shRNA interfering with SQR gene and its application

Abstract

The present invention discloses a shRNA interfering with the SQR gene and its application, belonging to the field of molecular biotechnology and genetic engineering. The present invention designs a lentiviral interfering RNA for the SQR gene, and by transfecting the lentiviral interfering RNA in cells, the SQR gene expression can be regulated and interfered, the cell clone formation ability is reduced, and the cell migration and invasion are inhibited; therefore, the lentiviral interfering RNA inhibiting the expression of the SQR gene reduces the expression of SQR and effectively inhibits the proliferation, migration and invasion of esophageal cancer cells. The present invention provides a new gene target and drug for the treatment of esophageal cancer, and has a high clinical practical application value.

Description

Technical Field

[0001] The invention belongs to the field of molecular biotechnology and genetic engineering, and more specifically, relates to a shRNA for interfering with SQR gene and application thereof. Background Art

[0002] Esophageal cancer is a major public health problem worldwide and one of the most aggressive malignant tumors. Although considerable progress has been made in diagnosis and treatment in recent years, the prognosis of esophageal cancer patients is still poor due to the high proliferation and invasion rates. Studying the role of proliferation and invasion-related genes in the proliferation and metastasis of esophageal cancer cells has important theoretical significance and application value for improving the prognosis of esophageal cancer patients. Sulfide: quinoneoxidoreductase SQR is a key enzyme in sulfide metabolism in organisms. The enzyme catalyzes the reaction between hydrogen sulfide and ubiquinone, in which hydrogen sulfide is oxidized to persulfide and ubiquinone is converted from oxidized to reduced form. At present, immunohistochemical experiments have shown that the SQR gene is highly expressed in esophageal cancer. The shRNA technology is used to specifically introduce lentiviral interfering RNA into mammalian and human cells to reduce the expression of the target gene, thereby causing a decrease in the expression of the target protein, achieving efficient and specific gene therapy. Summary of the invention

[0003] In view of the above problems existing in the prior art, the technical problem to be solved by the present invention is to provide a shRNA that interferes with the SQR gene; another technical problem to be solved by the present invention is to provide the use of the shRNA that interferes with the SQR gene in the preparation of anti-esophageal cancer drugs.

[0004] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0005] A shRNA for interfering with the SQR gene is a short hairpin RNA targeting the target sequence of the SQR gene, and the target sequence of the SQR gene is: 5'-gcGCCTTTCCATGTATCTCAT-3', (see SEQ ID NO.1); or 5'-ccTCACTGTTAACTACAAGAA-3', (see SEQ ID NO.2); or 5'-gaGACATTTCTACCAGCCAAT-3', (see SEQID NO.3).

[0006] Furthermore, the shRNA interfering with the SQR gene includes a target sequence of the SQR gene, a loop, and a complementary sequence of the target sequence of the SQR gene, wherein the nucleotide sequence of the loop is CTCGAG. The shRNA interfering with the SQR gene can specifically bind to the mRNA fragment encoded by the target sequence and specifically silence the expression of the SQR gene.

[0007] Furthermore, the sense strand and antisense strand of the shRNA that interferes with the SQR gene were designed based on the target sequence of the SQR gene: 5′-gcGCCTTTCCATGTATCTCAT-3′, and the nucleotide sequences thereof are as follows:

[0008] Sense strand: 5′-CCGGGCGCCTTTCCATGTATCTCATCTCGAGATGAGATACATGGAAAGGCGCTTTTTG-3′; (see SEQ ID NO. 4);

[0009] Antisense strand: 5′-AATTCAAAAAGCGCCTTTCCATGTATCTCATCTCGAGATGAGATACATGGAAAGGCGC-3′; (see SEQ ID NO. 5).

[0010] According to the target sequence of the SQR gene: 5′-ccTCACTGTTAACTACAAGAA-3′, the sense and antisense strands of the shRNA that interferes with the SQR gene were designed, and the nucleotide sequences are as follows:

[0011] Sense strand: 5′-CCGGCCTCACTGTTAACTACAAGAACTCGAGTTCTTGTAGTTAACAGTGAGGTTTTTG-3′; (see SEQ ID NO. 6);

[0012] Antisense strand: 5′-AATTCAAAAACCTCACTGTTAACTACAAGAACTCGAGTTCTTGTAGTTAACAGTGAGG-3′; (see SEQ ID NO. 7).

[0013] According to the target sequence of the SQR gene: 5′-gaGACATTTCTACCAGCCAAT-3′, the sense and antisense strands of the shRNA that interferes with the SQR gene were designed, and the nucleotide sequences are as follows:

[0014] Sense strand: 5′-CCGGGAGACATTTCTACCAGCCAATCTCGAGATTGGCTGGTAGAAATGTCTCTTTTTG-3′; (see SEQ ID NO. 8);

[0015] Antisense strand: 5′-AATTCAAAAAGAGACATTTCTACCAGCCAATCTCGAGATTGGCTGGTAGAAATGTCTC-3′; (see SEQ ID NO. 9).

[0016] The present invention also protects a recombinant lentiviral expression vector containing shRNA interfering with the SQR gene.

[0017] Furthermore, the lentiviral expression vector is GV112, which includes an Age I restriction site and an EcoR I restriction site. The GV112 vector is double-digested with Age I enzyme and EcoR I enzyme to obtain a linearized GV112 vector, and the sense chain and antisense chain DNA of the shRNA that interferes with the SQR gene are annealed to form a DNA double strand containing an interference target sequence; the linearized GV112 vector and the purified DNA double strand are connected by T4 DNA ligase to obtain a recombinant viral expression vector.

[0018] A recombinant lentivirus is obtained by packaging a recombinant lentivirus expression vector after transfecting cells.

[0019] The present invention also provides the use of the shRNA interfering with the SQR gene or the recombinant lentiviral expression vector containing the shRNA interfering with the SQR gene or the recombinant lentivirus in the preparation of an anti-esophageal cancer drug.

[0020] Furthermore, the anti-esophageal cancer drug is a drug that reduces the activity of esophageal cancer cells.

[0021] Furthermore, the anti-esophageal cancer drug is a drug that reduces the clone-forming ability of esophageal cancer cells.

[0022] Furthermore, the anti-esophageal cancer drug is a drug that inhibits the invasion of esophageal cancer cells.

[0023] A kit for reducing the expression of the SQR gene in esophageal cancer cells is also within the protection scope of the present application.

[0024] Compared with the prior art, the beneficial effects of the present invention are as follows: the present invention designs a lentiviral interfering RNA for the SQR gene, and by transfecting the lentiviral interfering RNA in cells, it can regulate and interfere with the expression of the SQR gene, reduce the cell clone formation ability, and inhibit cell migration and invasion; therefore, the lentiviral interfering RNA that inhibits the expression of the SQR gene reduces the expression of SQR and effectively inhibits the proliferation, migration and invasion of esophageal cancer cells. The present invention provides a new gene target and drug for the treatment of esophageal cancer, and has a high clinical practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the expression diagram of SQR gene in esophageal cancer patient tissues and adjacent tissues detected by immunohistochemical staining;

[0026] Figure 2This is a graph of the results of a protein immunoblotting experiment to identify the efficiency of shRNA interference with SQR; in the figure, KYSE150 is a human esophageal squamous cell carcinoma cell; GD represents GAPDH, which is used as an internal reference; NC is a negative control group; #1, #2, and #3 are experimental groups infected with lentivirus interference shRNA-1, shRNA-2, and shRNA-3, respectively;

[0027] Figure 3 This is the result of the cell viability experiment with shRNA interfering with SQR expression;

[0028] Figure 4 This is a diagram showing the results of a cell clone formation experiment in which shRNA interferes with SQR expression;

[0029] Figure 5 This is a diagram showing the results of a cell Transwell experiment in which shRNA interfered with SQR expression. DETAILED DESCRIPTION

[0030] The present invention is further described below in conjunction with specific examples. Molecular biology experimental methods not specifically described in the following examples can be performed with reference to the methods listed in the book Molecular Cloning Laboratory Manual (3rd Edition) by J. Sambrook or conventional methods in the art, or according to the kits and product instructions.

[0031] Example 1

[0032] 1. Immunohistochemical staining to detect the expression of SQR gene in esophageal cancer tissues and adjacent tissues

[0033] The tissue fixed with paraformaldehyde was embedded in paraffin, sliced ​​continuously, and pressed on a glass slide; the immunohistochemical slide was placed in an oven at 80°C for 30 minutes; it was soaked in xylene I and xylene II for 15 minutes each; then it was placed in anhydrous ethanol, 95% ethanol, 80% ethanol, and 70% ethanol for 2 minutes each; finally, the slide was soaked in ultrapure water for cleaning; the slide was placed in EDTA antigen repair solution, and after the pressure cooker was boiled until steam was emitted, it was continued to heat for 3 minutes, and then the heat source was removed, the pressure cooker lid was opened, and it was cooled; after rinsing 3 times with PBST, the immunohistochemical slide was used. Circle the tissue with a pen, then incubate with H2O2 at room temperature for 20 minutes; dilute the primary antibody with antibody diluent and incubate at 4°C overnight; the next day, rewarm at room temperature for 30 minutes; rinse with PBST three times, and incubate with secondary antibody for 20 minutes; carefully rinse with PBST, develop color with DAB, observe the color change, and terminate the reaction with tap water when it shows brown; stain with hematoxylin for 30 seconds, rinse with tap water, and observe under a microscope. If the staining is not deep, repeat the hematoxylin staining; then soak in gradient ethanol for 4 minutes, and then soak in xylene I and xylene II for 10 minutes each. Seal the slide with neutral resin, dry in a fume hood, and observe under a microscope.

[0034] Figure 1 This is an immunohistochemical staining to detect the expression of SQR gene in esophageal cancer patient tissues and adjacent tissues; the results show that the expression of SQR gene in esophageal cancer patient tissues is significantly higher than that in adjacent tissues.

[0035] 2. Design of SQR lentiviral interference fragment and construction of lentiviral vector and negative control plasmid

[0036] The SQR (NM_021199) gene information was retrieved from Genbank; the effective siRNA target for the SQR gene was designed using the design software Genechem of Shanghai Jikai Gene Chemistry Technology Co., Ltd. Table 1 lists three effective siRNA target sequences for the SQR gene. The corresponding shRNA chain DNA oligo was synthesized for the siRNA target sequence, and its sequence and structure are shown in Table 2.

[0037] Table 1 siRNA target sequences targeting human SQR gene

[0038] NO. Target sequence GC% 1 gcGCCTTTCCATGTATCTCAT 42.11％ 2 ccTCACTGTTAACTACAAGAA 31.58％ 3 gaGACATTTCTACCAGCCAAT 42.11％

[0039] Table 2 Double-stranded DNA oligonucleotides containing siRNA target sequences of SQR genes

[0040]

[0041]

[0042] After synthesis, the paired primer powder was dissolved in annealing buffer, incubated at 90°C for 15 minutes, and then cooled naturally to room temperature. The GV112 vector was linearized by Age I and EcoR I restriction endonucleases. The enzyme digestion reaction system was: ddH2O 41μL, 10×CutSmart Buffer 5μL, purified plasmid DNA (1μg / μL) 2μL, Age I (10U / μL) 1μL, EcoR I 1μL, and the total enzyme digestion system was 50μL. Use a pipette to gently blow and mix, centrifuge briefly, and place at 37°C for 3h or overnight. Perform agarose gel electrophoresis on the vector digestion product to recover the target band.

[0043] The double-digested linearized GV112 vector and annealed double-stranded DNA were connected by T4 DNA ligase, connected at 16°C overnight, and the ligation product was recovered. The ligation reaction system was: 1 μL of linearized vector (100 ng / μL), 1 μL of double-stranded DNA (100 ng / μL), 2 μL of 10×T4 DNA ligase buffer, 1 μL of T4 DNA ligase, and dd H2O was added to 20 μL.

[0044] The ligation product was transformed into fresh competent E. coli cells prepared with calcium chloride. The surface of the bacteria grown by the ligation transformation product was stained, dissolved in 10 μL LB medium, mixed and 1 μL was taken as a template, and universal PCR primers (upstream primer sequence: 5′-CCATGATTCCTTCATATTTGC-3′; downstream primer sequence: 5′-GTAATACGGTTATCCACGCG-3′) were designed upstream and downstream of the RNAi sequence in the lentiviral vector, and a colony PCR amplification experiment was performed. The PCR amplification product was identified by agarose gel electrophoresis, and the clones identified as positive were sequenced and compared. The bacterial solution with correct sequencing was expanded and cultured, and the recombinant vector containing the SQR interference fragment in the bacteria was extracted using a plasmid extraction kit.

[0045] The siRNA negative control target sequence was 5′-TTCTCCGAACGTGTCACGT-3′. When constructing the siRNA control plasmid, a double-stranded DNA oligo sequence was synthesized for the siRNA negative control target sequence (upstream primer sequence: 5′-CCGGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTG-3′; downstream primer sequence: 5′-AATTCAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAA-3′). The rest of the construction method, identification method and conditions were the same as above. The successfully constructed negative control was named shRNA-NC.

[0046] 3. Screening of SQR Lentiviral Interference Fragments

[0047] Cell culture conditions and culture medium: KYSE150 cell line was cultured in RPMI 1640 (HyClone SH30809.01) containing 10% fetal bovine serum in a 5% CO2, 37°C incubator.

[0048] Cell transfection: The constructed shRNA-1, shRNA-2 and shRNA-3 recombinant plasmids were extracted using Qiagen's plasmid midi extraction kit and diluted to a final concentration of 20μM solution for later use; after digesting the cells, they were plated in a 6-well plate and transfected when the cell density reached 30-50%; three sterile 1.5mL EP tubes were prepared, and 200μL of OPTI-MEM and 5μL of the corresponding shRNA-1, shRNA-2, shRNA-3 and negative control shRNA solution (non-targeted shRNA empty sequence, named shRNA-NC) were added to 4 EP tubes respectively, and vortexed quickly for 10s to mix them completely; then 6μL of shRNA-Mate transfection reagent was added to each of the 4 EP tubes, and allowed to stand at room temperature for 10 minutes to allow the shRNA and transfection reagent to form a transfection complex, and then added to the corresponding wells of the 6-well plate and gently shaken to mix; after 2 days, the knockdown efficiency was verified by immunoblotting and cell function experiments were performed. Figure 2 shown.

[0049] The results of protein expression were as follows Figure 2 As shown, it can be seen that compared with the control group, the expression of SQR protein in the experimental groups infected with lentiviral interfering RNA1 (shRNA-1), lentiviral interfering RNA2 (shRNA-2) and lentiviral interfering RNA3 (shRNA-3) is reduced. From the relative expression of the protein, it can be clearly seen that the experimental group infected with lentiviral interfering shRNA-2 has the greatest interference with SQR protein expression and the best effect. Therefore, shRNA-2 that interferes with SQR gene expression can be used in interfering with SQR gene expression for subsequent embodiments.

[0050] 4. SQR lentiviral interference fragment inhibits the viability of esophageal cancer cells

[0051] The cell proliferation was detected by CCK8 method. KYSE150 cells transfected with shSQR or NC were cultured at 3×10 3 The cells were seeded at a density of 1×10 cells / well in a 96-well plate and cultured for 24 h, 48 h, and 72 h, respectively. At different time points, 10 μl of CCK8 reagent (Dojindo Laboratories) was added to each well and incubated at 37°C for 2 h. To study the sensitivity of cisplatin, KYSE150 cells transfected with shSQR or NC were cultured at 1×10 4 The cells were inoculated in a 96-well plate at a density of 100 μg / mL and cultured overnight. They were then treated with 4 and 1 μg / mL cisplatin for 0 h, 24 h, 48 h, and 72 h, respectively. The absorbance at 450 nm was measured using a microplate reader (Thermo Science).

[0052] like Figure 3As shown, the cell viability of the experimental group with SQR lentiviral interfering RNA interference was significantly reduced compared with the NC group, indicating that SQR can promote the viability of KYSE150 cells, that is, the SQR gene interference by transfecting KYSE150 with chronic disease interfering shRNA-2 can inhibit cell viability.

[0053] 5. Detection of SQR lentiviral interference fragments in inhibiting esophageal cancer metastasis and invasion

[0054] 1. Cloning experiments proved that shRNA-2 interfered with SQR and led to anti-tumor effects at the cellular level

[0055] Place 500 cells / well of the cell suspension in a 6 cm culture dish. Cultivate the cells in 3 mL of culture medium in a 37°C incubator. After 2 weeks of culturing, wash the cells gently with PBS, fix them with formalin, and stain them with 0.1% crystal violet to determine the clone formation rate. Figure 4 As shown, the proliferation ability of esophageal cancer cell KYSE150 transfected with lentiviral interference SQR was significantly weakened, and the number of esophageal cancer cell KYSE150 transfected with lentiviral interference SQR was significantly decreased.

[0056] The results showed that the number of cell clones in the experimental group with SQR lentiviral interfering RNA interference was significantly reduced compared with the NC group, indicating that SQR can promote the clone formation of rat KYSE150 cells, that is, interfering with the SQR gene by transfecting KYSE150 with chronic disease interfering shRNA-2 can inhibit the clone formation of cells.

[0057] 2. Transwell analysis experiments demonstrate the anti-tumor effect of SQR lentiviral interference fragments at the cellular level

[0058] Prepare a 24-well plate first and move the chamber into the 24-well plate. For cell invasion experiments, the matrix gel needs to be placed in a 4-degree refrigerator from -20 degrees Celsius one day in advance. The 24-well plate, the pipette tip, and the chamber need to be pre-cooled in advance, and all operations need to be performed on ice. Digest the transfected cells from the 6-well plate, centrifuge, discard the supernatant, and keep the cell pellet. Add 1 mL of PBS to resuspend and centrifuge. Add 1 mL of PBS to resuspend and centrifuge again, and discard the supernatant. Add a little matrix gel to resuspend, and then take a 200 μL volume containing 5×10 5 Cells were placed in a Transwell chamber with a pore size of 8 μm, with or without Matrigel treatment, and 500 μL of 1640 medium containing 10% FBS was placed in the lower compartment. After incubation for 24 hours, the cell suspension in the upper chamber was removed, and the cells on the membrane of the lower chamber were fixed with 4% paraformaldehyde for 30 minutes, and then stained with crystal violet for 5 minutes. Five fields of view were randomly selected under a microscope to count the invasive cells. Figure 5As shown, it is the cell status of the invasion experiment. The invasion ability of esophageal cancer cell KYSE150 transfected with lentivirus interference SQR is significantly weakened, and the number of esophageal cancer cell KYSE150 transfected with lentivirus interference SQR is significantly decreased.

[0059] It is known to those skilled in the art that when the technical solution of the present invention is changed within the following scope, the same or similar technical effects as those of the above embodiments can still be obtained and still fall within the protection scope of the present invention. Sequence Listing <110> Nantong Cancer Hospital <120> shRNA interfering with SQR gene and its application <130> 1 <160> 9 <170> SIPOSequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> SQR gene target sequence 1 (Artificial) <400> 1 gcgcctttcc atgtatctca t 21 <210> 2 <211> twenty one <212> DNA <213> SQR gene target sequence 2 (Artificial) <400> 2 cctcactgtt aactacaaga a 21 <210> 3 <211> twenty one <212> DNA <213> SQR gene target sequence 3 (Artificial) <400> 3 gagacatttc taccagccaa t 21 <210> 4 <211> 58 <212> DNA <213> shRNA-1-upstream (Artificial) <400> 4 ccgggcgcctttccatgtat ctcatctcga gatgagatac atggaaaggc gctttttg 58 <210> 5 <211> 58 <212> DNA <213> shRNA-1-downstream (Artificial) <400> 5 aattcaaaaa gcgcctttcc atgtatctca tctcgagatg agatacatgg aaaggcgc 58 <210> 6 <211> 58 <212> DNA <213> shRNA-2-upstream (Artificial) <400> 6 ccggcctcac tgttaactac aagaactcga gttcttgtag ttaacagtga ggtttttg 58 <210> 7 <211> 58 <212> DNA <213> shRNA-2-downstream (Artificial) <400> 7 aattcaaaaa cctcactgtt aactacaaga actcgagttc ttgtagttaa cagtgagg 58 <210> 8 <211> 58 <212> DNA <213> shRNA-3-upstream (Artificial) <400> 8 ccgggagaca tttctaccag ccaatctcga gattggctgg tagaaatgtc tctttttg 58 <210> 9 <211> 58 <212> DNA <213> shRNA-3-downstream (Artificial) <400> 9 aattcaaaaa gagacatttc taccagccaa tctcgagatt ggctggtaga aatgtctc 58

Claims

1. Use of shRNA interfering with SQR gene or recombinant lentiviral expression vector or recombinant lentivirus containing shRNA interfering with SQR gene in the preparation of anti-esophageal cancer drugs, The shRNA interfering with the SQR gene is a short hairpin RNA targeting the target sequence of the SQR gene, the target sequence is shown in SEQ ID NO.1, or the target sequence is shown in SEQ ID NO.2, or the target sequence is shown in SEQ ID NO.3; the shRNA includes the target sequence of the SQR gene, a loop and a complementary sequence of the target sequence of the SQR gene, and the nucleotide sequence of the loop is CTCGAG; the sense strand and antisense strand of the shRNA are shown in SEQ ID NO.4-SEQID NO.5, respectively; or the sense strand and antisense strand of the shRNA are shown in SEQ ID NO.6-SEQ ID NO.7, respectively; or the sense strand and antisense strand of the shRNA are shown in SEQ ID NO.8-SEQ ID NO.9, respectively; The recombinant lentivirus is obtained by packaging a recombinant lentivirus expression vector containing shRNA interfering with the SQR gene after transfecting cells.

2. The use according to claim 1, characterized in that: The anti-esophageal cancer drug is a drug that reduces the activity of esophageal cancer cells.

3. The use according to claim 1, characterized in that: The anti-esophageal cancer drug is a drug that reduces the clone-forming ability of esophageal cancer cells.

4. The use according to claim 1, characterized in that: The anti-esophageal cancer drug is a drug that inhibits the invasion of esophageal cancer cells.

Images