A bispecific anti-HIV-1 antibody

Abstract

The present invention relates to a bispecific anti-HIV-1 antibody or an antigen-binding molecule thereof, a nucleic acid molecule encoding the bispecific antibody or the antigen-binding molecule thereof, a vector comprising the nucleic acid molecule, a host cell comprising the vector, and the use of the bispecific antibody, the antigen-binding molecule thereof, and the homodimer thereof in the preparation of a medicament for treating or preventing a disease caused by HIV-1 virus, as well as in detection products; the bispecific anti-HIV-1 antibody of the present invention has a significant neutralizing ability against HIV-1 virus, and has a good prospect for clinical application in the future.

Description

Technical Field

[0001] The invention relates to a bispecific anti-HIV-1 antibody and belongs to the field of biomedicine. Background Art

[0002] AIDS is a highly harmful infectious disease caused by infection with human immunodeficiency virus (HIV). So far, there are two main types of HIV-1 and HIV-2. HIV-1 is also the main strain currently prevalent in the world.

[0003] Since the discovery of HIV-1 as the main causative agent of AIDS in 1983, finding an effective treatment for HIV-1 has been the top priority in responding to the AIDS pandemic.

[0004] In recent years, researchers have discovered several new strains of broadly neutralizing antibodies against HIV-1 from AIDS patients that can produce broadly neutralizing antibodies (bNAb) through newly developed B cell culture technology or probe-labeled cell sorting methods; in animal experiments and human clinical studies, these broadly neutralizing antibodies against HIV-1 have also been shown to have the effect of defending, treating and preventing HIV.

[0005] For example, Professor Zhiwei Chen of the University of Hong Kong discovered a bispecific antibody PGT128-iMab with HIV neutralizing activity. This antibody can effectively protect monkeys from SHIV infection and has high application value in clinical practice.

[0006] Although existing studies have tested the neutralization efficacy and breadth of various broad-spectrum neutralizing antibodies against HIV-1, as well as the crystal structure and mode of action of binding to HIV-1 envelope protein, and their preventive and therapeutic effects on HIV-1 virus in vitro and in vivo, etc. However, when these neutralizing antibodies are used alone in clinical prevention and treatment experiments, it is found that these neutralizing antibodies are difficult to fight against naturally resistant viruses; in particular, since HIV-1 virus easily mutates and escapes to produce drug-resistant mutant viruses, a single neutralizing antibody is difficult to effectively inhibit the mutation escape of HIV-1 virus; therefore, the treatment method based on a single neutralizing antibody cannot permanently suppress the plasma viremia of AIDS patients.

[0007] In order to improve the neutralization breadth and efficacy of neutralizing antibodies against HIV-1 virus, scientists have genetically engineered existing HIV-1 neutralizing antibodies, hoping to construct bispecific antibodies that target multiple viral epitopes, effectively inhibit viral escape, and have better neutralizing activity.

[0008] Bispecific antibodies (BsAb) are artificial antibodies that contain two specific antigen binding sites and can simultaneously target two different epitopes. BsAb can not only target two epitopes of the same molecule to achieve multi-site specific binding, but also target two epitopes of different target molecules to act as a bridge between different target molecules, so it has great potential for the treatment of AIDS.

[0009] Bispecific antibodies were originally prepared by fusing two hybridomas of different antibodies. Since each hybridoma can produce different immunoglobulins, the hybridoma or quadruplex obtained by fusion can theoretically produce antibodies with antigen specificity of both the first parent hybridoma and the second parent hybridoma. However, the light and heavy chain pairing combinations of antibodies produced by this method are complex, and the correct pairing ratio is low, which cannot achieve the desired effect of drug production. In recent years, the correct pairing ratio of the target heavy chain has been improved through genetic engineering methods such as "knob-into-hole", but these different construction methods all require the co-optimization transfection of multiple different expression plasmids such as three plasmids or four plasmids to produce the target bispecific antibody molecules. The byproducts of incorrect pairing need to be removed later, and the antibody purification step is also relatively complicated, resulting in poor applicability.

[0010] In recent years, a method for constructing a single-gene-encoded bispecific antibody invented by scientists has attracted widespread attention. Its advantage is that it can significantly improve the purification efficiency of bispecific antibodies, and the resulting bispecific antibodies can play a good neutralizing role.

[0011] Therefore, those skilled in the art hope to develop new bispecific antibodies against HIV-1. Summary of the invention

[0012] In order to solve the above technical problems, the present invention provides a bispecific anti-HIV-1 antibody or an antigen-binding molecule thereof, wherein the bispecific anti-HIV-1 antibody or an antigen-binding molecule thereof comprises a first antigen-binding module and a second antigen-binding module; the first antigen-binding module specifically binds to the MPER antigen, and the second antigen-binding module specifically binds to the CD4 antigen;

[0013] The first antigen binding moiety comprises a light chain variable region VL-1 and a heavy chain variable region VH-1;

[0014] The sequence of the light chain variable region VL-1 is as shown in SEQ ID NO.1, or it has more than 80% sequence homology with the sequence shown in SEQ ID NO.1; the sequence of the heavy chain variable region VH-1 is as shown in SEQ ID NO.2, or it has more than 80% sequence homology with the sequence shown in SEQ ID NO.2;

[0015] The second antigen binding moiety comprises a light chain variable region VL-2 and a heavy chain variable region VH-2;

[0016] The sequence of the light chain variable region VL-2 is shown in SEQ ID NO.3, or it has more than 80% sequence homology with the sequence shown in SEQ ID NO.3; the sequence of the heavy chain variable region VH-2 is shown in SEQ ID NO.4, or it has more than 80% sequence homology with the sequence shown in SEQ ID NO.4.

[0017] In a specific embodiment of the present invention, the light chain variable region VL-1 can be subjected to a small amount of amino acid deletion, insertion or amino acid mutation based on the above sequence to obtain an amino acid sequence with a homology of more than 80%. The variants obtained by substitution (deletion or insertion, or amino acid mutation, or substitution of similar amino acids) of a small amount of amino acids, especially conservative amino acid substitution in the framework region, have a high homology (more than 80% homology) with the above sequence and retain the original properties and functions of the light chain variable region, that is, the antibody properties and functions of specific binding to HIV virus, then these variants also fall within the scope of protection of the present invention. Similarly, the heavy chain variable region VH-1 can also be subjected to a small amount of amino acid deletion, insertion or amino acid mutation based on the above sequence, especially conservative amino acid substitution in the framework region to obtain variants, the obtained variants retain the original properties and functions of the heavy chain variable region, that is, the antibody properties and functions of specific binding to HIV virus, and these variants also fall within the scope of protection of the present invention. Similarly, the above situation also applies to the light chain variable region VL-2 and the heavy chain variable region VH-2, and the details are not repeated here.

[0018] In a specific embodiment of the present invention, the first antigen binding moiety is selected from any one of Fv, Fab, Fab', dsFv or scFv; the second antigen binding moiety is selected from any one of Fv, Fab, Fab', dsFv or scFv.

[0019] Preferably, the first antigen binding moiety is a single-chain antibody fragment scFv-1; the second antigen binding moiety is a single-chain antibody fragment scFv-2;

[0020] The ScFv-1 comprises a light chain variable region VL-1, a linker peptide Linker-1 and a heavy chain variable region VH-1 from the N-terminus to the C-terminus;

[0021] The ScFv-2 comprises a light chain variable region VL-2, a linker peptide Linker-2 and a heavy chain variable region VH-2 in sequence from the N-terminus to the C-terminus; or, the ScFv-2 comprises a heavy chain variable region VH-2, a linker peptide Linker-2 and a light chain variable region VL-2 in sequence from the N-terminus to the C-terminus;

[0022] The C-terminus of the ScFv-1 is connected to the N-terminus of the ScFv-2 via a linker peptide Linker-3.

[0023] Preferably, the sequences of the linker peptide Linker-1 and the linker peptide Linker-2 are (Gly4Ser)3; and the sequence of the linker peptide Linker-3 is GlySer(Gly4Ser)4.

[0024] Preferably, the C-terminus of the ScFv-2 is connected to a tag sequence; the tag sequence is a small molecule polypeptide purification tag sequence.

[0025] In another alternative embodiment of the present invention, the first and second antigen binding moieties are Fab or Fab' fragments. In yet another alternative embodiment of the present invention, the first and second antigen binding moieties, one of which is a Fab or Fab' fragment, and the other is Fv, dsFv or scFv.

[0026] In an alternative embodiment of the present invention, the bispecific antibody or antigen-binding molecule thereof of the present invention may further comprise more antigen-binding moieties, which may be the same as or different from the first / second antigen-binding moieties, for example, may be antigen-binding moieties that bind to other antigens.

[0027] In an alternative embodiment of the present invention, the first / second antigen binding moiety is selected from a murine antibody, a humanized antibody or a chimeric antibody.

[0028] In a specific embodiment of the present invention, the bispecific anti-HIV-1 antibody or antigen-binding molecule thereof comprises a heavy chain constant region; the heavy chain constant region is preferably a heavy chain constant region of human IgG1, 2, 3, or 4.

[0029] Preferably, the C-terminus of the ScFv-2 is connected to the Fc domain of human IgG1 via a hinge peptide.

[0030] Preferably, the Fc domain of human IgG1 comprises a heavy chain constant region CH2 and a heavy chain constant region CH3 from the N-terminus to the C-terminus;

[0031] The sequence of the heavy chain constant region CH2 is shown in SEQ ID NO.8;

[0032] The sequence of the heavy chain constant region CH3 is shown in SEQ ID NO.9;

[0033] The sequence of the hinge peptide is shown in SEQ ID NO.10.

[0034] On the other hand, the present invention provides a bispecific anti-HIV-1 antibody homodimer, wherein when the above-mentioned bispecific anti-HIV-1 antibody is expressed in a host cell, the heavy chain constant region, preferably the Fc domain of human IgG1, homodimerizes to form the bispecific anti-HIV-1 antibody homodimer.

[0035] In another aspect, the present invention provides a nucleic acid molecule, wherein the nucleic acid molecule encodes the bispecific anti-HIV-1 antibody or antigen-binding molecule thereof as described above.

[0036] In another aspect, the present invention provides a vector comprising the above-mentioned nucleic acid molecule, preferably, a vector comprising a nucleic acid molecule encoding the above-mentioned bispecific antibody or its antigen-binding molecule, in particular an expression vector expressing the above-mentioned bispecific antibody or its antigen-binding molecule.

[0037] The term "vector" refers to a nucleic acid delivery vehicle into which a polynucleotide encoding a protein can be inserted and the protein can be expressed. The vector can be transformed, transduced or transfected into a host cell so that the genetic material elements it carries can be expressed in the host cell. The vector can contain a variety of elements that control expression, such as a promoter sequence, a transcription start sequence, an enhancer sequence, a selection element, and a reporter gene. In addition, the vector may also contain a replication initiation site. The vector may also include components that assist it in entering the cell, such as viral particles, liposomes, or protein shells, but not only these substances. In an embodiment of the present invention, the vector can be selected from, but not limited to: plasmids, phagemids, cosmids, artificial chromosomes (such as yeast artificial chromosomes YAC, bacterial artificial chromosomes BAC, or P1-derived artificial chromosomes PAC), phages (such as lambda phages or M13 phages), and animal viruses used as vectors, for example, retroviruses (including lentiviruses), adenoviruses, adeno-associated viruses, herpes viruses (such as herpes simplex viruses), poxviruses, baculoviruses, papillomaviruses, papillomaviruses (such as SV40).

[0038] Another aspect of the present invention provides a host cell comprising the above vector.

[0039] Regarding the "host cell", it can be selected, but not limited to: prokaryotic cells such as Escherichia coli or Bacillus subtilis, fungal cells such as yeast cells or Aspergillus, insect cells such as S2 Drosophila cells or Sf9, or animal cell models such as fibroblasts, CHO cells, COS cells, NSO cells, HeLa cells, BHK cells, HEK293 cells, etc. Preferably, the host cell is HEK293 cell.

[0040] In another aspect, the present invention provides a method for producing the above-mentioned bispecific antibody or antigen-binding molecule thereof, wherein the above-mentioned bispecific antibody is produced by culturing a host cell containing a nucleic acid molecule encoding the above-mentioned bispecific antibody or antigen-binding molecule thereof.

[0041] The bispecific antibodies or antigen-binding molecules thereof of the present invention can be produced by the above-mentioned recombinant method or by hybridoma method.

[0042] The present invention also provides a method for producing the homologous dimer of the above-mentioned bispecific antibody, which comprises culturing the above-mentioned host cell. When the above-mentioned bispecific antibody is expressed in the host cell, the domains of the heavy chain constant region undergo homologous dimerization to produce the homologous dimer of the bispecific antibody.

[0043] Other aspects of the present invention also provide glycosylation variants of the above-mentioned bispecific antibodies, antibody variants engineered with cysteine, antibody derivatives, recombinant proteins and immunoconjugates.

[0044] The recombinant protein comprises the bispecific antibody or the homodimer. The immunoconjugate comprises the bispecific antibody or the homodimer. Preferably, the conjugated part of the immunoconjugate uses one or more heterologous molecules, for example, a heterologous molecule with cytotoxicity that can be applied to the immunoconjugate.

[0045] On the other hand, the present invention also provides a pharmaceutical composition, wherein the pharmaceutical composition comprises the above-mentioned bispecific antibody or its antigen-binding molecule, or the above-mentioned homodimer, or the above-mentioned nucleic acid molecule, or the above-mentioned vector, or the above-mentioned host cell, or the above-mentioned recombinant protein, or the above-mentioned immunoconjugate, and a pharmaceutically acceptable carrier.

[0046] In another aspect, the present invention provides the use of the above-mentioned bispecific anti-HIV-1 antibody or its antigen-binding molecule, or the above-mentioned homodimer, or the above-mentioned pharmaceutical composition in the preparation of a drug for treating or preventing diseases caused by HIV-1 virus.

[0047] In another aspect, the present invention provides a detection product, wherein the detection product comprises the above-mentioned bispecific anti-HIV-1 antibody or antigen-binding molecule thereof, or comprises the above-mentioned homodimer.

[0048] The detection product is used to detect the presence or level of HIV-1 virus in a sample.

[0049] In a specific embodiment of the present invention, the detection product includes, but is not limited to, a detection reagent, a detection kit, a detection chip or a test paper, etc.

[0050] The above-mentioned bispecific antibody or antigen-binding fragment thereof of the present invention can be labeled by chemical methods or genetic engineering methods, and the labeled antibody or antigen-binding fragment thereof can be used for detection; the labeled antibody or antigen-binding fragment thereof falls within the protection scope of the present invention.

[0051] The specific detection method can adopt the following steps: 1) providing a sample; 2) contacting the sample with the bispecific antibody or antigen-binding fragment thereof of the present invention; 3) detecting the immune reaction between the sample and the antibody or antigen-binding fragment thereof.

[0052] The present invention relates to a bispecific anti-HIV-1 antibody or an antigen-binding molecule thereof, a nucleic acid molecule encoding the bispecific antibody or the antigen-binding molecule thereof, a vector comprising the nucleic acid molecule, a host cell comprising the vector, and the use of the bispecific antibody, the antigen-binding molecule thereof, and the homodimer thereof in the preparation of a medicament for treating or preventing a disease caused by HIV-1 virus, and in detection products; the bispecific anti-HIV-1 antibody of the present invention has a significant neutralizing ability against HIV-1 virus, and has a good prospect for clinical application in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 This is the plasmid map of the pcDNA3.4-Fc expression vector used in the preparation of the bispecific antibody of Example 1 of the present invention;

[0054] Figure 2 This is the plasmid map of the expression vector pcDNA3.4-10E8-iMab-Fc constructed in the preparation of the bispecific antibody of Example 1 of the present invention.

[0055] Figure 3 is a schematic diagram of a homodimer formed when the bispecific antibody of Example 1 of the present invention is expressed;

[0056] Figure 4 This is a diagram showing the identification results of Reducing SDS-PAGE of the bispecific antibodies of Examples 1 and 2;

[0057] Figure 5 The electrophoresis result diagram of using SDS-PAGE to identify the bispecific antibodies of Examples 1 and 2;

[0058] Figure 6 The results are the neutralizing activity and broad spectrum of the bispecific antibody of Example 1, as well as known anti-HIV-1 monoclonal antibodies (VRC01, 10E8, PGT128, iMab) and bispecific antibodies (PGT128-iMab) against 96 conventional HIV-1 pseudoviruses;

[0059] Figure 7 and Figure 8 They are respectively a graph showing the change in viral load over time in rhesus monkeys and a graph showing the change in corresponding antibody concentration in plasma over time when the bispecific antibody of Example 1 is used to treat rhesus monkeys persistently infected with HIV-1 virus. DETAILED DESCRIPTION

[0060] The present invention will be described in detail below in conjunction with the specific embodiments shown in the accompanying drawings. However, these embodiments do not limit the present invention, and any structural, methodological, or functional changes made by a person skilled in the art based on these embodiments are all within the scope of protection of the present invention.

[0061] Example embodiments will now be described more fully with reference to the accompanying drawings. However, example embodiments can be implemented in many forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that the present invention will be comprehensive and complete and fully convey the concept of the example embodiments to those skilled in the art.

[0062] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field (for example, refer to "Molecular Cloning Experiment Guide" 3rd edition, written by J. Sambrook et al., translated by Huang Peitang et al., Science Press) or the product instructions are used.

[0063] Example 1

[0064] The bispecific anti-HIV-1 antibody of Example 1 comprises two single-chain antibody variable domains ScFv-1 and ScFv-2, wherein the single-chain antibody variable domain ScFv-1 specifically binds to the MPER antigen, and the single-chain antibody variable domain ScFv-2 specifically binds to the CD4 antigen.

[0065] ScFv-1 includes the light chain variable region VL-1, linker peptide Linker-1 and heavy chain variable region VH-1 from N-terminus to C-terminus;

[0066] ScFv-2 includes the light chain variable region VL-2, linker peptide Linker-2 and heavy chain variable region VH-2 from N-terminus to C-terminus;

[0067] The C-terminus of ScFv-1 is connected to the N-terminus of ScFv-2 via the linker peptide Linker-3;

[0068] The C-terminus of ScFv-2 is connected to the Fc domain of human IgG1 via a hinge peptide;

[0069] The Fc domain of human IgG1 includes the heavy chain constant region CH2 and the heavy chain constant region CH3 from N-terminus to C-terminus;

[0070] That is, the sequence of the bispecific anti-HIV-1 antibody of Example 1, from N-terminus to C-terminus, is: VL-1—Linker-1—VH-1—Linker-3—VL-2—Linker-2—VH-2—Hinge—CH2—CH3.

[0071] Wherein, the sequence of the light chain variable region VL-1 is shown in SEQ ID NO.1; the sequence of the heavy chain variable region VH-1 is shown in SEQ ID NO.2; the sequence of the light chain variable region VL-2 is shown in SEQ ID NO.3; the sequence of the heavy chain variable region VH-2 is shown in SEQ ID NO.4;

[0072] The sequences of Linker-1 and Linker-2 are (Gly4Ser)3, as shown in SEQ ID NO.5.

[0073] The sequence of Linker-3 is GlySer(Gly4Ser)4, as shown in SEQ ID NO.6;

[0074] The sequence of the heavy chain constant region CH2 is shown in SEQ ID NO.8; the sequence of the heavy chain constant region CH3 is shown in SEQ ID NO.9;

[0075] The sequence of the hinge peptide Hinge is shown in SEQ ID NO.10.

[0076] Construction and expression of the bispecific anti-HIV-1 antibody of Example 1

[0077] Step 1) Construction of antibody expression vector pcDNA3.4-Fc containing Fc gene fragment

[0078] The gene fragments of the fully human IgG1 signal peptide gene SP, hinge peptide Hinge, heavy chain constant region CH2 and heavy chain constant region CH3 (SP-Fc gene) were synthesized by GenScript Corporation.

[0079] AgeI and BamHI restriction sites were inserted between the signal peptide and hinge region genes, separated by the GTACGC nucleic acid sequence, to synthesize the SP-AgeI-BamHI-Fc sequence, which was connected to the pcDNA3.4 vector by TA cloning to finally obtain the pcDNA3.4-Fc expression vector. The specific plasmid map is shown in the figure. Figure 1 shown.

[0080] Step 2) Synthesize antibody gene sequence

[0081] The single-chain antibody variable domain ScFv-1 specifically binding to the MPER antigen adopts the ScFv of the fully human HIV-1 neutralizing antibody 10E8;

[0082] The single-chain antibody variable domain ScFv-2 specifically binding to CD4 antigen adopts the ScFv of the fully human HIV-1 neutralizing antibody iMab;

[0083] The nucleotide sequence corresponding to the single-chain antibody ScFv-1—Linker-3—ScFv-2 was synthesized by Nanjing GenScript Co., Ltd. according to conventional methods, that is, from the 5' end to the 3' end, it is the ScFv gene sequence of antibody 10E8 (as shown in SEQ ID NO.11), the gene sequence of Linker-3 and the ScFv gene sequence of antibody iMab (as shown in SEQ ID NO.12).

[0084] Step 3) Construction of expression vector for antibody gene

[0085] The 5' and 3' ends of the nucleotide sequence of the single-chain antibody ScFv-1-Linker-3-ScFv-2 synthesized in step 2) were inserted into the pcDNA3.4-Fc expression vector constructed in step 1) through the AgeI and BamHI restriction sites, respectively. The expression plasmid of the bispecific anti-HIV-1 antibody finally obtained was named pcDNA3.4-10E8-iMab-Fc. The plasmid map is shown in FIG. Figure 2 shown.

[0086] Step 4) Expression of bispecific anti-HIV-1 antibody in mammalian cells HEK 293F The expression plasmid (pcDNA3.4-10E8-iMab-Fc) of the bispecific anti-HIV-1 antibody constructed in step 3) was transiently transfected into HEK 293F cells to express the protein for subsequent purification, identification and functional studies.

[0087] First, the expression plasmid with the correct sequence was extracted using a plasmid extraction kit (Meiji Biotechnology), and then the expression plasmid was transiently transfected into HEK 293F suspension cells.

[0088] The specific transfection steps are as follows: one day before transfection, 50 ml of HEK293F cells were cultured at 1.2 × 10 6 / ml density was plated in a 250mL cell culture shake flask. On the day of transfection, the transfection reagent EZTrans was fully mixed with the expression plasmid constructed in step 3) (mass volume ratio was DNA: EZTrans = 1:3) and dissolved in serum-free 239-TⅡ medium to obtain an EZTrans-DNA mixture (i.e. 60μg DNA and 180μl EZTrans dissolved in 4mL medium). After standing for 15 minutes, the EZTrans-DNA mixture was evenly added to HEK293F cells in the form of raindrops. Six days after transfection, the cell culture supernatant was obtained by centrifugation for subsequent extraction and purification steps of the bispecific anti-HIV-1 antibody. (Note: When the antibody is expressed in the host cell, the Fc domain of human IgG1 will undergo homodimerization to form a homodimer; the schematic diagram of the homodimer is shown in Figure 3 As shown, after subsequent extraction and purification, identification will be performed. )

[0089] Step 5) Antibody extraction and purification

[0090] The cell supernatant collected in the above step 4) was filtered with a 0.45 μm filter membrane, the supernatant was diluted with binding buffer, and purified using a Protein G (Changzhou Tiandi Renhe) affinity chromatography column. The purified antibodies were analyzed for purity and molecular size by SDS-PAGE.

[0091] Specific operation method: The antibodies are cross-linked together by glutaraldehyde cross-linking to maintain their dimer structure, and then the size and purity are identified by SDS-PAGE electrophoresis.

[0092] Cross-linking SDS-PAGE steps: Take 2 μg of antibody, fill with 20 μL PBS, add 1 μL 50% glutaraldehyde for cross-linking at room temperature for 2 minutes, terminate the cross-linking with 1 μL Tris-HCL (1M, PH=8.0), add 5 μL 5× protein sample loading buffer, and perform electrophoresis separation in a 4%-20% precast gel (GenScript Biotech).

[0093] The identification results can be found in Figure 5 After the antibody of Example 1 was cross-linked with glutaraldehyde, a homodimer size band was observed around 170 kDa, and no obvious small molecular weight band was observed. This shows that the bispecific antibody of Example 1 formed the correct homodimer after purification, and the purity was very high, which was in line with expectations.

[0094] Then, the bispecific antibody of Example 1 of the present invention was subjected to protein denaturation treatment (Reducing), and then the size of the monomer produced after the bispecific antibody was denatured was identified by SDS-PAGE.

[0095] The specific operation steps of Reducing SDS-PAGE were as follows: 2 μg of antibody was taken, 20 μL of PBS was added, 5 μL of 5× protein sample loading buffer was added, and the mixture was heated in a metal water bath at 100°C for 10 minutes for denaturation, and then separated by electrophoresis in a 4%-20% precast gel (GenScript Biotech).

[0096] Reducing SDS-PAGE experimental results Figure 4 As shown, after the antibody of Example 1 was heated and denatured with SDS, a size band of the bispecific antibody monomer was observed around 80 kDa, which was in line with expectations.

[0097] Finally, the absorbance at 280 nm was measured using Nanodrop 2000 (ThermoFisher) and the antibody concentration was calculated.

[0098] Example 2

[0099] The bispecific anti-HIV-1 antibody of Example 2 is different from the antibody of Example 1 in that the positions of the light chain variable region VL-2 and the heavy chain variable region VH-2 in the single-chain antibody variable domain ScFv-2 are exchanged.

[0100] The sequence of the bispecific anti-HIV-1 antibody of Example 2, from N-terminus to C-terminus, is: VL-1—Linker-1—VH-1—Linker-3—VH-2—Linker-2—VL-2—Hinge—CH2—CH3.

[0101] The method for constructing and expressing a bispecific anti-HIV-1 antibody in Example 2 differs from that in Example 1 above only in that, in the process of synthesizing the antibody gene sequence in step 2), the sequence of the synthesized single-chain antibody variable domain ScFv-2 is replaced with VH-2—Linker-2—VL-2; the operations in other steps are the same as those in Example 1 and will not be described in detail.

[0102] The purified antibody obtained in Example 2 was analyzed for purity and identified for molecular size by SDS-PAGE. Figure 5 ; The identification results of Reducing SDS-PAGE can be found in Figure 4 The analysis of the identification results is the same as in Example 1, and will not be described in detail.

[0103] Example 3

[0104] The bispecific anti-HIV-1 antibody of Example 3 is different from the antibody of Example 1 in that the Fc purification tag sequence is replaced by a His tag sequence.

[0105] The His tag sequence is shown in SEQ ID NO.7.

[0106] The specific construction and purification steps of Example 3 are as follows:

[0107] Step 1) Construct an antibody expression vector pcDNA3.4-His containing a His tag sequence.

[0108] The fully human IgG1 heavy chain signal peptide SP and His tag gene fragments were synthesized by GenScript, and the restriction sites AgeI and BamHI were inserted between the signal peptide and the His tag gene, separated by the GTACGC nucleic acid sequence, that is, the SP-AgeI-BamHI-His tag gene was synthesized and inserted into the pcDNA3.4 vector through TA cloning; finally, the pcDNA3.4-His expression vector was obtained, and the antibody gene was inserted into the antibody expression vector through the AgeI and BamHI restriction sites.

[0109] Step 2) Synthesize antibody gene sequence

[0110] The specific operation is the same as step 2) of Example 1 and will not be repeated here.

[0111] Step 3) Construction of expression vector for antibody gene

[0112] The 5' and 3' ends of the nucleotide sequence of the single-chain antibody ScFv-1—Linker-3—ScFv-2 synthesized in the above step 2) are respectively inserted into the pcDNA3.4-His expression vector constructed in the above step 1) through the AgeI and BamHI restriction sites, and the expression plasmid of the bispecific anti-HIV-1 antibody is finally obtained.

[0113] Step 4) Expression of bispecific anti-HIV-1 antibodies in mammalian HEK293F cells

[0114] The expression plasmid of the bispecific anti-HIV-1 antibody constructed in step 3) is transiently transfected into mammalian cells HEK293F to express the protein for subsequent purification, identification and functional studies.

[0115] The specific transfection operation is the same as step 4) in Example 1 and will not be repeated here.

[0116] Step 5) Antibody extraction and purification

[0117] The specific operations of extraction and purification are the same as step 5) of Example 1 and will not be repeated here.

[0118] Comparative Example

[0119] The antibody sequences of Comparative Example 1 are as follows from N-terminus to C-terminus:

[0120] VH-1—Linker-1—VL-1—Linker-3—VL-2—Linker-2—VH-2—Hinge—CH2—CH3.

[0121] The antibody sequence of Comparative Example 1 is different from that of Example 1 in that the positions of the light chain variable region VL-1 and the heavy chain variable region VH-1 in the single-chain antibody variable domain ScFv-1 are exchanged.

[0122] The antibody sequences of Comparative Example 2 are as follows from N-terminus to C-terminus:

[0123] VH-1—Linker-1—VL-1—Linker-3—VH-2—Linker-2—VL-2—Hinge—CH2—CH3.

[0124] The antibody sequence of Comparative Example 1 differs from that of Example 1 in that the positions of the light chain variable region VL-1 and the heavy chain variable region VH-1 in the single-chain antibody variable domain ScFv-1 are exchanged; and the positions of the light chain variable region VL-2 and the heavy chain variable region VH-2 in the single-chain antibody variable domain ScFv-2 are exchanged.

[0125] The antibody sequences of Comparative Example 3 are as follows from N-terminus to C-terminus:

[0126] VL-2—Linker-2—VH-2—Linker-3—VL-1—Linker-1—VH-1—Hinge—CH2—CH3.

[0127] The antibody sequence of Comparative Example 3 is different from that of Example 1 in that the positions of the single-chain antibody variable domains ScFv-1 and ScFv-2 are exchanged.

[0128] The antibody sequences of Comparative Example 4 are as follows from N-terminus to C-terminus:

[0129] VH-2—Linker-2—VL-2—Linker-3—VL-1—Linker-1—VH-1—Hinge—CH2—CH3.

[0130] The antibody sequence of Comparative Example 4 differs from that of Example 1 in that the positions of the single-chain antibody variable domains ScFv-1 and ScFv-2 are exchanged, and the positions of the light chain variable region VL-2 and the heavy chain variable region VH-2 in the single-chain antibody variable domain ScFv-2 are exchanged.

[0131] The antibody sequences of Comparative Example 5 are as follows from N-terminus to C-terminus:

[0132] VH-2—Linker-2—VL-2—Linker-3—VH-1—Linker-1—VL-1—Hinge—CH2—CH3.

[0133] The antibody sequence of Comparative Example 5 differs from that of Example 1 in that the positions of the single-chain antibody variable domains ScFv-1 and ScFv-2 are exchanged, and the positions of the light chain variable region VL-1 and the heavy chain variable region VH-1 in the single-chain antibody variable domain ScFv-1, as well as the positions of the light chain variable region VL-2 and the heavy chain variable region VH-2 in the single-chain antibody variable domain ScFv-2 are exchanged.

[0134] Comparative Examples 1-5 all constructed an antibody expression vector pcDNA3.4-Fc containing an Fc gene fragment according to step 1) of Example 1, then synthesized their respective synthetic antibody gene sequences, and then obtained their respective antibodies according to steps 3)-5) of Example 1.

[0135] Comparative Example 6: Fully human HIV-1 neutralizing antibody 10E8 that specifically binds to MPER antigen;

[0136] Comparative Example 7: Fully human HIV-1 neutralizing antibody iMab that specifically binds to CD4 antigen.

[0137] Performance data

[0138] 1. Production of HIV-1 pseudovirus strains

[0139] HIV-1 pseudoviruses were obtained by co-transfecting HEK293T cells with their respective HIV envelope protein plasmids and HIV Env-deficient backbone plasmids (pNL4-3.Luc.RE-) with luciferase reporter gene. HIV envelope protein plasmids were preserved by our laboratory, and pNL4-3.Luc.RE- backbone plasmids were derived from the NIH AIDS Reagent Program in the United States. All plasmids were amplified by transforming DH5ɑ, and plasmids were extracted using the Meiji Bioplasmid Extraction Kit.

[0140] The specific steps of virus packaging are as follows: one day in advance, 5×10 6HEK293T cells. 24 hours later, the backbone plasmid (pNL4-3.Luc.RE-) and HIV envelope protein expression plasmid were co-transfected into 293T cells at a volume-to-mass ratio of 3:1 using EZTrans cell transfection reagent (Liji Biotechnology). For detailed transfection methods, please refer to the instruction manual of EZ Trans cell transfection reagent. 48 hours after transfection, the supernatant containing pseudovirus was collected, centrifuged at 2500 rpm for 10 minutes to remove cell debris, and then fully mixed and aliquoted and frozen in a -80°C refrigerator for antibody purity and size identification and neutralization activity detection.

[0141] 2. Neutralizing activity detection of antibodies

[0142] Detection objects: antibodies of Examples 1, 2 and 3, and antibodies of Comparative Examples 1-7;

[0143] Six common HIV-1 pseudovirus strains (Q168.a2, CAAN.A2, CNE58, Bal.01, ZM106.9 and CNE56) prevalent in China and the world were selected for antibody neutralization experiments.

[0144] The specific steps of the neutralization experiment are as follows: in a 96-well U-bottom culture plate, the antibody was graded diluted with DMEM high-glucose medium containing 10% fetal bovine serum, and then transferred to a 96-well flat-bottom plate, and the diluted HIV-1 pseudovirus was added. After the two were fully mixed, they were placed in a cell culture incubator at 37°C for 30 minutes. During the incubation period, U87MG cells were digested and the cell density was adjusted to 5×10 5 / mL, add 20μl of U87MG cells to each well, and then continue to culture in a cell culture incubator. After 24 hours, add 10% FBS DMEM high-glucose medium to 200μl / well, continue to culture in a cell culture incubator for 24 hours, aspirate the cell culture supernatant, lyse the cells, use a luciferase assay kit (Luciferase Assay System, Promega Cat.#E1500) to detect the intensity of intracellular luciferase, and use a multi-function microplate reader (Perkin Elmer) to detect the chemiluminescence RLU value of each well; and calculate the percentage of inhibition of virus entry into cells and the half-inhibitory dose IC50 of the antibody to inhibit the virus.

[0145] The test results are shown in Tables 1 and 2 below:

[0146] Table 1

[0147]

[0148]

[0149] Table 2

[0150]

[0151] From the data in Table 1 and Table 2, it can be seen that the antibodies of Examples 1 and 2 of the present invention have significantly excellent neutralizing ability for the above 6 HIV-1 pseudovirus strains, and can show neutralizing activity at a concentration level 2 to 4 orders of magnitude lower than the 1 μg / ml level; for example, for HIV-1 pseudoviruses Q168.a2, CNE58, Bal.01 and CNE56, neutralizing activity is shown at a concentration level of 0.1 ng / ml; for HIV-1 pseudovirus CAAN.A2, neutralizing activity is shown at a concentration level of 1 ng / ml; for HIV-1 pseudovirus ZM106.9, neutralizing activity is also shown at a concentration level of 0.01 μg / ml. From the statistical results in Table 1, the median IC50 values ​​and geometric mean IC50 values ​​of the antibodies of Examples 1 and 2 for these 6 viruses are basically the same; indicating that the neutralizing ability of the antibodies of Examples 1 and 2 for HIV-1 virus is comparable.

[0152] However, the neutralizing activity of the monoclonal antibodies of Comparative Examples 6 and 7 against any of the above 6 HIV-1 pseudovirus strains is significantly inferior to that of the antibodies of Examples 1 and 2. From the geometric mean IC50 values ​​in the statistical results, the neutralizing ability of the antibodies of Examples 1 and 2 is 445 times that of the monoclonal antibody of Comparative Example 6 and 84 times that of the monoclonal antibody of Comparative Example 7.

[0153] The antibodies of Comparative Examples 1 to 5 are also bispecific antibodies based on the sequences of the monoclonal antibodies (antibody 10E8 and antibody iMab) of Comparative Examples 6 and 7, but their neutralizing activities are significantly inferior to those of the antibodies of Examples 1 and 2. From the geometric mean IC50 values ​​in the statistical results, the neutralizing abilities of the antibodies of Examples 1 and 2 are tens or even thousands of times (998, 2111, 49, 9585, 1138 times) that of the antibodies of Comparative Examples 1-5.

[0154] Although the prior art discloses the sequence of the fully human HIV-1 neutralizing antibody 10E8 that specifically binds to the MPER antigen and the sequence of the fully human HIV-1 neutralizing antibody iMab that specifically binds to the CD4 antigen. Theoretically, the neutralization ability of the bispecific antibody formed by the combination of two monoclonal antibodies can be inferred to be the "sum" of the neutralization abilities of the two monoclonal antibodies. However, the inventors of the present invention found that the actual situation is not the case during the scientific research process. The inventors found that the arrangement order of the heavy and light chains of the single-chain antibody variable domains ScFv-1 and ScFv-2, as well as the arrangement order between ScFv-1 and ScFv-2 have a great influence on the neutralizing activity of the bispecific antibody. Although the antibodies of Comparative Examples 1-5 are also bispecific antibodies based on the sequences of antibody 10E8 and antibody iMab, their neutralizing activity is not only significantly inferior to that of the antibodies in Examples 1 and 2, but also worse than that of the monoclonal antibodies in Comparative Examples 6 and 7 from the overall data.

[0155] The inventors unexpectedly discovered that by constructing a bispecific antibody (the bispecific antibody of Examples 1 and 2) with the sequences of antibody 10E8 and antibody iMab in a specific combination, its neutralizing ability against HIV-1 virus is much greater than the simple sum of the neutralizing abilities of antibody 10E8 and antibody iMab (the neutralizing ability of the antibodies of Examples 1 and 2 is 445 times that of the antibody of Example 6 and 84 times that of the antibody of Example 7), achieving unexpected technical effects.

[0156] See Table 3 below for a comparison of the data results of Example 1 and Example 3.

[0157] Table 3:

[0158]

[0159]

[0160] From the data in Table 3, it can be seen that both Example 1 and Example 3 can neutralize the six viruses, and the median IC50 and the geometric mean IC50 are comparable, indicating that different tags (Fc, His tags) have little effect on the neutralizing activity of the antibody.

[0161] 3. Comparison of neutralizing activity and broad-spectrum of antibodies against 96 common HIV-1 pseudovirus strains

[0162] The neutralizing activity and broad-spectrum results of the bispecific antibody of Example 1 of the present invention, the anti-HIV-1 monoclonal antibodies (VRC01, 10E8, PGT128, iMab) that have entered clinical trials in the United States, and the known bispecific anti-HIV-1 antibody (PGT128-iMab) against 96 conventional HIV-1 pseudovirus strains (pseudovirus strains corresponding to the 96 HIV-1 viruses currently prevalent in China and the world) are shown in Tables 4 and Figure 6 .

[0163] Table 4

[0164]

[0165]

[0166] It can be seen from the data in Table 4 that the bispecific antibody of Example 1 of the present invention has significantly excellent broad-spectrum neutralization ability against 96 HIV-1 pseudovirus strains.

[0167] 1) At an antibody concentration of 20 μg / ml, the antibody of Example 1 can 100% neutralize 96 conventional HIV-1 pseudovirus strains, with a median IC50 value of 0.0008 μg / ml. The median IC50 values ​​of monoclonal antibodies VRC01, 10E8, PGT128, and iMab are 0.3133 μg / ml, 0.2169 μg / ml, 0.0267 μg / ml, and 0.0632 μg / ml, respectively, and the median IC50 value of bispecific antibody PGT128-iMab is 0.0293 μg / ml. It can be seen that the neutralizing ability of the antibody of Example 1 is 252 times and 58 times that of its corresponding parent monoclonal antibody 10E8 and iMab, 342 times that of monoclonal antibody VRC01, and 27 times that of bispecific antibody PGT128-iMab.

[0168] 2) At an antibody concentration of 0.1 μg / ml, the antibody of Example 1 can still neutralize 96 conventional HIV-1 pseudovirus strains 100%, however, the broad-spectrum of monoclonal antibodies VRC01, 10E8, PGT128 and iMab, as well as the bispecific antibody PGT128-iMab, is greatly reduced, and the percentage of the number of virus strains that can be neutralized is 11%, 21%, 54%, 68% and 84% of the total, respectively (compared with the data of the antibody concentration of 20 μg / ml, it is decreased by 62%, 75%, 12%, 26% and 16%, respectively).

[0169] 3) When the antibody concentration was 0.01 μg / ml, the antibody in Example 1 could still neutralize 96% of conventional HIV-1 pseudovirus strains, while the corresponding parental monoclonal antibody 10E8 and iMab could neutralize only 1% and 10% of the strains. Monoclonal antibody VRC01 could not neutralize any strains (0%), and the broad spectrum of the dual antibody PGT128-iMab was also significantly reduced (the number of strains that could be neutralized accounted for only 28%).

[0170] from Figure 6 It can be more intuitively seen that the broad-spectrum neutralizing activity of the dual antibody of Example 1 of the present invention far exceeds the currently known HIV-1 monoclonal antibody and dual antibody in the clinical trial stage.

[0171] More importantly, the broad-spectrum neutralizing ability of the bispecific antibody of Example 1 of the present invention is much greater than the simple sum of its corresponding parental monoclonal antibody 10E8 and iMab, achieving an unexpected technical effect.

[0172] IV. Therapeutic effect of antibodies on rhesus monkeys with persistent HIV-1 infection

[0173] The Institute of Medical Laboratory Animals, Chinese Academy of Medical Sciences in Beijing, established a model of HIV-1 virus persistent infection in rhesus monkeys. We used this model to verify the therapeutic effect of the bispecific antibody of Example 1 of the present invention on HIV-1 infected rhesus monkeys.

[0174] Rhesus monkeys weighed about 5-6 kg / animal, and were administered at a dose of 10 mg / kg (the dual antibody in Example 1). Rhesus monkey plasma was retained as a background control before administration. Administration was performed by intravenous injection on day 0, and then blood was collected every 4 days, and plasma was separated and stored at -80°C. Sampling was performed until the end of day 63. All plasma collected at different time points was used to measure the plasma viral load by qRT-PCR, and the plasma antibody concentration was detected by ELISA.

[0175] Plasma viral load was measured by qRT-PCR: SIV gag477 was measured by quantitative real-time reverse transcription-PCR (qRT-PCR) using the upstream primer GCAGAGGGAGAAATTACCCTAC, the downstream primer CAATTTTACCCAGGCATTTATTTT and the probe FAM (6-carboxyfluorescein)-ACCTGCCATTAAGCCCGA-MGB on a Perkin-Elmer ABI7500 instrument. Viral RNA was extracted and purified from cell-free plasma by using the QIAamp viral RNA mini kit (Qiagen). RNA was eluted in 20 μl of nuclease-free water and immediately frozen at -80 °C until analysis. The SIV gag477 cDNA sequence was used as a PCR positive control. The detection limit was 100 copies of equivalent RNA per ml of plasma. Triplicate test reactions were performed for each sample.

[0176] ELISA detection of plasma antibody concentration: Dilute the MPER polypeptide recognized by 10E8 in the double antibody of Example 1 with the coating solution sodium bicarbonate buffer to a final concentration of 10 μg / mL, add 100 μl / well to a 96-well plate, and incubate at 4°C overnight. Remove the coating solution, add 300 μl of PBS blocking solution containing 5% skim milk powder and block at room temperature for at least 1 hour. Wash the plate 3 times with PBS-T buffer. Dilute the rhesus monkey plasma in a 5-fold gradient starting from 1:100 and add 100 μl / well to a 96-well plate. Incubate at room temperature for 1 hour. Add 100 μl / well HRP anti-human IgG (1:2500 dilution in PBS buffer) to the PBS buffer and incubate at room temperature for 1 hour. Wash 3 times with PBS-T buffer. Add 100 μl of the color developing solution ABTS to each well. Color at room temperature and read the absorbance at A405.

[0177] from Figure 7 It can be seen that after the bispecific antibody of Example 1 was injected into rhesus monkeys, a large amount of viruses in the plasma were neutralized by the antibodies, and the viral load rapidly dropped to an undetectable level within 7 days; thereafter, due to the presence of HIV-1 infected cells in the rhesus monkeys, the latent viruses in the cells replicated and released viral particles, and the viral load in the plasma gradually increased again; unexpectedly, the viral load began to slowly decrease again at 21 days, and almost no virus was detected at 35-63 days; this shows that the bispecific antibody of Example 1 of the present invention can recognize and kill cells infected with HIV-1 virus in rhesus monkeys, clear the virus reservoir, and completely eliminate the virus in the body.

[0178] Figure 8 The figure shows the change in the concentration of the bispecific antibody of Example 1 in the plasma of rhesus monkeys. After the antibody is injected into the body, due to the neutralization of a large number of free virus particles, the concentration drops rapidly from 15 μg / ml, and then maintains at a level of about 5 μg / ml, and then slowly decreases until 63 days. This indicates that the bispecific antibody of Example 1 of the present invention is relatively stable in rhesus monkeys and has a relatively long half-life.

[0179] In summary, the bispecific antibody of Example 1 of the present invention can stably exist in rhesus monkeys, and can not only remove free virus particles in plasma, but also remove HIV-1 infected cells, reduce the virus reservoir, and achieve the goal of completely eliminating the virus in the body. Therefore, the bispecific antibody of Example 1 has a good effect in treating HIV-1 and clinical application prospects.

[0180] It should be understood that although this specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each implementation mode may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

[0181] The series of detailed descriptions listed above are only specific descriptions of feasible implementation methods of the present invention. They are not intended to limit the scope of protection of the present invention. Any equivalent implementation methods or changes that do not deviate from the technical spirit of the present invention should be included in the scope of protection of the present invention.

Claims

1. A bispecific anti-HIV-1 antibody or antigen-binding molecule thereof, characterized in that: The bispecific anti-HIV-1 antibody or antigen binding molecule thereof comprises a first antigen binding moiety and a second antigen binding moiety; the first antigen binding moiety specifically binds to the MPER antigen, and the second antigen binding moiety specifically binds to the CD4 antigen; The first antigen binding moiety is a single-chain antibody fragment scFv-1; the second antigen binding moiety is a single-chain antibody fragment scFv-2; The scFv-1 comprises a light chain variable region VL-1, a linker peptide Linker-1 and a heavy chain variable region VH-1 in sequence from the N-terminus to the C-terminus; The scFv-2 comprises a light chain variable region VL-2, a linker peptide Linker-2 and a heavy chain variable region VH-2 in sequence from the N-terminus to the C-terminus; or, the scFv-2 comprises a heavy chain variable region VH-2, a linker peptide Linker-2 and a light chain variable region VL-2 in sequence from the N-terminus to the C-terminus; The C-terminus of the scFv-1 is connected to the N-terminus of the scFv-2 via a linker peptide Linker-3; The sequence of the light chain variable region VL-1 is shown in SEQ ID NO.1; the sequence of the heavy chain variable region VH-1 is shown in SEQ ID NO.2; The sequence of the light chain variable region VL-2 is shown in SEQ ID NO.3; the sequence of the heavy chain variable region VH-2 is shown in SEQ ID NO.

4.

2. The bispecific anti-HIV-1 antibody or antigen-binding molecule thereof according to claim 1, characterized in that: The sequences of the linker peptide Linker-1 and the linker peptide Linker-2 are (Gly4Ser)3; the sequence of the linker peptide Linker-3 is GlySer(Gly4Ser)4.

3. The bispecific anti-HIV-1 antibody or antigen-binding molecule thereof according to claim 1, characterized in that: The C-terminus of the scFv-2 is connected to a tag sequence; the tag sequence is a small molecule polypeptide purification tag sequence.

4. The bispecific anti-HIV-1 antibody or antigen-binding molecule according to any one of claims 1 to 2, characterized in that: The bispecific anti-HIV-1 antibody comprises a heavy chain constant region; the heavy chain constant region is selected from the heavy chain constant regions of human IgG1, 2, 3, and 4.

5. The bispecific anti-HIV-1 antibody or antigen-binding molecule according to claim 4, characterized in that: The C-terminus of the scFv-2 is connected to the Fc domain of human IgG1 via a hinge peptide.

6. The bispecific anti-HIV-1 antibody or antigen-binding molecule according to claim 5, characterized in that: The Fc domain of human IgG1 includes a heavy chain constant region CH2 and a heavy chain constant region CH3 from the N-terminus to the C-terminus; The sequence of the heavy chain constant region CH2 is shown in SEQ ID NO.8; The sequence of the heavy chain constant region CH3 is shown in SEQ ID NO.9; The sequence of the hinge peptide is shown in SEQ ID NO.

10.

7. A bispecific anti-HIV-1 antibody homodimer, characterized in that: When the bispecific anti-HIV-1 antibody according to any one of claims 4 to 6 is expressed in a host cell, the heavy chain constant region undergoes homodimerization to form a homodimer of the bispecific anti-HIV-1 antibody.

8. A nucleic acid molecule, characterized in that: The nucleic acid molecule encodes the bispecific anti-HIV-1 antibody or antigen-binding molecule thereof according to any one of claims 1 to 6.

9. A vector comprising a nucleic acid molecule as claimed in claim 8.

10. A host cell comprising the vector according to claim 9.

11. A pharmaceutical composition, characterized in that: The pharmaceutical composition comprises the bispecific anti-HIV-1 antibody or antigen-binding molecule thereof according to any one of claims 1 to 6, or comprises the homodimer according to claim 7.

12. Use of the bispecific anti-HIV-1 antibody or antigen-binding molecule according to any one of claims 1 to 6, the homodimer according to claim 7, or the pharmaceutical composition according to claim 11 in the preparation of a drug for treating or preventing AIDS caused by HIV-1 virus.

13. A detection product, characterized in that: The detection product comprises the bispecific anti-HIV-1 antibody or antigen-binding molecule thereof as claimed in any one of claims 1 to 6, or comprises the homodimer as claimed in claim 7.

Images