A molecular marker for diagnosing moyamoya disease and its primer pair, kit and application

Abstract

The present invention provides a molecular marker for diagnosing moyamoya disease, wherein the molecular marker is miR‑151a‑3p in peripheral blood exosomes, and belongs to the field of medical detection technology. The present invention selects miR‑151a‑3p in exosomes as a new blood molecular marker for moyamoya disease, which has the following advantages: 1) The number of exosomes in the peripheral blood of patients with moyamoya disease is significantly higher than that of healthy people, and the exosomes do not contain high-abundance proteins in the blood, which has little interference with detection and has higher sensitivity. 2) Exosomes encapsulate miRNAs with a lipid bilayer structure, so that the miRNAs transported by the exosomes are protected from degradation by RNases, thereby improving the stability of the exosomes in the blood. 3) Blood specimens are easy to obtain, easy to detect and standardize the production of kits. 4) The miR‑151a‑3p in the peripheral blood exosomes of the present invention has strong specificity and high sensitivity in diagnosing moyamoya disease.

Description

Technical Field

[0001] The present invention relates to the field of medical detection technology, and in particular to a molecular marker for diagnosing moyamoya disease and a primer pair, a kit and application thereof. Background Art

[0002] Moyamoya disease is a cerebrovascular disease of unknown etiology, characterized by chronic progressive stenosis or occlusion of the bilateral internal carotid artery terminals and the anterior cerebral artery and the beginning of the middle cerebral artery, followed by the formation of an abnormal vascular network at the skull base. Because this abnormal vascular network at the skull base looks like "smoke" on cerebral angiography images, it is called "moyamoya disease". Moyamoya disease has an insidious onset, with transient ischemic attacks as the main symptom in the early stage and cerebral infarction or cerebral hemorrhage as the main symptom in the later stage. The disability and mortality rates are high. Currently, there is no early screening method for the disease. Therefore, it is particularly important to identify the cause and make an early diagnosis.

[0003] Cerebral angiography is considered the gold standard for diagnosing moyamoya disease, but it is expensive and invasive, making it difficult to meet the needs of early clinical screening. Therefore, developing a molecular marker with strong specificity and high sensitivity for diagnosing moyamoya disease is of great significance for the treatment and early detection of moyamoya disease. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular marker for diagnosing moyamoya disease with high sensitivity and strong specificity, as well as a primer pair, a kit and application thereof.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a molecular marker for diagnosing moyamoya disease. The molecular marker is miR-151a-3p in peripheral blood exosomes. The nucleotide sequence of the miR-151a-3p is shown in SEQ ID NO:1.

[0007] The present invention also provides a primer pair for the above molecular marker, wherein the primer pair for the molecular marker is an upstream primer for amplifying miR-151a-3p as shown in SEQ ID NO:2 and a downstream primer for amplifying miR-151a-3p as shown in SEQ ID NO:3.

[0008] The present invention also provides the use of the above molecular marker or the above primer pair in the preparation of a product for diagnosing moyamoya disease.

[0009] Preferably, the product comprises a kit, a reagent, a chip or a test strip.

[0010] Preferably, when the relative expression content of miR-151a-3p in peripheral blood exosomes is less than 1.81, it indicates that the patient does not suffer from moyamoya disease, and when the expression content of miR-151a-3p in peripheral blood exosomes is greater than or equal to 1.81, it indicates that the patient suffers from moyamoya disease.

[0011] The present invention also provides a kit for diagnosing moyamoya disease, comprising the above primer pair.

[0012] Preferably, the kit further comprises a peripheral blood exosome extraction reagent, a reverse transcription reagent, and a quantitative PCR reagent.

[0013] Compared with the prior art, the present invention has the following beneficial effects:

[0014] The present invention provides a molecular marker for diagnosing moyamoya disease, wherein the molecular marker is miR-151a-3p in peripheral blood exosomes. The present invention selects miR-151a-3p in exosomes as a new blood molecular marker for moyamoya disease, which has the following advantages: 1) The number of exosomes in the peripheral blood of patients with moyamoya disease is significantly higher than that of healthy people, and the exosomes do not contain high-abundance proteins in the blood, which has little interference with detection and has higher sensitivity. 2) Exosomes encapsulate miRNAs in a lipid bilayer structure, so that the miRNAs transported by the exosomes are protected from degradation by RNases, thereby improving the stability of the exosomes in the blood. 3) Blood specimens are easy to obtain, easy to detect and standardize the production of kits. 4) The miR-151a-3p in the peripheral blood exosomes of the present invention has strong specificity and high sensitivity in diagnosing moyamoya disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 A: Electron microscopy to observe the morphology of exosomes; B: Exosome size; C: Western Blot to detect the expression of exosome characteristic antigens CD9 and TSG101 and the expression of negative antigen Calnexin; D: Analysis of peripheral blood exosome concentrations in the moyamoya disease (MMD) group and the healthy control (Health) group;

[0016] Figure 2 The results of pPCR identification of miR-151a-3 in peripheral blood exosomes and peripheral blood plasma of patients with moyamoya disease and healthy controls;

[0017] Figure 3 This is the molecular ROC curve of miR-151a-3p. DETAILED DESCRIPTION

[0018] The present invention provides a molecular marker for diagnosing moyamoya disease. The molecular marker is miR-151a-3p in peripheral blood exosomes. The nucleotide sequence of the miR-151a-3p is CTAGACTGAAGCTCCTTGAGG (as shown in SEQ ID NO: 1).

[0019] In the present invention, the peripheral blood exosome extraction method preferably includes ultracentrifugation method and kit extraction method.

[0020] The present invention also provides a primer pair for the above molecular marker, wherein the primer pair comprises an upstream primer 5'-GGGCAACCTAGACTGAAGCTC-3' (as shown in SEQ ID NO: 2) for amplifying miR-151a-3p and a downstream primer 5'-GTGCGTGTCGTGGAGTCG-3' (as shown in SEQ ID NO: 3) for amplifying miR-151a-3p.

[0021] The present invention also provides the use of the above molecular marker or the above primer pair in the preparation of a product for diagnosing moyamoya disease.

[0022] In the present invention, the product preferably includes a kit, a reagent, a chip or a test strip.

[0023] In the present invention, the relative expression of miR-151a-3p in the peripheral blood exosomes in the sample is used as the judgment standard to determine whether the patient suffers from moyamoya disease, and miR-425-5p is used as the internal reference. When the relative expression of miR-151a-3p in the peripheral blood exosomes is less than 1.81, it indicates that the patient does not suffer from moyamoya disease, and when the relative expression of miR-151a-3p in the peripheral blood exosomes is greater than or equal to 1.81, it indicates that the patient suffers from moyamoya disease. In the present invention, the kit also preferably includes a peripheral blood exosome extraction reagent, a reverse transcription reagent, and a quantitative PCR reagent.

[0024] The technical solutions in the present invention will be described clearly and completely below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0025] The experimental studies on patients with moyamoya disease and healthy patients involved in the following examples were approved by the Ethics Committee of the Affiliated Hospital of Jining Medical College, and were agreed by the patients and their families, who signed informed consent forms.

[0026] The inclusion criteria for moyamoya disease in the following embodiments are: ① All patients were diagnosed with moyamoya disease by cerebral angiography; ② were younger than 60 years old; ③ had no comorbidities such as cerebral arteriosclerosis, and ruled out severe cardiopulmonary and other systemic diseases.

[0027] Example 1

[0028] Establishment of clinical blood specimen and peripheral blood exosome experimental database

[0029] A total of 20 patients with moyamoya disease were selected for the study. At the same time, 10 healthy controls with similar physical conditions such as age, admission time, and weight to the moyamoya disease patients were selected. Blood samples were collected from the patients with moyamoya disease, and detailed medical records were recorded, including age, gender, site of disease, degree of stenosis, and follow-up data.

[0030] Collect peripheral blood samples: Use sodium heparin anticoagulant tubes or EDTA anticoagulant tubes to collect whole blood, and separate peripheral blood as soon as possible: centrifuge at 3000rpm at room temperature for 10min (blood samples must be centrifuged within 1h after being placed at room temperature after collection; blood samples must be centrifuged within 2h after being placed on ice after collection), take the upper layer, dispense 0.2mL / tube into 1.5mL centrifuge tubes, and freeze at -80℃.

[0031] Extraction of peripheral blood exosomes: The method of the exosome extraction kit (Shanghai Yumeibo Biotechnology Co., Ltd., catalog number UR52136) was used for extraction:

[0032] (1) Sample pretreatment

[0033] ① Centrifugation to remove cell debris: Centrifuge at 3000g for 10 min at 4°C to remove cell debris and other impurities, and transfer the centrifugal supernatant after removing cell debris to a new centrifuge tube;

[0034] ② Centrifugation to remove impurities: Centrifuge the transferred supernatant at 10,000 g for 10 min at 4°C to remove impurities in the sample, and transfer the supernatant to a new centrifuge tube.

[0035] (2) Extraction of exosomes

[0036] ① Pretreatment of supernatant: Add pre-cooled 1×PBS to the centrifugal supernatant after removing impurities for dilution, and then add Blood PureExo Solution (BPS); the specific dosage is shown in Table 1 (Note: other dosage specifications should be converted according to the proportion of the reagent dosage in the table).

[0037] Table 1 Reagents and their contents used in peripheral blood pretreatment

[0038] Sample name Sample dosage PBS dosage BPS Dosage peripheral blood 1.0mL 3.0mL 1.0mL

[0039] ②Solution mixing: After adding BPS reagent, cover the centrifuge tube tightly, mix it by vortexing for 1 minute, and then place it at 4℃ for 2 hours;

[0040] ③ Precipitate exosomes: Take out the centrifuge tube containing the mixed solution and centrifuge it at 10000g for 60 minutes at 4°C, discard the supernatant, and the precipitate is rich in exosome particles;

[0041] ④ Resuspend the exosomes: Take 1×PBS and blow the centrifugal precipitate evenly, where the volume ratio of 1×PBS to centrifugal precipitate is 1:2. After it is dissolved, transfer the resuspended liquid to a new 1.5mL centrifuge tube;

[0042] ⑤ Harvesting exosome particles: Centrifuge the 1.5 mL centrifuge tube containing the resuspension at 12000 g for 2 min at 4°C and retain the supernatant, which is rich in exosome particles.

[0043] (3) Purification of exosomes

[0044] ① Purify exosomes: transfer the harvested crude exosome particles into the upper chamber of the Exosome Purification Filter (EPF column), centrifuge at 3000g for 10 min at 4°C, and collect the liquid at the bottom of the EPF column after centrifugation. This liquid is the purified exosome particles;

[0045] ② Preservation of exosomes: The purified exosomes were packaged into 50-100 μL portions and stored at -80°C for subsequent experiments.

[0046] Identification of exosomes and determination of their content

[0047] 1. Observe the general morphology of exosomes and their surface markers using transmission electron microscopy: Take a uniformly suspended exosome solution, negatively stain it with 3% phosphotungstic acid solution, and observe the exosome morphology under an electron microscope;

[0048] 2. Use Nanosight visual nanoparticle analyzer to detect exosome concentration and size;

[0049] 3. Western-blot detection of the expression of CD9 and TSG101 marker protein molecules in peripheral blood exosomes;

[0050] Depend on Figure 1 The results showed that the morphology of peripheral blood exosomes observed by electron microscopy was "tray-shaped" ( Figure 1 A in the figure); the particle size is concentrated between 40 and 150 nm ( Figure 1 B); Western Blot detected that the isolated peripheral blood exosomes expressed characteristic antigens CD9 and TSG101, but did not express Calnexin ( Figure 1The concentration of exosomes in peripheral blood of patients with moyamoya disease was significantly higher than that of healthy controls ( Figure 1 D).

[0051] Example 2

[0052] In this example, a kit for detecting moyamoya disease according to the present invention was assembled based on the primer pair of miR-151a-3p.

[0053] The kit for detecting moyamoya disease of the present invention is composed of the following:

[0054] 1) RNA extraction reagents:

[0055]

[0056] 2) Reverse transcription reagents:

[0057]

[0058]

[0059] 3) Quantitative PCR reagents:

[0060]

[0061] 4) The sequences of the primer pair for amplifying the molecular marker miR-151a-3p are as shown in SEQ ID NO:2, 5'-GGGCAACCTAGACTGAAGCTC-3' and as shown in SEQ ID NO:3, 5'-GTGCGTGTCGTGGAGTCG-3';

[0062] 5) The healthy cDNA of the control group was used as the negative control group and was tested together with the cDNA of the test sample by quantitative PCR. The cDNA of each reaction system was the same as that of the test sample.

[0063] Evaluation of the diagnostic efficacy of miR-151a-3p in peripheral blood exosomes: In this example, 20 patients with moyamoya disease were selected from the Affiliated Hospital of Jining Medical College, and 10 healthy control groups with similar physical conditions such as age, admission time, and weight as those of the moyamoya disease patients were collected and selected. The method for detecting the expression level of miR-151a-3p in moyamoya disease patients includes the following steps:

[0064] 1) Extraction of total RNA from peripheral blood plasma and exosomes of patients with moyamoya disease and healthy controls: Total RNA was extracted according to the Trizol method to extract peripheral blood plasma and exosome RNA;

[0065] 2) cDNA synthesis: cDNA was synthesized using a miRNA first-strand cDNA synthesis kit. The reverse transcription primer sequence of miR-151a-3p was as shown in SEQ ID NO: 4, specifically as follows: GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACCCTCAAG; the internal reference miR-425-5p, the reverse transcription primer sequence of miR-425-5p was as shown in SEQ ID NO: 5, specifically as follows: GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACTCAACG; the following reverse transcription reagents were added sequentially into an RNase-free centrifuge tube. The reverse transcription system was as follows: dNTP (2.5 mM each) 2.0 μL, 10×RT Buffer 2.0 μL, Total RNA 250 ng, 1 μM RT specific primer 0.3 μL, M-MulV Reverse Transcriptase (200 U / μL) 0.2 μL, RNAse Inhibitor (40u / μL) 0.3μL, RNase-free water up to 20μL, the reaction mixture was incubated at 16℃ for 30min, 42℃ for 40min, heated at 85℃ for 5min to inactivate the enzyme, and stored at 4℃;

[0066] 3) MiRNAs RT-qPCR amplification: The MiRNA RT-qPCR amplification system was ddH2O 2μL, MasterMix 5.0μL, template DNA 2.0μL, 10μM upstream primer 0.5μL, 10μM downstream primer 0.5μL; the sequences of the primer pair for amplifying molecular markers were as shown in SEQ ID NO:2 5'-GGGCAACCTAGACTGAAGCTC-3' and SEQ ID NO:3 5'-GTGCGTGTCGTGGAGTCG-3'; the internal reference miR-425-5p, the sequences of the primer pair for amplifying miR-425-5p were as shown in SEQ ID NO:6 and SEQ ID NO:7, specifically as follows: 5'-GGGGAATGACACGATCACTC-3' (SEQ ID NO:6), 5'-GTGCGTGTCGTGGAGTCG-3' (SEQ ID NO:7); MiRNAs RT-qPCR amplification program: 95°C, 10 min; 40 PCR cycles (95°C, 10 sec; 60°C, 60 sec (collecting fluorescence)).

[0067] 4) Identification: After amplification, use 2 -ΔΔCT Methods Analysis of gene expression.

[0068] Depend on Figure 2 The results showed that in the case of exosome transport, miR-151a-3p was upregulated in 20 patients with moyamoya disease, and the relative expression levels of miR-151a-3p in peripheral blood exosomes of 20 patients with moyamoya disease were greater than or equal to 1.81, and the relative expression levels of miR-151a-3p in peripheral blood exosomes of 10 healthy people were less than 1.81, indicating the accuracy of the kit detection. It also further shows that if the relative expression levels of miR-151a-3p molecular markers in peripheral blood exosomes are greater than or equal to 1.81, then the patient suffers from moyamoya disease, and if the relative expression levels of miR-151a-3p in peripheral blood exosomes are less than 1.81, then the patient does not suffer from moyamoya disease.

[0069] Depend on Figure 2 The results showed that in the absence of exosome transport, there was no difference in the expression of miR-151a-3p in the peripheral whole plasma between the moyamoya disease patient group and the healthy control group, suggesting that miR-151a-3p can only demonstrate its diagnostic efficacy when it is specifically enriched and transported in exosomes.

[0070] Example 3

[0071] Specificity and sensitivity of miR-151a-3p in peripheral blood exosomes for diagnosing moyamoya disease

[0072] Patients with moyamoya disease diagnosed by cerebral angiography and healthy controls were selected, and the content of "miR-151a-3p" in peripheral blood exosomes of patients with moyamoya disease (20 cases) and healthy controls (10 cases) was detected by the quantitative RT-PCR method described in Example 2. The receiver operating characteristic curve (ROC curve) and the area under the curve (AUC) value were plotted using SPSS software, and the point close to the upper left corner was taken as the optimal diagnostic critical value.

[0073] Depend on Figure 3 It can be seen that the AUC value of miR-151a-3p is 1, indicating that miR-151a-3p has the highest specificity and sensitivity, and the test specimen results show that the diagnostic efficacy is close to 100%.

[0074] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention. Sequence Listing <110> The Affiliated Hospital of Jining Medical College <120> A molecular marker for diagnosing moyamoya disease and its primer pair, kit and application <160> 7 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <400> 1 ctagactgaa gctccttgag g 21 <210> 2 <211> twenty one <212> DNA <213> Artificial Sequence <400> 2 gggcaaccta gactgaagct c 21 <210> 3 <211> 18 <212> DNA <213> Artificial Sequence <400> 3 gtgcgtgtcg tggagtcg 18 <210> 4 <211> 55 <212> DNA <213> Artificial Sequence <400> 4 gtcgtatcca gtgcgtgtcg tggagtcggc aattgcactg gatacgaccc tcaag 55 <210> 5 <211> 54 <212> DNA <213> Artificial Sequence <400> 5 gtcgtatcca gtgcgtgtcg tggagtcggc aattgcactg gatacgactc aacg 54 <210> 6 <211> 20 <212> DNA <213> Artificial Sequence <400> 6 ggggaatgac acgatcactc 20 <210> 7 <211> 18 <212> DNA <213> Artificial Sequence <400> 7 gtgcgtgtcg tggagtcg 18

Claims

1. Application of a primer pair for detecting the expression of miR-151a-3p in peripheral blood exosomes in the preparation of a product for diagnosing moyamoya disease.

2. The use according to claim 1, characterized in that: The primer pair is an upstream primer for amplifying miR-151a-3p as shown in SEQ ID NO: 2 and a downstream primer for amplifying miR-151a-3p as shown in SEQ ID NO:

3.

3. The use according to claim 1, characterized in that: The product is a test kit.

4. The use according to claim 3, characterized in that: The kit also includes a peripheral blood exosome extraction reagent, a reverse transcription reagent, and a quantitative PCR reagent.

Images