueous sodium phosphate buffer (0.5 mM monobasic sodium phosphate, 0.5 mM dibasic sodium phosphate) suitable for subcutaneous administration in humans.

[0207] Treatment methods and inhibition of expression The CFB RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) with diseases or disorders that would benefit from the administration of RNAi agents. In some embodiments, the RNAi agents disclosed herein are CFB Subjects (e.g., humans) who would benefit from reduced and / or inhibition of mRNA and / or CFB protein expression levels may be used to treat subjects diagnosed with or suffering from conditions related to, for example, IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD), including early and / or intermediate-stage AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases.

[0208] In some embodiments, the subject is administered a therapeutically effective dose of any one or more CFB RNAi agents. Treatment of the subject may include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective dose of any one or more CFB RNAi agents described herein. The subject may be an adult, adolescent, child, or infant. Administration of the pharmaceutical compositions described herein may be to humans or animals.

[0209] The CFB RNAi agents described herein can be used to treat at least one symptom of a subject having a CFB-related disease or disorder, or a disease or disorder that is at least partially mediated by CFB gene expression. In some embodiments, the CFB RNAi agents are used to treat or manage clinical symptoms of a subject having a disease or disorder that benefits from, or is at least partially mediated by, a reduction in CFB mRNA or CFB protein levels and / or a reduction in alternative pathway complement activity. The subject is administered one or more of the CFB RNAi agents or CFB RNAi agent-containing compositions described herein in a therapeutically effective amount. In some embodiments, the methods disclosed herein include administering a composition containing the CFB RNAi agent described herein to the subject to be treated. In some embodiments, the subject is treated by administering any one or more of the described CFB RNAi agents in a prophylactically effective amount, thereby preventing or inhibiting at least one symptom.

[0210] In certain embodiments, the Disclosure provides a method for treating a disease, disorder, condition, or pathological condition in a patient in need thereof that is at least partially mediated by CFB gene expression, the method comprising administering one of the CFB RNAi agents described herein to the patient.

[0211] In some embodiments, the gene expression level and / or mRNA level of the CFB gene in subjects administered with the described CFB RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to subjects before administration of the CFB RNAi agent or subjects not receiving the CFB RNAi agent. CFB mRNA levels in subjects may be reduced in the cells, cell populations, and / or tissues of the subjects. In some embodiments, CFB gene expression is inhibited by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or more than 65% in hepatocytes compared to subjects before administration of the CFB RNAi agent or subjects not receiving the CFB RNAi agent.

[0212] In some embodiments, the CFB protein levels of subjects administered with the described CFB RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to subjects before or after administration of the CFB RNAi agent. Protein levels in subjects may be reduced in the cells, cell populations, tissues, blood, and / or other fluids of the subjects.

[0213] Decreases in CFB mRNA levels and CFB protein levels can be evaluated by any method known in the art. As used herein, a decrease or reduction in CFB mRNA levels and / or protein levels is collectively referred to as a decrease or reduction in CFB, or inhibition or reduction of CFB gene expression. The examples described herein illustrate known methods for evaluating inhibition of CFB gene expression. Those skilled in the art will know of further suitable methods for evaluating inhibition of CFB gene expression in vivo and / or in vitro.

[0214] In some embodiments, the alternative pathway complement activity in subjects administered with the described CFB RNAi agent is reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or more than 99% compared to subjects before or after CFB RNAi agent administration. Protein levels in subjects may be reduced in the subjects' cells, cell populations, tissues, blood, and / or other fluids.

[0215]

[0216] In some embodiments, methods for treating (including prophylactic or preventive treatment) diseases, disorders, or symptoms associated with complement system dysregulation, including IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD) including early and / or intermediate-stage AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated disorders are disclosed herein (van Lookeren et al., 2016, Casiraghi et al. (al., 2017, Wong & Kavanaugh 2018, Holers & Banda 2018, Poppelaars & Thurman 2020, Crowley et al., 2023, Blakey et al., 2023, Hoppe & Gregory-Ksander 2024), the method involves administering a therapeutically effective dose of a CFB RNAi agent containing an antisense strand at least partially complementary to the portion of the CFB mRNA having the sequence in Table 1 to a subject in need of treatment.In some embodiments, methods for treating (including prophylactic or preventive treatment) diseases or symptoms associated with complement system dysregulation, including IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD) including early and / or intermediate-stage AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases are disclosed herein (van Lookeren et al., 2016, Casiraghi et al. (al.,2017, Wong & Kavanaugh 2018, Holers & Banda 2018, Poppelaars & Thurman 2020, Crowley et al.,2023, Blakey et al.,2023, Hoppe & Gregory-Ksander 2024), the method involves administering a therapeutically effective dose of a CFB RNAi agent to a subject in need thereof, comprising an antisense strand containing one of the sequences in Table 2, 3, or 5C, and a sense strand containing one of the sequences in Table 2, 4, or 5C that is at least partially complementary to the antisense strand.In some embodiments, methods for treating (including prophylactic or preventive treatment) diseases or symptoms associated with complement system dysregulation, including IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD) including early and / or intermediate-stage AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases are disclosed herein (van Lookeren et al., 2016, Casiraghi et al. (al.,2017, Wong & Kavanaugh 2018, Holers & Banda 2018, Poppelaars & Thurman 2020, Crowley et al.,2023, Blakey et al.,2023, Hoppe & Gregory-Ksander 2024), the method involves administering a therapeutically effective dose of a CFB RNAi agent to a subject in need thereof, comprising a sense strand containing one of the sequences in Table 2, 4A, 4B, or 5C, and an antisense strand containing one of the sequences in Table 2, 3, or 5C that is at least partially complementary to the sense strand.

[0217] In some embodiments, methods for inhibiting CFB gene expression in cells are disclosed herein, the methods comprising administering a CFB RNAi agent to cells comprising an antisense strand at least partially complementary to a portion of CFB mRNA having the sequence of Table 1. In some embodiments, methods for inhibiting CFB gene expression in cells are disclosed herein, the methods comprising administering a CFB RNAi agent to cells comprising an antisense strand containing any sequence of Table 2, 3, or 5C, and a sense strand containing any sequence of Table 2, 4A, 4B, or 5C, at least partially complementary to the antisense strand. In some embodiments, methods for inhibiting CFB gene expression in cells are disclosed herein, the methods comprising administering a CFB RNAi agent comprising a sense strand containing any sequence of Table 2, 4A, 4B, or 5C, and an antisense strand containing any sequence of Table 2, 3, or 5C, at least partially complementary to the sense strand.

[0218] The use of CFB RNAi agents provides a method for treating (including prevention of) diseases / disorders associated with complement system dysregulation, such as IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection (TCMR) in kidney transplantation, anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD) including early and / or intermediate-stage AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases (van Lookeren et al., 2016, Casiraghi et al.). (Al., 2017, Wong & Kavanaugh 2018, Holers & Banda 2018, Poppelaars & Thurman 2020, Crowley et al., 2023, Blakey et al., 2023, Hoppe & Gregory-Ksander 2024). The CFB RNAi agents described inhibit the expression of one or more genes necessary for CFB protein production by mediating RNA interference.CFB RNAi agents can also be used to treat or prevent a variety of diseases, disorders, or conditions associated with complement system dysregulation, including IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD) including early and / or intermediate-stage AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases (van Lookeren et al., 2016, Casiraghi et al.). (al., 2017, Wong & Kavanaugh 2018, Holers & Banda 2018, Poppelaars & Thurman 2020, Crowley et al., 2023, Blakey et al., 2023, Hoppe & Gregory-Ksander 2024). Furthermore, compositions for the in vivo delivery of CFB RNAi agents to hepatocytes, particularly to hepatocytes, are described.

[0219] Cells, tissues, organs and non-human organisms Cells, tissues, organs, and non-human organisms comprising at least one of the CFB RNAi agents described herein are intended. Cells, tissues, organs, or non-human organisms are created by delivering the RNAi agent to the cells, tissues, organs, or non-human organisms.

[0220] Here, the embodiments and items provided above will be explained using the following non-limiting examples. [Examples]

[0221] Example 1. Synthesis of CFB RNAi agent. The CFB RNAi double helix shown in Tables 5A, 5B, and 5C was synthesized according to the following general procedure:

[0222] A.Synthesis The sense and antisense strands of the RNAi agents were synthesized according to solid-phase phosphoramidite techniques used for oligonucleotide synthesis. Such standard synthesis is generally known in the art. Depending on the scale, one of the following was used: MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare). Synthesis was performed on solid supports made of controlled-pore glass (CPG, 500 Å or 600 Å, available from Prime Synthesis, Aston, PA, USA). Monomers located at the 3' end of each strand were bound to the solid support as starting points for synthesis. All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA) or Hongene Biotech (Shanghai, PRC). The 2'-O-methylphosphoramidites included: (5'-O-dimethoxytrityl-N 6 -(benzoyl)-2'-O-methyladenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite,5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methylcytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, (5'-O-dimethoxytrityl-N 2-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite and 5'-O-dimethoxytrityl-2'-O-methyluridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. 2'-deoxy-2'-fluoro-phosphoramidite had the same protecting group as 2'-O-methylamidite. 5'-(4,4'-dimethoxytrityl)-2',3'-secor-uridine and 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite were also purchased from Thermo Fisher Scientific or Hongene Biotech. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite was purchased from Glen Research (Virginia) or Hongene Biotech. Cyclopropylphosphonate phosphoramidite was synthesized according to International Publication No. 2017 / 214112 (see also Altenhofer et.al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)). The reverse debase (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite) was purchased from ChemGenes (Wilmington, MA, USA) or SAFC (St Louis, MO, USA). 2 ,N 6 -(phenoxyacetate)-2'-O-methyl-diaminopurine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite was obtained from ChemGenes or Hongene Biotech.

[0223] The phosphoramidite containing the targeted ligand was dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), and all other amidites were dissolved in anhydrous acetonitrile (50 mM), or anhydrous dimethylformamide and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT in acetonitrile, 250 mM) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 12 minutes (RNA), 15 minutes (targeted ligand), 90 seconds (2'OMe), and 60 seconds (2'F). To introduce the phosphorothioate bond, a 100 mM solution of 3-phenyl1,2,4-dithiazolin-5-one (POS, PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used. Each of the CFB RNAi agent double helix synthesized and tested in the following examples utilized N-acetyl-galactosamine as "NAG" in the targeted ligand chemical structure shown in Table 6. (NAG37) and the phosphoramidite compounds that are the targeted ligands of (NAG37) can generally be synthesized in accordance with Arrowhead Pharmaceuticals, Inc.'s International Patent Application Publication No. 2018 / 044350.

[0224] B. Cleavage and deprotection of support-bound oligomers. After the completion of solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt% methylamine and 28% ammonium hydroxide (Aldrich) in water at 30°C for 1.5 hours. The solution was evaporated, and the solid residue was reconstituted in water (see below).

[0225] C. Purification Crude oligomers were purified by anion exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, containing 20% ​​acetonitrile, and Buffer B was the same as Buffer A with 1.5 M sodium chloride added. UV traces were recorded at 260 nm. Appropriate fractions were pooled and then subjected to size exclusion HPLC using a GE Healthcare XK 26 / 40 column packed with Sephadex G-25 Fine, with running buffer of filtered DI water or 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile.

[0226] D. Annealing RNAi agents were prepared by mixing complementary RNAs in equimolar RNA solutions (sense and antisense) in 1× phosphate-buffered saline (Corning, Cellgro). Several RNAi agents were lyophilized and stored at -15 to -25°C. The double-strand concentration was determined by measuring the solution absorbance in 1× phosphate-buffered saline using a UV-Vis spectrometer. The double-strand concentration was then determined by multiplying the solution absorbance at 260 nm by a conversion factor and a dilution factor. The conversion factor used was 0.050 mg / (mL·cm) or calculated from the experimentally determined extinction coefficient.

[0227] Example 2. hCFB-SEAP mouse model. To evaluate the efficacy of specific RNAi agents, an hCFB-SEAP mouse model was used. Female C57BL / 6 albino mice aged 6–8 weeks were transiently transfected in vivo with plasmids by hydrodynamic tail vein injection at least 15 days prior to administration of the CFB RNAi agent or control. The plasmids contained a human CFB sequence (GenBank NM_001710.6 (SEQ ID NO: 1)) inserted into the 3'UTR of the SEAP (secreted human placental alkaline phosphatase) reporter gene. CFB-SEAP model mice were created by injecting mice via the tail vein with 10–50 μg of plasmid containing the CFB gene sequence in Ringer's solution at a total volume of 10% of the animal's body weight. As mentioned above, the solution was injected using a 27-gauge needle for 5-7 seconds (Zhang G et al., “High levels of foreign gene expression in hepatocytes after tail vein injection of naked plasmid DNA.” Human Gene Therapy 1999 Vol.10, p1735-1737). Inhibition of CFB sequence expression by CFB RNAi agents results in simultaneous inhibition of SEAP expression, as measured by the Phospha-Light® SEAP Reporter Gene Assay System (Invitrogen). Before treatment, serum SEAP expression levels were measured, and mice were grouped according to their mean SEAP levels. Analysis: SEAP levels can be measured at various time points both before and after administration of CFB RNAi agents. i) Serum collection: Mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular region into serum separation tubes (Sarstedt AG & Co., Numbrecht, Germany). The blood was allowed to coagulate at ambient temperature for 20 minutes. The tubes were centrifuged at 8,000 × g for 3 minutes to separate the serum, which was then stored at 4°C. ii) Serum SEAP levels: Serum was collected and measured using the Phospha-Light® SEAP Reporter Gene Assay System (Invitrogen) according to the manufacturer's instructions. The serum SEAP levels of each animal were normalized to a control group of saline-injected mice to account for the non-treatment-related decrease in CFB sequence expression in this model. First, to determine the "normalized to pretreatment" expression ratio, the SEAP level of each animal at a given time point can be divided by the pretreatment level of expression in that animal ("pretreatment"). Expression at a specific time point can be normalized to the control group by dividing the "normalized to pretreatment" ratio for each individual animal by the average "normalized to pretreatment" ratio for all mice in the saline control group. Alternatively, the serum SEAP levels of each animal can be evaluated by normalizing to the pretreatment level only.

[0228] Example 3. In vivo study of CFB RNAi agents in hCFB-SEAP mice The hCFB-SEAP mouse model described in Example 2 above was used. On day 1, four female C57bl / 6 albino mice (n=4) received a single subcutaneous (SQ) injection of 200 μl per 20 g body weight containing either 3.0 mg / kg (mpk) of the CFB RNAi agent or physiological saline without the CFB RNAi agent used as a control, according to Table 7 below.

[0229] [Table 7]

[0230] Each CFB RNAi agent contained an N-acetyl-galactosamine-targeting ligand ((NAG37)) conjugated to the 5' end of the sense strand, as shown in Tables 5A, 5B, 5C, and 6, and was added as a phosphoramidite compound during the oligonucleotide synthesis process described above in Example 1.

[0231] Each of the CFB RNAi agents in groups 2-15 contained a nucleotide sequence designed to inhibit CFB gene expression by targeting a specific site in the CFB mRNA shown in Table 5B above. (For example, the referenced CFB (See Sequence ID 1 and Table 2 for mRNA sequences) Specifically, Group 2 (AD12521) contains a nucleotide sequence designed to inhibit expression at position 992 of the CFB gene transcript; Group 3 (AD12524) contains a nucleotide sequence designed to inhibit expression at position 495 of the CFB gene transcript; Group 4 (AD12525) contains a nucleotide sequence designed to inhibit expression at position 778 of the CFB gene transcript; Group 5 (AD12526) contains a nucleotide sequence designed to inhibit expression at position 781 of the CFB gene transcript; Group 6 (AD12527) contains a nucleotide sequence designed to inhibit expression at position 784 of the CFB gene transcript; Group 7 (AD12528) contains a nucleotide sequence designed to inhibit expression at position 845 of the CFB gene transcript; Group 8 (AD12529) contains a nucleotide sequence designed to inhibit expression at position 927 of the CFB gene transcript Group 9 (AD12530) includes a nucleotide sequence designed to inhibit expression at position 934 of the CFB gene transcript; Group 10 (AD12531) includes a nucleotide sequence designed to inhibit expression at position 954 of the CFB gene transcript; Group 11 (AD12532) includes a nucleotide sequence designed to inhibit expression at position 990 of the CFB gene transcript; Group 12 (AD12533) includes a nucleotide sequence designed to inhibit expression at position 1019 of the CFB gene transcript; Group 13 (AD12534) includes a nucleotide sequence designed to inhibit expression at position 1030 of the CFB gene transcript; Group 14 (AD12535) includes a nucleotide sequence designed to inhibit expression at position 1206 of the CFB gene transcript; and Group 15 (AD12536) includes a nucleotide sequence designed to inhibit expression at position 1315 of the CFB gene transcript.

[0232] The injection was administered via skin-to-muscle (i.e., subcutaneous injection) into loose skin over the neck and shoulder area. Four mice were tested in each group (n=4). Serum was collected on days 8, 15, and 22, and SEAP expression levels were determined according to the procedure described in Example 2 above. The data from the experiment are shown in Table 8 below, where mean SEAP reflects the normalized mean of SEAP.

[0233] [Table 8]

[0234] As described above, some of the CFB RNAi agents tested showed little to no inhibition. On day 8, group 8 (AD12529, CFB gene target position 927) showed the greatest reduction in SEAP compared to the saline control (group 1), with a reduction of approximately 41% (0.589). On day 22, groups 11 (AD12532, CFB gene target position 990) and 15 (AD12536, CFB gene target position 1315) showed reductions of approximately 51% (0.486) and 43% (0.526), ​​respectively, in this hCFB-SEAP mouse model.

[0235] Example 4. In vivo study of CFB RNAi agents in hCFB-SEAP mice The hCFB-SEAP mouse model described in Example 2 above was used. On day 1, four female C57bl / 6 albino mice (n=4) received a single subcutaneous (SQ) injection of 200 μl per 20 g body weight containing either 3.0 mg / kg (mpk) of the CFB RNAi agent or physiological saline without the CFB RNAi agent used as a control, according to Table 9 below.

[0236] [Table 9]

[0237] Each CFB RNAi agent contained an N-acetyl-galactosamine-targeting ligand ((NAG37)) conjugated to the 5' end of the sense strand, as shown in Tables 5A, 5B, 5C, and 6, and was added as a phosphoramidite compound during the oligonucleotide synthesis process described above in Example 1.

[0238] Each of the CFB RNAi agents in groups 2-13 contained a nucleotide sequence designed to inhibit CFB gene expression by targeting CFB mRNA position 1315, as shown in Table 5B above, but with different chemical modifications. (See, for example, SEQ ID NO: 1 and Table 2 for the referenced CFB mRNA sequences.)

[0239] The injection was administered via skin-to-muscle (i.e., subcutaneous injection) into loose skin above the neck and shoulder area. Four mice were tested in each group (n=4). Serum was collected on days 8 and 15, and SEAP expression levels were determined according to the procedure described in Example 2 above. The data from the experiment are shown in Table 10 below, where mean SEAP reflects the normalized mean of SEAP.

[0240] [Table 10]

[0241] As described above, each CFB RNAi agent tested exhibited silencing activity ranging from approximately 30% to 58% in the hCFB-SEAP mouse model. Example 5. In vivo study of CFB RNAi agents in wild-type mice

[0242] Certain CFB RNAi agents have sufficient homology to the mouse CFB gene transcript and are suitable for investigating their CFB gene expression inhibitory activity in wild-type mice. On day 1, 6-8 week old male C57bl / 6 mice were given a single subcutaneous dose of 200 μl / 20 g animal body weight containing 2.0 mg / kg (mpk) of a formulated CFB RNAi agent in isotonic saline or vehicle control (isotonic saline without the RNAi agent), according to Table 11 below.

[0243] [Table 11]

[0244] Each CFB RNAi agent contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeted ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described herein in the double-strand structure. (See Tables 3, 4, 5A, 5B, 5C, and 6 for specific modifications and structural information related to CFB RNAi agents containing the (NAG37) ligand.) Each of the CFB RNAi agents in groups 2-14 was homologous to the mouse CFB gene transcript, but contained a nucleotide sequence designed to inhibit human CFB gene expression at specific locations, as shown in Table 11 above. (See also Sequence ID No. 1 and Table 2 for the referenced CFB gene.)

[0245] Injections were administered subcutaneously (i.e., through the skin and muscle) into loose skin over the neck and shoulder area. Four mice were tested in each group (n=4). Mice were euthanized on day 8 of the study, and total RNA was isolated from the liver and both eyes after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized to mouse beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0246] [Table 12]

[0247] The data were normalized to the isotonic saline treatment group (Group 1). As shown in Table 12 above, each CFB RNAi agent (Groups 2-14) showed a reduction in mCFB mRNA in the liver. In particular, Group 10 (AD12088, target site of the CFB gene 1667) and Group 14 (AD12096, target site of the CFB gene 2399) showed particularly strong inhibition of mCFB mRNA on day 8, achieving silencing activity of over 70% in both the liver (approximately 70% (0.305) to approximately 79% (0.213), respectively) and the eyes (approximately 73% (0.268) to approximately 77% (0.227), respectively).

[0248] To confirm the consistency of the knockdown data, liver samples were reanalyzed for each CFB RNAi agent tested, as shown in Table 14 below:

[0249] [Table 14]

[0250] The data in Table 14 are consistent with the data in Table 12. CFB RNAi agents in group 10 (AD12088, CFB gene target position 1667) and group 14 (AD012096, CFB gene target position 2399) showed particularly robust inhibitory activity against CFB gene expression, while RNAi agent in group 4 (AD12082, CFB gene target position 938) did not show inhibition compared to the physiological saline control.

[0251] Example 6. In vivo study of CFB RNAi agents in wild-type mice On day 1, 6-8 week old male C57bl / 6 mice were given a single subcutaneous dose of 200 μl / 20 g animal body weight containing 1.0 mg / kg (mpk) of CFB RNAi formulation in isotonic saline or vehicle control (isotonic saline without RNAi agent), according to Table 15 below.

[0252] [Table 15]

[0253] Each CFB RNAi agent contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeted ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described herein in the double-strand structure. (See Tables 3, 4, 5A, 5B, 5C, and 6 for specific modifications and structural information related to CFB RNAi agents containing the (NAG37) ligand.) Each of the CFB RNAi agents in groups 2-17 was homologous to the mouse CFB gene transcript, but contained nucleotide sequences with different chemical modifications, although they were designed to inhibit human CFB gene expression at position 2399 of the CFB gene, as shown in Table 15 above. (See also Sequence ID No. 1 and Table 2 for the referenced CFB gene.)

[0254] Injections were administered subcutaneously (i.e., intracutaneously) into loose skin over the neck and shoulder area. Four mice were tested in each group (n=4). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized to mouse beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval). [Table 16]

[0255] The data were normalized relative to the saline treatment group (Group 1). As shown in Table 16 above, each of the CFB RNAi agents (Groups 2-17) that targeted all 2399 positions of the CFB gene showed a substantial reduction in mCFB mRNA in the liver. All CFB RNAi agents showed knockdown of approximately 50% or more, and the most potent CFB RNAi agent showed a knockdown of approximately 75% of mCFB mRNA on day 15.

[0256] Example 7. In vivo study of CFB RNAi agents in wild-type mice On day 1, 6-8 week old male C57bl / 6 mice were given a single subcutaneous dose of 200 μl / 20 g animal body weight containing 1.0 mg / kg (mpk) of CFB RNAi formulation in isotonic saline or vehicle control (isotonic saline without RNAi agent), according to Table 17 below. [Table 17]

[0257] Each CFB RNAi agent contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeted ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described herein in the double-strand structure. (See Tables 3, 4, 5A, 5B, 5C, and 6 for specific modifications and structural information related to CFB RNAi agents containing the (NAG37) ligand.) Each of the CFB RNAi agents in groups 2-17 was homologous to the mouse CFB gene transcript, but contained nucleotide sequences with different chemical modifications, although they were designed to inhibit human CFB gene expression at position 1667 of the CFB gene, as shown in Table 17 above. (See also Sequence ID No. 1 and Table 2 for the referenced CFB gene.)

[0258] Injections were administered subcutaneously (i.e., intracutaneously) into loose skin above the neck and shoulder area. Each group tested four mice (n=4), with the exception of groups 8 (AD12555) and 15 (AD12562), which tested only three mice (n=3). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized to mouse beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval). [Table 18]

[0259] The data were normalized relative to the saline treatment group (Group 1). As shown in Table 18 above, each CFB RNAi agent except for Group 2 (AD12088), which targeted all CFB gene positions 1667, showed a substantial reduction in mCFB mRNA in the liver, except for Group 10. All CFB RNAi agents in Groups 3-17 showed knockdown of approximately 50% or more, and the most potent CFB RNAi agent showed a knockdown approaching 80% of mCFB mRNA by day 15 (see, for example, Group 4 (AD12551, showing approximately 72% knockdown (0.274)), Group 5 (AD12552, showing approximately 80% knockdown (0.206)), Group 12 (AD12559, showing approximately 73% knockdown (0.266)), etc.).

[0260] Example 8. In vivo study of CFB RNAi agents in wild-type mice On day 1, 6-8 week old male C57bl / 6 mice were given a single subcutaneous dose of 200 μl / 20 g animal body weight containing 0.5 mg / kg (mpk) of CFB RNAi formulation in isotonic saline or vehicle control (isotonic saline without RNAi agent), according to Table 19 below. [Table 19]

[0261] Each CFB RNAi agent contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeted ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described herein in the double-strand structure. (See Tables 3, 4, 5A, 5B, 5C, and 6 for specific modifications and structural information related to CFB RNAi agents containing the (NAG37) ligand.) Each of the CFB RNAi agents in groups 2-15 was homologous to the mouse CFB gene transcript, but contained nucleotide sequences with different chemical modifications, although they were designed to inhibit human CFB gene expression at position 2399 of the CFB gene, as shown in Table 19 above. (See also Sequence ID No. 1 and Table 2 for the referenced CFB gene.)

[0262] Injections were administered subcutaneously (i.e., intracutaneously) into loose skin over the neck and shoulder area. Four mice were tested in each group (n=4). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized to mouse beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval). [Table 20]

[0263] The data were normalized relative to the saline treatment group (Group 1). As shown in Table 20 above, each of the CFB RNAi agents targeting all 2399 CFB gene positions showed a decrease in mCFB mRNA in the liver.

[0264] Example 9. In vivo study of CFB RNAi agents in wild-type mice On day 1, 6-8 week old male C57bl / 6 mice were given a single subcutaneous dose of 200 μl / 20 g animal body weight containing 0.5 mg / kg (mpk) of CFB RNAi formulation in isotonic saline or vehicle control (isotonic saline without RNAi agent), according to Table 21 below. [Table 21]

[0265] Each CFB RNAi agent contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeted ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described herein in the double-strand structure. (See Tables 3, 4, 5A, 5B, 5C, and 6 for specific modifications and structural information related to CFB RNAi agents containing the (NAG37) ligand.) Each of the CFB RNAi agents in groups 2-17 was homologous to the mouse CFB gene transcript, but contained nucleotide sequences with different chemical modifications, although they were designed to inhibit human CFB gene expression at position 1667 of the CFB gene, as shown in Table 21 above. (See also Sequence ID No. 1 and Table 2 for the referenced CFB gene.)

[0266] Injections were administered subcutaneously (i.e., intracutaneously) into loose skin over the neck and shoulder area. Four mice were tested in each group (n=4). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized to mouse beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval). [Table 22]

[0267] The data were normalized relative to the saline treatment group (Group 1). As shown in Table 22 above, each CFB RNAi agent targeting all CFB gene positions 1667 showed a reduction of at least several mCFB mRNA in the liver, and some achieved significant inhibition.

[0268] Example 10. In vivo study of CFB RNAi agents in wild-type mice On day 1, 6-8 week old male C57bl / 6 mice were given a single subcutaneous dose of 200 μl / 20 g animal body weight containing either a CFB RNAi preparation in 0.5 mg / kg (mpk) isotonic saline or a vehicle control (isotonic saline without the RNAi preparation), which contained the groups listed in Table 23 below: [Table 23]

[0269] Each CFB RNAi agent contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeted ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described herein in the double-strand structure. (See Tables 3, 4, 5A, 5B, 5C, and 6 for specific modifications and structural information related to CFB RNAi agents containing the (NAG37) ligand.) Each CFB RNAi agent contained a nucleotide sequence homologous to the mouse CFB gene transcript, but designed to inhibit human CFB gene expression at either position 1667 or position 2399 of the CFB gene, as shown in Table 23 above. (See also Sequence ID No. 1 and Table 2 for the referenced CFB gene.)

[0270] Injections were administered subcutaneously (i.e., intracutaneously) into loose skin over the neck and shoulder area. Four mice were tested in each group (n=4). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized to mouse beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval). [Table 24]

[0271] The data were normalized relative to the saline treatment group (group 1). As shown in Table 24 above, group 10 (AD13931) showed only minimal knockdown of mCFB mRNA, substituting the U nucleotide at position 13 of the antisense strand (5'→3'), thereby forming a U:G wobble with the CFB gene and essentially inactivating the CFB RNAi agent (comparing AD13931 (group 10) with AD13436 (group 8)). On the other hand, the CFB RNAi agent in group 11 contained a mismatch with the target mRNA at position 15 of the antisense strand (5'→3') and also substituted a U nucleotide instead of C, thus forming a U:G wobble with the CFB mRNA (and sense strand). This was more tolerable than group 10, but not as potent as the version that was more completely complementary to the CFB gene target (AD13932 (group 11) (approximately 43% knockdown (0.547)) compared to AD13436 (group 8) (approximately 49% knockdown (0.516))).

[0272] Conversely, the CFB RNAi agent in group 12 also contained a mismatch with the target CFB mRNA, but here, a U nucleotide was substituted with a C nucleotide at position 16 of the antisense strand (5'→3), and despite this change to the antisense strand sequence, it no longer formed a Watson-Crick base pair with the CFB mRNA (SEQ ID NO: 1) reported at this position (as well as with the sense strand of this particular CFB RNAi agent), instead forming a U:G wobble, which surprisingly and unexpectedly resulted in an improvement of approximately 10% in CFB gene silencing activity, making it the most potent CFB RNAi agent in this particular study. (Compare AD13933 (group 12), which showed the highest level of knockdown in this study at 59% (0.410) from a single 0.5 mg / kg subcutaneous (SQ) dose, with AD13436 (group 8), which showed only 49% knockdown (0.516). Table 1 (position 1667) See also mRNA target sequence: UGUGGUGUCUGAGUACUUU (SEQ ID NO: 45) (the underlined part highlights the aforementioned position 16 where AD13933 forms a G:U oscillating base pair with the CFB gene transcript instead of a C:G base pair)). Similarly, group 13 (AD13934, with a G:U oscillating pair inserted at position 18 by modifying the antisense strand) exhibited improved inhibitory activity compared to the perfectly complementary sequence of group 8 (AD13436), though not as potent as group 12. The exact reasons for the unexpected improvements observed in groups 12 (AD13933) and 13 (AD13934) compared to the RNAi agent (AD13436) with a perfectly complementary antisense strand sequence to the CFB gene target are merely hypotheses and not bound by any theory, but modifying the nucleotide sequence at these specific positions may be the reason for the improvement in CFB The thermodynamic changes of the RNAi agent are thought to lead to improved RISC loading and / or improved endosome evasion properties of the antisense strand, allowing for more RNAi agents to target desired cells without causing the expected decrease in inhibitory activity due to the lack of complete complementarity to the CFB gene (as seen, for example, with the sequence modifications performed in group 10).

[0273] Example 11. In vivo study of CFB RNAi agents in wild-type mice On day 1, 6-8 week old male C57bl / 6 mice were given a single subcutaneous dose of 200 μl / 20 g animal body weight containing a CFB RNAi preparation in isotonic saline at 0.3 mg / kg, 1.0 mg / kg, or 3.0 mg / kg, or a vehicle control (isotonic saline without the RNAi preparation). This included the groups shown in Table 25 below: [Table 25]

[0274] Each CFB RNAi agent contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeted ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described herein in the double-strand structure. (See Tables 3, 4, 5A, 5B, 5C, and 6 for specific modifications and structural information related to CFB RNAi agents containing the (NAG37) ligand.) Each CFB RNAi agent contained a nucleotide sequence homologous to the mouse CFB gene transcript, as shown in Table 25 above, but designed to inhibit human CFB gene expression at position 1667 of the CFB gene. (See also Sequence ID No. 1 and Table 2 for the referenced CFB gene.)

[0275] Injections were administered subcutaneously (i.e., intracutaneously) into loose skin over the neck and shoulder area. Four mice were tested in each group (n=4). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized to mouse beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval). [Table 26]

[0276] The data were normalized relative to the saline treatment group (Group 1). As shown in Table 26 above, each CFB RNAi agent showed robust gene inhibition, and all four CFB RNAi agents tested showed a clear dose-response.

[0277] Example 12. In vivo study of CFB RNAi agents in cynomolgus monkeys The CFB RNAi agents AD12964, AD13126, AD13933, and AD13934 were evaluated in cynomolgus monkeys (cynos). On days 1 and 29, four groups of three male cynomolgus monkeys (n=3 per group) were administered a subcutaneous injection of 0.3 mL / kg (approximately 1.5 mL depending on the animal's mass) containing 3.0 mg / kg (mpk) of the CFB RNAi agent (one CFB RNAi agent per group) formulated in isotonic saline.

[0278] The CFB RNAi agents contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described herein for the double-strand structure. (See Tables 3, 4, 5A, 5B, 5C, and 6 for specific modifications and structural information related to CFB RNAi agents containing the (NAG37) ligand.)

[0279] Serum samples were collected on days -7 (pre-administration), 1 (pre-administration), 8, and 15. Figure 1 shows serum cynomolgus monkey cCFB (cCFB) protein levels normalized to pre-administration levels on day 1, plotted by measurements taken on each serum collection day up to week 2 (for example, in Figure 1, week 0 is day 1, week 4 is day 29).

[0280] The decrease in CFB also correlates with impaired alternative complement pathways (APs). The Wieslab® AP assay is an ELISA-based assay that detects complement membrane attack complexes (MACs), the cytolytic effectors of immunity at the final stage of the complement cascade. (See Example 13 below for further discussion of the Wieslab® AP assay used). The kit is alternative pathway specific because the plates are coated with the specific activator of the alternative pathway. Figure 2 shows the relative activity measured by the Wieslab® AP assay, normalized to pre-D1 levels, plotted by measurements on each serum collection day up to week 2 (e.g., in Figure 1, week 0 is day 1 and week 4 is day 29).

[0281] As shown in Figure 1, each of the evaluated CFB RNAi agents resulted in a significant decrease in serum CFB protein levels, though to varying degrees. Similarly, as shown in Figure 2, the Wieslab® AP assay, which assesses complement alternative pathway activity, supported loss of function correlated with the decrease in CFB protein levels. By day 15, the four evaluated CFB RNAi agents resulted in serum CFB protein decreases of 70% (AD12964), 92% (AD13933), 87% (AD13934), and 73% (AD13126), respectively (Figure 1). Correspondingly, these decreases in serum CFB levels were accompanied by significant loss of complement alternative pathway activity, as measured by the Wieslab® AP assay, of 47% (AD12964), 81% (AD13933), 75% (AD13934), and 49% (AD13126), respectively (Figure 2).

[0282] Example 13. In vivo study of CFB RNAi agents in cynomolgus monkeys over a duration of 85 days. In the study described in Example 12, observations and evaluations (excluding others) of treatment with the CFB RNAi agent AD13933 were maintained until day 85 after the first injection (day 1) to further characterize the pharmacodynamic effects. Serum samples collected every week after the first injection (i.e., weeks 0, 2, 4, 6, 8, 10, and 12) were analyzed.

[0283] Semi-quantitative measurement of serum CFB levels in cynomolgus monkeys was performed by Western blotting using Jess (ProteinSimple, MN, USA). Serum protein concentrations were measured using the Thermo Scientific® Pierce® BCA protein assay kit (catalog number 23227, Thermo Scientific®). The primary antibody for detecting serum CFB was purchased from Sigma (catalog number HPA001817), and the primary antibody for detecting transferrin was purchased from R&D Systems (catalog number AF3987SP). Serum CFB protein levels were normalized to transferrin levels and then compared to the corresponding day 1 levels for each animal. All supplies required for Western blotting analysis were purchased from ProteinSimple.

[0284] Furthermore, the hemolytic activity of the CFB RNAi agent AD13933 was evaluated. Hemolytic activity is sensitive to the reduction, absence, and / or inactivation of key components of the complement system. As mentioned, there are three pathways of complement activation: the alternative pathway, the classical pathway, and the lectin pathway. Since all three complement system activation pathways require CFB involvement to cause tissue damage in vivo (see, e.g., Thurman, J. & Holers, VM, J. Immunol. February 1, 2006, 176(3) 1305-1310), the activation of the alternative complement pathway (AP) was measured to evaluate the effect of CFB knockdown on the complement system. AP requires only Mg2+ ions, while the classical and lectin pathways require both Ca2+ and Mg2+. Using this difference, AP alone was assayed in the presence of classical and lectin pathway proteins. Rabbit erythrocytes, which are known to spontaneously activate AP in most mammalian species, were used to perform the assay.

[0285] method

[0286] Hemolysis assay (alternative route)

[0287] Alternative hemolysis assays were performed by measuring the hemolysis of sensitized rabbit erythrocytes, following a modified protocol provided by Complement Technology, Inc. (https: / / www.complementtech.com). Briefly, for each reaction with a total volume of 100 μL in a 96-well plate, 8–30 μL of 2-fold diluted serum sample was incubated with 50 μL of GVBE0, 5 μL of 0.1 M MgEGTA, and 25 μL of rabbit erythrocytes (5 × 10⁸ / mL). After incubation of the mixture at 37°C for 30 minutes, the reaction was stopped by adding 100 μL of GVBE. After centrifugation, 100 μL of supernatant was transferred to a new plate. Hemolysis was determined by analyzing the optical density of the supernatant at 412 nM. The maximum hemolytic lysates were achieved after incubation at 37°C for 60 minutes. All reagents were purchased from Complement Technology, Inc. (Texas, USA).

[0288] One AP50 unit is defined as the amount of serum required to induce 50% RBC lysis. This is calculated by subtracting the background OD from all samples and then dividing them by the maximum lysis control. Plot the curve ln(dilution) vs ln(lysis). Select three points enclosing the 50% maximum lysis to create a line used to calculate one AP50 unit. Based on the dilution, AP50 U / ml for each sample can be calculated.

[0289] Hemolysis assay (classical route)

[0290] Hemolysis assays for the classical pathway were performed according to a modified protocol provided by Complement Technology, Inc. (https: / / www.complementtech.com). Briefly, for each reaction of 120 μL total volume with GVB++, serum samples were first diluted 20-fold, then 1:2.5, and further diluted three times at 1:1.5. 15 μL of GVB++-diluted serum sample was incubated with 10 μL of sheep erythrocytes coated with rabbit antibody (EA cells, 5 × 10⁸ / mL). After incubation of the mixture at 37°C for 30 minutes, the reaction was stopped by adding 100 μL of cold GVB++. After centrifugation at 1000 g for 5 minutes, 100 μL of supernatant was transferred to a new plate. Hemolysis was determined by analyzing the optical density of the supernatant at 412 nM. All reagents were purchased from Complement Technology, Inc. (Texas, USA).

[0291] 1 CH50 unit is defined as the amount of serum required to induce 50% RBC lysis. This is calculated by subtracting the background OD from all samples and then dividing by the maximum lysis control. Plot the curve ln(dilution) vs ln(lysis). Select three points enclosing the 50% maximum lysis point to create a line used to calculate 1 CH50 unit. Based on the dilution, CH50 U / ml for each sample can be calculated.

[0292] Wieslab® assay (alternative and classical pathways)

[0293] Quantitative measurements of complement alternative pathways and classical activity in cynomolgus monkeys were performed using in vitro competitive ELISA kits (catalog numbers COMPLAP330, COMPLCP310, Svar Life Science AB). Serum samples were assayed according to the manufacturer's instructions.

[0294] result

[0295] Treatment with AD13933 induced a rapid decrease in serum CFB levels after the first injection. By day 15, the CFB RNAi agent AD13933 showed a 95% reduction in serum CFB protein. This reduction was further enhanced by a second injection administered on day 29. Low levels of serum CFB protein were maintained at less than 5% of baseline levels until day 85 (week 12) (see Figure 3). Data from individual cynomolgus monkeys are provided in the table below.

[0296] [Table 30] (See also Figure 3, which plots the mean values.) As shown in the data presented herein, AD13933 resulted in a reduction of over 95% by day 15 and showed strong inhibition until day 85 (0.0243-cynomolgus monkey 1; 0.0235-cynomolgus monkey 3).

[0297] Serum levels of Bb protein, a component of C3 convertase, were also evaluated. In the alternative complement activation pathway, CFB binds to C3b and cleaves C3 to produce C3b. However, CFB itself is cleaved only when bound to C3b. The Bb fragment exhibits serine protease activity, but can only cleave C3 and C5 while bound to C3b. Therefore, CFB and C3 generate an amplification loop, which is a suitable marker for Bb to reflect alternative pathway activation. Serum Bb levels were quantified by ELISA using MicroVue Bb Plus EIA (Quidel, San Diego, CA, USA). Serum Bb levels showed a similar decline pattern to CFB protein levels and were maintained at less than 30% of baseline levels from day 15 to day 85 (see Figure 4).

[0298] Correspondingly, the decrease observed in serum CFB and Bb levels was accompanied by a significant loss of complement alternative pathway activity, as measured by both the hemolytic AP50 and Wieslab® AP assays, respectively. Two AD13933 treatments in 3mpk resulted in a decrease of over 75% by the AP hemolytic assay (day 43, Figure 5) and approximately 90% by the Wieslab® AP assay (day 43, Figure 6). Furthermore, it was established that CFB is involved only in alternative pathways of the complement cascade. As expected, no significant changes in classical pathway activity were detected by the hemolytic CH assay (CH50, Figure 7) and the Wieslab® CP assay (classical pathway) (Figure 8).

[0299] Example 14. In vivo study of CFB RNAi agents in wild-type mice On day 1, 6-8 week old male C57bl / 6 mice were given a single subcutaneous dose of 200 μl / 20 g animal body weight containing either a CFB RNAi formulation in 0.5 mg / kg isotonic saline or a vehicle control (isotonic saline without the RNAi formulation). This included the groups shown in Table 28 below:

[0300] [Table 28]

[0301] Each CFB RNAi agent contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeted ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described herein in the double-strand structure. (See Tables 3, 4, 5A, 5B, 5C, and 6 for specific modifications and structural information related to CFB RNAi agents containing the (NAG37) ligand.) Each CFB RNAi agent was homologous to the mouse CFB gene transcript, but contained a nucleotide sequence designed to inhibit human CFB gene expression at either position 1667 (group 2) or position 2399 (groups 3-20) of the CFB gene, as shown in Table 25 above. (See also Sequence ID No. 1 and Table 2 for the referenced CFB gene.)

[0302] Injections were administered subcutaneously (i.e., intracutaneously) into loose skin over the neck and shoulder area. Four mice were tested in each group (n=4). Mice were euthanized on day 15 of the study, and total RNA was isolated from both livers after collection and homogenization. Mouse CFB mRNA expression was quantified by probe-based quantitative PCR, normalized to mouse beta-actin expression, and expressed as a percentage of the vehicle control group (geometric mean, + / - 95% confidence interval).

[0303] [Table 29]

[0304] The data were normalized relative to the saline treatment group (Group 1). As shown in Table 26 above, each CFB RNAi agent inhibited CFB gene expression, and some achieved a reduction of nearly or more than 50% in mCFB mRNA. Example 15. Phase I / IIa clinical trial to evaluate the safety, tolerability, pharmacokinetics, and pharmacodynamics of single and multiple doses of CFB RNAi agents in healthy human volunteers and adults with complement-mediated renal disease.

[0305] Phase 1 / 2 single-dose and multi-dose dose-escalation studies have been initiated to evaluate the safety, tolerability, pharmacokinetics, and pharmacodynamic effects of the CFB RNAi agent AD13933 formulated in sodium phosphate buffer in healthy adult volunteers and subjects with complement-mediated renal disease. The CFB RNAi agent AD13933 was formulated at a dose of 200 mg / mL (salt-free or free acid basis) in a buffer solution containing 0.5 mM monobasic sodium phosphate and 0.5 mM dibasic sodium phosphate ("formulated CFB RNAi drug substance") in water for injection.

[0306] Each of the five single-elevation-dose (SAD) cohorts is expected to enroll six normal healthy volunteers (NHV) (randomized 2:1 drug:placebo) to receive either a formulated CFB RNAi drug at doses of 25 mg, 50 mg, 100 mg, 200 mg, or 400 mg, or a placebo (i.e., four subjects in each cohort will receive the CFB RNAi drug and two subjects will receive the placebo), with safety checks performed on day 15. Furthermore, each of the three multiple-elevation-dose (MAD) cohorts is expected to enroll six NHV subjects (randomized 2:1 drug:placebo) to receive either a formulated CFB RNAi drug at doses of 100 mg, 200 mg, or 400 mg, or a placebo, in two doses administered on day 1 and day 29. A cohort has also been initiated to enroll subjects with complement-mediated renal disease, with up to 18 IgAN patients being enrolled. These patients will receive a total dose of formulated CFB RNAi drug substance in three doses on days 1, 29, and 113, at a dose level determined based on data from the SAD and MAD cohorts.

[0307] Example 16. In vivo study of CFB RNAi agents in cynomolgus monkeys The CFB RNAi agent AD13933 was evaluated in cynomolgus monkeys (cynos). On days 1 and 29, three male cynomolgus monkeys (n=3) were administered a subcutaneous injection of 0.3 mL / kg (approximately 1.5 mL depending on the animal's mass) containing either 0.5 mg / kg (mpk), 1.5 mg / kg, or 4.5 mg / kg of the CFB RNAi agent AD13933, formulated in isotonic saline.

[0308] The CFB RNAi agent AD13933 contained a modified nucleotide conjugated at the 5' end of the sense strand to a targeting ligand (tridentate ligand) containing three N-acetyl-galactosamine groups having the modified sequence described herein for the double-strand structure. (See Tables 3, 4, 5A, 5B, 5C, and 6 for specific modifications and structural information related to CFB RNAi agents containing the (NAG37) ligand.)

[0309] Serum samples were collected on day 1 (before administration), day 8, day 15, day 22, day 29 (before the second administration), day 36, day 43, day 50, day 57, day 64, day 71, day 78, and day 85 on day 77 (before administration).

[0310] Administration of the CFB RNAi agent AD13933 induced a significant decrease in serum CFB two weeks after the initial dose, and such decreases showed a dose-dependent response. The lowest serum CFB protein levels appeared on day 43, with decreases of over 90% (for the 0.5 mg / kg group) and over 95% (for the 4.5 mg / kg group) compared to the corresponding baseline levels (Figure 9). The functional fragment Bb of CFB in alternative pathway activation was similarly significantly reduced by treatment with the CFB RNAi agent AD13933, showing a decrease of over 95% at the lowest point in all treatment groups (Figure 10).

[0311] Complement activity affected by treatment with the CFB RNAi agent AD13933 was also measured by hemolysis assays and Wieslab® assays (see Examples 12 and 13 for assay information). The CFB RNAi agent AD13933 resulted in a dose-dependent decrease in complement alternative pathway activity. At the lowest point, 4.5 mg / kg of the CFB RNAi agent AD13933 caused loss of alternative pathway activity of over 70% (AP50 of hemolysis, Figure 11) and 90% (Wieslab® AP assay, Figure 12). On the other hand, classical pathway activity measured by CH50 of hemolysis (Figure 13) and the Wieslab® CP (classical pathway) assay (Figure 14) remained unchanged, confirming that CFB inhibition caused by the CFB RNAi agent AD13933 does not affect the classical pathway.

[0312] The results of this study suggest that the CFB RNAi agent AD13933 effectively silences CFB gene expression. Repeated administration yielded further pharmacodynamic effects. Not only was serum CFB protein significantly reduced in dose-related terms by treatment with the CFB RNAi agent AD13933, but CFB-related function of complement alternative pathway activity was dramatically impaired in correlation with the reduction in CFB.

[0313] Example 17. Toxicity evaluation of CFB RNAi agents The nonclinical safety profile of the CFB RNAi agent AD13933 was evaluated using a standard series of in vitro and in vivo studies. Results from non-GLP in vitro studies demonstrated minimal potential for induction of the innate immune system (cytokine and complement activation), mitochondrial toxicity / cytotoxicity, or spontaneous platelet aggregation. The CFB RNAi agent AD13933 also demonstrated no adverse effects on the central nervous system, respiratory system, or cardiovascular system, as demonstrated by the results of the safety pharmacology evaluation.

[0314] To assess the potential for general toxicity of AD13933, a repeated dose-toxicity study was conducted using one dose subcutaneously every four weeks. A summary of the study's NOAEL is shown in Table 6.

[0315] [Table 31]

[0316] Microscopic findings in the liver and kidneys of rats, as well as in the injection sites and lymph nodes of monkeys, suggested uptake and clearance of the CFB RNAi agent AD13933, similar to those described for other subcutaneously administered N-acetyl-galactosamine siRNA drugs. Microscopic findings were also observed in the adrenal glands and pancreas of rats, but were not considered harmful. A no-observed-adverse-effect level (NOAEL) of 30 mg / kg was assigned based on the incidence and severity of hepatocellular carcinomas observed in rats administered ADS-020 at doses of 100 mg / kg or higher; however, these findings did not show clinicopathological correlation and were not associated with any apparent adverse effects on organ function or the overall health of the animals.

[0317] Furthermore, off-target analysis of the nucleotide sequence of the CFB RNAi agent AD13933 revealed that AD13933 is a highly specific RNAi agent for human CFB mRNA, and that it is very unlikely to cause off-target gene silencing, especially at clinically appropriate doses.

[0318] In summary, the results of the in vitro and in vivo nonclinical safety studies conducted support the appropriate safety of the CFB RNAi agent AD13933 for clinical development in humans. The toxicological effects observed in animal studies occurred at substantially higher dose levels than those intended for use in clinical trials, and therefore do not pose a substantial risk to human safety.

[0319] Other Embodiments Although the present invention has been described in conjunction with its detailed description, it should be understood that the foregoing description is illustrative and does not limit the scope of the invention as defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

1. RNAi agents for inhibiting the expression of the complement factor B (CFB) gene, An antisense strand comprising a nucleotide sequence of 17 consecutive nucleotides and at least 15 consecutive nucleotides that differ by 0 or 1 nucleotide from any one of the antisense strand sequences in Table 2, Table 3, or Table 5C, A sense strand comprising a nucleotide sequence at least partially complementary to the antisense strand, RNAi agents that inhibit the expression of the complement factor B (CFB) gene, including [specific RNAi agent].

2. The RNAi agent according to claim 1, wherein the antisense strand comprises nucleotides 2 to 18 of any one sequence provided in Table 2, Table 3, or Table 5C.

3. The RNAi agent according to claim 1 or 2, wherein the sense strand comprises a nucleotide sequence of at least 17 consecutive nucleotides that differ by 0 or 1 nucleotide from any one of the sense strand sequences in Table 2, Table 4, or Table 5, and the sense strand has a region of at least 85% complementarity with respect to the antisense strand over at least 17 consecutive nucleotides.

4. The RNAi agent according to any one of claims 1 to 2, comprising a nucleoside linkage in which at least one nucleotide of the RNAi agent is modified.

5. The RNAi agent according to any one of claims 1 to 3, wherein the RNAi agent comprises one or more modified nucleotides independently selected from the group consisting of 2'-O-methylnucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-seconucleotide mimetic, locked nucleotide, 2'-F-arabinonucleotide, 2'-methoxyethyl nucleotide, debasalized nucleotide, ribitol, inverted nucleotide, inverted 2'-O-methylnucleotide, inverted 2'-deoxynucleotide, 2'-amino modified nucleotide, 2'-alkyl modified nucleotide, morpholine nucleotide, vinyl phosphonate-containing nucleotide, cyclopropylphosphonate-containing nucleotide, and 3'-O-methylnucleotide.

6. The RNAi agent according to any one of claims 1 to 5, wherein all or substantially all of the nucleotides are modified nucleotides, and the modified nucleotides are 2'-O-methylnucleotides, 2'-fluoronucleotides, or a combination thereof.

7. The RNAi agent according to any one of claims 1 to 6, wherein the antisense strand consists of or is essentially one nucleotide sequence of any one of the modified antisense strand sequences in Table 3 or Table 5C.

8. The RNAi agent according to any one of claims 1 to 7, wherein the sense strand consists of, essentially comprises, or includes any nucleotide sequence of any of the modified sense strand sequences in Table 4A, Table 4B, or Table 5C.

9. The RNAi agent according to claim 1, wherein the antisense strand comprises one of the nucleotide sequences of the modified sequences in Table 3 or Table 5C, and the sense strand comprises one of the nucleotide sequences of the modified sequences in Table 4A, Table 4B, or Table 5C.

10. The RNAi agent according to any one of claims 1 to 9, wherein the RNAi agent is linked to a targeted ligand.

11. The RNAi agent according to claim 10, wherein the targeted ligand has affinity for the asialoclycoprotein receptor.

12. The RNAi agent according to claim 10 or claim 11, wherein the targeted ligand comprises N-acetyl-galactosamine.

13. The RNAi agent according to any one of claims 10 to 12, wherein the targeted ligand is linked to the sense strand.

14. The RNAi agent according to claim 13, wherein the targeted ligand is ligated to the 5' end of the sense strand.

15. The targeted ligand is 【Chemistry 1】 An RNAi agent according to any one of claims 10 to 14, comprising:

16. The RNAi agent according to any one of claims 1 to 15, wherein the sense strand is 15 to 30 nucleotides long and the antisense strand is 19 to 30 nucleotides long.

17. The RNAi agent according to claim 16, wherein the sense strand and the antisense strand are each 19 to 26 nucleotides long.

18. The RNAi agent according to claim 17, wherein the sense strand and the antisense strand are each 21 to 24 nucleotides long.

19. The RNAi agent according to claim 18, wherein the sense strand and the antisense strand are each 21 nucleotides long.

20. The RNAi agent according to any one of claims 1 to 19, wherein the RNAi agent has two blunt ends.

21. The RNAi agent according to any one of claims 1 to 20, wherein the sense strand comprises one or two terminal caps.

22. The RNAi agent according to any one of claims 1 to 21, wherein the sense strand comprises one or two inverse debase residues.

23. The RNAi agent according to claim 1, wherein the RNAi agent comprises a sense strand and an antisense strand that form a double-stranded sequence of any of the double-stranded sequences shown in Table 5A, Table 5B, or Table 5C.

24. The following nucleotide sequence (5'→3'): AAAGUACUCAGACACCACACAGC (Sequence ID 1275); UAGAAAACCCAAAAUCCUCAUC (Sequence ID 1283); UAAGUACUCAGACUCACACACC (Sequence ID 1332); UAAGUACUCAGACACCAUAGC (Sequence ID 1333); UAAGUACUCAGACACCACACAGC (Sequence ID 1326) UCAAUGACAGUAAUUGGGUCC (Sequence ID 1310); AAAGUACUCAGACACCACA (Sequence ID 359); UAGAAAACCCAAAAUCCUCA (Sequence ID 474); UAAGUACUCAGACUCUACA (Sequence ID 367); UAAGUACUCAGACACCAUA (Sequence ID 361); UAAGUACUCAGACACCACA (Sequence ID 360); or UCAAUGACAGUAAUUGGGGU (Sequence ID 246) The RNAi agent according to any one of claims 1 to 23, comprising an antisense strand consisting of, essentially consisting of, or containing a nucleotide sequence that differs from one of the others by 0 or 1 nucleotide.

25. The sense strand has the following nucleotide sequence (5'→3'): GCUGUGUGUGUCUGAGUAGUUU (Sequence ID 1355); GAUGAGGAUUUGGGUU UUCUA (Sequence ID 1363); GCUGUGUGUGUCUGAGUACUUA (Sequence ID 1406); GCUGUGUGUGUUUGAGUACUA (Sequence ID 1409); GGACCCAAUUACUGUCAUGA (Sequence ID 1390); UGUGUGUGUCUGUGAGUACUUU (Sequence ID 1410); UGAGGAUUUGGGUU UUCUA (Sequence ID 1408); UGUGUGUGUCUGUGAGUACUA (Sequence ID 779); UGUGUGUGUGUGUGUGAGUACUA (Sequence ID 1439); or ACCCAAAUUACUGUCAUGA (Sequence ID 665) An RNAi agent according to any one of claims 1 to 24, comprising, essentially, or including a nucleotide sequence that differs from one of the others by 0 or 1 nucleotide.

26. The RNAi agent according to any one of claims 23 to 25, wherein all or substantially all of the nucleotides are modified nucleotides.

27. The following nucleotide sequence (5'→3'): asAfsaguaCfucagAfcAfcCfacagsc (Sequence ID 983); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc(Sequence ID 913); usAfsgsaAfaaccccaAfaUfcCfucausc (Sequence ID 915); usAfsaguaCfucagAfcAfcUfacagsc(Sequence ID 1013); usAfsaguaCfucagAfcAfcCfauagsc (Sequence ID 1014); usAfsaguaCfucagAfcAfcCfacagsc(SEQ ID NO: 994); or usCfsaaugAfcaguAfaUfuGfggucsc (Sequence ID 1022); It includes, consists of, or is essentially an antisense strand containing a modified nucleotide sequence that differs from one of the others by only 0 or 1 nucleotide, The RNAi agent according to claim 1, wherein a represents 2'-O-methyladenosine, c represents 2'-O-methylcytidine, g represents 2'-O-methylguanosine, u represents 2'-O-methyluridine, Af represents 2'-fluoroadenosine, Cf represents 2'-fluorocytidine, Gf represents 2'-fluoroguanosine, Uf represents 2'-fluorouridine, s represents a phosphorothioate bond, and all or substantially all of the nucleotides on the sense strand are modified nucleotides.

28. The sense strand has the following nucleotide sequence (5'→3'): gcuguguguGfUfCfugaguacuuu (Sequence ID 1176); gaugaggaUfUfUfggguguuuucua (Sequence ID 1184); gaugaggaUfuUfGfgguuuucua (Sequence ID 1185); gcuguguguGfUfCfugaguacuua (Sequence ID 1235); gcuguguguGfUfUfugaguacuua (Sequence ID 1248); or ggacccAfaUfuAfcugucauuga (Sequence ID 1251), It contains, consists of, or is essentially composed of, one of the modified nucleotide sequences that differs from the others by only 0 or 1 nucleotide. The RNAi agent according to claim 1, wherein a represents 2'-O-methyladenosine, c represents 2'-O-methylcytidine, g represents 2'-O-methylguanosine, u represents 2'-O-methyluridine, Af represents 2'-fluoroadenosine, Cf represents 2'-fluorocytidine, Gf represents 2'-fluoroguanosine, and Uf represents 2'-fluorouridine, s represents a phosphorothioate bond, and all or substantially all of the nucleotides on the antisense strand are modified nucleotides.

29. The RNAi agent according to any one of claims 23 to 28, wherein the sense strand further comprises an inverted debase residue at the 3' end of the nucleotide sequence, the 5' end of the nucleotide sequence, or both.

30. The RNAi agent according to any one of claims 1 to 29, wherein the RNAi agent is linked to a targeted ligand.

31. The targeted ligand is 【Chemistry 2】 An RNAi agent according to any one of claims 1 to 30, comprising:

32. The RNAi agent according to any one of claims 1 to 31, wherein the targeted ligand is linked to the sense strand.

33. The RNAi agent according to claim 32, wherein the targeted ligand is ligated to the 5' end of the sense strand.

34. The RNAi agent according to any one of claims 1 to 33, wherein the RNAi agent is a pharmaceutically acceptable salt.

35. The RNAi agent according to claim 34, wherein the RNAi agent is a sodium salt.

36. The RNAi agent has the following sequence pair (5'→3'): asAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO: 983) and (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuus(invAb) (SEQ ID NO: 1077); usAfsgsAfaAfaCfcCfaAfaUfcCfuCfaUfsc (SEQ ID NO: 913) and (NAG37)s(invAb)sgaugaggaUfUfUfgggguuuuucuas(invAb) (SEQ ID NO: 1085); usAfsgsaAfaaccccaAfaUfcCfucausc (SEQ ID NO: 915) and (NAG37)s(invAb)sgaugaggaUfuUfGfgguuuucuas(invAb) (SEQ ID NO: 1086); usAfsaguaCfucagAfcAfcUfacagsc (SEQ ID NO: 1013) and (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuas(invAb) (SEQ ID NO: 1136); usAfsaguaCfucagAfcAfcCfauagsc (SEQ ID NO: 1014) and (NAG37)s(invAb)sgcugugguGfUfCfugaguacuuas(invAb) (SEQ ID NO: 1136); usAfsaguaCfucagAfcAfcCfacagsc (SEQ ID NO: 994) and (NAG37)s(invAb)sgcugugguGfUfUfugaguacuuas(invAb) (SEQ ID NO: 1149); or usCfsaaugAfcaguAfaUfuGfggucsc(SEQ ID NO: 1022) and (NAG37)s(invAb)sggacccAfaUfuAfcugucauugas(invAb)(SEQ ID NO: 1152); An antisense strand and a sense strand comprising, essentially consisting of, or containing, one of the modified nucleotide sequences that differ by only 0 or 1 nucleotide, In the formula, a represents 2'-O-methyladenosine, c represents 2'-O-methylcytidine, g represents 2'-O-methylguanosine, u represents 2'-O-methyluridine, Af represents 2'-fluoroadenosine, Cf represents 2'-fluorocytidine, Gf represents 2'-fluoroguanosine, and Uf represents 2'-fluorouridine, s represents a phosphorothioate bond, (invAb) represents an inverse nonbasic deoxyribonucleotide, and (NAG37) has the following chemical structure: 【Transformation 3】 An RNAi agent according to any one of claims 1 to 35, having the following characteristics.

37. A composition comprising an RNAi agent according to any one of claims 1 to 36, wherein the composition comprises a pharmaceutically acceptable excipient.

38. The composition according to claim 37, wherein the pharmaceutically acceptable excipient is sodium phosphate buffer.

39. The composition according to claim 38, wherein the pharmaceutically acceptable excipient is isotonic saline or water for injection.

40. A method for inhibiting CFB gene expression in hepatocytes, comprising introducing an effective amount of an RNAi agent according to any one of claims 1 to 36 or a composition according to any one of claims 37 to 39 into target cells.

41. The method according to claim 40, wherein the subject is a human subject.

42. The method according to any one of claims 40 to 41, wherein the CFB mRNA level is reduced by at least about 50% in hepatocytes or the subject.

43. The method according to any one of claims 40 to 42, wherein the CFB protein level is reduced by at least about 50% in hepatocytes or the subject.

44. The method according to any one of claims 40 to 43, wherein the alternative pathway for complement activity in the human subject is inhibited by at least 50% when measured by the Wieslab® AP assay.

45. The method according to any one of claims 40 to 44, wherein the alternative pathway for complement activity in the human subject is inhibited by at least 90% when measured by the Wieslab® AP assay.

46. The method according to any one of claims 40 to 45, wherein the alternative pathway for complement activity in the human subject is inhibited by at least 50% when measured by the AP50 hemolysis assay.

47. The method according to any one of claims 40 to 46, wherein the alternative pathway for complement activity in the human subject is inhibited by at least 70% when measured by the AP50 hemolysis assay.

48. A method for treating CFB-related diseases, disorders, or symptoms, comprising administering a therapeutically effective amount of the composition described in any one of claims 37 to 39 to a human subject in need thereof.

49. The method according to claim 48, wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD) including early and / or intermediate-stage AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases.

50. The method according to any one of claims 40 to 49, wherein the RNAi agent is administered to the human subject at a dose of approximately 0.05 mg / kg to approximately 6.0 mg / kg of the human subject's body weight.

51. The method according to any one of claims 40 to 50, wherein the RNAi agent is administered to a human subject in a fixed dose of approximately 25 mg to approximately 400 mg.

52. Use of an RNAi agent according to any one of claims 1 to 36 or a composition according to any one of claims 37 to 39 for the treatment of a disease, disorder, or symptom that is at least partially mediated by a decrease in CFB gene expression.

53. The use according to claim 52, wherein the disease is IgA nephropathy (IgAN), C3 glomerulopathy (C3G), immune complex-mediated membrane proliferative glomerulonephritis (IC-MPGN), lupus nephritis (LN), anti-glomerular basement membrane antibody disease (anti-GBM), ischemia-reperfusion injury and T-cell-mediated rejection in kidney transplantation (TCMR), anti-neutrophil cytoplasmic antibody (ANCA)-associated vasculitis, age-related macular degeneration (AMD) including early and / or intermediate-stage AMD, geographic atrophy (GA), glaucoma, Doyne honeycomb retinal dystrophy, paroxysmal nocturnal hemoglobinuria (PNH), atypical hemolytic uremic syndrome (aHUS), pre-eclampsia, rheumatoid arthritis (RA), and / or other complement-mediated diseases.

54. Use of an RNAi agent according to any one of claims 1 to 36 or a composition according to any one of claims 37 to 39 for preparing a pharmaceutical composition for treating a disease, disorder, or symptom that is at least partially mediated by a decrease in CFB gene expression.

55. The use according to any one of claims 52 to 54, wherein the RNAi agent is administered to a human subject at a dose of approximately 0.05 mg / kg to approximately 6.0 mg / kg of the human subject's body weight, or at a fixed dose of approximately 10 mg to approximately 400 mg.

Images