Anti-EGFR and cMet bispecific chimeric antigen receptor and its application

Abstract

The present invention provides an anti-EGFR and cMet bispecific chimeric antigen receptor and its application. Specifically, the present invention provides an immune cell expressing a first CAR and a second CAR, wherein the first CAR targets a first tumor cell marker, and the second CAR targets a second tumor cell marker. The first CAR and the second CAR of the present invention simultaneously recognize corresponding tumor cell markers, and immune cells can be fully activated, the targeting specificity is enhanced, the anti-tumor efficacy is exerted, and the on-target / off-tumor toxicity is reduced, thereby improving the safety of cell therapy.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology. Specifically, the present invention relates to an anti-EGFR and cMet bispecific chimeric antigen receptor and its application. Background Art

[0002] T cells genetically engineered to express chimeric antigen receptors (CARs) have been shown to have therapeutic effects on patients with certain B-cell leukemia or lymphoma subtypes, and have also shown potential efficacy in patients with multiple myeloma. Currently, three CAR T drugs have been approved, namely Yescarta for the treatment of large B-cell lymphoma and follicular lymphoma, Tecartus for the treatment of mantle cell lymphoma, and Kymriah for the treatment of large B-cell lymphoma and acute lymphoblastic leukemia in children and young people. CAR molecules include three main structural components, namely, the extracellular antigen binding functional domain; the transmembrane domain, which is used to transmit antigen recognition signals; and the intracellular signal transduction domain. The first generation of CAR only contains the CD3ζ activation signal. Due to the lack of the co-stimulatory signal functional domain, CAR T cells cannot be fully activated, show limited cytotoxicity, and cannot be effectively expanded or persisted in vivo. The second generation of CAR also introduces the co-stimulatory functional domain of CD28 or 4-1BB, which enhances the cytotoxicity of CAR T and improves its persistence. Currently, all CAR T cell products on the market adopt the second-generation design. By adding another co-stimulatory domain, such as OX40, ICOS, CD27, etc., the third-generation CAR is further expanded on the basis of the second generation. Although it is reported to have stronger persistence, it may induce excessive release of cytokines, and its clinical efficacy has not been verified. In order to expand the efficacy of CAR T and apply it to a wider range of malignant tumors, especially solid tumors, CAR T needs to be innovatively engineered.

[0003] During CAR T cell therapy, there are many adverse reactions, such as cytokine release syndrome (CRS), neurological toxicity, on-target off-tumor toxicity, and tumor lysis syndrome. Among them, CRS is systemic and can affect all organs of the body. It is the most frequent and most symptomatic acute adverse reaction. Effective management and intervention of CRS is required in clinical practice. In addition to high expression of tumor-associated antigens in tumor cells, they are also non-specifically expressed at low levels in normal tissues or cells, such as CD19, Her2, ROR1, Muc1, etc. Target toxicity means that CAR T cells are activated by recognizing antigens expressed by normal tissues and cause damage to normal tissues. In the treatment of CD19-positive malignant lymphoma, CAR T has B cell progenitor cells expressing CD19 in the bone marrow, which are cleared together with tumor cells, resulting in B cell dysplasia and decreased hemoglobin. Clinically, immunoglobulin is infused to replace the antibody function produced by B cells. In a clinical trial of CAR T cells targeting carbonic anhydrase IX for the treatment of renal cancer, several patients developed abnormal liver enzymes. These adverse reactions were attributed to the infiltration of CAR T cells and their action on the bile duct epithelium expressing carbonic anhydrase. A patient with colorectal cancer suffered fatal lung damage after receiving an infusion of CAR T cells targeting Her2, because the lung epithelial cells also expressed low levels of Her2. In addition, similar pulmonary edema toxicity also occurred in a clinical trial of CART targeting EGFRvIII for the treatment of glioma. Because single-targeted CAR T cells may cause target toxicity, it is currently difficult to accurately judge through in vitro screening methods such as IHC or tissue chips.

[0004] Therefore, there is an urgent need in this field to develop a new type of chimeric antigen receptor T cell that can recognize multiple antigens at the same time, enhance targeting specificity, exert anti-tumor efficacy, and reduce on-target / off-tumor toxicity and improve the safety of cell therapy. Summary of the invention

[0005] The purpose of the present invention is to provide a new type of chimeric antigen receptor T cell that can recognize multiple antigens at the same time, enhance targeting specificity, exert anti-tumor efficacy, reduce on-target / off tumor toxicity, and improve the safety of cell therapy.

[0006] According to a first aspect of the present invention, an engineered immune cell is provided, wherein the engineered immune cell expresses a first CAR and a second CAR, wherein the first CAR targets a first tumor cell marker, and the second CAR targets a second tumor cell marker, wherein the first tumor cell marker is selected from the following group: cMet, Her2, Her3, Muc1, ROR1, PD-L1, CD47, or a combination thereof; and the second tumor cell marker is selected from the following group: EGFR, EpCAM, Her2, Her3, or a combination thereof.

[0007] In another preferred example, the immune cell contains a first CAR and a second CAR.

[0008] In another preferred embodiment, the immune cells are NK cells, macrophages or T cells, preferably T cells.

[0009] In another preferred example, the first CAR and the second CAR are located on the cell membrane of the immune cell.

[0010] In another preferred example, the first CAR and the second CAR contain antigen binding domains targeting tumor cell markers.

[0011] In another preferred embodiment, the antigen binding domain is an antibody or an antigen binding fragment.

[0012] In another preferred embodiment, the antigen-binding fragment is Fab or scFv or single-domain antibody sdFv.

[0013] In another preferred embodiment, the structure of the first CAR is as shown in Formula I:

[0014] L1-S1-H1-TM1-C1-CD3ζ (I)

[0015] In the formula, the "-" is a connecting peptide or a peptide bond;

[0016] L1 is none or the first signal peptide sequence;

[0017] S1 is an antigen binding domain targeting a first tumor cell marker, wherein the first tumor cell marker is selected from the group consisting of cMet, Her2, Her3, Muc1, ROR1, PD-L1, CD47, or a combination thereof;

[0018] H1 is none or the first hinge region;

[0019] TM1 is the first transmembrane domain;

[0020] C1 is the absence or first co-stimulatory signal molecule;

[0021] CD3ζ is a cytoplasmic signaling sequence derived from CD3ζ.

[0022] In another preferred embodiment, the antigen binding domain targeting the first tumor cell marker comprises an antibody single chain variable region sequence targeting the tumor cell marker.

[0023] In another preferred embodiment, the structure of the single-chain variable region sequence of the antibody targeting the first tumor cell marker is as shown in Formula A1 or A2:

[0024] V H1 -V L1 (A1); or

[0025] V L1 -V H1 (A2);

[0026] Among them, V L1 V is the light chain variable region of the antibody against the first tumor cell marker; H1 is the heavy chain variable region of the antibody against the first tumor cell marker; "-" is a connecting peptide (or flexible linker) or a peptide bond.

[0027] In another preferred embodiment, the V L1 and V H1 Connected by flexible joints.

[0028] In another preferred embodiment, the flexible linker is a sequence represented by 1-5 (preferably 2-4) consecutive GGGGS.

[0029] In another preferred embodiment, the amino acid sequence of the flexible linker is shown in positions 120-134 of SEQ ID NO.:1.

[0030] In another preferred embodiment, V L1 The amino acid sequence is shown in SEQ ID NO.: 1 at positions 135 to 247, and V H1 The amino acid sequence is shown at positions 1 to 119 of SEQ ID NO.: 1.

[0031] In another preferred embodiment, the sequence of the single-chain variable region of the antibody targeting the first tumor cell marker is shown as SEQ ID NO.:1.

[0032] In another preferred example, the amino acid sequence of the first CAR is as shown in any one of SEQ ID NO.: 2-4.

[0033] In another preferred embodiment, the structure of the second CAR is as shown in Formula II:

[0034] L2-S2-H2-TM2-C2-Z2 (II)

[0035] In the formula, the "-" is a connecting peptide or a peptide bond;

[0036] L2 is none or a second signal peptide sequence;

[0037] S2 is an antigen binding domain targeting a second tumor cell marker, wherein the second tumor cell marker is selected from the group consisting of EGFR, EpCAM, Her2, Her3, or a combination thereof;

[0038] H2 is none or the second hinge region;

[0039] TM2 is the second transmembrane domain;

[0040] C2 is the second co-stimulatory signal molecule;

[0041] Z2 is absent or derived from the cytoplasmic signaling sequence of CD3ζ.

[0042] In another preferred example, the antigen binding domain targeting the second tumor cell marker comprises an antibody single chain variable region sequence targeting the tumor cell marker.

[0043] In another preferred embodiment, the structure of the single-chain variable region sequence of the antibody targeting the second tumor cell marker is as shown in Formula A3 or A4:

[0044] V H2 -V L2 (A3); or

[0045] V L2 -V H2 (A4);

[0046] Among them, V L2 V is the light chain variable region of the antibody against the second tumor cell marker; H2 is the heavy chain variable region of the antibody against the second tumor cell marker; “-” is a connecting peptide (or flexible linker) or a peptide bond.

[0047] In another preferred embodiment, the V L2 and V H2 Connected by flexible joints.

[0048] In another preferred embodiment, the flexible linker is a sequence represented by 1-5 (preferably 2-4) consecutive GGGGS.

[0049] In another preferred embodiment, the amino acid sequence of the flexible linker is shown in positions 120-134 of SEQ ID NO.:5.

[0050] In another preferred embodiment, the amino acid sequence of the flexible linker is shown in positions 120-134 of SEQ ID NO.:6.

[0051] In another preferred embodiment, V L2 The amino acid sequence is shown in SEQ ID NO.: 5 at positions 135 to 241, and V H2 The amino acid sequence is shown at positions 1 to 119 of SEQ ID NO.:5.

[0052] In another preferred embodiment, V L2 The amino acid sequence is shown in SEQ ID NO.: 6 at positions 135 to 241, and V H2 The amino acid sequence is shown at positions 1 to 119 of SEQ ID NO.:6.

[0053] In another preferred embodiment, the sequence of the single-chain variable region of the antibody targeting the second tumor cell marker is as shown in SEQ ID NO.: 5 or 6.

[0054] In another preferred example, the amino acid sequence of the second CAR is as shown in any one of SEQ ID NOs.: 7-14.

[0055] In another preferred embodiment, the antibody single-chain variable region sequence targeting the first or second tumor cell marker is a mouse, human, human and mouse chimeric, or fully humanized single-chain antibody variable region fragment.

[0056] In another preferred embodiment, L1 and L2 are each independently a signal peptide of a protein selected from the following group: CD8a, CD8, CD28, GM-CSF, CD4, CD137, or a combination thereof.

[0057] In another preferred embodiment, the L1 is a signal peptide derived from CD8a.

[0058] In another preferred embodiment, the L2 is a signal peptide derived from CD8a.

[0059] In another preferred example, the amino acid sequences of L1 and L2 are independently shown as SEQ ID NO.:15.

[0060] In another preferred embodiment, H1 and H2 are each independently a hinge region of a protein selected from the following group: CD8, Ig (immunoglobulin) hinge, or a combination thereof.

[0061] In another preferred embodiment, the H1 and H2 are each independently a hinge region derived from CD8.

[0062] In another preferred example, the amino acid sequences of H1 and H2 are independently shown as SEQ ID NO.:16.

[0063] In another preferred embodiment, TM1 and TM2 are each independently a transmembrane region of a protein selected from the following group: CD8, CD28, CD8a, CD33, CD37, CD8α, CD5, CD16, ICOS, CD9, CD22, CD134, CD137, CD154, CD19, CD45, CD4, CD3ε, or a combination thereof.

[0064] In another preferred embodiment, the TM1 and TM2 are transmembrane regions derived from CD8.

[0065] In another preferred embodiment, the TM2 is a transmembrane region derived from CD28.

[0066] In another preferred example, the amino acid sequences of TM1 and TM2 are shown in SEQ ID NO.:17.

[0067] In another preferred embodiment, the amino acid sequence of TM2 is shown in SEQ ID NO.:18.

[0068] In another preferred embodiment, C1 and C2 are each independently a co-stimulatory signal molecule of a protein selected from the following group: CD28, 4-1BB (CD137), CD30, CD40, CD70, CD134, LIGHT, DAP10, CDS, ICAM-1, OX40, or a combination thereof.

[0069] In another preferred embodiment, the C1 is absent; or a costimulatory signal molecule derived from CD28 and / or 4-1BB.

[0070] In another preferred embodiment, the C2 is a co-stimulatory signal molecule derived from CD28 and / or 4-1BB.

[0071] In another preferred example, the amino acid sequences of C1 and C2 are independently shown as SEQ ID NO.: 19.

[0072] In another preferred example, the amino acid sequences of C1 and C2 are each independently shown as SEQ ID NO.: 20.

[0073] In another preferred example, the amino acid sequence of CD3ζ is shown in SEQ ID NO.:21.

[0074] The second aspect of the present invention provides a method for preparing the engineered immune cell according to the first aspect of the present invention, comprising the following steps:

[0075] (A) providing an immune cell to be modified; and

[0076] (B) Transforming the immune cells so that the immune cells express a first CAR and a second CAR, wherein the first CAR targets a first tumor cell marker and the second CAR targets a second tumor cell marker, thereby obtaining the engineered immune cells described in the first aspect of the present invention.

[0077] In another preferred embodiment, step (A) further includes isolating and / or activating the immune cells to be modified.

[0078] In another preferred embodiment, in step (B), it includes (B1) introducing a first expression cassette expressing a first CAR targeting the first tumor cell marker into the immune cell; and (B2) introducing a second expression cassette expressing a second CAR targeting a second tumor cell marker into the immune cell; wherein the step (B1) can be performed before, after, simultaneously with, or alternately with step (B2).

[0079] In another preferred embodiment, in step (B), the first expression cassette and / or the second expression cassette is introduced into the nucleus of the immune cell.

[0080] In another preferred embodiment, when the immune cells to be modified in step (A) already express the first CAR and the second CAR, step (B) can be omitted.

[0081] In another preferred embodiment, the immune cells are NK cells, macrophages or T cells.

[0082] In another preferred example, the first expression cassette contains a nucleic acid sequence encoding the first CAR.

[0083] In another preferred example, the second expression cassette contains a nucleic acid sequence encoding the second CAR.

[0084] In another preferred embodiment, the first expression cassette and the second expression cassette are located on the same or different vectors.

[0085] In another preferred embodiment, the first expression cassette and the second expression cassette are located in the same vector.

[0086] In another preferred embodiment, the first expression cassette and the second expression cassette are located in different vectors.

[0087] In another preferred embodiment, the vector is a viral vector.

[0088] In another preferred embodiment, the vector is selected from the following group: DNA, RNA, plasmid, lentiviral vector, adenoviral vector, retroviral vector, transposon, other gene transfer systems, or a combination thereof.

[0089] In another preferred embodiment, the vector is a lentiviral vector.

[0090] In another preferred embodiment, the method further comprises the step of testing the function and effectiveness of the obtained engineered immune cells.

[0091] The third aspect of the present invention provides a preparation, which contains the engineered immune cells described in the first aspect of the present invention, and a pharmaceutically acceptable carrier, diluent or excipient.

[0092] In another preferred embodiment, the preparation is a liquid preparation.

[0093] In another preferred embodiment, the dosage form of the preparation includes injection.

[0094] In another preferred embodiment, the concentration of the engineered immune cells in the preparation is 1×10 3 -1×10 8 cells / ml, preferably 1×10 4 -1×10 7 cells / ml.

[0095] In another preferred embodiment, the preparation also contains other drugs for treating cancer or tumors (such as emerging antibody drugs, other CAR-T drugs or chemotherapy drugs).

[0096] The fourth aspect of the present invention provides a use of the engineered immune cells as described in the first aspect of the present invention for preparing a drug or preparation for selectively killing tumors.

[0097] In another preferred embodiment, the tumor includes a tumor that highly expresses tumor cell markers (such as EGFR, cMet, Her2, Her3, Muc1, ROR1, PD-L1, CD47, EpCAM).

[0098] In another preferred embodiment, the tumor includes a tumor that simultaneously expresses tumor cell markers (such as EGFR, cMet, Her2, HER3).

[0099] In another preferred embodiment, the tumor includes a tumor that expresses both EGFR and cMet.

[0100] In another preferred embodiment, the tumor is selected from the following group: a blood tumor, a solid tumor, or a combination thereof. Preferably, the tumor is a solid tumor.

[0101] In another preferred embodiment, the blood tumor is selected from the following group: acute myeloid leukemia, acute lymphocytic leukemia, acute monocytic leukemia, acute granulocytic leukemia, acute myeloid-monocytic leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloid leukemia, lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, multiple myeloma (MM), myelodysplastic syndrome, or a combination thereof.

[0102] In another preferred embodiment, the tumor comprises a solid tumor.

[0103] In another preferred embodiment, the solid tumor is selected from the group consisting of prostate cancer, liver cancer, head and neck cancer, melanoma, non-Hodgkin's lymphoma, bladder cancer, glioblastoma, cervical cancer, lung cancer, chondrosarcoma, thyroid cancer, kidney cancer, mesothelioma, osteosarcoma, bile duct cancer, ovarian cancer, gastric cancer, bladder cancer, meningioma, pancreatic cancer, multiple squamous cell neoplasia, esophageal cancer, small cell lung cancer, colorectal cancer, breast cancer, medulloblastoma, breast cancer, nasopharyngeal carcinoma, thymic carcinoma, or a combination thereof.

[0104] The fifth aspect of the present invention provides a kit for selectively killing tumors, the kit comprising a container, and:

[0105] (1) a first nucleic acid sequence, wherein the first nucleic acid sequence contains a first expression cassette for expressing a first CAR targeting a first tumor cell marker, wherein the first tumor cell marker is selected from the following group: cMet, Her2, Her3, Muc1, ROR1, PD-L1, CD47, or a combination thereof; and

[0106] (2) a second nucleic acid sequence, wherein the second nucleic acid sequence contains a second expression cassette of a second CAR targeting a second tumor cell marker, wherein the second tumor cell marker is selected from the following group: EGFR, EpCAM, Her2, Her3, or a combination thereof.

[0107] In another preferred embodiment, the first and second nucleic acid sequences are independent or connected.

[0108] In another preferred embodiment, the first and second nucleic acid sequences are located in the same or different containers.

[0109] In another preferred embodiment, the first and second nucleic acid sequences are located on the same or different vectors.

[0110] In another preferred embodiment, the first and second nucleic acid sequences are located in the same vector.

[0111] The sixth aspect of the present invention provides a method for selectively killing tumors, comprising:

[0112] A safe and effective amount of the engineered immune cells described in the first aspect of the present invention or the preparation described in the third aspect of the present invention is administered to a subject in need of treatment.

[0113] In another preferred embodiment, the subject includes a human or a non-human mammal.

[0114] In another preferred embodiment, the non-human mammals include rodents (such as mice, rats, rabbits) and primates (such as monkeys).

[0115] In another preferred embodiment, the method is non-therapeutic and non-diagnostic.

[0116] The seventh aspect of the present invention provides a method for treating a disease, comprising administering a safe and effective amount of the engineered immune cells described in the first aspect of the present invention, or the preparation described in the third aspect of the present invention to a subject in need of treatment.

[0117] In another preferred embodiment, the method further comprises administering other drugs for treating cancer or tumors to the subject in need of treatment.

[0118] In another preferred embodiment, the other drugs include CAR-T drugs.

[0119] In another preferred embodiment, the disease is cancer or tumor.

[0120] In another preferred embodiment, the tumor includes a tumor that highly expresses tumor cell markers (such as EGFR, cMet, HER2, HER3, MUC1, ROR1, PD-L1, CD47).

[0121] In another preferred embodiment, the tumor includes a tumor that simultaneously expresses tumor cell markers (such as EGFR, cMet, EpCAM, HER2, HER3).

[0122] In another preferred embodiment, the tumor includes a tumor that expresses both EGFR and cMet.

[0123] In another preferred embodiment, the tumor is selected from the following group: a blood tumor, a solid tumor, or a combination thereof. Preferably, the tumor is a solid tumor.

[0124] In another preferred embodiment, the blood tumor is selected from the following group: acute myeloid leukemia, acute lymphocytic leukemia, acute monocytic leukemia, acute granulocytic leukemia, acute myeloid-monocytic leukemia, chronic lymphocytic leukemia, chronic myeloid leukemia, chronic myeloid leukemia, lymphoma, Hodgkin's lymphoma, non-Hodgkin's lymphoma, multiple myeloma (MM), myelodysplastic syndrome, or a combination thereof.

[0125] In another preferred embodiment, the tumor comprises a solid tumor.

[0126] In another preferred embodiment, the solid tumor is selected from the group consisting of prostate cancer, liver cancer, head and neck cancer, melanoma, non-Hodgkin's lymphoma, bladder cancer, glioblastoma, cervical cancer, lung cancer, chondrosarcoma, thyroid cancer, kidney cancer, mesothelioma, osteosarcoma, bile duct cancer, ovarian cancer, gastric cancer, bladder cancer, meningioma, pancreatic cancer, multiple squamous cell neoplasia, esophageal cancer, small cell lung cancer, colorectal cancer, breast cancer, medulloblastoma, breast cancer, nasopharyngeal carcinoma, thymic carcinoma, or a combination thereof.

[0127] The eighth aspect of the present invention provides a fusion protein, which comprises a first CAR targeting a first tumor cell marker and a second CAR targeting a second tumor cell marker, wherein the first tumor cell marker is selected from the following group: cMet, Her2, Her3, Muc1, ROR1, PD-L1, CD47, or a combination thereof; the second tumor cell marker is selected from the following group: EGFR, EpCAM, Her2, Her3, or a combination thereof.

[0128] In another preferred example, the first CAR and the second CAR are connected by a connecting peptide.

[0129] In another preferred embodiment, the connecting peptide comprises a self-cleaving protein.

[0130] In another preferred embodiment, the self-cleaving protein is selected from the following group: T2A, P2A, E2A, F2A, or a combination thereof.

[0131] In another preferred embodiment, the self-cleaving protein includes T2A.

[0132] In another preferred embodiment, the structure of the fusion protein is shown in the following formula III:

[0133] L1-S1-H1-TM1-C1-CD3ζ-Z3-L2-S2-H2-TM2-C2-Z2 (III)

[0134] In the formula,

[0135] Each "-" is independently a connecting peptide or a peptide bond;

[0136] L1 is none or the first signal peptide sequence;

[0137] L2 is none or a second signal peptide sequence;

[0138] S1 is an antigen binding domain targeting a first tumor cell marker, wherein the first tumor cell marker is selected from the group consisting of cMet, Her2, Her3, Muc1, ROR1, PD-L1, CD47, or a combination thereof;

[0139] S2 is an antigen binding domain targeting a second tumor cell marker, wherein the second tumor cell marker is selected from the group consisting of EGFR, EpCAM, Her2, Her3, or a combination thereof;

[0140] H1 is none or the first hinge region;

[0141] H2 is none or the second hinge region;

[0142] TM1 is the first transmembrane domain;

[0143] TM2 is the second transmembrane domain;

[0144] C1 is the absence or first co-stimulatory signal molecule;

[0145] C2 is the second co-stimulatory signal molecule;

[0146] CD3ζ is a cytoplasmic signaling sequence derived from CD3ζ;

[0147] Z2 is absent or derived from the cytoplasmic signaling sequence of CD3ζ;

[0148] Z3 is a connecting peptide.

[0149] In another preferred embodiment, the amino acid sequence of the fusion protein is shown in any one of SEQ ID NOs.: 22-25.

[0150] The ninth aspect of the present invention provides a polynucleotide encoding the fusion protein described in the eighth aspect of the present invention.

[0151] In another preferred embodiment, the polynucleotide is selected from the following group:

[0152] (a) a polynucleotide encoding a fusion protein as shown in any one of SEQ ID NOs.: 22-25;

[0153] (b) a polynucleotide whose sequence is shown in any one of SEQ ID NOs.: 26-29;

[0154] (c) a polynucleotide having a nucleotide sequence homologous to the sequence shown in (b) of ≥ 75% (preferably ≥ 80%);

[0155] (d) a polynucleotide having 1 to 60 (preferably 1 to 30, more preferably 1 to 10) nucleotides truncated or added to the 5' end and / or 3' end of the polynucleotide as shown in (b);

[0156] (e) A polynucleotide complementary to the polynucleotide described in any one of (a) to (d).

[0157] In another preferred embodiment, the polynucleotide sequence is shown in any one of SEQ ID NOs.: 26-29.

[0158] The tenth aspect of the present invention provides a vector, which comprises the polynucleotide described in the ninth aspect of the present invention.

[0159] In another preferred embodiment, the vector includes DNA and RNA.

[0160] In another preferred embodiment, the vector is selected from the following group: plasmid, viral vector, transposon, or a combination thereof.

[0161] In another preferred embodiment, the vector includes a DNA virus or a retroviral vector.

[0162] In another preferred embodiment, the vector is selected from the following group: a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a combination thereof.

[0163] In another preferred embodiment, the vector is a lentiviral vector.

[0164] In another preferred embodiment, the vector comprises one or more promoters, which are operably connected to the nucleic acid sequence, enhancer, intron, transcription termination signal, polyadenylation sequence, replication origin, selective marker, nucleic acid restriction site, and / or homologous recombination site.

[0165] In another preferred embodiment, the vector is a vector containing or inserted with the polynucleotide described in the ninth aspect of the present invention.

[0166] In another preferred embodiment, the vector is used to express the fusion protein described in the eighth aspect of the present invention.

[0167] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0168] FIG1 shows the composition of a bispecific "and" logic CAR (And logic BiCAR) targeting EGFR and cMet, including two independent CAR molecules, which are a CAR of an anti-cMet scFv in series with a CD3ζ activation signaling domain and a CAR of an anti-EGFR scFv in series with a 4-1BB or CD28 co-stimulatory signaling domain; Figure 1B Schematic diagram showing the molecular construct connections for BiCAR expression with “and” logic; Figure 1C The composition of the second-generation fully functional CAR targeting cMet is shown, with scFv in series with 4-1BB or CD28 and CD3ζ; Figure 1DThe composition of the second-generation fully functional CAR targeting EGFR is shown, with scFv tandem with 4-1BB or CD28 and CD3ζ.

[0169] Figure 2 shows the staining flow cytometric analysis of Mock T (2A), E-28 (2B), E-28z (2C), Mz (2D), M-28z (2E)CAR and “And” logic BiCAR T (2F) cells.

[0170] Figure 3 shows the in vitro cytolytic toxicity of Mock T, E-28, Mz, M-28z CAR and BiCAR T cells after incubation with 293T (3A), 293T stably expressing antigen EGFR (3B), cMet (3C), and 293T cell lines co-expressing EGFR / cMet (3D) for 24 hours. The ratio of CAR-T effector cells to target cells was 1:10, 1:3, 1:1 and 3:1, respectively.

[0171] Figure 4 shows the cytotoxicity of the in vitro secreted cytokine IFN-r after co-incubation of Mock T, E-28, Mz, M-28z CAR and BiCAR T cells with 293T, as well as 293T cell lines stably expressing EGFR, cMet, and EGFR / cMet co-expression for 24 hours under different effector-target ratios of 1:10 (4A), 1:3 (4B), 1:1 (4C), and 3:1 (4D).

[0172] Figure 5 shows the in vitro cytolytic toxicity of Mock T, Mz, M-28z, E-28z CAR and BiCAR T against normal human epidermal keratinocytes with overexpression of EGFR and low expression of cMet, with effector-target ratios of 1:10 (5A), 1:3 (5B), 1:1 (5C) and 3:1 (5D), respectively.

[0173] Figure 6 shows the lytic toxicity of Mock T, E-28, Mz, M-28z CAR and BiCAR T cells prepared from peripheral blood mononuclear cells (PBMC) of different healthy donors #1 (6A) and #2 (6B) to target cells after being incubated with SNU-5 human gastric cancer cell lines co-expressing EGFR and cMet for 24 hours in vitro under different effector-target ratios.

[0174] Figure 7 The results show that Mock T, E-28, Mz, M-28z CAR and BiCAR T cells were co-cultured with EGFR / cMet-overexpressing H1993 human lung adenocarcinoma cell line in vitro for 24 h, and their lytic toxicity to target cells was observed under different effector-target ratios of 1:10, 1:3, 1:1 and 3:1.

[0175] Figure 8 The data show that Mock T, E-28, Mz, M-28z CAR and BiCAR T cells prepared from PBMC were co-incubated with H1975 human lung adenocarcinoma cell lines co-expressing EGFR and cMet in vitro for 24 hours, and their lytic toxicity to target cells was observed under different effector-target ratios of 1:10, 1:3, 1:1, and 3:1.

[0176] Fig. 9 The results show that Mock T, E-28, Mz, M-28z CAR and BiCAR T cells prepared from PBMC were co-incubated with H820 human lung adenocarcinoma cell lines co-expressing EGFR / cMet in vitro for 24 hours, and their lytic toxicity to target cells was observed under different effector-target ratios of 1:10, 1:3, 1:1, and 3:1. DETAILED DESCRIPTION

[0177] After extensive and in-depth research, the inventor unexpectedly discovered for the first time that immune cells containing a first CAR targeting a first tumor cell marker (such as cMet, Her2, Her3, Muc1, ROR1, PD-L1, CD47) and a second CAR targeting a second tumor cell marker (such as EGFR, EpCAM, Her2, Her3) can be fully activated, enhance targeting specificity, exert anti-tumor efficacy, and reduce on-target / off-tumor toxicity, thereby improving the safety of cell therapy. On this basis, the inventor completed the present invention.

[0178] Terminology

[0179] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0180] As used herein, when used in reference to a specific recited numerical value, the term "about" means that the value may vary by no more than 1% from the recited value. For example, as used herein, the expression "about 100" includes all values ​​between 99 and 101 (e.g., 99.1, 99.2, 99.3, 99.4, etc.).

[0181] As used herein, the term "comprising" or "including (comprising)" may be open, semi-closed and closed. In other words, the term also includes "consisting essentially of" or "consisting of".

[0182] As used herein, a "chimeric antigen receptor (CAR)" is a fusion protein comprising an extracellular domain capable of binding to an antigen, a transmembrane domain derived from a different polypeptide than the extracellular domain, and at least one intracellular domain. "Chimeric Antigen Receptor (CAR)" is also known as a "chimeric receptor", "T-body" or "chimeric immune receptor (CIR)". The "extracellular domain capable of binding to an antigen" refers to any oligopeptide or polypeptide capable of binding to a certain antigen. "Intracellular domain" refers to any oligopeptide or polypeptide known as a domain that transmits signals to activate or inhibit intracellular biological processes.

[0183] As used herein, "domain" refers to a region of a polypeptide that is independent of other regions and folds into a specific structure.

[0184] As used herein, the terms "administer" and "treat" refer to the application of an exogenous drug, therapeutic agent, diagnostic agent or composition to an animal, human, subject, cell, tissue, organ or biological fluid. "Administer" and "treat" can refer to treatment, pharmacokinetics, diagnosis, research and experimental methods. Treatment of cells includes contact of an agent with a cell, and contact of an agent with a fluid, and contact of a fluid with a cell. "Administer" and "treat" also mean in vitro and ex vivo treatment by an agent, a diagnosis, a combination composition or by another cell. "Treatment" when applied to a human, animal or research subject refers to therapeutic treatment, prophylactic or preventive measures, research and diagnosis.

[0185] As used herein, the term "treatment" refers to administering an internal or external therapeutic agent to a patient, including any CAR of the present invention and its composition, wherein the patient has one or more disease symptoms, and the therapeutic agent is known to have a therapeutic effect on these symptoms. Typically, the amount of the therapeutic agent (therapeutically effective amount) that effectively alleviates one or more disease symptoms is administered to the patient.

[0186] As used herein, the term "optional" or "optionally" means that the event or situation described subsequently may occur but need not occur. For example, "optionally comprising 1-3 antibody heavy chain variable regions" means that the antibody heavy chain variable region of a specific sequence may have but need not have, and may be 1, 2 or 3.

[0187] "Sequence identity" as used herein refers to the degree of identity between two nucleic acid or amino acid sequences when optimally aligned and compared with appropriate mutations such as substitutions, insertions or deletions. The sequence identity between the sequences described herein and the sequences with which they are identical may be at least 85%, 90% or 95%, preferably at least 95%. Non-limiting examples include 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100%.

[0188] EGFR

[0189] Epidermal growth factor receptor (EGFR) belongs to the tyrosine kinase family, which includes three other members: ERBB2 / HER2, ERBB3 / HER3 and ERBB4 / HER4. It is anchored in the cell membrane, including the extracellular ligand binding functional domain, the hydrophobic transmembrane region and the intracellular tyrosine kinase domain. After the ligands of EGFR (such as EGF, TGF-a, etc.) bind to it, they will form homodimers or heterodimers with other family members, leading to the autophosphorylation of tyrosine residues, thereby activating multiple downstream signal transduction pathways and regulating cell proliferation, survival and apoptosis. The EGFR signaling network plays an important role in the maintenance and growth of epithelial tissues. Its abnormal activation and activity are related to the occurrence, progression and poor prognosis of various cancers.

[0190] EGFR is overexpressed in a variety of tumors, including 25-77% of colorectal cancer, 80-100% of head and neck cancer, 40-80% of non-small cell lung cancer (NSCLC), 50-90% of renal cancer, 30-50% of pancreatic cancer, 14-91% of breast cancer, 40-63% of glioblastoma, 35-70% of ovarian cancer, etc. Gene mutation and overexpression of EGFR abnormally activate downstream pathways and are closely related to carcinogenesis and cancer progression. Currently, drugs targeting EGFR targets, including tyrosine kinase inhibitors (TKI) (such as erlotinib, gefitinib, osimertinib, etc.) and monoclonal antibodies (cetuximab and panitumumab), have been approved for the treatment of non-small cell lung cancer, colorectal cancer and head and neck cancer, respectively. EGFR is also widely expressed in normal human organs and tissues, including skin, lungs, liver, kidneys, etc. The adverse reactions of approved monoclonal antibody drugs in the real world and the on-target toxicity of CAR T cell therapy drugs developed for EGFR in the clinic are mainly manifested as skin toxicity. EGFR proto-oncogene driver mutations are important factors in NSCLC carcinogenesis and disease progression. They are detected in 50-60% of Asian patients and are clinically used as biomarkers for prognosis and disease prediction. EGFR-TKI drugs (gefitinib, erlotinib, etc.) have a good effect on advanced NSCLC patients with EGFR sensitive mutations. However, after a median of 6-12 months of treatment, most patients become resistant to EGFR-TKI. The resistance mechanism mainly includes acquired mutations of EGFR. About 50% of resistant patients have T790M mutations, while resistance to third-generation TKI drugs such as osimertinib is due to C797S mutations; as well as activation of bypass pathways cMet and Her2 signaling pathways. About 30% of patients treated with osimertinib will have acquired cMet gene amplification, thereby avoiding the target EGFR and leading to TKI resistance. NSCLC is a typical disease with multiple driver gene mutations. Genomic instability, tumor heterogeneity, and primary or acquired drug resistance generated during disease progression have created a bottleneck for the application of targeted therapy for advanced NSCLC. Therefore, multi-target targeted therapy will have the opportunity to achieve better clinical efficacy.

[0191] cMet

[0192] Mesenchymal epithelial transition factor (cMet) is a type of receptor tyrosine kinase. After binding to its ligand hepatocyte growth factor (HGF), it leads to receptor dimerization and phosphorylation, activating a variety of different cell signaling pathways and participating in cell proliferation, motility, migration, invasion and angiogenesis. cMet is normally expressed in a variety of human tissues and organs, including the liver, esophagus, stomach, colorectum, skin, ovary and endometrium. cMet is very important for controlling cell homeostasis under normal physiological conditions. When cMet is overactivated, it will initiate the transformation of normal cells into tumor cells, resulting in epithelial-mesenchymal transition. Gene mutation, gene amplification or overexpression of cMet can lead to abnormal activation of its signaling pathways and promote tumor progression.

[0193] cMet is overexpressed in many cancers, including lung cancer, breast cancer, ovarian cancer, kidney cancer, colorectal cancer, thyroid cancer, liver cancer and gastric cancer. Overexpression of cMet is directly associated with poor survival. In some cancers such as lung cancer, colorectal cancer, and ovarian cancer, cMet and / or its ligand HGF are used as clinical prognostic indicators. Typical cancers with abnormal cMet genes are gastric cancer and colorectal cancer, of which about 10-20% of gastric cancers have amplified cMet gene copies and about 25% of cMet gene mutations; the cMet mutation rate in colorectal cancer patients is about 15%. cMet is overexpressed in 25%-75% of NSCLC. In EGFR-TKI-resistant NSCLC, 15%-30% have acquired amplification of the cMet gene. cMet is also used as a marker for detecting TKI resistance in NSCLC patients with EGFR mutations.

[0194] Targeted drugs for cMet all inhibit the HGF / cMet signaling pathway. The main ones in clinical trials include receptor enzyme inhibitors (such as Tivantinib, Capmatinib, etc.), monoclonal antibodies (such as Onartuzumab), and antibody-drug conjugates (such as Telisotuzumab vedotin). Due to the overexpression of cMet caused by mutations in many types of cancer, acquired gene amplification caused by EGFR-TKI resistance in NSCLC, and resistance in the development of cMet inhibitors, multi-target development or combination therapy for specific indications and patient groups will have the opportunity to improve clinical efficacy.

[0195] Antigen binding domain

[0196] In the present invention, the antigen binding domain of the chimeric antigen receptor CAR specifically binds to tumor cell markers, such as EGFR, cMet, Her2, Her3, Muc1, ROR1, or PD-L1. The antigen binding domain of CAR is a single-chain variable fragment (scFv) formed by connecting the heavy chain and light chain of a monoclonal antibody through flexible linkers of different lengths. The svFv sequence is usually derived from a mouse, humanized or fully human monoclonal antibody. In addition, the antigen binding domain also includes a heavy chain nanobody (VH / nanobody) from an alpaca due to the lack of a light chain and smaller. The affinity of scFv or VH to the target antigen is crucial for regulating the function of CAR T cells, but too high an affinity may cause over-activation of CAR T cells and lead to cell death. In addition to affinity, the density and epitope of the target antigen are also important factors affecting antigen recognition and efficacy. In addition, high expression of antigen-independent scFv and CAR molecules on the cell membrane will induce the aggregation of CAR molecules, resulting in antigen-independent signal transduction (tonic signalling) and off-target activation, which may eventually lead to early exhaustion of CAR T cells.

[0197] Hinge and transmembrane regions

[0198] For hinge region and transmembrane region (transmembrane domain), CAR can be designed to include a transmembrane domain fused to the extracellular domain of CAR. In one embodiment, a transmembrane domain naturally associated with one of the domains in CAR is used. In some examples, a transmembrane domain can be selected, or modified by amino acid replacement to avoid binding such a domain to the transmembrane domain of the same or different surface membrane proteins, thereby minimizing the interaction with other members of the receptor complex.

[0199] The transmembrane domain may be derived from a natural source or a synthetic source. In a natural source, the domain may be derived from any membrane-bound protein or transmembrane protein. Preferably, the hinge region in the CAR of the present invention is the hinge region of CD8, and the transmembrane region of the present invention is the transmembrane region of CD8 or CD28.

[0200] Intracellular domain

[0201] The intracellular domain or additional intracellular signaling domain of the CAR of the present invention is responsible for the activation of at least one normal effector function of the immune cell in which the CAR has been placed. The term "effector function" refers to a proprietary function of a cell. For example, the effector function of a T cell may be a cytolytic activity or auxiliary activity including cytokine secretion. Therefore, the term "intracellular signaling domain" refers to a protein portion that transduces effector function signals and instructs cells to implement proprietary functions. Although the entire intracellular signaling domain can usually be used, in many examples, the entire chain does not have to be used. In terms of using a truncated portion of an intracellular signaling domain, such a truncated portion can be used to replace the complete chain as long as it transduces an effector function signal. The term "intracellular signaling domain" generally refers to any truncated portion of an intracellular signaling domain that is sufficient to transduce an effector function signal.

[0202] Preferred examples of intracellular signaling domains for use in the CAR of the present invention include cytoplasmic sequences of T cell receptors (TCRs) and co-receptors that act synergistically to initiate signal transduction following antigen receptor binding, as well as any derivatives or variants of these sequences and any synthetic sequences having the same functional capabilities.

[0203] In a preferred embodiment, the cytoplasmic domain of CAR can be designed to include the CD3ζ signaling domain itself, or can be combined with any other desired cytoplasmic domain (one or more) useful in the context of the CAR of the present invention. For example, the cytoplasmic domain of CAR may include a CD3ζ chain portion and a costimulatory signaling region. The costimulatory signaling region refers to a portion of the CAR that includes the intracellular domain of the costimulatory molecule. Costimulatory molecules are cell surface molecules required for the effective response of lymphocytes to antigens, rather than antigen receptors or their ligands. Preferably, 4-1BB (CD137), CD28, etc. are included.

[0204] The cytoplasmic signaling sequences within the cytoplasmic signaling portion of the CAR of the present invention can be connected to each other randomly or in a specified order. Optionally, a short oligopeptide or polypeptide linker, preferably 2 and 10 amino acids in length, can form the connection. Glycine-serine doublets provide particularly suitable linkers.

[0205] In one embodiment, the cytoplasmic domain in the CAR of the present invention is designed to include the signaling domain of 4-1BB and / or CD28 (co-stimulatory molecules) and the signaling domain of CD3ζ.

[0206] Chimeric Antigen Receptor (CAR)

[0207] Chimeric antigen receptors (CARs) consist of an extracellular antigen recognition region, usually scFv (single-chain variable fragment), a transmembrane region, and an intracellular co-stimulatory signal region. The design of CARs has gone through the following process: The first-generation CAR has only one intracellular signal component, CD3ζ or FcγRI molecule. Since there is only one activation domain in the cell, it can only cause short-term T cell proliferation and less cytokine secretion, but cannot provide long-term T cell proliferation signals and sustained in vivo anti-tumor effects, so it has not achieved good clinical efficacy. The second-generation CARs introduce a co-stimulatory molecule, such as CD28, 4-1BB, OX40, and ICOS, based on the original structure. Compared with the first-generation CARs, the function is greatly improved, further enhancing the persistence of CAR-T cells and the ability to kill tumor cells. On the basis of the second-generation CARs, some new immune co-stimulatory molecules such as CD27 and CD134 are connected in series, and developed into the third and fourth generation CARs.

[0208] The extracellular segment of CARs can recognize a specific antigen, and then transduce the signal through the intracellular domain, causing cell activation and proliferation, cytolytic toxicity and secretion of cytokines, thereby eliminating target cells. First, the patient's autologous cells (or allogeneic donors) are separated, activated and genetically modified to produce CAR immune cells, and then injected into the same patient. This method has a very low probability of graft-versus-host disease, and the antigen is recognized by immune cells in a non-MHC restricted manner.

[0209] CAR-immune cell therapy has achieved a very high clinical response rate in the treatment of hematological malignancies. Such a high response rate cannot be achieved by any previous treatment method and has triggered a wave of clinical research in countries around the world.

[0210] Specifically, the chimeric antigen receptor (CAR) of the present invention includes an extracellular domain, a transmembrane domain, and an intracellular domain. The extracellular domain includes a target-specific binding element (also referred to as an antigen binding domain). The intracellular domain includes a costimulatory signaling region and / or a ζ chain portion. The costimulatory signaling region refers to a portion of the intracellular domain including a costimulatory molecule. Costimulatory molecules are cell surface molecules required for the effective response of lymphocytes to antigens, rather than antigen receptors or their ligands.

[0211] Between the extracellular domain and the transmembrane domain of CAR, or between the cytoplasmic domain and the transmembrane domain of CAR, a joint may be incorporated. As used herein, the term "joint" generally refers to any oligopeptide or polypeptide that acts to connect the transmembrane domain to the extracellular domain or cytoplasmic domain of a polypeptide chain. The joint may include 0-300 amino acids, preferably 2 to 100 amino acids and most preferably 3 to 50 amino acids.

[0212] The CAR of the present invention, when expressed in T cells, can recognize antigens based on antigen binding specificity. When it binds to its associated antigen, it affects tumor cells, causing tumor cells not to grow, to be prompted to die or otherwise affected, and causes the patient's tumor load to shrink or eliminate. The antigen binding domain is preferably fused with one or more intracellular domains from a co-stimulatory molecule and / or a ζ chain. Preferably, the antigen binding domain is fused with the intracellular domain of a combination of a 4-1BB signaling domain and / or a CD3ζ signaling domain.

[0213] As used herein, "antigen binding domain" and "single-chain antibody fragment" all refer to Fab fragments, Fab' fragments, F(ab')2 fragments, or single Fv fragments with antigen binding activity. Fv antibodies contain the variable region of the antibody heavy chain and the variable region of the light chain, but no constant region, and are the smallest antibody fragments with all antigen binding sites. Generally, Fv antibodies also contain a polypeptide linker between the VH and VL domains, and are capable of forming the structure required for antigen binding. The antigen binding domain is usually scFv (single-chain variable fragment). The size of scFv is generally 1 / 6 of a complete antibody. A single-chain antibody is preferably an amino acid chain sequence encoded by a nucleotide chain. As a preferred embodiment of the present invention, the scFv comprises an antibody that specifically recognizes tumor cell markers highly expressed by tumors (such as PSMA, GPC3, GD2, HER2, Mesothelin (MSLN), CEA, EGFR / EGFRvIII, Claudin18.2, Mucin 1 (MUC1), NKG2D ligand, CD19, CD20, BCMA, CD22, CD30, IL3RA, CD38, CD138), preferably a single-chain antibody.

[0214] In a preferred embodiment, the antigen binding portion of the CAR of the present invention targets a first tumor cell marker and a second tumor cell marker. In a preferred embodiment, the antigen binding portion of the CAR of the present invention is a first scFv targeting cMet and a second scFv targeting EGFR.

[0215] In a preferred embodiment, the structure of the first scFv is as shown in Formula A1 or A2:

[0216] V H1 -V L1 (A1); or

[0217] V L1 -V H1 (A2);

[0218] Among them, V L1 V is the light chain variable region of the antibody against the first tumor cell marker; H1 is the heavy chain variable region of the antibody against the first tumor cell marker; "-" is a connecting peptide (or flexible linker) or a peptide bond.

[0219] In a preferred embodiment, V L1 The amino acid sequence is shown in SEQ ID NO.: 1 at positions 135 to 247, and V H1 The amino acid sequence is shown at positions 1 to 119 of SEQ ID NO.: 1.

[0220] In a preferred embodiment, the structure of the second scFv is shown in Formula A3 or A4:

[0221] V H2 -V L2 (A3); or

[0222] V L2 -V H2 (A4);

[0223] Among them, V L2 V is the light chain variable region of the antibody against the second tumor cell marker; H2 is the heavy chain variable region of the antibody against the second tumor cell marker; “-” is a connecting peptide (or flexible linker) or a peptide bond.

[0224] In a preferred embodiment, V L2 The amino acid sequence is shown in SEQ ID NO.: 5 at positions 135 to 241, and V H2 The amino acid sequence is shown at positions 1 to 119 of SEQ ID NO.:5.

[0225] In a preferred embodiment, the first scFv and the second scFv comprise variant forms, wherein the variants have ≥80%, ≥85%, ≥90%, ≥95%, ≥98% or ≥99% homology with their wild-type first scFV and second scFV sequences, respectively.

[0226] In the present invention, the first scFV and the second scFV of the present invention also include conservative variants thereof, which refer to polypeptides formed by replacing at most 10, preferably at most 8, more preferably at most 5, and most preferably at most 3 amino acids with amino acids having similar or similar properties compared with the amino acid sequences of the first scFV and the second scFV of the present invention, respectively.

[0227] In the present invention, the number of added, deleted, modified and / or substituted amino acids is preferably no more than 40% of the total number of amino acids in the initial amino acid sequence, more preferably no more than 35%, more preferably 1-33%, more preferably 5-30%, more preferably 10-25%, more preferably 15-20%.

[0228] In the present invention, the number of amino acids added, deleted, modified and / or substituted is usually 1, 2, 3, 4 or 5, preferably 1-3, more preferably 1-2, and most preferably 1.

[0229] For hinge region and transmembrane region (transmembrane domain), CAR can be designed to include a transmembrane domain fused to the extracellular domain of CAR. In one embodiment, a transmembrane domain naturally associated with one of the domains in CAR is used. In some examples, a transmembrane domain can be selected, or modified by amino acid replacement to avoid binding such a domain to the transmembrane domain of the same or different surface membrane proteins, thereby minimizing the interaction with other members of the receptor complex.

[0230] In the present invention, the intracellular domain in the first CAR of the present invention includes the transmembrane region of CD8 and the signaling domain of CD3ζ.

[0231] In the present invention, the intracellular domain in the second CAR of the present invention includes the transmembrane region of CD8 or CD28, and the co-stimulatory factor of 4-1BB or CD28.

[0232] In a preferred embodiment of the present invention, the amino acid sequence of the first CAR is as shown in any one of SEQ ID NOs.: 2-4.

[0233] In a preferred embodiment of the present invention, the amino acid sequence of the second CAR is any one of SEQ ID NOs.: 7-14.

[0234] In a preferred embodiment of the present invention, the amino acid sequence of the fusion protein containing the first CAR and the second CAR (ie, logicBiCAR) is as shown in any one of SEQ ID NOs.: 22-25.

[0235] Among them, in SEQ ID NO.: 22, positions 1-21 are the first signal peptide; positions 22-268 are the antigen binding domain targeting the first tumor cell marker (such as the single-chain variable region sequence of an antibody targeting cMet); positions 269-313 are the hinge region; positions 314-337 are the transmembrane region (such as the transmembrane region of CD8); positions 338-449 are CD3ζ, positions 453-470 are the connecting peptide (such as a self-cleaving protein), positions 471-491 are the second signal peptide, positions 492-732 are the antigen binding domain targeting the second tumor cell marker (such as the single-chain variable region sequence of an antibody targeting EGFR); positions 732-777 are the hinge region; positions 778-804 are the transmembrane region (such as the transmembrane region of CD28); and positions 805-845 are co-stimulatory elements (such as CD28).

[0236] Among them, in SEQ ID NO.: 23, positions 1-21 are the first signal peptide; positions 22-268 are the antigen binding domain targeting the first tumor cell marker (such as the single-chain variable region sequence of an antibody targeting cMet); positions 269-313 are the hinge region; positions 314-337 are the transmembrane region (such as the transmembrane region of CD8); positions 338-449 are CD3ζ, positions 453-470 are the connecting peptide (such as a self-cleaving protein), positions 471-491 are the second signal peptide, positions 492-732 are the antigen binding domain targeting the second tumor cell marker (such as the single-chain variable region sequence of an antibody targeting EGFR); positions 733-777 are the hinge region; positions 778-804 are the transmembrane region (such as the transmembrane region of CD28); and positions 805-845 are co-stimulatory elements (such as CD28).

[0237] Among them, in SEQ ID NO.: 24, positions 1-21 are the first signal peptide; positions 22-268 are the antigen binding domain targeting the first tumor cell marker (such as the single-chain variable region sequence of an antibody targeting cMet); positions 269-313 are the hinge region; positions 314-337 are the transmembrane region (such as the transmembrane region of CD8); positions 338-449 are CD3ζ, positions 453-470 are the connecting peptide (such as a self-cleaving protein), positions 471-491 are the second signal peptide, positions 495-732 are the antigen binding domain targeting the second tumor cell marker (such as the single-chain variable region sequence of an antibody targeting EGFR); positions 733-777 are the hinge region; positions 778-801 are the transmembrane region (such as the transmembrane region of CD8); and positions 802-843 are co-stimulatory elements (such as 4-1BB).

[0238] Among them, in SEQ ID NO.: 25, positions 1-21 are the first signal peptide; positions 22-268 are the antigen binding domain targeting the first tumor cell marker (such as the single-chain variable region sequence of an antibody targeting cMet); positions 269-313 are the hinge region; positions 314-337 are the transmembrane region (such as the transmembrane region of CD8); positions 338-449 are CD3ζ, positions 453-470 are the connecting peptide (such as a self-cleaving protein), positions 471-491 are the second signal peptide, positions 495-732 are the antigen binding domain targeting the second tumor cell marker (such as the single-chain variable region sequence of an antibody targeting EGFR); positions 733-777 are the hinge region; positions 778-801 are the transmembrane region (such as the transmembrane region of CD8); and positions 802-843 are co-stimulatory elements (such as 4-1BB).

[0239] Chimeric Antigen Receptor T Cells (CAR-T Cells)

[0240] As used herein, the terms "CAR-T cells", "CAR-T", and "CAR-T cells of the present invention" all refer to the CAR-T cells described in the present invention. The CAR-T cells of the present invention can target tumor surface antigens (such as PSMA) and are used to treat PSMA-highly expressed or positive tumors, especially solid tumors.

[0241] CAR-T cells have the following advantages over other T-cell-based treatments: (1) The action of CAR-T cells is not restricted by MHC; (2) Since many tumor cells express the same tumor antigens, once the CAR gene construction targeting a certain tumor antigen is completed, it can be widely used; (3) CAR can utilize both tumor protein antigens and glycolipid non-protein antigens, expanding the target range of tumor antigens; (4) The use of the patient's own cells reduces the risk of rejection; and (5) CAR-T cells have immune memory function and can survive in the body for a long time.

[0242] In the present invention, the fusion protein containing the first CAR and the second CAR of the present invention (i.e., logicBiCAR) comprises (i) an extracellular domain comprising an antigen targeting a first tumor cell surface antigen; (ii) a first hinge region; (iii) a first transmembrane domain; (iv) an optional first co-stimulatory factor; and (iv) a signaling domain of CD3ζ; and; (v) a connecting peptide (such as a self-cleaving protein); (vi) an extracellular domain comprising an antigen targeting a second tumor cell surface antigen; (ii) a second hinge region; (iii) a second transmembrane domain; and (iv) a second co-stimulatory factor.

[0243] Chimeric Antigen Receptor Macrophages (CAR-M Cells)

[0244] As used herein, the terms "CAR-M cells", "CAR-M", and "CAR-M cells of the present invention" all refer to the CAR-M cells described in the present invention. The CAR-M cells of the present invention can target tumor surface antigens (such as cMet and EGFR) and are used to treat tumors with high expression or positive tumor antigens (such as cMet and EGFR), especially solid tumors.

[0245] Macrophages are the main effectors and regulators of the innate immune system. They have phagocytic ability, can secrete pro-inflammatory factors, and present antigens to T cells to activate the immune system.

[0246] Compared with CART, CAR-M can directly kill antigen-specific tumor cells in vitro, inhibit tumor growth in vivo, reshape the tumor microenvironment, and has good anti-tumor activity. In addition, CAR-M also has antigen presentation ability, presenting tumor cell antigens and activating endogenous T cells.

[0247] Chimeric Antigen Receptor NK Cells (CAR-NK Cells)

[0248] As used herein, the terms "CAR-NK cells", "CAR-NK", and "CAR-NK cells of the present invention" all refer to the CAR-NK cells of the present invention. The CAR-NK cells of the present invention can target tumor surface antigens (such as cMet and EGFR) and are used to treat tumors with high or positive expression of cMet and EGFR, especially solid tumors.

[0249] Natural killer (NK) cells are a major type of immune effector cells that protect the body from viral infection and tumor cell invasion through non-antigen specific pathways. Engineered (genetically modified) NK cells may acquire new functions, including the ability to specifically recognize tumor antigens and have enhanced anti-tumor cytotoxic effects.

[0250] Compared with autologous CAR-T cells, CAR-NK cells also have the following advantages, such as: (1) they directly kill tumor cells by releasing perforin and granzyme, but have no killing effect on normal cells in the body; (2) they release very small amounts of cytokines, thereby reducing the risk of cytokine storms; (3) they are very easy to expand in vitro and develop into "ready-made" products. Other than that, it is similar to CAR-T cell therapy.

[0251] Exogenous T cell antigen receptor

[0252] As used herein, exogenous T cell antigen receptor (T cell receptor, TCR) refers to TCR α chain and β chain cloned from tumor-reactive T cells by gene transfer technology, and exogenously transferred into T cells by means of genetic engineering using lentivirus or retrovirus as a vector.

[0253] T cells modified with exogenous TCR can specifically recognize and kill tumor cells, and by optimizing the affinity of TCR with tumor-specific antigens, the affinity of T cells with tumors can be increased, thereby improving the anti-tumor effect.

[0254] Carrier

[0255] The nucleic acid sequence encoding the desired molecule can be obtained using recombinant methods known in the art, such as, for example, by screening a library from a cell expressing the gene, by obtaining the gene from a known vector comprising the gene, or by directly isolating from cells and tissues comprising the gene using standard techniques. Alternatively, the gene of interest can be produced synthetically.

[0256] The present invention also provides vectors into which the expression cassette of the present invention is inserted. Vectors derived from retroviruses such as lentiviruses are suitable tools for achieving long-term gene transfer because they allow long-term, stable integration of transgenes and their proliferation in daughter cells. Lentiviral vectors have advantages over vectors derived from oncogenic retroviruses such as murine leukemia viruses because they can transduce non-proliferating cells, such as hepatocytes. They also have the advantage of low immunogenicity.

[0257] In brief summary, the expression cassette or nucleic acid sequence of the present invention is usually operably connected to a promoter and incorporated into an expression vector. The vector is suitable for replication and integration into eukaryotic cells. Typical cloning vectors contain transcription and translation terminators, initiation sequences, and promoters that can be used to regulate the expression of the desired nucleic acid sequence.

[0258] The expression constructs of the present invention can also be used for nucleic acid immunization and gene therapy using standard gene delivery protocols. Methods of gene delivery are known in the art. See, for example, U.S. Patent Nos. 5,399,346, 5,580,859, 5,589,466, which are incorporated herein by reference in their entirety. In another embodiment, the present invention provides a gene therapy vector.

[0259] The nucleic acid can be cloned into many types of vectors. For example, the nucleic acid can be cloned into vectors including, but not limited to, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Specific vectors of interest include expression vectors, replication vectors, probe generation vectors, and sequencing vectors.

[0260] Further, expression vector can be provided to cell in the form of viral vector. Viral vector technology is well known in the art and is described in, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York) and other virology and molecular biology manuals. Viruses that can be used as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpes viruses and slow viruses. Generally, suitable vectors are included in at least one organism that works on the origin of replication, promoter sequence, convenient restriction enzyme sites and one or more selectable markers (for example, WO01 / 96584; WO01 / 29058; and U.S. Patent number 6,326,193).

[0261] Many virus-based systems have been developed for transferring genes into mammalian cells. For example, retroviruses provide a convenient platform for gene delivery systems. The selected gene can be inserted into a vector and packaged into retroviral particles using techniques known in the art. The recombinant virus can then be isolated and delivered to a subject's cells in vivo or in vitro. Many retroviral systems are known in the art. In some embodiments, adenoviral vectors are used. Many adenoviral vectors are known in the art. In one embodiment, a lentiviral vector is used.

[0262] Additional promoter elements, such as enhancers, can regulate the frequency of transcription initiation. Typically, these are located in the 30-110bp region upstream of the start site, although recently it has been shown that many promoters also contain functional elements downstream of the start site. The spacing between promoter elements is often flexible so that when an element is inverted or moved relative to another, the promoter function is maintained. In the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased by 50bp before activity begins to decline. Depending on the promoter, it is shown that individual elements can work cooperatively or independently to initiate transcription.

[0263] An example of a suitable promoter is the immediate early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence that can drive any polynucleotide sequence operably connected thereto to express at a high level. Another example of a suitable promoter is elongation growth factor-1α (EF-1α). However, other constitutive promoter sequences may also be used, including but not limited to simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukemia virus promoter, Epstein-Barr (Epstein-Barr) virus immediate early promoter, Rous sarcoma virus promoter, and human gene promoters, such as but not limited to actin promoter, myosin promoter, heme promoter, and creatine kinase promoter. Further, the present invention should not be limited to the application of constitutive promoters. Inducible promoters are also considered to be part of the present invention. The use of an inducible promoter provides a molecular switch that can turn on the expression of a polynucleotide sequence operably linked to an inducible promoter when such expression is desired, or turn off expression when expression is undesirable. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0264] In order to evaluate the expression of CAR polypeptides or parts thereof, the expression vector introduced into the cell may also include any one or both of a selectable marker gene or a reporter gene to facilitate identification and selection of expressing cells from a cell population seeking to be transfected or infected by a viral vector. In other aspects, selectable markers may be carried on a single DNA segment and used for co-transfection procedures. Both selectable markers and reporter genes may be flanked by appropriate regulatory sequences so that they can be expressed in host cells. Useful selectable markers include, for example, antibiotic resistance genes, such as neo and the like.

[0265] Reporter gene is used to identify the cells of potential transfection and to evaluate the functionality of regulatory sequences. Generally, reporter gene is the following gene: it is not present in or expressed by a receptor organism or tissue, and it encodes a polypeptide whose expression is clearly indicated by some easily detectable properties such as enzymatic activity. After DNA has been introduced into the receptor cell, the expression of the reporter gene is measured at the appropriate time. Suitable reporter gene can include genes encoding luciferase, beta-galactosidase, chloramphenicol acetyltransferase, secretory alkaline phosphatase or green fluorescent protein (for example, Ui-Tei et al., 2000FEBS Letters479:79-82). Suitable expression systems are well known and can be prepared using known techniques or commercially available. Generally, the construct with a minimum of 5 flanking regions showing the highest level of reporter gene expression is identified as a promoter. Such a promoter region can be connected to a reporter gene and used to evaluate the ability of a reagent to regulate promoter-driven transcription.

[0266] Methods for introducing genes into cells and expressing genes into cells are known in the art. In the context of expression vectors, vectors can be easily introduced into host cells, such as mammalian, bacterial, yeast or insect cells, by any method known in the art. For example, expression vectors can be transferred into host cells by physical, chemical or biological means.

[0267] Physical methods for introducing polynucleotides into host cells include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like. Methods for producing cells containing vectors and / or exogenous nucleic acids are well known in the art. See, for example, Sambrook et al. (2001, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). A preferred method for introducing polynucleotides into host cells is calcium phosphate transfection.

[0268] Biological methods for introducing polynucleotides of interest into host cells include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used methods for inserting genes into mammalian cells such as human cells. Other viral vectors can be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, etc. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362.

[0269] Chemical means for introducing polynucleotides into host cells include colloidal dispersion systems, such as macromolecular complexes, nanocapsules, microspheres, beads; and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles and liposomes. An exemplary colloidal system used as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0270] In the case of using a non-viral delivery system, an exemplary delivery vehicle is a liposome. Consider using lipid preparations to introduce nucleic acid into a host cell (in vitro, ex vivo or in vivo). On the other hand, the nucleic acid can be associated with a lipid. Nucleic acids associated with lipids can be encapsulated in the aqueous interior of the liposome, dispersed in the lipid bilayer of the liposome, attached to the liposome through a connecting molecule associated with both the liposome and the oligonucleotide, trapped in the liposome, compounded with the liposome, dispersed in a solution comprising lipids, mixed with lipids, combined with lipids, included in lipids as a suspension, included in micelles or compounded with micelles, or otherwise associated with lipids. The lipids, lipid / DNA or lipid / expression vectors associated with the composition are not limited to any specific structure in the solution. For example, they can be present in a bilayer structure, as micelles or have a "collapsed (collapsed)" structure. They can also be simply dispersed in a solution, possibly forming aggregates of size or shape inhomogeneity. Lipid is a fatty substance, which can be a naturally occurring or synthetic lipid. For example, lipids include fat droplets that occur naturally in the cytoplasm as well as compounds that contain long-chain aliphatic hydrocarbons and their derivatives such as fatty acids, alcohols, amines, amino alcohols, and aldehydes.

[0271] In a preferred embodiment of the present invention, the vector is a lentiviral vector.

[0272] preparation

[0273] The present invention provides an engineered immune cell according to the first aspect of the present invention, and a pharmaceutically acceptable carrier, diluent or excipient. In one embodiment, the preparation is a liquid preparation. Preferably, the preparation is an injection. Preferably, the concentration of the CAR-T cells in the preparation is 1×10 3 -1×10 8 cells / kg body weight, preferably 1×10 4 -1×10 7 cells / Kg body weight.

[0274] In one embodiment, the formulation may include a buffer such as neutral buffered saline, sulfate buffered saline, etc.; a carbohydrate such as glucose, mannose, sucrose or dextran, mannitol; a protein; a polypeptide or an amino acid such as glycine; an antioxidant; a chelating agent such as EDTA or glutathione; an adjuvant (e.g., aluminum hydroxide); and a preservative. The formulation of the present invention is preferably formulated for intravenous administration.

[0275] Therapeutic applications

[0276] The present invention includes therapeutic applications of cells (e.g., T cells) transduced with a lentiviral vector (LV) encoding the expression cassette of the present invention. The transduced T cells can target tumor cell markers (e.g., cMet, EGFR) proteins, synergistically activate T cells, induce cellular immune responses, and selectively kill tumor cells, such as tumor cells with high expression of cMet and EGFR.

[0277] Therefore, the present invention also provides a method for stimulating a T cell-mediated immune response to a target cell population or tissue in a mammal, comprising the following steps: administering the CAR-T cell of the present invention to the mammal.

[0278] In one embodiment, the present invention includes a type of cell therapy that separates the patient's autologous T cells (or allogeneic donors), activates and genetically modifies them to produce CAR-T cells, which are then injected into the same patient. This approach has a very low probability of graft-versus-host disease, and antigens are recognized by T cells in an MHC-free manner. In addition, one CAR-T can treat all cancers that express the antigen. Unlike antibody therapy, CAR-T cells can replicate in vivo, producing long-term persistence that can lead to sustained tumor control.

[0279] In one embodiment, the CAR-T cells of the present invention can undergo a stable in vivo T cell expansion and can sustain an extended amount of time. In addition, the CAR-mediated immune response can be part of an adoptive immunotherapy step, in which CAR-modified T cells induce an immune response specific to the antigen binding domain in the CAR. For example, CAR-T cells of markers of tumor cells (such as cMet, EGFR) cause a specific immune response against cells expressing markers of tumor cells (such as cMet, EGFR).

[0280] Although the data disclosed herein specifically discloses a lentiviral vector comprising an antigen binding domain targeting a first tumor cell surface antigen, a hinge and a transmembrane region, and a CD3ζ signaling domain, T2A, an antigen binding domain targeting a second tumor cell surface antigen, a hinge and a transmembrane region, and 4-1BB / CD28, the present invention should be interpreted as including any number of changes in each of the components of the construct.

[0281] Treatable cancers include tumors that are not vascularized or substantially not vascularized, and vascularized tumors. Cancers may include non-solid tumors (such as hematological tumors, such as leukemia and lymphoma) or solid tumors. The types of cancer treated with the CAR of the present invention include, but are not limited to, cancer, blastoma and sarcoma, and certain leukemia or lymphoid malignancies, benign and malignant tumors, malignancies, such as sarcomas, cancers, and melanomas. Also included are adult tumors / cancers and childhood tumors / cancers.

[0282] Hematological cancers are cancers of the blood or bone marrow. Examples of hematological (or hematogenous) cancers include leukemias, including acute leukemias (such as acute lymphocytic leukemia, acute myeloid leukemia, acute myeloid leukemia, and myeloblastic, promyelocytic, myelo-monocytic, monocytic, and erythroleukemias), chronic leukemias (such as chronic myeloid (granulocytic) leukemia, chronic myeloid leukemia, and chronic lymphocytic leukemia), polycythemia vera, lymphomas, Hodgkin's disease, non-Hodgkin's lymphomas (indolent and high-grade forms), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, myelodysplastic syndrome, hairy cell leukemia, and myelodysplasia.

[0283] Solid tumors are abnormal masses of tissue that do not usually contain cysts or fluid areas. Solid tumors can be benign or malignant. Different types of solid tumors are named after the cell types that form them (such as sarcomas, carcinomas, and lymphomas). Examples of solid tumors such as sarcomas and carcinomas include prostate cancer, liver cancer, fibrosarcomas, myxosarcoma, liposarcoma mesothelioma, lymphoid malignancies, pancreatic cancer, ovarian cancer.

[0284] The CAR-modified T cells of the present invention can also be used as a type of vaccine for ex vivo immunization and / or in vivo therapy of mammals. Preferably, the mammal is a human.

[0285] For ex vivo immunization, at least one of the following occurs in vitro prior to administering the cells into a mammal: i) expanding the cells, ii) introducing a nucleic acid encoding a CAR into the cells, and / or iii) cryopreserving the cells.

[0286] Ex vivo procedures are well known in the art and are discussed more fully below. Briefly, cells are isolated from mammals (preferably humans) and genetically modified (i.e., in vitro transduction or transfection) with vectors expressing CAR disclosed herein. CAR-modified cells can be administered to a mammalian recipient to provide therapeutic benefits. The mammalian recipient can be human, and the CAR-modified cells can be autologous relative to the recipient. Alternatively, the cells can be allogeneic, syngeneic, or xenogeneic relative to the recipient.

[0287] In addition to the use of cell-based vaccines for ex vivo immunization, the present invention also provides compositions and methods for in vivo immunization to elicit an immune response against an antigen in a patient.

[0288] The present invention provides a method for treating a tumor, comprising administering a therapeutically effective amount of the CAR-modified T cells of the present invention to a subject in need thereof.

[0289] The CAR-modified T cells of the present invention may be administered alone or as a pharmaceutical composition in combination with a diluent and / or with other components or other cytokines or cell groups. Simply put, the pharmaceutical composition of the present invention may include a target cell group as described herein, combined with one or more pharmaceutically or physiologically acceptable carriers, diluents or excipients. Such a composition may include a buffer such as neutral buffered saline, sulfate buffered saline, etc.; carbohydrates such as glucose, mannose, sucrose or dextran, mannitol; protein; polypeptides or amino acids such as glycine; antioxidants; chelating agents such as EDTA or glutathione; adjuvants (e.g., aluminum hydroxide); and preservatives. The composition of the present invention is preferably formulated for intravenous administration.

[0290] The pharmaceutical composition of the present invention can be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by factors such as the patient's condition, and the type and severity of the patient's disease-although the appropriate dosage can be determined by clinical trials.

[0291] When an "immunologically effective amount", "anti-tumor effective amount", "tumor-suppressive effective amount" or "therapeutic amount" is indicated, the exact amount of the composition of the present invention to be administered can be determined by a physician, who takes into account individual differences in the patient's (subject's) age, weight, tumor size, degree of infection or metastasis, and condition. It can be generally stated that the pharmaceutical composition comprising the T cells described herein can be administered in an amount of 10 4 Up to 10 9 The dosage is preferably 10 cells / kg body weight. 5 Up to 10 6 The T cell composition can also be administered at these doses multiple times. The cells can be administered by using well-known injection techniques in immunotherapy (see, for example, Rosenberg et al., New Eng. J. of Med. 319: 1676, 1988). The optimal dose and treatment regimen for a specific patient can be easily determined by a medical technician by monitoring the patient's disease signs and adjusting the treatment accordingly.

[0292] Administration of the subject composition can be carried out in any convenient manner, including by spraying, injection, swallowing, infusion, implantation or transplantation. The compositions described herein can be administered to the patient subcutaneously, intradermally, intratumorally, intranodally, intraspinal, intramuscularly, by intravenous (iv) injection or intraperitoneally. In one embodiment, the T cell composition of the present invention is administered to the patient by intradermal or subcutaneous injection. In another embodiment, the T cell composition of the present invention is preferably administered by iv injection. The composition of the T cell can be injected directly into the tumor, lymph node or infection site.

[0293] In certain embodiments of the invention, cells activated and expanded using the methods described herein or other methods known in the art to expand T cells to therapeutic levels are administered to patients in combination with any number of related treatment forms (e.g., before, simultaneously or after), including but not limited to treatment with the following agents: agents such as antiviral therapy, cidofovir and interleukin-2, cytarabine (also known as ARA-C) or natalizumab treatment for MS patients or efavirenz treatment for psoriasis patients or other treatments for PML patients. In further embodiments, the T cells of the present invention can be used in combination with chemotherapy, radiation, immunosuppressants such as cyclosporine, azathioprine, methotrexate, mycophenolate and FK506, antibodies or other immunotherapeutic agents. In further embodiments, the cell compositions of the present invention are administered to patients in combination with bone marrow transplantation, using chemotherapeutic agents such as fludarabine, external beam radiation therapy (XRT), cyclophosphamide (e.g., before, simultaneously or after). For example, in one embodiment, the subject can undergo standard treatment with high-dose chemotherapy followed by peripheral blood stem cell transplantation. In some embodiments, the subject receives an infusion of the expanded immune cells of the invention following transplantation. In an additional embodiment, the expanded cells are administered prior to or after surgery.

[0294] The dosage of the above treatments administered to a patient will vary with the precise nature of the condition being treated and the recipient of the treatment. The dosage ratio for human administration can be implemented according to practices accepted in the art. Typically, 1×10 6 to 1×10 10 The modified T cells of the present invention (e.g., the CAR-T cells of the present invention) are administered to the patient, for example, by intravenous infusion.

[0295] Fusion Protein

[0296] As used herein, the terms "fusion protein", "fusion protein of the present invention", "polypeptide of the present invention", and "logicBiCAR" have the same meanings and all have the structure described in the eighth aspect of the present invention.

[0297] In another preferred embodiment, the amino acid sequence of the fusion protein is shown in any one of SEQ ID NOs.: 22-25.

[0298] As used herein, the term "fusion protein" also includes variant forms of the sequences shown in any one of SEQ ID NO.: 22-25 that have the above-mentioned activities. These variant forms include (but are not limited to): deletion, insertion and / or substitution of 1-3 (usually 1-2, preferably 1) amino acids, and addition or deletion of one or several (usually within 3, preferably within 2, and more preferably within 1) amino acids at the C-terminus and / or N-terminus. For example, in the art, when amino acids with similar or similar properties are substituted, the function of the protein is usually not changed. For another example, adding or deleting one or several amino acids at the C-terminus and / or N-terminus usually does not change the structure and function of the protein. In addition, the term also includes the polypeptides of the present invention in monomeric and polymeric forms. The term also includes linear and non-linear polypeptides (such as cyclic peptides).

[0299] The present invention also includes active fragments, derivatives and analogs of the above-mentioned fusion proteins. As used herein, the terms "fragment", "derivative" and "analog" refer to polypeptides that substantially maintain the function or activity of the fusion protein of the present invention. The polypeptide fragments, derivatives or analogs of the present invention can be (i) a polypeptide in which one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) are substituted, or (ii) a polypeptide having a substitution group in one or more amino acid residues, or (iii) a polypeptide formed by fusion of a polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iv) a polypeptide formed by fusion of an additional amino acid sequence to this polypeptide sequence (a fusion protein formed by fusion with a leader sequence, a secretory sequence or a tag sequence such as 6His). According to the teachings of this article, these fragments, derivatives and analogs belong to the scope known to those skilled in the art.

[0300] A preferred class of active derivatives refers to polypeptides formed by replacing at most 3, preferably at most 2, and more preferably at most 1 amino acid with similar or similar properties compared to the amino acid sequence of the present invention. These conservative variant polypeptides are preferably produced by amino acid substitution according to Table 1.

[0301] Table 1

[0302] Initial residue Representative replacement Preferred substitutions Ala(A) Val; Leu; Ile Val Arg(R) Lys; Gln; Asn Lys Asn(N) Gln; His; Lys; Arg Gln Asp(D) Glu Glu Cys(C) Ser Ser Gln(Q) Asn Asn Glu(E) Asp Asp Gly(G) Pro; Ala Ala His(H) Asn; Gln; Lys; Arg Arg Ile(I) Leu; Val; Met; Ala; Phe Leu Leu(L) Ile; Val; Met; Ala; Phe Ile Lys(K) Arg; Gln; Asn Arg Met(M) Leu; Phe; Ile Leu Phe(F) Leu; Val; Ile; Ala; Tyr Leu Pro(P) Ala Ala Ser(S) Thr Thr Thr(T) Ser Ser Trp(W) Tyr; Phe Tyr Tyr(Y) Trp; Phe; Thr; Ser Phe Val(V) Ile; Leu; Met; Phe; Ala Leu

[0303] The present invention also provides analogs of the fusion protein of the present invention. The difference between these analogs and the polypeptides shown in any of SEQ ID NOs.: 22-25 may be a difference in amino acid sequence, or a difference in modification form that does not affect the sequence, or both. Analogs also include analogs with residues different from natural L-amino acids (such as D-amino acids), and analogs with non-natural or synthetic amino acids (such as β, γ-amino acids). It should be understood that the polypeptides of the present invention are not limited to the representative polypeptides exemplified above.

[0304] Modifications (usually without changing the primary structure) include: chemical derivatization of polypeptides in vivo or in vitro, such as acetylation or carboxylation. Modifications also include glycosylation, such as those produced by glycosylation modification during the synthesis and processing of the polypeptide or in further processing steps. This modification can be accomplished by exposing the polypeptide to a glycosylation enzyme (such as a mammalian glycosylase or deglycosylase). Modifications also include sequences with phosphorylated amino acid residues (such as phosphotyrosine, phosphoserine, phosphothreonine). Also included are polypeptides that have been modified to improve their resistance to proteolysis or optimize their solubility.

[0305] In one embodiment of the present invention, the amino acid sequence of the fusion protein is shown in any one of SEQ ID NOs.: 22-25.

[0306] Coding sequence

[0307] The present invention also relates to a polynucleotide encoding the fusion protein according to the present invention.

[0308] The polynucleotide of the present invention may be in the form of DNA or RNA. The DNA may be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide may be the same as the sequence encoding the polypeptide shown in any one of SEQ ID NOs.: 22-25 or may be a degenerate variant. As used herein, "degenerate variant" in the present invention refers to a nucleic acid sequence encoding a polypeptide shown in any one of SEQ ID NOs.: 22-25, but the corresponding coding region sequence is different.

[0309] The full-length nucleotide sequence of the present invention or its fragment can usually be obtained by PCR amplification, recombination or artificial synthesis. At present, the DNA sequence encoding the polypeptide of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. Then the DNA sequence can be introduced into various existing DNA molecules (or vectors) and cells known in the art.

[0310] The present invention also relates to vectors comprising the polynucleotides of the present invention, and host cells produced by genetic engineering using the vectors or polypeptide coding sequences of the present invention. The above polynucleotides, vectors or host cells may be isolated.

[0311] As used herein, "isolated" means that a substance is separated from its original environment (if it is a natural substance, the original environment is the natural environment). For example, polynucleotides and polypeptides in their natural state in living cells are not isolated and purified, but the same polynucleotides or polypeptides are isolated and purified if they are separated from other substances that exist with them in their natural state.

[0312] The polynucleotide of the present invention can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand.

[0313] The present invention also relates to variants of the above-mentioned polynucleotides, which encode protein fragments, analogs and derivatives having the same amino acid sequence as the present invention. The variants of this polynucleotide can be naturally occurring allelic variants or non-naturally occurring variants. These nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is an alternative form of a polynucleotide, which may be a substitution, deletion or insertion of one or more nucleotides, but will not substantially change its function of encoding the fusion protein of the present invention.

[0314] The full-length nucleotide sequence encoding the fusion protein of the present invention or its fragment can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the disclosed relevant nucleotide sequences, especially the open reading frame sequence, and a commercially available cDNA library or a cDNA library prepared by conventional methods known to those skilled in the art is used as a template to amplify the relevant sequence. When the sequence is long, it is often necessary to perform two or more PCR amplifications, and then splice the fragments amplified in each time together in the correct order.

[0315] In one embodiment of the present invention, the polynucleotide sequence encoding the fusion protein is shown in any one of SEQ ID NOs.: 26-29.

[0316] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods.

[0317] In addition, artificial synthesis methods can also be used to synthesize related sequences, especially when the fragment length is shorter. Usually, a long fragment of sequence can be obtained by synthesizing multiple small fragments first and then connecting them.

[0318] The method of using PCR technology to amplify DNA / RNA is preferably used to obtain the gene of the present invention. The primers used for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein, and can be synthesized by conventional methods. The DNA / RNA fragments amplified can be separated and purified by conventional methods such as by gel electrophoresis.

[0319] The present invention also relates to a vector comprising the polynucleotide of the present invention, a host cell produced by genetic engineering using the vector or protein coding sequence of the present invention, and a method for expressing the fusion protein of the present invention on the NK cell by recombinant technology.

[0320] The polynucleotide sequence of the present invention can be used to obtain NK cells expressing the fusion protein of the present invention by conventional recombinant DNA technology, which generally includes the steps of: transducing the first expression cassette and / or the second expression cassette of the present invention into NK cells, thereby obtaining the NK cells.

[0321] Methods well known to those skilled in the art can be used to construct expression vectors containing the coding DNA sequence of the fusion protein of the present invention and suitable transcription / translation control signals. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The DNA sequence can be effectively connected to an appropriate promoter in the expression vector to guide mRNA synthesis. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0322] In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0323] The vector containing the above-mentioned appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform appropriate host cells to enable them to express proteins.

[0324] The host cell can be a prokaryotic cell, such as a bacterial cell; or a lower eukaryotic cell, such as a yeast cell; or a higher eukaryotic cell, such as a mammalian cell. Representative examples include: bacterial cells of Escherichia coli, Bacillus subtilis, Streptomyces; fungal cells such as Pichia pastoris, Saccharomyces cerevisiae cells; plant cells; insect cells of Drosophila S2 or Sf9; animal cells of CHO, NS0, COS7, or 293 cells, etc. In a preferred embodiment of the present invention, NK cells are selected as host cells.

[0325] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with the CaCl2 method, the steps used are well known in the art. Another method is to use MgCl2. If necessary, transformation can also be carried out using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0326] The obtained transformant can be cultured by conventional methods to express the protein encoded by the gene of the present invention. Depending on the host cell used, the culture medium used in the culture can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the promoter selected is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0327] The protein in the above method can be expressed in the cell, on the cell membrane, or secreted outside the cell. If necessary, the protein can be separated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultra-treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.

[0328] The main advantages of the present invention include:

[0329] 1. The present invention is the first to discover that engineered immune cells containing a first CAR targeting a first tumor cell marker (such as cMet, Her2, Her3, Muc1, ROR1, PD-L1, CD47) and a second CAR targeting a second tumor cell marker (such as EGFR, EpCAM, Her2, Her3) can be fully activated, enhance targeting specificity, exert anti-tumor efficacy, and reduce on-target / off-tumor toxicity, thereby improving the safety of cell therapy.

[0330] 2. The present invention first discovered that the immune cells of the present invention can simultaneously recognize two different antigens, EGFR and cMet, to enhance the specificity and selectivity of CAR T cells targeting tumors, as well as their homing in tumors. In addition, two pathogenic signaling pathways can be inhibited simultaneously, thereby inhibiting disease progression and improving survival.

[0331] The present invention is further described below in conjunction with specific implementation. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0332] Unless otherwise specified, the materials and reagents used in the examples of the present invention are commercially available products.

[0333] General Methods

[0334] Lentiviral particle preparation

[0335] 293T cells in the logarithmic growth phase were inoculated into a 10 cm culture dish at a density of 7E6 / dish, and cultured overnight in a 37°C, 5% CO2 incubator for transfection. The culture medium was DMEM containing 10% FBS. The next day, fresh DMEM culture medium was replaced before transfection. The transfection steps are as follows: the target gene plasmid, such as pWPXLd-cMET-EGFP, pWPXLd-EGFR-BFP or pWPXLd-CAR, was respectively mixed with the packaging plasmid psPAX2 and the envelope plasmid pMD2.G in Opti-MEM culture medium; then DNA transfection reagent was added and mixed; added dropwise to the culture dish and cultured for 6 hours; replaced with DMEM culture medium containing 10% FBS; after 72 hours, the supernatant was collected, centrifuged, filtered, and packaged; frozen at -80°C for titer determination or cell infection.

[0336] CAR T cell preparation

[0337] Human peripheral blood mononuclear cells were obtained from healthy human peripheral blood by Ficoll-Hypaque density gradient centrifugation. PBMC T cells were stimulated and activated in lymphocyte culture medium with CD3 monoclonal antibody and recombinant human IL-2; after activation, recombinant lentivirus and Polybrene were added for transduction; after incubation in a 37°C, 5% CO2 incubator, the cells were centrifuged and the medium was replaced, and the cells were counted and subcultured.

[0338] CAR expression was detected by flow cytometry

[0339] On the 7th day of CAR T cell culture, 1E6 cells were taken and washed twice; 1ugMET-His and 1ug EGFR-Fc antigen were added separately or together and incubated at 4°C for 30 minutes; washed twice, then Anti-His-PE and Allophycocyanin AffiniPure Goat Anti-Human IgG were added separately and incubated at 4°C for 30 minutes; then the cells were washed twice and the expression of different CARs was detected by flow cytometry.

[0340] Preparation and monoclonal screening of antigen-stable 293T cells

[0341] 293T cells were seeded in a 6-well plate at an appropriate density, and unconcentrated lentiviral particles containing the target antigen gene were added for infection. The culture medium was replaced 24 hours after infection, and then subcultured. The infected 293T cells were sorted by flow cytometry to select the clone pool expressing the target gene or by limiting dilution method for monoclonal screening, and then the selected pool or monoclonal cells were identified for the expression of the target gene. The steps are as follows: 1E6 cells were taken, washed twice, and PE Mouse Anti-Human EGF Receptor clone EGFR.1 and Alexa After incubation with 647 Mouse Anti-Human c-Met Clone 3D6 at 4°C for 30 min, the cells were washed twice and detected using a flow cytometer.

[0342] Cytotoxicity assay by CCK8

[0343] The toxicity of CAR-T cells was determined using the CCK8 kit. Target cells in the logarithmic growth phase were collected and cell suspensions of different cell densities were prepared using CAR T cells cultured to day 7; target cells were plated at 5000 cells / well (3 replicates), and then CAR T cell suspensions were added at different effector-target ratios and incubated for 24 hours; CCK8 was then added to each well and reacted for 4 hours; the absorbance at a wavelength of 450nm was measured using an ELISA reader.

[0344] Cytotoxicity was determined by secreted HiBiT-tagged protein detection (HiBiT Extracellular Detection System, Promega)

[0345] Target cells carrying the HaloTag-HiBiT label (including 293T-HaloTag-HiBiT, 293T-HaloTag-HiBiT-EGFR, 293T-HaloTag-HiBiT-cMet, 293T-HaloTag-HiBiT-EGFR-cMet&EGFR, H1975-Halotag-HiBiT, H1975-HaloTag-HiBiT) in the logarithmic growth phase and CAR T cells cultured to day 7 were collected to prepare cell suspensions with different cell densities; target cells were plated at 5000 cells / well (3 replicates), and then CAR T cell suspensions were added at different effector-target ratios and incubated for 24 hours; luminescence was detected using a microplate reader. After adding a certain final concentration of digitonin to the positive control group with maximum release and incubating for 30 minutes, the plate was taken out of the incubator, cooled to room temperature, and an equal volume of pre-prepared detection buffer (containing 1:100 diluted LgBiT Protein and 1:50 diluted HiBiT Extracellular Substrate) was mixed on a shaker and luminescence was detected using a microplate reader.

[0346] Cytation 5 fully automated cell imaging multi-function microplate reader system for cytotoxicity determination

[0347] Take NHEK cells in the logarithmic growth phase and resuspend them in the pre-warmed designated NHEK cell culture medium; add the dye CellTracker TM Deep Red dye, incubate for 30 minutes; centrifuge and discard the supernatant, prepare NHEK cell suspension with a certain cell density, inoculate in a 96-well plate with a black transparent bottom and incubate overnight; place the well plate in Cytation 5 to monitor the number of live cells; 1 hour later, add CAR T cell suspension with different effector-target ratios to perform real-time and dynamic monitoring of the number of live target cells.

[0348] Example 1

[0349] Virus preparation: Add the lentiviral target gene plasmid pWPXLd-CAR, packaging plasmid psPAX2 and envelope plasmid pMD2.G to X-tremeGENE 9DNA Transfection Reagent (Roche), mix well, add to the culture dish in which 293T cells are cultured, mix gently, collect the supernatant after 72 hours, centrifuge at 1000g, filter with 0.45um filter membrane, directly aliquot or concentrate with ultrafiltration tube, and store at -80℃ until cell infection.

[0350] CAR T cell preparation: Peripheral blood mononuclear cells were obtained from healthy human peripheral blood by Ficoll-Hypaque density gradient centrifugation, and inoculated into lymphocyte culture medium (Gibco) containing CD3 monoclonal antibody (Miltenyi Biotec) and IL-2 (GE Healthcare) for stimulation and activation. Then, recombinant lentivirus and polybrene (Sigma) were added to transduce the cells, and the cells were placed in a 37°C, saturated humidity, 5% CO2 incubator for subculture. The results are shown in Figure 1. The results show that Figure 1A The composition of the "and" logic BiCAR targeting EGFR and cMet is shown, including 2 independent CAR molecules, which are a CAR of anti-cMet scFv tandem with CD3ζ activation signal domain (as shown in SEQ ID NO.: 2, wherein SEQ ID NO.: 3-4 are fully functional 2G single CARs against cMet) combined with a CAR of anti-EGFR scFv tandem with 4-1BB or CD28 costimulatory signal domain (as shown in any one of SEQ ID NO.: 7-10, wherein SEQ ID NO.: 11-14 are fully functional 2G single CARs against EGFR); Figure 1B A schematic diagram showing the molecular construction connection of "and" logic BiCAR expression (as shown in any one of SEQ ID NO.: 22-25); Figure 1C The composition of the second-generation fully functional CAR targeting cMet is shown, scFv is tandem with 4-1BB or CD28 and CD3ζ (as shown in any one of SEQ ID NO.: 3-4); Figure 1D The composition of the second-generation fully functional CAR targeting EGFR is shown, with scFv tandem with 4-1BB or CD28 and CD3ζ (as shown in any one of SEQ ID NO.: 11-14).

[0351] Example 2

[0352] Flow cytometry for CAR molecule expression: On the 7th day of CAR T cell culture, 1E6 cells were taken, washed twice with washing buffer, and then incubated at 4°C for 30 minutes with 1ug cMet-His (Acrobiosystem) and / or 1ug EGFR-Fc antigen (Acrobiosystem), washed twice with washing buffer, and then Anti-His-PE (BD) and Allophycocyanin (APC) AffiniPure Goat Anti-Human IgG, Fcγfragment specific (Jackson ImmunoResearch) were added and incubated at 4°C for 30 minutes. After washing the cells twice, flow cytometry (CytoFLEXLX, Beckman Coulter) was used to detect CAR expression.

[0353] The results are shown in Figure 2 . The expression of CAR molecules in CAR T cells was detected by flow cytometry. Figure 2A It is shown that since the Mock T cells were not transduced with any CAR molecules, there was no first CAR (anti-cMet-scFv-CD3ζ / Mz) or second CAR molecule (anti-EGFR-scFv-CD28 / E-28). Figure 2B It was shown that E-28CAR T expressing only the second CAR molecule had a cell transduction rate of 24%; Figure 2C It was shown that the fully functional second-generation CAR T (anti-EGFR-scFv-CD28-CD3ζ / E-28z) targeting EGFR had a cell transduction rate of 27%; Figure 2D It was shown that CAR T expressing the first CAR molecule Mz had a cell transduction rate of 28%; Figure 2E It was shown that the fully functional second-generation CAR T (anti-cMet-scFv-CD28-CD3ζ / M-28z) targeting the cMet target had a transduction rate of 26%; Figure 2F The “and” logic shows that the transduction rate of the first CAR molecule Mz and the second CAR molecule E-28 co-expressed in BiCAR T cells was 35%.

[0354] Example 3

[0355] Preparation and monoclonal screening of EGFR and / or cMet stably transfected cell line 293T: Add lentiviral particles containing target genes EGFR and / or cMet to cultured 293T cells for infection, replace the culture medium after 24 hours and perform subculture. Then, the infected 293T cells are sorted by flow cytometry to obtain pool clones expressing the target gene or by limiting dilution method for monoclonal screening. The sorted pool or monoclonal cells are then identified for target gene expression by flow cytometry.

[0356] HiBiT Extracellular Detection System (Promega) method to detect cytotoxicity: Target cells 293T-Halotag-HiBiT, 293T-Halotag-HiBiT-EGFR, 293T-Halotag-HiBiT-cMet, 293T-Halotag-HiBiT-Met&EGFR carrying HaloTag-HiBiT labels in the logarithmic growth phase and CAR T cells cultured to day 7 were collected to prepare cell suspensions with different cell densities. The corresponding target cells were plated (3 replicates), and then CAR T cell suspensions were added at effector-target ratios of 3:1, 1:1, 1:3, and 1:10. After incubation for 24 hours, an equal volume of pre-prepared HiBiT Extracellular Buffer (containing 1:100 diluted LgBiT Protein and 1:50 diluted HiBiT Extracel lular Substrate) was added, mixed on a shaker, and chemiluminescence was detected using a microplate reader (Thermo Varioskan LUX).

[0357] The results are shown in Figure 3. The results show that due to the absence of the CD3ζ signal activation functional domain, MockT and E-28CART have no specific lytic toxicity for any detected target cells and effector-target ratio ( Figures 3A-3D ); Mz, M-28z and BiCAR T showed dose-dependent and specific in vitro killing function against stable cell lines expressing cMet alone or EGFR and cMet co-expression ( Figure 3C ,3D); and BiCAR has enhanced cell lytic toxicity compared with first-generation Mz or second-generation M-28z CAR T ( Figure 3C ,3D).

[0358] Example 4

[0359] IFN-r cytokine detection (Human IFN-r Quantikine ELISA Kit, R&D Systems): Target cells 293T-Halotag-HiBiT, 293T-Halotag-HiBiT-EGFR, 293T-Halotag-HiBiT-cMet, 293T-Halotag-HiBiT-Met&EGFR carrying HaloTag-HiBiT labels in the logarithmic growth phase and CAR T cells cultured to day 7 were collected to prepare cell suspensions with different cell densities. The corresponding target cells were plated (3 replicates), and then CAR T cell suspensions were added at effector-target ratios of 3:1, 1:1, 1:3, and 1:10. After incubation for 24 hours, the supernatant was taken and added to the enzyme label solution for incubation for 2 hours, and then the color development solution was added to develop color at room temperature in the dark for 30 minutes, and then the stop solution was added to terminate the reaction, and the absorbance at a wavelength of 450nm was measured using an enzyme reader.

[0360] The results are as follows Figures 4A-4D As shown in the figure, the results show that compared with target cells expressing only cMet single antigen, BiCAR T enhances IFN-r secretion on target cells co-expressing EGFR and cMet antigens, and is superior to the fully functional second-generation M-28z CAR T; however, for the first-generation Mz CAR T, due to the absence of the co-stimulatory signaling domain, it produces very limited IFN-r secretion compared to BiCAR or M-28z CAR T; Mock T and E-28CAR T have no killing activity against target cells, nor do they specifically secrete IFN-r. In simple summary, the "and" logic BiCAR has a synergistically enhanced cytotoxic effect function for target cells with both EGFR and cMet targets, which means that it has a highly selective anti-tumor effect.

[0361] Example 5

[0362] Cytation 5 (Biotek), a multifunctional microplate reader for cell imaging, was used to measure the toxicity of CAR-T cells: NHEK cells in the logarithmic growth phase were resuspended in NHEK cell culture medium (Dermal Cell Basal Medium containing Keratinocyte Growth Kit, ATCC), and CellTracker TMDeep Red dye (Invitrogen), incubate for 30 minutes, centrifuge, discard the supernatant, prepare a certain cell density of NHEK cell suspension, inoculate in a black transparent bottom 96-well plate and incubate in an incubator overnight. Then place the well plate on a cell imaging multifunctional microplate reader to monitor the number of live cells. After 1 hour, add CAR T cells according to the effector-target ratio of 3:1, 1:1, 1:3 and 1:10, and continue to monitor the number of live target cells.

[0363] The results are as follows Figures 5A-5D As shown, the results show that compared with the second-generation E-28z, M-28z CAR T, or the first-generation Mz CART, BiCAR T minimizes the lytic toxicity to NHEK cells. The "and" logic BiCAR can effectively reduce or avoid target toxicity to normal human tissues, such as toxicity to human skin, and has potential for better safety.

[0364] Example 6

[0365] CCK8 method (Tongren Chemical Research Institute) was used to detect cytotoxicity: Human gastric cancer cells SUN5 in the logarithmic growth phase and CAR T cells cultured to day 7 were collected. After target cells were plated (3 replicates), CAR T cell suspensions were added at effector-target ratios of 10:1, 3:1, 1:1, 1:3, and 1:10, and incubated in an incubator for 24 hours. CCK8 was added, and after 4 hours of reaction, the absorbance at a wavelength of 450 nm was measured using an ELISA reader.

[0366] The results are as follows Figure 6A-6B As shown, the results showed that BiCAR T produced specific, dose-dependent lytic function for SNU5 cells and was stronger than M-28z and Mz CAR T; however, Mock T and E-28CAR T did not produce specific effector function on target cells.

[0367] Example 7

[0368] CCK8 method to detect cytotoxicity: Human lung adenocarcinoma cells H1993 in the logarithmic growth phase and CAR T cells cultured to day 7 were collected. After the target cells were plated (3 replicates), CAR T cell suspensions were added at effector-target ratios of 3:1, 1:1, 1:3, and 1:10, and incubated in the incubator for 24 hours. CCK8 was added, and after 4 hours of reaction, the absorbance at a wavelength of 450 nm was measured using an enzyme reader.

[0369] The results are as follows Figure 7As shown, the results showed that BiCAR exhibited dose-dependent specific killing of H1993 and had better in vitro efficacy than M-28z and Mz; however, Mock T and E-28CAR T had no lytic activity on target cells.

[0370] Example 8

[0371] HiBiT Extracellular Detection System (Promega) method to detect cytotoxicity: lung adenocarcinoma cell line H1975 carrying HaloTag-HiBiT label in logarithmic growth phase and CAR T cells cultured to day 7 were collected to prepare cell suspensions with different cell densities. The corresponding target cells were plated (3 replicates), and then CAR T cell suspensions were added at effector-target ratios of 3:1, 1:1, 1:3 and 1:10. After incubation for 24 hours, an equal volume of pre-prepared Add HiBiT Extracellular Buffer, mix well on a shaker, and detect luminescence using a microplate reader.

[0372] The results are as follows Figure 8 As shown, the results showed that BiCAR T cells had dose-dependent and specific lytic activity against H1975 tumor cells, and their cytotoxicity was comparable to that of M-28z CAR, and both were stronger than the first-generation Mz CAR T cells.

[0373] Example 9

[0374] CCK8 method to detect cytotoxicity: Human lung adenocarcinoma cells H820 in the logarithmic growth phase and CAR T cells cultured to day 7 were collected. After the target cells were plated (3 replicates), CAR T cell suspensions were added at effector-target ratios of 3:1, 1:1, 1:3, and 1:10, and incubated in the incubator for 24 hours. CCK8 was added, and after 4 hours of reaction, the absorbance at a wavelength of 450 nm was measured using an ELISA reader.

[0375] The results are as follows Fig. 9 As shown, the results showed that BiCAR T cells had a dose-dependent and specific in vitro killing function for H820 tumor cells, and its effect was better than M-28z or Mz CAR T; however, Mock T and E-28CAR T did not show specific killing effect on target cells.

[0376] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application. Sequence Listing <110> Fosun Kite Biotechnology Co., Ltd. <120> Anti-EGFR and cMet bispecific chimeric antigen receptor and its application <130> P2020-2816 <160> 29 <170> PatentIn version 3.5 <210> 1 <211> 247 <212> PRT <213> Artificial sequence <400> 1 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Trp Leu His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Gly Met Ile Asp Pro Ser Asn Ser Asp Thr Arg Phe Asn Pro Asn Phe 50 55 60 Lys Asp Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Thr Tyr Arg Ser Tyr Val Thr Pro Leu Asp Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro Ser Ser 130 135 140 Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Lys Ser Ser 145 150 155 160 Gln Ser Leu Leu Tyr Thr Ser Ser Gln Lys Asn Tyr Leu Ala Trp Tyr 165 170 175 Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Trp Ala Ser 180 185 190 Thr Arg Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly 195 200 205 Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala 210 215 220 Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ala Tyr Pro Trp Thr Phe Gly Gln 225 230 235 240 Gly Thr Lys Val Glu Ile Lys 245 <210> 2 <211> 449 <212> PRT <213> Artificial sequence <400> 2 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu 20 25 30 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr 35 40 45 Thr Phe Thr Ser Tyr Trp Leu His Trp Val Arg Gln Ala Pro Gly Lys 50 55 60 Gly Leu Glu Trp Val Gly Met Ile Asp Pro Ser Asn Ser Asp Thr Arg 65 70 75 80 Phe Asn Pro Asn Phe Lys Asp Arg Phe Thr Ile Ser Ala Asp Thr Ser 85 90 95 Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr 100 105 110 Ala Val Tyr Tyr Cys Ala Thr Tyr Arg Ser Tyr Val Thr Pro Leu Asp 115 120 125 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr 145 150 155 160 Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile 165 170 175 Thr Cys Lys Ser Ser Gln Ser Leu Leu Tyr Thr Ser Ser Gln Lys Asn 180 185 190 Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 195 200 205 Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Ser Arg Phe Ser 210 215 220 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln 225 230 235 240 Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ala Tyr Pro 245 250 255 Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Thr Thr Thr Pro 260 265 270 Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu 275 280 285 Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His 290 295 300 Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu 305 310 315 320 Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr 325 330 335 Cys Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln 340 345 350 Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu 355 360 365 Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly 370 375 380 Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln 385 390 395 400 Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu 405 410 415 Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr 420 425 430 Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro 435 440 445 Arg <210> 3 <211> 493 <212> PRT <213> Artificial sequence <400> 3 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu 20 25 30 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr 35 40 45 Thr Phe Thr Ser Tyr Trp Leu His Trp Val Arg Gln Ala Pro Gly Lys 50 55 60 Gly Leu Glu Trp Val Gly Met Ile Asp Pro Ser Asn Ser Asp Thr Arg 65 70 75 80 Phe Asn Pro Asn Phe Lys Asp Arg Phe Thr Ile Ser Ala Asp Thr Ser 85 90 95 Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr 100 105 110 Ala Val Tyr Tyr Cys Ala Thr Tyr Arg Ser Tyr Val Thr Pro Leu Asp 115 120 125 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr 145 150 155 160 Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile 165 170 175 Thr Cys Lys Ser Ser Gln Ser Leu Leu Tyr Thr Ser Ser Gln Lys Asn 180 185 190 Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 195 200 205 Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Ser Arg Phe Ser 210 215 220 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln 225 230 235 240 Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ala Tyr Pro 245 250 255 Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Thr Thr Thr Pro 260 265 270 Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu 275 280 285 Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His 290 295 300 Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe Trp Val Leu Val Val Val 305 310 315 320 Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile 325 330 335 Ile Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr 340 345 350 Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln 355 360 365 Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser Arg Val Lys 370 375 380 Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln 385 390 395 400 Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu 405 410 415 Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg 420 425 430 Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met 435 440 445 Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly 450 455 460 Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp 465 470 475 480 Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 485 490 <210> 4 <211> 473 <212> PRT <213> artificial sequence <400> 4 Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Thr Phe Thr Ser Tyr 20 25 30 Trp Leu His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40 45 Gly Met Ile Asp Pro Ser Asn Ser Asp Thr Arg Phe Asn Pro Asn Phe 50 55 60 Lys Asp Arg Phe Thr Ile Ser Ala Asp Thr Ser Lys Asn Thr Ala Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys 85 90 95 Ala Thr Tyr Arg Ser Tyr Val Thr Pro Leu Asp Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro Ser Ser 130 135 140 Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Lys Ser Ser 145 150 155 160 Gln Ser Leu Leu Tyr Thr Ser Ser Gln Lys Asn Tyr Leu Ala Trp Tyr 165 170 175 Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Trp Ala Ser 180 185 190 Thr Arg Glu Ser Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly 195 200 205 Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro Glu Asp Phe Ala 210 215 220 Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ala Tyr Pro Trp Thr Phe Gly Gln 225 230 235 240 Gly Thr Lys Val Glu Ile Lys Thr Thr Thr Pro Ala Pro Arg Pro Pro 245 250 255 Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu 260 265 270 Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp 275 280 285 Phe Ala Cys Asp Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala 290 295 300 Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Lys 305 310 315 320 Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg 325 330 335 Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro 340 345 350 Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser 355 360 365 Ala Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu 370 375 380 Leu Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg 385 390 395 400 Gly Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln 405 410 415 Glu Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr 420 425 430 Ser Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp 435 440 445 Gly Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala 450 455 460 Leu His Met Gln Ala Leu Pro Pro Arg 465 470 <210> 5 <211> 241 <212> PRT <213> artificial sequence <400> 5 Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu 1 5 10 15 Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Val Ser Ser Gly 20 25 30 Asp Tyr Tyr Trp Thr Trp Ile Arg Gln Ser Pro Gly Lys Gly Leu Glu 35 40 45 Trp Ile Gly His Ile Tyr Tyr Ser Gly Asn Thr Asn Tyr Asn Pro Ser 50 55 60 Leu Lys Ser Arg Leu Thr Ile Ser Ile Asp Thr Ser Lys Thr Gln Phe 65 70 75 80 Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp Thr Ala Ile Tyr Tyr 85 90 95 Cys Val Arg Asp Arg Val Thr Gly Ala Phe Asp Ile Trp Gly Gln Gly 100 105 110 Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr Gln Ser Pro Ser Ser 130 135 140 Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile Thr Cys Gln Ala Ser 145 150 155 160 Gln Asp Ile Ser Asn Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys 165 170 175 Ala Pro Lys Leu Leu Ile Tyr Asp Ala Ser Asn Leu Glu Thr Gly Val 180 185 190 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr 195 200 205 Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr Tyr Phe Cys Gln His 210 215 220 Phe Asp His Leu Pro Leu Ala Phe Gly Gly Gly Thr Lys Val Glu Ile 225 230 235 240 Lys <210> 6 <211> 241 <212> PRT <213> artificial sequence <400> 6 Gln Val Gln Leu Lys Gln Ser Gly Pro Gly Leu Val Gln Pro Ser Gln 1 5 10 15 Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu Thr Asn Tyr 20 25 30 Gly Val His Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Leu 35 40 45 Gly Val Ile Trp Ser Gly Gly Asn Thr Asp Tyr Asn Thr Pro Phe Thr 50 55 60 Ser Arg Leu Ser Ile Asn Lys Asp Asn Ser Lys Ser Gln Val Phe Phe 65 70 75 80 Lys Met Asn Ser Leu Gln Ser Asn Asp Thr Ala Ile Tyr Tyr Cys Ala 85 90 95 Arg Ala Leu Thr Tyr Tyr Asp Tyr Glu Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly Ser Asp Ile Leu Leu Thr Gln Ser Pro Val Ile 130 135 140 Leu Ser Val Ser Pro Gly Glu Arg Val Ser Phe Ser Cys Arg Ala Ser 145 150 155 160 Gln Ser Ile Gly Thr Asn Ile His Trp Tyr Gln Gln Arg Thr Asn Gly 165 170 175 Ser Pro Arg Leu Leu Ile Lys Tyr Ala Ser Glu Ser Ile Ser Gly Ile 180 185 190 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser 195 200 205 Ile Asn Ser Val Glu Ser Glu Asp Ile Ala Asp Tyr Tyr Cys Gln Gln 210 215 220 Asn Asn Asn Trp Pro Thr Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu 225 230 235 240 Lys <210> 7 <211> 375 <212> PRT <213> artificial sequence <400> 7 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu 20 25 30 Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly 35 40 45 Ser Val Ser Ser Gly Asp Tyr Tyr Trp Thr Trp Ile Arg Gln Ser Pro 50 55 60 Gly Lys Gly Leu Glu Trp Ile Gly His Ile Tyr Tyr Ser Gly Asn Thr 65 70 75 80 Asn Tyr Asn Pro Ser Leu Lys Ser Arg Leu Thr Ile Ser Ile Asp Thr 85 90 95 Ser Lys Thr Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp 100 105 110 Thr Ala Ile Tyr Tyr Cys Val Arg Asp Arg Val Thr Gly Ala Phe Asp 115 120 125 Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr 145 150 155 160 Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile 165 170 175 Thr Cys Gln Ala Ser Gln Asp Ile Ser Asn Tyr Leu Asn Trp Tyr Gln 180 185 190 Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Asp Ala Ser Asn 195 200 205 Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr 210 215 220 Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr 225 230 235 240 Tyr Phe Cys Gln His Phe Asp His Leu Pro Leu Ala Phe Gly Gly Gly 245 250 255 Thr Lys Val Glu Ile Lys Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr 260 265 270 Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala 275 280 285 Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe 290 295 300 Ala Cys Asp Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys 305 310 315 320 Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser 325 330 335 Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg 340 345 350 Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg 355 360 365 Asp Phe Ala Ala Tyr Arg Ser 370 375 <210> 8 <211> 373 <212> PRT <213> artificial sequence <400> 8 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu 20 25 30 Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly 35 40 45 Ser Val Ser Ser Gly Asp Tyr Tyr Trp Thr Trp Ile Arg Gln Ser Pro 50 55 60 Gly Lys Gly Leu Glu Trp Ile Gly His Ile Tyr Tyr Ser Gly Asn Thr 65 70 75 80 Asn Tyr Asn Pro Ser Leu Lys Ser Arg Leu Thr Ile Ser Ile Asp Thr 85 90 95 Ser Lys Thr Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp 100 105 110 Thr Ala Ile Tyr Tyr Cys Val Arg Asp Arg Val Thr Gly Ala Phe Asp 115 120 125 Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr 145 150 155 160 Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile 165 170 175 Thr Cys Gln Ala Ser Gln Asp Ile Ser Asn Tyr Leu Asn Trp Tyr Gln 180 185 190 Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Asp Ala Ser Asn 195 200 205 Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr 210 215 220 Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr 225 230 235 240 Tyr Phe Cys Gln His Phe Asp His Leu Pro Leu Ala Phe Gly Gly Gly 245 250 255 Thr Lys Val Glu Ile Lys Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr 260 265 270 Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala 275 280 285 Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe 290 295 300 Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val 305 310 315 320 Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg Lys 325 330 335 Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr 340 345 350 Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu 355 360 365 Gly Gly Cys Glu Leu 370 <210> 9 <211> 375 <212> PRT <213> artificial sequence <400> 9 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Gln Val Gln Leu Lys Gln Ser Gly Pro Gly Leu 20 25 30 Val Gln Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe 35 40 45 Ser Leu Thr Asn Tyr Gly Val His Trp Val Arg Gln Ser Pro Gly Lys 50 55 60 Gly Leu Glu Trp Leu Gly Val Ile Trp Ser Gly Gly Asn Thr Asp Tyr 65 70 75 80 Asn Thr Pro Phe Thr Ser Arg Leu Ser Ile Asn Lys Asp Asn Ser Lys 85 90 95 Ser Gln Val Phe Phe Lys Met Asn Ser Leu Gln Ser Asn Asp Thr Ala 100 105 110 Ile Tyr Tyr Cys Ala Arg Ala Leu Thr Tyr Tyr Asp Tyr Glu Phe Ala 115 120 125 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Leu Leu Thr 145 150 155 160 Gln Ser Pro Val Ile Leu Ser Val Ser Pro Gly Glu Arg Val Ser Phe 165 170 175 Ser Cys Arg Ala Ser Gln Ser Ile Gly Thr Asn Ile His Trp Tyr Gln 180 185 190 Gln Arg Thr Asn Gly Ser Pro Arg Leu Leu Ile Lys Tyr Ala Ser Glu 195 200 205 Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr 210 215 220 Asp Phe Thr Leu Ser Ile Asn Ser Val Glu Ser Glu Asp Ile Ala Asp 225 230 235 240 Tyr Tyr Cys Gln Gln Asn Asn Asn Trp Pro Thr Thr Phe Gly Ala Gly 245 250 255 Thr Lys Leu Glu Leu Lys Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr 260 265 270 Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala 275 280 285 Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe 290 295 300 Ala Cys Asp Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys 305 310 315 320 Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser 325 330 335 Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg 340 345 350 Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg 355 360 365 Asp Phe Ala Ala Tyr Arg Ser 370 375 <210> 10 <211> 373 <212> PRT <213> artificial sequence <400> 10 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Gln Val Gln Leu Lys Gln Ser Gly Pro Gly Leu 20 25 30 Val Gln Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe 35 40 45 Ser Leu Thr Asn Tyr Gly Val His Trp Val Arg Gln Ser Pro Gly Lys 50 55 60 Gly Leu Glu Trp Leu Gly Val Ile Trp Ser Gly Gly Asn Thr Asp Tyr 65 70 75 80 Asn Thr Pro Phe Thr Ser Arg Leu Ser Ile Asn Lys Asp Asn Ser Lys 85 90 95 Ser Gln Val Phe Phe Lys Met Asn Ser Leu Gln Ser Asn Asp Thr Ala 100 105 110 Ile Tyr Tyr Cys Ala Arg Ala Leu Thr Tyr Tyr Asp Tyr Glu Phe Ala 115 120 125 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Leu Leu Thr 145 150 155 160 Gln Ser Pro Val Ile Leu Ser Val Ser Pro Gly Glu Arg Val Ser Phe 165 170 175 Ser Cys Arg Ala Ser Gln Ser Ile Gly Thr Asn Ile His Trp Tyr Gln 180 185 190 Gln Arg Thr Asn Gly Ser Pro Arg Leu Leu Ile Lys Tyr Ala Ser Glu 195 200 205 Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr 210 215 220 Asp Phe Thr Leu Ser Ile Asn Ser Val Glu Ser Glu Asp Ile Ala Asp 225 230 235 240 Tyr Tyr Cys Gln Gln Asn Asn Asn Trp Pro Thr Thr Phe Gly Ala Gly 245 250 255 Thr Lys Leu Glu Leu Lys Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr 260 265 270 Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala 275 280 285 Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe 290 295 300 Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val 305 310 315 320 Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr Cys Lys Arg Gly Arg Lys 325 330 335 Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr 340 345 350 Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu 355 360 365 Gly Gly Cys Glu Leu 370 <210> 11 <211> 487 <212> PRT <213> artificial sequence <400> 11 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu 20 25 30 Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly 35 40 45 Ser Val Ser Ser Gly Asp Tyr Tyr Trp Thr Trp Ile Arg Gln Ser Pro 50 55 60 Gly Lys Gly Leu Glu Trp Ile Gly His Ile Tyr Tyr Ser Gly Asn Thr 65 70 75 80 Asn Tyr Asn Pro Ser Leu Lys Ser Arg Leu Thr Ile Ser Ile Asp Thr 85 90 95 Ser Lys Thr Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp 100 105 110 Thr Ala Ile Tyr Tyr Cys Val Arg Asp Arg Val Thr Gly Ala Phe Asp 115 120 125 Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr 145 150 155 160 Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile 165 170 175 Thr Cys Gln Ala Ser Gln Asp Ile Ser Asn Tyr Leu Asn Trp Tyr Gln 180 185 190 Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Asp Ala Ser Asn 195 200 205 Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr 210 215 220 Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr 225 230 235 240 Tyr Phe Cys Gln His Phe Asp His Leu Pro Leu Ala Phe Gly Gly Gly 245 250 255 Thr Lys Val Glu Ile Lys Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr 260 265 270 Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala 275 280 285 Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe 290 295 300 Ala Cys Asp Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys 305 310 315 320 Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser 325 330 335 Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg 340 345 350 Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg 355 360 365 Asp Phe Ala Ala Tyr Arg Ser Arg Val Lys Phe Ser Arg Ser Ala Asp 370 375 380 Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn 385 390 395 400 Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg 405 410 415 Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly 420 425 430 Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu 435 440 445 Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu 450 455 460 Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His 465 470 475 480 Met Gln Ala Leu Pro Pro Arg 485 <210> 12 <211> 488 <212> PRT <213> Artificial sequence <400> 12 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Gln Val Gln Leu Gln Glu Ser Gly Pro Gly Leu 20 25 30 Val Lys Pro Ser Glu Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly 35 40 45 Ser Val Ser Ser Gly Asp Tyr Tyr Trp Thr Trp Ile Arg Gln Ser Pro 50 55 60 Gly Lys Gly Leu Glu Trp Ile Gly His Ile Tyr Tyr Ser Gly Asn Thr 65 70 75 80 Asn Tyr Asn Pro Ser Leu Lys Ser Arg Leu Thr Ile Ser Ile Asp Thr 85 90 95 Ser Lys Thr Gln Phe Ser Leu Lys Leu Ser Ser Val Thr Ala Ala Asp 100 105 110 Thr Ala Ile Tyr Tyr Cys Val Arg Asp Arg Val Thr Gly Ala Phe Asp 115 120 125 Ile Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr 145 150 155 160 Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile 165 170 175 Thr Cys Gln Ala Ser Gln Asp Ile Ser Asn Tyr Leu Asn Trp Tyr Gln 180 185 190 Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile Tyr Asp Ala Ser Asn 195 200 205 Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr 210 215 220 Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro Glu Asp Ile Ala Thr 225 230 235 240 Tyr Phe Cys Gln His Phe Asp His Leu Pro Leu Ala Phe Gly Gly Gly 245 250 255 Thr Lys Val Glu Ile Lys Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr 260 265 270 Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala 275 280 285 Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe 290 295 300 Ala Cys Asp Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys 305 310 315 320 Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Lys Arg 325 330 335 Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro 340 345 350 Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu 355 360 365 Glu Glu Glu Gly Gly Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala 370 375 380 Asp Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu 385 390 395 400 Asn Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly 405 410 415 Arg Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu 420 425 430 Gly Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser 435 440 445 Glu Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly 450 455 460 Leu Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu 465 470 475 480 His Met Gln Ala Leu Pro Pro Arg 485 <210> 13 <211> 487 <212> PRT <213> artificial sequence <400> 13 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Gln Val Gln Leu Lys Gln Ser Gly Pro Gly Leu 20 25 30 Val Gln Pro Ser Gln Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe 35 40 45 Ser Leu Thr Asn Tyr Gly Val His Trp Val Arg Gln Ser Pro Gly Lys 50 55 60 Gly Leu Glu Trp Leu Gly Val Ile Trp Ser Gly Gly Asn Thr Asp Tyr 65 70 75 80 Asn Thr Pro Phe Thr Ser Arg Leu Ser Ile Asn Lys Asp Asn Ser Lys 85 90 95 Ser Gln Val Phe Phe Lys Met Asn Ser Leu Gln Ser Asn Asp Thr Ala 100 105 110 Ile Tyr Tyr Cys Ala Arg Ala Leu Thr Tyr Tyr Asp Tyr Glu Phe Ala 115 120 125 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ala Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Leu Leu Thr 145 150 155 160 Gln Ser Pro Val Ile Leu Ser Val Ser Pro Gly Glu Arg Val Ser Phe 165 170 175 Ser Cys Arg Ala Ser Gln Ser Ile Gly Thr Asn Ile His Trp Tyr Gln 180 185 190 Gln Arg Thr Asn Gly Ser Pro Arg Leu Leu Ile Lys Tyr Ala Ser Glu 195 200 205 Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr 210 215 220 Asp Phe Thr Leu Ser Ile Asn Ser Val Glu Ser Glu Asp Ile Ala Asp 225 230 235 240 Tyr Tyr Cys Gln Gln Asn Asn Asn Trp Pro Thr Thr Phe Gly Ala Gly 245 250 255 Thr Lys Leu Glu Leu Lys Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr 260 265 270 Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala 275 280 285 Cys Arg Pro Ala Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe 290 295 300 Ala Cys Asp Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys 305 310 315 320 Tyr Ser Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser 325 330 335 Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg 340 345 350 Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg 355 360 365 Asp Phe Ala Ala Tyr Arg Ser Arg Val Lys Phe Ser Arg Ser Ala Asp 370 375 380 Ala Pro Ala Tyr Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn 385 390 395 400 Leu Gly Arg Arg Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg 405 410 415 Asp Pro Glu Met Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly 420 425 430 Leu Tyr Asn Glu Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu 435 440 445 Ile Gly Met Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu 450 455 460 Tyr Gln Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His 465 470 475 480 Met Gln Ala Leu Pro Pro Arg 485 <210> 14 <211> 467 <212> PRT <213> artificial sequence <400> 14 Gln Val Gln Leu Lys Gln Ser Gly Pro Gly Leu Val Gln Pro Ser Gln 1 5 10 15 Ser Leu Ser Ile Thr Cys Thr Val Ser Gly Phe Ser Leu Thr Asn Tyr 20 25 30 Gly Val His Trp Val Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Leu 35 40 45 Gly Val Ile Trp Ser Gly Gly Asn Thr Asp Tyr Asn Thr Pro Phe Thr 50 55 60 Ser Arg Leu Ser Ile Asn Lys Asp Asn Ser Lys Ser Gln Val Phe Phe 65 70 75 80 Lys Met Asn Ser Leu Gln Ser Asn Asp Thr Ala Ile Tyr Tyr Cys Ala 85 90 95 Arg Ala Leu Thr Tyr Tyr Asp Tyr Glu Phe Ala Tyr Trp Gly Gln Gly 100 105 110 Thr Leu Val Thr Val Ser Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly 115 120 125 Ser Gly Gly Gly Gly Ser Asp Ile Leu Leu Thr Gln Ser Pro Val Ile 130 135 140 Leu Ser Val Ser Pro Gly Glu Arg Val Ser Phe Ser Cys Arg Ala Ser 145 150 155 160 Gln Ser Ile Gly Thr Asn Ile His Trp Tyr Gln Gln Arg Thr Asn Gly 165 170 175 Ser Pro Arg Leu Leu Ile Lys Tyr Ala Ser Glu Ser Ile Ser Gly Ile 180 185 190 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser 195 200 205 Ile Asn Ser Val Glu Ser Glu Asp Ile Ala Asp Tyr Tyr Cys Gln Gln 210 215 220 Asn Asn Asn Trp Pro Thr Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu 225 230 235 240 Lys Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile 245 250 255 Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala 260 265 270 Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe Trp 275 280 285 Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val 290 295 300 Thr Val Ala Phe Ile Ile Phe Trp Val Lys Arg Gly Arg Lys Lys Leu 305 310 315 320 Leu Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln 325 330 335 Glu Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly 340 345 350 Cys Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr 355 360 365 Gln Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg 370 375 380 Glu Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met 385 390 395 400 Gly Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu 405 410 415 Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys 420 425 430 Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu 435 440 445 Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu 450 455 460 Pro Pro Arg 465 <210> 15 <211> 21 <212> PRT <213> Artificial sequence <400> 15 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro 20 <210> 16 <211> 45 <212> PRT <213> Artificial sequence <400> 16 Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala 1 5 10 15 Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly 20 25 30 Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp 35 40 45 <210> 17 <211> 24 <212> PRT <213> artificial sequence <400> 17 Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu 1 5 10 15 Ser Leu Val Ile Thr Leu Tyr Cys 20 <210> 18 <211> 27 <212> PRT <213> artificial sequence <400> 18 Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu 1 5 10 15 Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val 20 25 <210> 19 <211> 41 <212> PRT <213> artificial sequence <400> 19 Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met Thr 1 5 10 15 Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr Ala Pro 20 25 30 Pro Arg Asp Phe Ala Ala Tyr Arg Ser 35 40 <210> 20 <211> 42 <212> PRT <213> artificial sequence <400> 20 Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe Met 1 5 10 15 Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg Phe 20 25 30 Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu 35 40 <210> 21 <211> 112 <212> PRT <213> artificial sequence <400> 21 Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly 1 5 10 15 Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr 20 25 30 Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys 35 40 45 Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys 50 55 60 Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg 65 70 75 80 Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala 85 90 95 Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg 100 105 110 <210> 22 <211> 845 <212> PRT <213> artificial sequence <400> 22 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu 20 25 30 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr 35 40 45 Thr Phe Thr Ser Tyr Trp Leu His Trp Val Arg Gln Ala Pro Gly Lys 50 55 60 Gly Leu Glu Trp Val Gly Met Ile Asp Pro Ser Asn Ser Asp Thr Arg 65 70 75 80 Phe Asn Pro Asn Phe Lys Asp Arg Phe Thr Ile Ser Ala Asp Thr Ser 85 90 95 Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr 100 105 110 Ala Val Tyr Tyr Cys Ala Thr Tyr Arg Ser Tyr Val Thr Pro Leu Asp 115 120 125 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr 145 150 155 160 Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile 165 170 175 Thr Cys Lys Ser Ser Gln Ser Leu Leu Tyr Thr Ser Ser Gln Lys Asn 180 185 190 Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 195 200 205 Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Ser Arg Phe Ser 210 215 220 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln 225 230 235 240 Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ala Tyr Pro 245 250 255 Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Thr Thr Thr Pro 260 265 270 Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu 275 280 285 Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His 290 295 300 Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu 305 310 315 320 Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr 325 330 335 Cys Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln 340 345 350 Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu 355 360 365 Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly 370 375 380 Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln 385 390 395 400 Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu 405 410 415 Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr 420 425 430 Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro 435 440 445 Arg Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val 450 455 460 Glu Glu Asn Pro Gly Pro Met Ala Leu Pro Val Thr Ala Leu Leu Leu 465 470 475 480 Pro Leu Ala Leu Leu Leu His Ala Ala Arg Pro Gln Val Gln Leu Gln 485 490 495 Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr 500 505 510 Cys Thr Val Ser Gly Gly Ser Val Ser Ser Gly Asp Tyr Tyr Trp Thr 515 520 525 Trp Ile Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Ile Gly His Ile 530 535 540 Tyr Tyr Ser Gly Asn Thr Asn Tyr Asn Pro Ser Leu Lys Ser Arg Leu 545 550 555 560 Thr Ile Ser Ile Asp Thr Ser Lys Thr Gln Phe Ser Leu Lys Leu Ser 565 570 575 Ser Val Thr Ala Ala Asp Thr Ala Ile Tyr Tyr Cys Val Arg Asp Arg 580 585 590 Val Thr Gly Ala Phe Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val 595 600 605 Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 610 615 620 Ser Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val 625 630 635 640 Gly Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Asp Ile Ser Asn 645 650 655 Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 660 665 670 Ile Tyr Asp Ala Ser Asn Leu Glu Thr Gly Val Pro Ser Arg Phe Ser 675 680 685 Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln 690 695 700 Pro Glu Asp Ile Ala Thr Tyr Phe Cys Gln His Phe Asp His Leu Pro 705 710 715 720 Leu Ala Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Thr Thr Thr Pro 725 730 735 Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu 740 745 750 Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His 755 760 765 Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe Trp Val Leu Val Val Val 770 775 780 Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile 785 790 795 800 Ile Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr 805 810 815 Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln 820 825 830 Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser 835 840 845 <210> 23 <211> 845 <212> PRT <213> Artificial Sequence <400> 23 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu 20 25 30 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr 35 40 45 Thr Phe Thr Ser Tyr Trp Leu His Trp Val Arg Gln Ala Pro Gly Lys 50 55 60 Gly Leu Glu Trp Val Gly Met Ile Asp Pro Ser Asn Ser Asp Thr Arg 65 70 75 80 Phe Asn Pro Asn Phe Lys Asp Arg Phe Thr Ile Ser Ala Asp Thr Ser 85 90 95 Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr 100 105 110 Ala Val Tyr Tyr Cys Ala Thr Tyr Arg Ser Tyr Val Thr Pro Leu Asp 115 120 125 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr 145 150 155 160 Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile 165 170 175 Thr Cys Lys Ser Ser Gln Ser Leu Leu Tyr Thr Ser Ser Gln Lys Asn 180 185 190 Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 195 200 205 Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Ser Arg Phe Ser 210 215 220 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln 225 230 235 240 Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ala Tyr Pro 245 250 255 Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Thr Thr Thr Pro 260 265 270 Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu 275 280 285 Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His 290 295 300 Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu 305 310 315 320 Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr 325 330 335 Cys Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln 340 345 350 Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu 355 360 365 Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly 370 375 380 Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln 385 390 395 400 Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu 405 410 415 Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr 420 425 430 Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro 435 440 445 Arg Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val 450 455 460 Glu Glu Asn Pro Gly Pro Met Ala Leu Pro Val Thr Ala Leu Leu Leu 465 470 475 480 Pro Leu Ala Leu Leu Leu His Ala Ala Arg Pro Gln Val Gln Leu Lys 485 490 495 Gln Ser Gly Pro Gly Leu Val Gln Pro Ser Gln Ser Leu Ser Ile Thr 500 505 510 Cys Thr Val Ser Gly Phe Ser Leu Thr Asn Tyr Gly Val His Trp Val 515 520 525 Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Ser 530 535 540 Gly Gly Asn Thr Asp Tyr Asn Thr Pro Phe Thr Ser Arg Leu Ser Ile 545 550 555 560 Asn Lys Asp Asn Ser Lys Ser Gln Val Phe Phe Lys Met Asn Ser Leu 565 570 575 Gln Ser Asn Asp Thr Ala Ile Tyr Tyr Cys Ala Arg Ala Leu Thr Tyr 580 585 590 Tyr Asp Tyr Glu Phe Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 595 600 605 Ser Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 610 615 620 Ser Asp Ile Leu Leu Thr Gln Ser Pro Val Ile Leu Ser Val Ser Pro 625 630 635 640 Gly Glu Arg Val Ser Phe Ser Cys Arg Ala Ser Gln Ser Ile Gly Thr 645 650 655 Asn Ile His Trp Tyr Gln Gln Arg Thr Asn Gly Ser Pro Arg Leu Leu 660 665 670 Ile Lys Tyr Ala Ser Glu Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser 675 680 685 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile Asn Ser Val Glu 690 695 700 Ser Glu Asp Ile Ala Asp Tyr Tyr Cys Gln Gln Asn Asn Asn Trp Pro 705 710 715 720 Thr Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Thr Thr Thr Pro 725 730 735 Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu 740 745 750 Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His 755 760 765 Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe Trp Val Leu Val Val Val 770 775 780 Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu Val Thr Val Ala Phe Ile 785 790 795 800 Ile Phe Trp Val Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr 805 810 815 Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln 820 825 830 Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser 835 840 845 <210> 24 <211> 843 <212> PRT <213> artificial sequence <400> 24 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu 20 25 30 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr 35 40 45 Thr Phe Thr Ser Tyr Trp Leu His Trp Val Arg Gln Ala Pro Gly Lys 50 55 60 Gly Leu Glu Trp Val Gly Met Ile Asp Pro Ser Asn Ser Asp Thr Arg 65 70 75 80 Phe Asn Pro Asn Phe Lys Asp Arg Phe Thr Ile Ser Ala Asp Thr Ser 85 90 95 Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr 100 105 110 Ala Val Tyr Tyr Cys Ala Thr Tyr Arg Ser Tyr Val Thr Pro Leu Asp 115 120 125 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr 145 150 155 160 Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile 165 170 175 Thr Cys Lys Ser Ser Gln Ser Leu Leu Tyr Thr Ser Ser Gln Lys Asn 180 185 190 Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 195 200 205 Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Ser Arg Phe Ser 210 215 220 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln 225 230 235 240 Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ala Tyr Pro 245 250 255 Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Thr Thr Thr Pro 260 265 270 Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu 275 280 285 Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His 290 295 300 Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu 305 310 315 320 Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr 325 330 335 Cys Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln 340 345 350 Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu 355 360 365 Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly 370 375 380 Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln 385 390 395 400 Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu 405 410 415 Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr 420 425 430 Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro 435 440 445 Arg Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val 450 455 460 Glu Glu Asn Pro Gly Pro Met Ala Leu Pro Val Thr Ala Leu Leu Leu 465 470 475 480 Pro Leu Ala Leu Leu Leu His Ala Ala Arg Pro Gln Val Gln Leu Gln 485 490 495 Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu Thr Leu Ser Leu Thr 500 505 510 Cys Thr Val Ser Gly Gly Ser Val Ser Ser Gly Asp Tyr Tyr Trp Thr 515 520 525 Trp Ile Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Ile Gly His Ile 530 535 540 Tyr Tyr Ser Gly Asn Thr Asn Tyr Asn Pro Ser Leu Lys Ser Arg Leu 545 550 555 560 Thr Ile Ser Ile Asp Thr Ser Lys Thr Gln Phe Ser Leu Lys Leu Ser 565 570 575 Ser Val Thr Ala Ala Asp Thr Ala Ile Tyr Tyr Cys Val Arg Asp Arg 580 585 590 Val Thr Gly Ala Phe Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val 595 600 605 Ser Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 610 615 620 Ser Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val 625 630 635 640 Gly Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Asp Ile Ser Asn 645 650 655 Tyr Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 660 665 670 Ile Tyr Asp Ala Ser Asn Leu Glu Thr Gly Val Pro Ser Arg Phe Ser 675 680 685 Gly Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln 690 695 700 Pro Glu Asp Ile Ala Thr Tyr Phe Cys Gln His Phe Asp His Leu Pro 705 710 715 720 Leu Ala Phe Gly Gly Gly Thr Lys Val Glu Ile Lys Thr Thr Thr Pro 725 730 735 Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu 740 745 750 Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His 755 760 765 Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu 770 775 780 Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr 785 790 795 800 Cys Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe 805 810 815 Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg 820 825 830 Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu 835 840 <210> 25 <211> 843 <212> PRT <213> Artificial sequence <400> 25 Met Ala Leu Pro Val Thr Ala Leu Leu Leu Pro Leu Ala Leu Leu Leu 1 5 10 15 His Ala Ala Arg Pro Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu 20 25 30 Val Gln Pro Gly Gly Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr 35 40 45 Thr Phe Thr Ser Tyr Trp Leu His Trp Val Arg Gln Ala Pro Gly Lys 50 55 60 Gly Leu Glu Trp Val Gly Met Ile Asp Pro Ser Asn Ser Asp Thr Arg 65 70 75 80 Phe Asn Pro Asn Phe Lys Asp Arg Phe Thr Ile Ser Ala Asp Thr Ser 85 90 95 Lys Asn Thr Ala Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr 100 105 110 Ala Val Tyr Tyr Cys Ala Thr Tyr Arg Ser Tyr Val Thr Pro Leu Asp 115 120 125 Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Gly Gly Gly Gly 130 135 140 Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Ile Gln Met Thr 145 150 155 160 Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly Asp Arg Val Thr Ile 165 170 175 Thr Cys Lys Ser Ser Gln Ser Leu Leu Tyr Thr Ser Ser Gln Lys Asn 180 185 190 Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu 195 200 205 Ile Tyr Trp Ala Ser Thr Arg Glu Ser Gly Val Pro Ser Arg Phe Ser 210 215 220 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln 225 230 235 240 Pro Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln Tyr Tyr Ala Tyr Pro 245 250 255 Trp Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys Thr Thr Thr Pro 260 265 270 Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu 275 280 285 Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His 290 295 300 Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu 305 310 315 320 Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr 325 330 335 Cys Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln 340 345 350 Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu 355 360 365 Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly 370 375 380 Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln 385 390 395 400 Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu 405 410 415 Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr 420 425 430 Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro 435 440 445 Arg Gly Ser Gly Glu Gly Arg Gly Ser Leu Leu Thr Cys Gly Asp Val 450 455 460 Glu Glu Asn Pro Gly Pro Met Ala Leu Pro Val Thr Ala Leu Leu Leu 465 470 475 480 Pro Leu Ala Leu Leu Leu His Ala Ala Arg Pro Gln Val Gln Leu Lys 485 490 495 Gln Ser Gly Pro Gly Leu Val Gln Pro Ser Gln Ser Leu Ser Ile Thr 500 505 510 Cys Thr Val Ser Gly Phe Ser Leu Thr Asn Tyr Gly Val His Trp Val 515 520 525 Arg Gln Ser Pro Gly Lys Gly Leu Glu Trp Leu Gly Val Ile Trp Ser 530 535 540 Gly Gly Asn Thr Asp Tyr Asn Thr Pro Phe Thr Ser Arg Leu Ser Ile 545 550 555 560 Asn Lys Asp Asn Ser Lys Ser Gln Val Phe Phe Lys Met Asn Ser Leu 565 570 575 Gln Ser Asn Asp Thr Ala Ile Tyr Tyr Cys Ala Arg Ala Leu Thr Tyr 580 585 590 Tyr Asp Tyr Glu Phe Ala Tyr Trp Gly Gln Gly Thr Leu Val Thr Val 595 600 605 Ser Ala Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly 610 615 620 Ser Asp Ile Leu Leu Thr Gln Ser Pro Val Ile Leu Ser Val Ser Pro 625 630 635 640 Gly Glu Arg Val Ser Phe Ser Cys Arg Ala Ser Gln Ser Ile Gly Thr 645 650 655 Asn Ile His Trp Tyr Gln Gln Arg Thr Asn Gly Ser Pro Arg Leu Leu 660 665 670 Ile Lys Tyr Ala Ser Glu Ser Ile Ser Gly Ile Pro Ser Arg Phe Ser 675 680 685 Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Ser Ile Asn Ser Val Glu 690 695 700 Ser Glu Asp Ile Ala Asp Tyr Tyr Cys Gln Gln Asn Asn Asn Trp Pro 705 710 715 720 Thr Thr Phe Gly Ala Gly Thr Lys Leu Glu Leu Lys Thr Thr Thr Pro 725 730 735 Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr Ile Ala Ser Gln Pro Leu 740 745 750 Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala Ala Gly Gly Ala Val His 755 760 765 Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile Tyr Ile Trp Ala Pro Leu 770 775 780 Ala Gly Thr Cys Gly Val Leu Leu Leu Ser Leu Val Ile Thr Leu Tyr 785 790 795 800 Cys Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro Phe 805 810 815 Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser Cys Arg 820 825 830 Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu 835 840 <210> 26 <211> 2538 <212> DNA <213> artificial sequence <400> 26 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccggaggtgc agctggtgga gtccggcgga ggactggtgc aacctggcgg aagcctcagg 120 ctcagctgtg ccgctagcgg atacacattc acctcctact ggctccactg ggtgagacag 180 gcccctggca agggactgga gtgggtcgga atgatcgacc cttccaatag cgacaccagg 240 ttcacccca acttcagga taggttcaca atctccgccg acaccagcaa gatacccgct 300 tacctgcaga tgaattccct gagggctgag gataccgccg tgtactactg cgccacatac 360 agaagctacg tgaccctct ggactactgg ggccaggca cactgtgac agtgtccagc 420 ggaggagggagggagggagggagggagggagggagggagatcgacat ccagatgaca 480 cagagccctt cctccctgag cgctagcgtg ggagacaggg tgaccatcac ctgtaagagc 540 tcccagtccc tgctgtacac ctccagccag aagaattacc tgcctgta ccagcagaag 600 cccggaaag ccccaagct gctgatctac tgggctagca caagagtc cggcgtgccc 660 agcagattta gcggcagcgg atccggcacc gactttaccc tgacaatcag cagcctccag 720 cctgaagact tcgccaccta ctactgccag cagtactacg cctaccttg gaccttcggc 780 aaggcacaa aggtggagat haaggcacg acgccagcgc cgcgaccacc aacaccggcg 840 cccaccatcg cgtcgcagcc cctgtccctg cgcccagagg cgtgccggcc agcggcgggg 900 ggcgcagtgc acacgagggg gctggacttc gcctgtgata tctacatctg ggcgcccttg 960 gccgggactt gtggggtcct tctcctgtca ctggttatca ccctttactg cagagtgaag 1020 1080 ctcaatctag your hand ggagtacgat gttttggaca agagacgtgg ccgggaccct 1140 gagatggggg gaaagccgag aaagaac cctcaggaag gcctgtacaa tgaactgcag 1200 aaagataaga tggcggaggc ctacagtgag attgggatga aaggcgagcg ccggaggggc 1260 aaggggcacg atggccttta ccagggtctc agtacagcca ccaaggacac ctacgacgcc 1320 cttcacatgc aggccctgcc ccctcgcggc ggcggcgagg gcagaggag tctgctaaca 1380 tgcggtgacg tcgaggagaa tcctggccca atggccttac cagtgaccgc cttgctcctg 1440 ccgctggcct tgctgctcca cgccgccagg ccgcaagtgc aactgcaaga gtccggaccc 1500 ggactggtga agcccagcga gacactgtct ctgacatgta cagtgtccgg aggatccgtg 1560 tcctccggcg actattactg gacatggatc agacagtccc ccggcaaggg actggagtgg 1620 atcggacaca tctactattc cggcaacacc aactacaacc cctctctgaa gagcagactg 1680 accatcagca tcgacacccctc caacccag tttctctga agctgagctc cgtgaccgct 1740 gccgacacag ccatctacta ctgcgtgagg gatagagtga ccggcgcctt tgacattttgg 1800 ggacaaggca ccatggtgac cgtcagcagc ggaggaggag gaagcggcgg aggaggcagc 1860 ggaggcggag gaagcgacat ccagatgacc cagagcccta gctctctgag cgctagcgtg 1920 ggcgacagag tgaccatcac atgccaagcc tcccagaca ttcacta tctgaactgg 1980 taccagcaga aacccggcaag ggcccccaag ctgctgattt acgacgccag caatctggag 2040 accggcgtgc cttctagatt tagcggcagc ggatccggca ccgactcac attcaccatc 2100 tcctctctgc aacccgagga catcgccacc tactctgcc aacactttga ccatctgcct 2160 ctggcctttg gcggaggcac caggtggag atcagacca cgacgccagc gccgcgacca 2220 ccaacaccgg cgcccaccat cgcgtcgcag cccctgtccc tgcgcccaga ggcgtgccgg 2280 ccagcggcgg ggggcgcagt gcacacgagg gggctggact tcgcctgtga tttgggtg 2340 ctggtggtgg tgggggt cctggcttgc tatagcttgc tagtacagt ggcctttatt 2400 attttctggg tgaggagtaa gaggagcagg ctcctgcaca gtgactacat gaacatgact ccccgccgcc ccgggcccac ccgcaagcat taccagccct atgccccacc acgcgacttc 2520 gcagcctatc gctcctga 2538 <210> 27 <211> 2538 <212> DNA <213> singular sequence (artificial sequence) <400> 27 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg ccggaggtgc agctggtgga gtccggcgga ggactggtgc aacctggcgg aagcctcagg 120 180. ctcagctgtg ccgctagcgg atacacattc acctcctact ggctccactg ggtgagacag gccctggca agggactgga gtgggtcgga atgatcgacc cttccaatag cgacaccagg 240 ttcaacccca acttcaagga tagttcaca atctccgccg acaccagca gaataccgct 360. tacctgcaga tgaattccct gagggctgag gacaccgccg tgtactactg cgccacatac agaagctacg tgacccctct ggactactgg ggccagggca cactggtgac agtgtccagc 420 ggaggaggag gaagcggagg aggaggcagc ggaggaggag gatccgacat ccagatgaca cagagccctt cctccctgag cgctagcgtg ggagacaggg tgaccatcac ctgtaagagc 540 tcccagtccc tgctctacac ctccagccag aagaattacc tggcctggta ccagcagaag 600 cccggaaaag cccccaagct gctgatctac tgggctagca caagagagtc cggcgtgccc 660 agcagattta gcggcagcgg atccggcacc gactttaccc tgacaatcag cagcctccag 720 cctgaagaact tcgccaccta ctactgccag footactacg cctatccttg gaccttcggc 780 caagcacaa aggtggagat caagaccacg acgccagcgc cgcgaccacc aacaccggcg 840 cccaccatcg cgtcgcagcc cctgtccctg cgcccagagg cgtgccggcc agcggcgggg 900 ggcgcagtgc acacgagggg gctggacttc gcctgtgata tctacatctg ggcgcccttg 960 gccgggactt gtggggtcct tctcctgtca ctggttatca ccctttactg cagagtgaag 1020 1080 ctcaatctag your hand ggagtacgat gttttggaca agagacgtgg ccgggaccct 1140 gagatggggg gaaagccgag aaagaac cctcaggaag gcctgtacaa tgaactgcag 1200 aaagataaga tggcggaggc ctacagtgag attgggatga aaggcgagcg ccggaggggc 1260 aaggggcacg atggccttta ccagggtctc agtacagcca ccaaggacac ctacgacgcc 1320 cttcacatgc aggccctgcc ccctcgcggc ggcggcgagg gcagaggaag tctgctaaca 1380 tgcggtgacg tcgaggagaa tcctggccca atggccttac cagtgaccgc cttgctcctg 1440 ccgctggcct tgctgctcca cgccgccagg ccgcaagtgc aacttaaaca atcaggacct 1500 ggacttgtgc aaccttcaca atccctctct attacttgta cagtgtcagg attcagcttg 1560 acaaactacg gagtgcactg ggtgagacaa tcacctggaa agggtctaga atggcttgga 1620 gtgatctggt caggaggaaa cacagattac aacacaccgt ttacctcgcg cctgtcaatt 1680 aataaggaca actccaagtc gcaggtgttc ttcaaaatga attcacttca atcaaacgat 1740 acagcaatct actactgcgc aagagcactt acatactacg attacgaatt tgcatactgg 1800 ggtcagggaa cacttgtgac agtgtcagct ggtggcggtg gcagcggcgg tggcggctcc 1860 ggtggaggcg gctcagatat tcttcttaca caatcacctg tgatcctttc agtgtcacct 1920 ggagaaagag tgtcattctc ttgtagagca tcacaatcaa tcggaacaaa catccactgg 1980 taccaacaaa gaacaaacgg atcacctaga cttcttatca aatacgcatc agaatcaatc 2040 tcaggaatcc cttcaagatt cagtggctca ggatcaggaa cagatttcac gctttcgatc 2100 aactctgtag aatcagaaga tatcgcagat tactactgcc aacaaaacaa caactggcct 2160 acaacatttg gagcaggaac aaagttggag cttaaaacca cgacgccagc gccgcgacca 2220 ccaacaccgg cgcccaccat cgcgtcgcag cccctgtccc tgcgcccaga ggcgtgccgg 2280 ccagcggcgg ggggcgcagt gcacacgagg gggctggact tcgcctgtga tttttgggtg 2340 ctggtggtgg ttgggggagt cctggcttgc tatagcttgc tagtaacagt ggcctttatt 2400 attttctggg tgaggagtaa gaggagcagg ctcctgcaca gtgactacat gaacatgact 2460 ccccgccgcc ccgggcccac ccgcaagcat taccagccct atgccccacc acgcgacttc 2520 gcagcctatc gctcctga 2538 <210> 28 <211> 2532 <212> DNA <213> Artificial Sequence <400> 28 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccggaggtgc agctggtgga gtccggcgga ggactgtgc aacctggcgg aagcctcagg 120 ctcagctgtg ccgctagcgg atacacattc acctcctact ggctccactg ggtgagacag 180 gcccctggca agggactgga gtgggtcgga atgatcgacc cttccaatag cgacaccagg 240 ttcacccca acttcagga taggttcaca atctccgccg acaccagcaa gatacccgct 300 tacctgcaga tgaattccct gagggctgag gataccgccg tgtactactg cgccacatac 360 agaagctacg tgaccctct ggactactgg ggccaggca cactgtgac agtgtccagc 420 ggaggagggagggagggagggagggagggagggagggagatcgacat ccagatgaca 480 cagagccctt cctccctgag cgctagcgtg ggagacaggg tgaccatcac ctgtaagagc 540 tcccagtccc tgctgtacac ctccagccag aagaattacc tgcctgta ccagcagaag 600 cccggaaag ccccaagct gctgatctac tgggctagca caagagtc cggcgtgccc 660 agcagattta gcggcagcgg atccggcacc gactttaccc tgacaatcag cagcctccag 720 cctgaagaact tcgccaccta ctactgccag footactacg cctatccttg gaccttcggc 780 caagcacaa aggtggagat caagaccacg acgccagcgc cgcgaccacc aacaccggcg 840 cccaccatcg cgtcgcagcc cctgtccctg cgcccagagg cgtgccggcc agcggcgggg 900 ggcgcagtgc acacgagggg gctggacttc gcctgtgata tctacatctg ggcgcccttg 960 gccgggactt gtggggtcct tctcctgtca ctggttatca ccctttactg cagagtgaag 1020 1080 ctcaatctag your hand ggagtacgat gttttggaca agagacgtgg ccgggaccct 1140 gagatggggg gaaagccgag aaagaac cctcaggaag gcctgtacaa tgaactgcag 1200 aaagataaga tggcggaggc ctacagtgag attgggatga aaggcgagcg ccggaggggc 1260 aaggggcacg atggccttta ccagggtctc agtacagcca ccaaggacac ctacgacgcc 1320 cttcacatgc aggccctgcc ccctcgcggc ggcggcgagg gcagaggag tctgctaaca 1380 tgcggtgacg tcgaggagaa tcctggccca atggccttac cagtgaccgc cttgctcctg 1440 ccgctggcct tgctgctcca cgccgccagg ccgcaagtgc aactgcaaga gtccggacccc 1500 ggactggtga agcccagcga gandactgtct ctgacatgta cagtgtccgg aggatccgtg 1560 tcctccggcg actattactg gatatgatc agacagtccc ccggcaaggg actggagtgg 1620 atcggacaca tctactc cggcaacc aactacaacc cctctgaa gagcagactg 1680 accatcagca tcgacacccctc caacccag tttctctga agctgagctc cgtgaccgct 1740 gccgacacag ccatctacta ctgcgtgagg gatagagtga ccggcgcctt tgacattttgg 1800 ggacaaggca ccatggtgac cgtcagcagc ggaggaggag gaagcggcgg aggaggcagc 1860 ggaggcggag gaagcgacat ccagatgacc cagagcccta gctctctgag cgctagcgtg 1920 ggcgacagag tgaccatcac atgccaagcc tcccagaca ttcacta tctgaactgg 1980 taccagcaga aacccggcaag ggcccccaag ctgctgattt acgacgccag caatctggag 2040 accggcgtgc cttctagatt tagcggcagc ggatccggca ccgactcac attcaccatc 2100 tcctctctgc aacccgagga catcgccacc tactctgcc aacactttga ccatctgcct 2160 ctggcctttg gcggaggcac caaggtggag atcaagacca cgacgccagc gccgcgacca 2220 ccaacaccgg cgcccaccat cgcgtcgcag cccctgtccc tgcgcccaga ggcgtgccgg 2280 ccagcggcgg ggggcgcagt gcacacgagg gggctggact tcgcctgtga tatctacatc 2340 tgggcgccct tggccgggac ttgtggggtc cttctcctgt cactggttat caccctttac 2400 tgcaaacggg gcagaaagaa actcctgtat atattcaaac aaccatttat gagaccagta 2460 caaactactc aagaggaaga tggctgtagc tgccgatttc cagaagaaga agaaggagga 2520 tgtgaactgt ga 2532 <210> 29 <211> 2532 <212> DNA <213> Artificial Sequence <400> 29 atggccttac cagtgaccgc cttgctcctg ccgctggcct tgctgctcca cgccgccagg 60 ccggaggtgc agctggtgga gtccggcgga ggactggtgc aacctggcgg aagcctcagg 120 ctcagctgtg ccgctagcgg atacacattc acctcctact ggctccactg ggtgagacag 180 gcccctggca agggactgga gtgggtcgga atgatcgacc cttccaatag cgacaccagg 240 ttcacccca acttcagga taggttcaca atctccgccg acaccagcaa gatacccgct 300 tacctgcaga tgaattccct gagggctgag gataccgccg tgtactactg cgccacatac 360 agaagctacg tgaccctct ggactactgg ggccaggca cactgtgac agtgtccagc 420 ggaggagggagggagggagggagggagggagggagggagatcgacat ccagatgaca 480 cagagccctt cctccctgag cgctagcgtg ggagacaggg tgaccatcac ctgtaagagc 540 tcccagtccc tgctgtacac ctccagccag aagaattacc tgcctgta ccagcagaag 600 cccggaaag ccccaagct gctgatctac tgggctagca caagagtc cggcgtgccc 660 agcagattta gcggcagcgg atccggcacc gactttaccc tgacaatcag cagcctccag 720 cctgaagact tcgccaccta ctactgccag cagtactacg cctaccttg gaccttcggc 780 aaggcacaa aggtggagat haaggcacg acgccagcgc cgcgaccacc aacaccggcg 840 cccaccatcg cgtcgcagcc cctgtccctg cgcccagagg cgtgccggcc agcggcgggg 900 ggcgcagtgc acacgagggg gctggacttc gcctgtgata tctacatctg ggcgcccttg 960 gccgggactt gtggggtcct tctcctgtca ctggttatca ccctttactg cagagtgaag 1020 1080 ctcaatctag your hand ggagtacgat gttttggaca agagacgtgg ccgggaccct 1140 gagatggggg gaaagccgag aaagaac cctcaggaag gcctgtacaa tgaactgcag 1200 aaagataaga tggcggaggc ctacagtgag attgggatga aaggcgagcg ccggaggggc 1260 aaggggcacg atggccttta ccagggtctc agtacagcca ccaaggacac ctacgacgcc 1320 cttcacatgc aggccctgcc ccctcgcggc ggcggcgagg gcagaggag tctgctaaca 1380 tgcggtgacg tcgaggagaa tcctggccca atggccttac cagtgaccgc cttgctcctg 1440 ccgctggcct tgctgctcca cgccgccagg ccgcaagtgc aacttaaaca atcaggacct 1500 ggacttgtgc aaccttcaca atccctctct attacttgta cagtgtcagg attcagcttg 1560 1620 gtgatctggt cagaggaa cacagattac aacacaccgt ttacctcgcg cctgtcaatt 1680 aataggaca actccaagtc gcaggtgttc ttcaaaatga attcacttca atcaaacgat acagcaatct actactgcgc aagagcactt acatactcg attack tgcatactgg ggtcaggga cacttgtgac agtgtcagct ggtggcggtg gcagcggcgg tggcggctcc ggtggaggcg gctcagatat tcttcttaca caatcacctg tgatccttc agtgtcacct 1920. ggagaaagag tgtcattctc ttgtaggca tcacaatcaa tcggaacaaa catccactgg 2040. 2040. 2040. 2040. 2040. 2040. 2040. 2040 tcaggaatcc cttcaagatt cagtggctca ggatcagga cagatttcac gctttcgatc aactctgtag aatcagaaga tatcgcagat tactactgcc aacaaaacaa caactggcct acaacatttg gagcaggac aaagttggag cttaaaacca cgacgccagc gccgcgacca ccaacaccgg cgcccaccat cgcgtcgcag cccctgtccc tgcgcccaga ggcgtgccgg 2280 ccagcggcgg ggggcgcagt gcacacgagg gggctggact tcgcctgtga tatctacatc 2340 tggggcgccct tggccggggac ttgtggggtc cttctcctgt cactggttat caccctttac 2400 tgcaaacggg gcagaaagaa actcctgtat atattcaaac aaccatttat gagaccagaga 2460 caaactactc aagagaagaa tggctgtagc tgccgatttc cagaagaaga agaaggaga 2520 tgtgaactgt ga 2532

Claims

1. An engineered immune cell, characterized in that: The engineered immune cell expresses a first CAR and a second CAR, the first CAR targets a first tumor cell marker, the second CAR targets a second tumor cell marker, the first tumor cell marker is cMet; the second tumor cell marker is EGFR; The structure of the first CAR is shown in Formula I: L1-S1-H1-TM1-C1-CD3ζ(I) In the formula, the "-" is a connecting peptide or a peptide bond; L1 is none or the first signal peptide sequence; S1 is an antigen binding domain targeting a first tumor cell marker, wherein the first tumor cell marker is cMet; H1 is the first hinge region; TM1 is the first transmembrane domain; C1 is None; CD3ζ is a cytoplasmic signaling sequence derived from CD3ζ; The structure of the second CAR is shown in Formula II: L2-S2-H2-TM2-C2-Z2(II) In the formula, the "-" is a connecting peptide or a peptide bond; L2 is none or a second signal peptide sequence; S2 is an antigen binding domain targeting a second tumor cell marker, and the second tumor cell marker is EGFR; H2 is the second hinge region; TM2 is the second transmembrane domain; C2 is the second co-stimulatory signal molecule; Z2 is none; The antigen binding domain targeting the first tumor cell marker is a single-chain variable region sequence of an antibody targeting a tumor cell marker, wherein V L1 The amino acid sequence is shown in SEQ ID NO.: 1 at positions 135 to 247, and V H1 The amino acid sequence is shown in positions 1 to 119 of SEQ ID NO.: 1; The antigen binding domain targeting the second tumor cell marker is a single-chain variable region sequence of an antibody targeting a tumor cell marker, wherein V L2 The amino acid sequence is shown in SEQ ID NO.: 5 at positions 135 to 241, and V H2 The amino acid sequence is as shown in SEQ ID NO.: 5, 1-119 or V L2 The amino acid sequence is shown in SEQ ID NO.: 6 at positions 135 to 241, and V H2 The amino acid sequence is shown at positions 1 to 119 of SEQ ID NO.:

6.

2. The immune cell according to claim 1, characterized in that The sequence of the single-chain variable region of the antibody targeting the first tumor cell marker is shown in SEQ ID NO.:

1.

3. The immune cell according to claim 1, characterized in that The amino acid sequence of the first CAR is shown in any one of SEQ ID NOs.: 2-4.

4. The immune cell according to claim 1, characterized in that The sequence of the single-chain variable region of the antibody targeting the second tumor cell marker is shown in SEQ ID NO.: 5 or 6.

5. The immune cell according to claim 1, characterized in that The amino acid sequence of the second CAR is shown in any one of SEQ ID NOs.: 7-14.

6. A method for preparing the engineered immune cell according to claim 1, characterized in that: The following steps are involved: (A) providing an immune cell to be modified; and (B) Transforming the immune cells so that the immune cells express a first CAR and a second CAR, wherein the first CAR targets a first tumor cell marker and the second CAR targets a second tumor cell marker, thereby obtaining the engineered immune cells of claim 1.

7. A preparation, characterized in that The preparation contains the engineered immune cells according to claim 1 and a pharmaceutically acceptable carrier, diluent or excipient.

8. A use of the engineered immune cell according to claim 1, characterized in that: Used for preparing a drug or preparation for selectively killing tumors, wherein the tumor includes a tumor that expresses EGFR and cMet at the same time; the tumor is gastric cancer or lung adenocarcinoma.

9. A kit for selectively killing tumors, characterized in that: The kit comprises a container, and located within the container: (1) a first nucleic acid sequence, wherein the first nucleic acid sequence contains a first expression cassette for expressing a first CAR targeting a first tumor cell marker, wherein the first tumor cell marker is cMet; and (2) a second nucleic acid sequence, wherein the second nucleic acid sequence contains a second expression cassette of a second CAR targeting a second tumor cell marker, wherein the second tumor cell marker is EGFR; The structure of the first CAR is shown in Formula I: L1-S1-H1-TM1-C1-CD3ζ(I) In the formula, the "-" is a connecting peptide or a peptide bond; L1 is none or the first signal peptide sequence; S1 is an antigen binding domain targeting a first tumor cell marker, wherein the first tumor cell marker is cMet; H1 is the first hinge region; TM1 is the first transmembrane domain; C1 is None; CD3ζ is a cytoplasmic signaling sequence derived from CD3ζ; The structure of the second CAR is shown in Formula II: L2-S2-H2-TM2-C2-Z2(II) In the formula, the "-" is a connecting peptide or a peptide bond; L2 is none or a second signal peptide sequence; S2 is an antigen binding domain targeting a second tumor cell marker, and the second tumor cell marker is EGFR; H2 is the second hinge region; TM2 is the second transmembrane domain; C2 is the second co-stimulatory signal molecule; Z2 is none; The antigen binding domain targeting the first tumor cell marker is a single-chain variable region sequence of an antibody targeting a tumor cell marker, wherein V L1 The amino acid sequence is shown in SEQ ID NO.: 1 at positions 135 to 247, and V H1 The amino acid sequence is shown in positions 1 to 119 of SEQ ID NO.: 1; The antigen binding domain targeting the second tumor cell marker is a single-chain variable region sequence of an antibody targeting a tumor cell marker, wherein V L2 The amino acid sequence is shown in SEQ ID NO.: 5 at positions 135 to 241, and V H2 The amino acid sequence is as shown in SEQ ID NO.: 5, 1-119 or V L2 The amino acid sequence is shown in SEQ ID NO.: 6 at positions 135 to 241, and V H2 The amino acid sequence is shown in positions 1 to 119 of SEQ ID NO.: 6; The tumor includes a tumor that expresses both EGFR and cMet.

10. A fusion protein, characterized in that The fusion protein comprises a first CAR targeting a first tumor cell marker and a second CAR targeting a second tumor cell marker, wherein the first tumor cell marker is cMet; and the second tumor cell marker is EGFR; The structure of the first CAR is shown in Formula I: L1-S1-H1-TM1-C1-CD3ζ(I) In the formula, the "-" is a connecting peptide or a peptide bond; L1 is none or the first signal peptide sequence; S1 is an antigen binding domain targeting a first tumor cell marker, wherein the first tumor cell marker is cMet; H1 is the first hinge region; TM1 is the first transmembrane domain; C1 is None; CD3ζ is a cytoplasmic signaling sequence derived from CD3ζ; The structure of the second CAR is shown in Formula II: L2-S2-H2-TM2-C2-Z2(II) In the formula, the "-" is a connecting peptide or a peptide bond; L2 is none or a second signal peptide sequence; S2 is an antigen binding domain targeting a second tumor cell marker, and the second tumor cell marker is EGFR; H2 is the second hinge region; TM2 is the second transmembrane domain; C2 is the second co-stimulatory signal molecule; Z2 is none; The antigen binding domain targeting the first tumor cell marker is a single-chain variable region sequence of an antibody targeting a tumor cell marker, wherein V L1 The amino acid sequence is shown in SEQ ID NO.: 1 at positions 135 to 247, and V H1 The amino acid sequence is shown in positions 1 to 119 of SEQ ID NO.: 1; The antigen binding domain targeting the second tumor cell marker is a single-chain variable region sequence of an antibody targeting a tumor cell marker, wherein V L2 The amino acid sequence is shown in SEQ ID NO.: 5 at positions 135 to 241, and V H2 The amino acid sequence is as shown in SEQ ID NO.: 5, 1-119 or V L2 The amino acid sequence is shown in SEQ ID NO.: 6 at positions 135 to 241, and V H2 The amino acid sequence is shown at positions 1 to 119 of SEQ ID NO.:

6.

11. The fusion protein according to claim 10, characterized in that The structure of the fusion protein is shown in Formula III below: L1-S1-H1-TM1-C1-CD3ζ-Z3-L2-S2-H2-TM2-C2-Z2(III) In the formula, Each "-" is independently a connecting peptide or a peptide bond; L1 is none or the first signal peptide sequence; L2 is none or a second signal peptide sequence; S1 is an antigen binding domain targeting a first tumor cell marker, wherein the first tumor cell marker is cMet; S2 is an antigen binding domain targeting a second tumor cell marker, and the second tumor cell marker is EGFR; H1 is the first hinge region; H2 is the second hinge region; TM1 is the first transmembrane domain; TM2 is the second transmembrane domain; C1 is None; C2 is the second co-stimulatory signal molecule; CD3ζ is a cytoplasmic signaling sequence derived from CD3ζ; Z2 is none; Z3 is a connecting peptide.

12. The fusion protein according to claim 10, characterized in that The amino acid sequence of the fusion protein is shown in any one of SEQ ID NOs.: 22-25. A polynucleotide encoding the fusion protein of claim 10 .

14. A carrier, characterized in that The vector comprises the polynucleotide of claim 13.

Images