A multimodal composite functional Helicobacter pylori nucleic acid detection test strip

Abstract

The present invention belongs to the field of biological detection technology, and relates to a multimodal composite functional Helicobacter pylori nucleic acid detection test paper, wherein the test paper is sequentially provided with a sample area, a nucleic acid extraction area, a primary inspection area and a re-inspection area according to the direction of liquid flow, and a capture probe is provided in the re-inspection area, and the capture probe can hybridize with Helicobacter pylori nucleic acid. The test paper, DNA lysate, primary inspection reagent and re-inspection reagent constitute a detection kit, wherein the DNA lysate is used to lyse the sample in the nucleic acid extraction area to release Helicobacter pylori nucleic acid; the primary inspection reagent is used to react and release fluorophores to the Helicobacter pylori nucleic acid in the primary inspection area of ​​the test paper; and the re-inspection reagent is used to perform enzyme cleavage cyclic amplification and reaction to release fluorophores to the Helicobacter pylori nucleic acid captured by the capture probe in the re-inspection area of ​​the test paper. The present invention integrates nucleic acid extraction and detection, sensitively detects Helicobacter pylori nucleic acid in saliva samples, and performs semi-quantitative screening through the results of different partitions.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection, and relates to a multi-modal composite functional Helicobacter pylori nucleic acid detection test paper. Background Art

[0002] The information disclosed in this background technology section is only intended to enhance the understanding of the overall background of the invention, and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Since Helicobacter pylori (H.pylori) infection is universal and long-term, long-term, frequent and real-time testing is required for its control, treatment or prognosis tracking, which brings a great burden to patients. Convenient, home-use and inexpensive detection methods are of great significance for its prevention and treatment. According to the inventor's research, there is currently no household product that can quickly, sensitively and accurately detect H.pylori. Summary of the invention

[0004] In order to address the deficiencies of the prior art, the purpose of the present invention is to provide a multimodal composite functional Helicobacter pylori nucleic acid detection kit, which integrates nucleic acid extraction and detection, sensitively detects Helicobacter pylori nucleic acid in saliva samples, and performs semi-quantitative screening through the results of different partitions.

[0005] In order to achieve the above object, the technical solution of the present invention is:

[0006] On the one hand, a multimodal composite functional Helicobacter pylori nucleic acid detection test strip is provided, in which a sample area, a nucleic acid extraction area, a primary test area and a re-test area are arranged in sequence according to the direction of liquid flow, the sample area is arranged for dripping samples, and a capture probe is arranged in the re-test area, and the capture probe can hybridize with Helicobacter pylori nucleic acid.

[0007] On the other hand, a multimodal composite functional Helicobacter pylori nucleic acid detection kit comprises:

[0008] The test strip is provided with a sample area, a nucleic acid extraction area, a primary test area and a retest area in sequence according to the direction of liquid flow, the sample area is provided for dripping a sample, the retest area is provided with a capture probe, and the capture probe can hybridize with Helicobacter pylori nucleic acid;

[0009] DNA lysis solution, used to lyse the sample in the nucleic acid extraction area to release Helicobacter pylori nucleic acid;

[0010] Initial test reagent, used to react with Helicobacter pylori nucleic acid in the initial test area of ​​the test strip to release fluorophore;

[0011] The retest reagent is used to perform enzyme cleavage and cyclic amplification on the Helicobacter pylori nucleic acid captured by the capture probe in the retest area of ​​the test strip, and simultaneously react to release the fluorophore.

[0012] The present invention simultaneously sets a primary inspection area and a re-inspection area in a test strip. When the amount of Helicobacter pylori nucleic acid is relatively large, the primary inspection reagent is reacted in the primary inspection area, and the Helicobacter pylori can be visually detected through the released fluorophores. When the amount of Helicobacter pylori nucleic acid is relatively small, the fluorophores released by the reaction in the primary inspection area are relatively small, and the fluorescent signal is not discernible to the naked eye. At this time, the re-inspection reagent is used to perform cyclic amplification in the re-inspection area and react to release the fluorophores at the same time. After amplification, the released amount of the fluorophores increases, thereby generating a fluorescent signal discernible to the naked eye, thereby realizing the screening of high-concentration Helicobacter pylori and low-concentration Helicobacter pylori.

[0013] Since the concentration of Helicobacter pylori in the samples obtained at different times is different, when the initial inspection concentration is low, re-sampling for re-inspection will result in errors caused by different samples. Therefore, when the initial inspection area and the re-inspection area are set at the same time, the present invention also sets a sample area and a nucleic acid extraction area to achieve one-time sampling, and can perform initial inspection and re-inspection at the same time. The process is: when the sample is placed in the sample area, it flows into the nucleic acid extraction area, and the Helicobacter pylori nucleic acid in the sample is extracted by the DNA lysis solution, and the extracted Helicobacter pylori nucleic acid enters the initial inspection area and the re-inspection area. Since the initial inspection area performs real-time detection, the initial detection can be achieved by adding the initial inspection reagent and incubating. The re-examination area is used for re-examination after the initial examination, so a capture probe is set up. The Helicobacter pylori nucleic acid extracted in the nucleic acid extraction area enters the initial examination area and the re-examination area in turn, and is captured by the capture probe in the re-examination area. Therefore, the Helicobacter pylori nucleic acid extracted from the same sample is fixed in the re-examination area. When re-examination is carried out, the re-examination reagent can be added to realize re-examination of the Helicobacter pylori nucleic acid in the same sample after the initial examination, thereby avoiding the error caused by re-sampling and making the detection more accurate.

[0014] The beneficial effects of the present invention are:

[0015] 1. The present invention arranges the sample area, nucleic acid extraction area, initial inspection area and re-inspection area in the same test strip, which can realize nucleic acid extraction and detection through one injection, greatly shortening the sample pre-treatment time, being suitable for on-site instant detection and convenient for home use. At the same time, by utilizing the release of fluorophores in the initial inspection area and the re-inspection area, the detection of Helicobacter pylori nucleic acid can be realized through the visualization of strip information.

[0016] 2. The initial inspection area and re-inspection area of ​​the present invention are respectively matched with the initial inspection reagent and the re-inspection reagent to complete the detection of Helicobacter pylori nucleic acid of different concentrations through a single signal conversion and a cyclic signal amplification. The fluorescent signals in different areas can be used to preliminarily determine the different stages of Helicobacter pylori infection. The concentration of Helicobacter pylori nucleic acid is indicated by the strength of the fluorescent signal under the irradiation of excitation light, and Helicobacter pylori in different concentration ranges can be sensitively detected. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0018] Figure 1 Schematic diagram of the detection principle of an embodiment of the present invention;

[0019] Figure 2 The feasibility verification result diagram of the embodiment of the present invention is shown in Figure a, where a is a fluorescence spectrum diagram and b is a gel electrophoresis diagram;

[0020] Figure 3 It is a condition optimization result diagram of CRISPR / Cas12a detection in the primary inspection area of ​​the embodiment of the present invention, a is a bar graph of the relationship between fluorescence signal intensity and temperature change, b is a curve showing the effect of cas12a enzyme concentration on fluorescence signal intensity, c is a curve showing the change of fluorescence signal over time after the addition of target chain (Helicobacter pylori nucleic acid), and d is a bar graph showing the relationship between fluorescence signal intensity and reporter DNA concentration;

[0021] Figure 4 The results of the detection of target chains (Helicobacter pylori nucleic acid) of different concentrations in the initial inspection area and the re-inspection area of ​​the embodiment of the present invention are shown in FIG. a is the fluorescence spectrum corresponding to the high-concentration target chain, b is the standard curve fitting for the detection of the high-concentration target chain, c is the fluorescence spectrum corresponding to the low-concentration target chain, and d is the standard curve fitting for the detection of the low-concentration target chain;

[0022] Figure 5 These are the detection results of Helicobacter pylori nucleic acid at different concentrations according to the present invention, where a is a high concentration (0.1 nM) sample band and b is a low concentration (0.01 nM) sample band. DETAILED DESCRIPTION

[0023] It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0024] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0025] In view of the fact that there is currently no household product that can quickly, sensitively and accurately detect H. pylori, the present invention proposes a multimodal composite functional Helicobacter pylori nucleic acid detection kit.

[0026] A typical embodiment of the present invention provides a multimodal composite functional Helicobacter pylori nucleic acid detection test strip, wherein a sample area, a nucleic acid extraction area, a primary test area and a re-test area are sequentially arranged according to the direction of liquid flow, the sample area is arranged for dripping samples, and a capture probe is arranged in the re-test area, and the capture probe can hybridize with Helicobacter pylori nucleic acid.

[0027] In some examples of this embodiment, the capture probe is a hairpin probe connected to gold nanoparticles. The capture probe is fixed in the re-test area by gold nanoparticles, and the Helicobacter pylori nucleic acid can be fixed in the re-test area, thereby triggering an enzyme cleavage cycle reaction, which is more conducive to low-sensitivity detection.

[0028] In some examples of this embodiment, the nucleic acid extraction area, the initial test area and the re-test area are located on the nitrocellulose membrane.

[0029] In one or more embodiments, the sample zone overlaps the nucleic acid extraction zone.

[0030] Another embodiment of the present invention provides a multimodal composite functional Helicobacter pylori nucleic acid detection kit, comprising:

[0031] The test strip is provided with a sample area, a nucleic acid extraction area, a primary test area and a retest area in sequence according to the direction of liquid flow, the sample area is provided for dripping a sample, the retest area is provided with a capture probe, and the capture probe can hybridize with Helicobacter pylori nucleic acid;

[0032] DNA lysis solution, used to lyse the sample in the nucleic acid extraction area to release Helicobacter pylori nucleic acid;

[0033] Initial test reagent, used to react with Helicobacter pylori nucleic acid in the initial test area of ​​the test strip to release fluorophore;

[0034] The retest reagent is used to perform enzyme cleavage and cyclic amplification on the Helicobacter pylori nucleic acid captured by the capture probe in the retest area of ​​the test strip, and simultaneously react to release the fluorophore.

[0035] The sample area is configured to be used for dropping samples.

[0036] The nucleic acid extraction area is configured to extract Helicobacter pylori nucleic acid from the dripped sample.

[0037] The initial detection area is configured to perform initial nucleic acid detection on Helicobacter pylori nucleic acid in the sample.

[0038] The re-test area is configured to perform another nucleic acid test on the Helicobacter pylori nucleic acid in the sample.

[0039] The present invention simultaneously arranges a sample area, a nucleic acid extraction area, a primary inspection area and a re-inspection area on a test strip, realizes one-time sampling, can simultaneously perform primary inspection and re-inspection, avoids errors caused by re-sampling, and makes the detection more accurate. By respectively cooperating the primary inspection area and the re-inspection area with the primary inspection reagent and the re-inspection reagent, the different stages of Helicobacter pylori infection can be used for preliminary determination, and the detection of Helicobacter pylori of different concentrations can be realized by the strength of the fluorescent signal.

[0040] In some examples of this embodiment, the capture probe is a hairpin probe connected to gold nanoparticles. The capture probe is fixed in the re-test area by gold nanoparticles, and the Helicobacter pylori nucleic acid can be fixed in the re-test area, thereby triggering an enzyme cleavage cycle reaction, which is more conducive to low-sensitivity detection.

[0041] In some embodiments of this embodiment, the initial detection reagent includes a reporter DNA, a cas12a ribozyme, and a crRNA, wherein the reporter DNA is simultaneously connected to a fluorophore and a quencher, and the reporter DNA is cut into a sequence containing a fluorophore and a sequence containing a quencher under the action of the cas12a ribozyme, crRNA, and Helicobacter pylori nucleic acid.

[0042] In one or more embodiments, the re-test reagent includes a re-test additive, which is added to the initial test reagent to form a re-test reagent, and the re-test additive includes primers, polymerase and shearing enzyme. The capture probe, polymerase and shearing enzyme can perform enzyme cleavage-chain displacement cycle reaction on Helicobacter pylori nucleic acid to amplify Helicobacter pylori nucleic acid.

[0043] In some embodiments of this implementation, the re-examination reagent includes primers, polymerase, shearing enzyme, reporter DNA, cas12a ribozyme, and crRNA; the primers, capture probes, polymerase, and shearing enzyme can perform enzyme cleavage-chain displacement cycle reaction on Helicobacter pylori nucleic acid to amplify Helicobacter pylori nucleic acid, and the reporter DNA is cut into a sequence containing a fluorescent group and a sequence containing a quenching group under the action of cas12a ribozyme, crRNA, and Helicobacter pylori nucleic acid.

[0044] In one or more embodiments, the double-check reagent further includes deoxyribonucleoside triphosphates (dNTPs).

[0045] In some examples of this embodiment, the nucleic acid extraction area, the initial test area and the re-test area are located on the nitrocellulose membrane.

[0046] In one or more embodiments, the sample zone overlaps the nucleic acid extraction zone.

[0047] In some examples of this embodiment, the kit further comprises a buffer solution for preparing the initial test reagent and / or the retest reagent.

[0048] In some examples of this embodiment, the kit further comprises pure water and absorbent paper. The pure water is used to infiltrate the sample, and the absorbent paper is used for drainage.

[0049] The method for detecting Helicobacter pylori nucleic acid using the multimodal composite functional Helicobacter pylori nucleic acid detection kit comprises the following steps:

[0050] The sample to be tested is added dropwise to the sample area, soaked with pure water, and then drained with absorbent paper to enter the nucleic acid extraction area;

[0051] Adding a DNA lysis solution to the nucleic acid extraction area to release the Helicobacter pylori nucleic acid in the sample in the nucleic acid extraction area;

[0052] The free Helicobacter pylori nucleic acid in the nucleic acid extraction area is free to enter the initial inspection area and the re-inspection area;

[0053] Add the prepared initial inspection reagent solution to the initial inspection area, incubate, and perform fluorescence detection. Determine whether to conduct a re-inspection based on the fluorescence signal of the initial inspection area;

[0054] When there is a fluorescent signal in the initial inspection area, there is no need to re-inspect; when there is no fluorescent signal in the initial inspection area, add the prepared re-inspection reagent solution to the re-inspection area, incubate, and then perform fluorescence detection.

[0055] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0056] Example

[0057] A multimodal composite functional Helicobacter pylori nucleic acid detection kit comprises a detection test strip, a DNA lysis solution, a primary detection reagent, and a re-detection reagent.

[0058] The test strip is sequentially provided with a sample area, a nucleic acid extraction area, a primary test area and a retest area, and the retest area contains a capture probe connected to nanogold.

[0059] The initial test reagents mainly include reporter DNA, cas12a ribozyme, and crRNA.

[0060] The retest reagents mainly include primers, polymerase, shearing enzyme, reporter DNA, cas12a ribozyme, and crRNA.

[0061] The detection principle of this test kit is as follows Figure 1 As shown: the saliva sample is collected and dripped into the sample area, diffused into the nucleic acid extraction area, and after passing through the DNA lysis solution, the Helicobacter pylori nucleic acid extraction is completed. The extracted Helicobacter pylori nucleic acid is drained with the solution through absorbent paper and enters the initial inspection area and the re-inspection area. In the initial inspection area, Helicobacter pylori nucleic acid, reporter DNA, cas12a ribozyme and crRNA are subjected to CRISPR / Cas12a detection to achieve the detection of high-concentration Helicobacter pylori nucleic acid. In the re-inspection area, the capture probe is hybridized with the Helicobacter pylori nucleic acid, and the target cycle amplification reaction is carried out through the action of primers, polymerases, and shearing enzymes to achieve the amplification of Helicobacter pylori nucleic acid. The amplified Helicobacter pylori nucleic acid is subjected to CRISPR / Cas12a detection with reporter DNA, cas12a ribozyme and crRNA, thereby achieving the detection of low-concentration Helicobacter pylori nucleic acid. The extraction and detection of Helicobacter pylori nucleic acid are completed after one injection, which greatly shortens the time for sample pre-treatment.

[0062] Sample processing: Pre-drop the DNA lysis solution on the area, then take 10μL of the collected saliva sample and drop it on the area. After incubation at room temperature for 3 minutes, the nucleic acid extraction is completed.

[0063] CRISPR / Cas12a detection: After a certain concentration of cas12a ribozyme and crRNA were mixed and incubated for 1 hour, the pre-prepared reporter DNA (final concentration of 500nM) and different concentrations of target were added, and the volume was made up to 100μL with DEPC water, incubated at 37℃ for 90min, and terminated at 65℃ for 10min. The solution was taken and the standard curve was scanned by fluorescence spectrophotometer.

[0064] Target cyclic amplification reaction: First, a certain concentration of hairprobe, primer and target chain were mixed, annealed at 95℃ for 10min, and then 1μL of the product, 1.8μL of dNTP (10mM), 1μL of ATP (10mM), 1μL of Klenow (500U / mL), 1μL of Nb.BbvCI (1000U / mL), 1μL of 10×NEBuffer 2, and 1μL of DTT (10mM) were added and the volume was adjusted to 10μL with pure water. The mixed solution was placed in a constant temperature oscillator at 37℃ for 1h, and then 95℃ for 10min was used to terminate the enzymatic reaction. The terminated reaction product was read out according to the above CRISPR / Cas12a detection steps.

[0065] Visual detection of test paper: After dripping saliva sample directly on the paper, soak it with pure water, drip CRISPR / Cas12a detection reaction solution in the initial inspection area, and drip nanogold to fix hairprobe nucleic acid chain in the re-inspection area to capture the target target chain. Add the target molecule solution to the nucleic acid extraction area, drain it from the other end with absorbent paper, let the sample flow through the detection area, and take a picture under the irradiation of the excitation lamp to test the fluorescence intensity. When the concentration of the target molecule is high, green stripes will appear in both the initial inspection area and the re-inspection area, and the brightness of the initial inspection area is significantly higher than that of the re-inspection area; when the concentration of the target molecule is low, the initial inspection area is not bright, and then the enzyme cleavage-chain replacement cycle and CRISPR / Cas12a detection reaction solution are added to the re-inspection area to perform the target cycle amplification reaction. The re-inspection area can show obvious green stripes through signal amplification.

[0066] Figure 2 This indicates that only when crRNA, cas12a and target chain are present at the same time in the initial test area, the target recognizes crRNA and activates the cas12a enzyme to trans-cleave the reporter DNA sequence, so that the fluorescent group is away from the quenching group and the fluorescent signal is restored. The gel electrophoresis in the re-test area shows that the enzyme cleavage cycle produces a band consistent with the molecular weight of the target chain nucleic acid, indicating that the experiments in the re-test area and the initial test area are both feasible.

[0067] Figure 3 It shows that after optimization, the experimental conditions are optimal when the cas12a enzyme concentration is 80nM, the reporter concentration is 500nM, the temperature is 37°C, and the reaction time is 90min.

[0068] Figure 4 It was shown that fluorescence signal measurement revealed that different concentrations of Helicobacter pylori nucleic acid all responded.

[0069] Figure 5 This indicates that two different concentrations of Helicobacter pylori nucleic acids can produce green bands visible to the naked eye after being detected by the test paper of the present invention.

[0070] The nucleic acid sequence used in this example is (5' to 3'):

[0071] crRNA:UAAUU UCUAC UAAGU GUAGA U GCAAG ACGGA AAGAC CCCGU-3, see SEQ IDNO.1.

[0072] hairprobe:

[0073] TCTGCAAGACGGAAAGACCCCGTCCTCAGCTCTTGCAGA, see SEQ ID NO. 2.

[0074] target: ACGGGGTCTTTCCGTCTTGC, see SEQ ID NO.3.

[0075] Primer: TCTGCAAG, see SEQ ID NO.4.

[0076] Reporter DNA: BHQ1-TTATT-FAM, see SEQ ID NO.5.

[0077] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention. SEQUENCE LISTING <110> Fujian Medical University <120> A multimodal composite functional Helicobacter pylori nucleic acid detection test strip <130> <160> 5 <170> PatentIn version 3.3 <210> 1 <211> 41 <212> RNA <213> Artificial sequence <400> 1 uaauuucuac uaaguguaga ugcaagacgg aaagaccccg u 41 <210> 2 <211> 39 <212> DNA <213> Artificial sequence <400> 2 tctgcaagac ggaaagaccc cgtcctcagc tcttgcaga 39 <210> 3 <211> 20 <212> DNA <213> Artificial sequence <400> 3 acggggtctt tccgtcttgc 20 <210> 4 <211> 8 <212> DNA <213> Artificial sequence <400> 4 tctgcaag 8 <210> 5 <211> 5 <212> DNA <213> Artificial sequence <400> 5 ttatt 5

Claims

1. A multimodal composite functional Helicobacter pylori nucleic acid detection kit, characterized in that: include: The test strip is provided with a sample area, a nucleic acid extraction area, a primary test area and a retest area in sequence according to the direction of liquid flow, the sample area is provided for dripping a sample, the retest area is provided with a capture probe, and the capture probe can hybridize with Helicobacter pylori nucleic acid; DNA lysis solution, used to lyse the sample in the nucleic acid extraction area to release Helicobacter pylori nucleic acid; Initial test reagent, used to react with Helicobacter pylori nucleic acid in the initial test area of ​​the test strip to release fluorophore; Re-test reagent, used for performing enzyme cleavage and cyclic amplification on the Helicobacter pylori nucleic acid captured by the capture probe in the re-test area of ​​the test strip and reacting to release the fluorophore; The primary detection reagent includes a reporter DNA, a cas12a ribozyme, and a crRNA, wherein the reporter DNA is simultaneously connected to a fluorophore and a quencher, and the reporter DNA is cut into a sequence containing a fluorophore and a sequence containing a quencher under the action of the cas12a ribozyme, the crRNA, and the Helicobacter pylori nucleic acid; The retest reagents include primers, polymerase, shearing enzyme, reporter DNA, cas12a ribozyme, and crRNA; Primers, capture probes, polymerases and shearing enzymes can perform enzyme cleavage-chain displacement cycle reactions on Helicobacter pylori nucleic acids to amplify Helicobacter pylori nucleic acids. The reporter DNA is cut into a sequence containing a fluorophore and a sequence containing a quencher under the action of cas12a ribozyme, crRNA and Helicobacter pylori nucleic acids.

2. The multimodal composite functional Helicobacter pylori nucleic acid detection kit according to claim 1, characterized in that: The capture probe is a hairpin probe, which is connected to gold nanoparticles; Alternatively, the nucleic acid extraction area, the initial test area and the retest area are located on a nitrocellulose membrane.

3. The multimodal composite functional Helicobacter pylori nucleic acid detection kit according to claim 1, characterized in that: The sample area is overlapped with the nucleic acid extraction area.

4. The multimodal composite functional Helicobacter pylori nucleic acid detection kit according to claim 1, characterized in that: The retest reagent also includes deoxyribonucleoside triphosphates.

5. The multimodal composite functional Helicobacter pylori nucleic acid detection kit according to claim 1, characterized in that: The kit also includes a buffer solution.

6. The multimodal composite functional Helicobacter pylori nucleic acid detection kit according to claim 1, characterized in that: The kit also includes pure water and absorbent paper.

Images