Gene editing system for constructing gp130 gene mutation of gastric cancer model pig nuclear transfer donor cells and application thereof
By constructing GP130 gene mutations in pig cells using CRISPR/Cas9 technology and ssODN homologous recombination, the problem of mouse models being unable to simulate human gastric cancer was solved, and a pig model suitable for studying gastric cancer caused by GP130 mutations was established, realizing an efficient and low-cost gastric cancer research tool.
Patent Information
- Application Number
- CN202110654513.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-06-11
- Publication Date
- 2025-12-09
- Estimated Expiration
- 2041-06-11
AI Technical Summary
Existing mouse models cannot realistically simulate the physiological and pathological state of human gastric cancer, and primates are costly and difficult to breed, making it difficult to effectively study the pathogenesis of gastric cancer caused by GP130 mutations.
The GP130 gene was edited using CRISPR/Cas9 technology combined with ssODN homologous recombination technology. Cas9 protein was prepared by combining a specific fusion protein with the optimized prokaryotic Cas9 high-efficiency expression vector pKG-GE4 and gene editing was performed on porcine primary fibroblasts. A gastric cancer model pig was constructed by somatic cell nuclear transfer.
A single-cell clone with a precise point mutation in the GP130 gene was obtained, and a gastric cancer model pig more similar to humans was established. This shortened the cycle of model pig production, reduced costs, and provided an effective experimental tool for studying the pathogenesis of gastric cancer and drug development.
Smart Images

Figure CN115247163B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of gene editing, and particularly relates to application of a CRISPR / Cas9 system and ssODN homologous recombination technology in construction of a gastric cancer model pig nuclear transfer donor cell with a GP130 gene mutation. BACKGROUND
[0002] Gastric cancer is the most common malignant tumor of the digestive tract. According to the latest global cancer burden data released by the International Agency for Research on Cancer (IARC) of the World Health Organization in 2020, gastric cancer accounts for 6.7% of global new cancer cases in 2020, ranking fifth, and accounts for 10.5% in China, ranking third, which has caused serious health threats and economic burdens to the people of our country and has become one of the most urgent health problems today. With the continuous development of modern medicine, although there has been progress in cancer diagnosis, treatment and life span, the degree of improvement in mortality has been small. Lack of understanding of the natural history of the disease is the main reason for this limitation, and it is not yet clear at the molecular level which changes in gastric cancer may lead to the metaplasia, invasion and metastasis of tumors.
[0003] Interleukin 6 (IL-6) is an important member of the cytokine network, its family includes IL-6, IL-11, IL-27, IL-31, oncostatin M (OSM), leukemia inhibitory factor (LIF), ciliary neurotrophic factor (CNTF), cardiomyocyte trophic factor 1 (CT-1) and cardiomyocyte trophic factor-like cytokine 1 (CLCF1), these cytokines show pleiotropic biological activity in the immune, hematopoietic and nervous systems, and also have important effects on human metabolism, autoimmune cell differentiation, disease treatment, etc. GP130 is a common signal transduction component of the IL-6 family cytokine function receptor complex, which is almost expressed on various tissues and cells in the body, and one of its main functions is to bind the IL-6-IL-6R complex in the extracellular region to transmit signals to the cell, thereby participating in the above important physiological processes. Research results have shown that in mice, GP130 gene Y757F mutation (corresponding to pig GP130 Y779) can cause symptoms similar to human gastric cancer disease phenotypes, and the position is highly conserved among different species. This shows that GP130 mutation can lead to the occurrence of gastric cancer, but the pathogenic mechanism is not clear.
[0004] The research on the cell and molecular mechanisms of the development of gastric cancer or other diseases caused by GP130 mutation and the development of corresponding drugs need to be based on animal models. At present, the commonly used animal model is a mouse model. However, the mouse is quite different from human beings in terms of size, organ size, physiology, pathology and the like, and cannot truly simulate the normal physiological and pathological state of human beings. As a large animal, the pig has been a major meat supply animal for human beings for a long time. The size and physiological functions of the pig are similar to those of human beings, the pig is easy to breed in large quantities, and the requirements for ethics, morality and animal protection are relatively low, so the pig is an ideal animal model for human diseases.
[0005] Gene editing is a biological technology that has made great progress in recent years, which includes gene editing based on homologous recombination and editing technologies such as ZFN, TALEN and CRISPR / Cas9 based on nuclease. Among them, the CRISPR / Cas9 technology is the most advanced gene editing technology at present. At present, gene editing technology is increasingly applied to the production of animal models.
[0006] Homologous recombination (HDR) is to exchange DNA sequence information through sequence homology: that is, the repair template contains the desired insertion fragment, and the two ends of the repair template are recombination arms with sequence homology near the insertion site. In the past, double-stranded DNA (dsDNA) was usually used as a repair template, but recent studies have revealed the superiority of single-stranded oligonucleotide deoxynucleotide (ssODN) as a HDR donor template. First, the insertion site specificity of ssODN as a donor template is higher than that of dsDNA template, and dsDNA template is prone to random insertion. Second, the length requirement of ssODN for homologous recombination arms is shorter than that of dsDNA template, and a single-sided 30-60 base recombination arm design can obtain efficient and stable HDR, which provides higher insertion efficiency than similar dsDNA templates. Third, dsDNA is easy to be integrated by the NHEJ repair pathway, which leads to the replication of homologous arms or the partial integration of dsDNA templates, while ssODN is not prone to such phenomena. In addition, dsDNAs are harmful to cultured cells, and linear or plasmid dsDNAs have low transfection efficiency and cause adverse reactions in cells, while ssODN templates have more advantages in these aspects.
[0007] Therefore, the present application adopts CRISPR / Cas9 technology combined with ssODN homologous recombination technology to edit the point mutation of GP130 gene, simulates the natural genetic characteristics of gastric cancer, and obtains a single cell clone with precise point mutation of GP130 gene, which lays a foundation for cultivating a gastric cancer disease model pig through somatic cell nuclear transfer animal cloning technology in the later stage. The model pig will provide a powerful experimental tool for studying the pathogenesis of gastric cancer and drug development. SUMMARY
[0008] The present application aims to provide a specific fusion gene encoding a specific fusion protein containing Cas9 protein.
[0009] The present application further aims to provide a gene editing system for constructing a pig nuclear transfer donor cell of a gastric cancer model with GP130 gene mutation.
[0010] The present application further aims to provide an application of the gene editing system.
[0011] The specific fusion protein containing Cas9 protein comprises, from N-terminal to C-terminal, the following elements: a signal peptide for secretory expression of the target protein, a chaperone fusion protein for increasing soluble expression of the target protein, a tag protein for protein purification, an endoprotease recognition site for removing the fusion tag and obtaining the native form of Cas9 protein from the fusion protein, a nuclear localization signal 1 for guiding the Cas9 protein into the nucleus, a Cas9 protein (spCas9), and a nuclear localization signal 2 for guiding the Cas9 protein into the nucleus.
[0012] In the specific fusion protein, the signal peptide for secretory expression of the target protein is selected from the signal peptide of Escherichia coli alkaline phosphatase (phoA), the signal peptide of Staphylococcus aureus protein A, the signal peptide of Escherichia coli outer membrane protein (ompa), or the signal peptide of any other prokaryotic gene, preferably the signal peptide of alkaline phosphatase (phoA).
[0013] In the specific fusion protein, the chaperone fusion protein for increasing soluble expression of the target protein can be any protein that helps form disulfide bonds, preferably thioredoxin Trx, and further preferably TrxA.
[0014] In the specific fusion protein, the endoprotease recognition site for removing the fusion tag and obtaining the native form of Cas9 protein from the fusion protein is selected from the recognition site of enterokinase, Factor Xa, Thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endoprotease, and further preferably the recognition site of enterokinase.
[0015] In the specific fusion protein, the protein tag for facilitating purification of the target protein is selected from His tag, GST tag, Flag tag, HA tag, c-Myc tag, or any other protein tag, and further preferably His protein tag.
[0016] The nuclear localization signal in the specific fusion protein for guiding the Cas9 protein into the nucleus can be any eukaryotic nuclear localization signal, and is further preferably an SV40 nuclear localization signal and / or a nucleoplasmin nuclear localization signal.
[0017] The cas protein in the specific fusion protein is selected from Casl-lO, Cpfl or other types of Cas proteins, and is preferably Cas9, and is further preferably spCas9.
[0018] The specific fusion protein comprises the following elements from N-terminus to C-terminus: alkaline phosphatase (phoA) signal peptide (phoA:SP), thioredoxin A (TrxA), His-tag protein, enterokinase cleavage site (EK), nuclear localization signal (SV40NLS), Cas9 protein (spCas9), and nuclear localization signal (nucleoplasmin NLS).
[0019] A specific fusion gene encoding the specific fusion protein.
[0020] As a preferred embodiment of the present application, the specific fusion gene sequence is shown in SEQ ID NO. 1, 5209-9849 nucleotides, or shown in SEQ ID NO. 2.
[0021] A prokaryotic Cas9 high-efficiency expression vector pKG-GE4 containing the specific fusion gene of the present application.
[0022] As a preferred embodiment of the present application, the main elements of the prokaryotic Cas9 high-efficiency expression vector pKG-GE4 include: T7 promoter (T7 Promoter), Lac operator (Lac Operator), ribosome binding site (RBS), the specific fusion gene, and T7 terminator sequence element.
[0023] In the plasmid pKG-GE4, the expression of the specific fusion gene is initiated by the T7 promoter.
[0024] In the plasmid pKG-GE4, the induced expression of the specific fusion gene is controlled by the Lac operator.
[0025] In the plasmid pKG-GE4, the specific fusion gene has a T7 terminator sequence element downstream.
[0026] As a further preferred embodiment of the present application, the main elements of the prokaryotic Cas9 high-efficiency expression vector pKG-GE4 include:
[0027] T7 Promoter, Lac Operator, RBS, phoA:SP, TrxA, His-Tag, EK, SV40 NLS, spCas9, nucleoplasmin NLS, T7 terminator, vector backbone (including Amp resistance element, ori replication initiator, LacI constitutive expression element, etc.).
[0028] As a further preferred embodiment of the present application, the sequence of the prokaryotic Cas9 high-efficiency expression vector pKG-GE4 of the present application is shown in SEQ ID NO. 1.
[0029] In the prokaryotic Cas9 high-efficiency expression vector pKG-GE4 of the present application, the specific fusion gene is shown in SEQ ID NO. 1 at positions 5209-9849, wherein the coding sequence of the phoA signal peptide is shown in SEQ ID NO. 1 at positions 5209-5271, the coding sequence of the TrxA protein is shown in SEQ ID NO. 1 at positions 5272-5598, the coding sequence of the His-Tag is shown in SEQ ID NO. 1 at positions 5620-5637, the coding sequence of the EK is shown in SEQ ID NO. 1 at positions 5638-5652, the coding sequence of the SV40 NLS is shown in SEQ ID NO. 1 at positions 5656-5670, the coding sequence of the spCas9 protein is shown in SEQ ID NO. 1 at positions 5701-9801, and the coding sequence of the nucleoplasmin NLS is shown in SEQ ID NO. 1 at positions 9802-9849. The T7 promoter is shown in SEQ ID NO. 1 at positions 5121-5139. The Lac operator is shown in SEQ ID NO. 1 at positions 5140-5164. The RBS is shown in SEQ ID NO. 1 at positions 5178-5201. The T7 terminator is shown in SEQ ID NO. 1 at positions 9902-9949.
[0030] After the above-mentioned optimization design and modification, the activity of the Cas9 protein expressed by the pKG-GE4 vector is significantly higher than that of the commercial Cas9 protein.
[0031] A method for preparing a Cas9 protein, comprising the following steps:
[0032] (1) The correct pKG-GE4 plasmid is identified and transformed into E. coli expression strain BL21(DE3), the bacteria are cultured, IPTG is added, and the genetically engineered bacteria are induced to express soluble target proteins at a temperature of 25 DEG C, and the bacterial precipitate is collected;
[0033] (2) The fusion protein is extracted and then purified by Ni-NTA agarose column;
[0034] (3) The fusion protein is digested with recombinant bovine enterokinase with a his tag, and the NLS-spCas9-NLS target protein is obtained by purifying the digested recombinant bovine enterokinase and TrxA-His with Ni-NTA resin.
[0035] A gene editing system for constructing a GP130 gene mutant gastric cancer model pig nuclear transfer donor cell, comprising a Cas9 protein prepared according to the method of the present application, a gRNA for the GP130 gene, and a single-stranded Donor DNA containing a GP130 mutation site.
[0036] As a preferred embodiment of the present application, the target point of the gRNA for the GP130 gene is selected from GP130-E16-gRNA4 shown in SEQ ID NO. 15 and GP130-E16-gRNA7 shown in SEQ ID NO. 16.
[0037] As a further preferred embodiment of the present application, the gRNA for the GP130 gene is obtained by in vitro gRNA transcription from a GP130-T7-gRNA4 transcription template shown in SEQ ID NO. 25 and a GP130-T7-gRNA7 transcription template shown in SEQ ID NO. 26, respectively.
[0038] As a further preferred embodiment of the present application, the single-stranded Donor DNA sequence containing the GP130 mutation site is shown in SEQ ID NO. 27.
[0039] As a further preferred embodiment of the present application, the mass ratio of GP130-E16-gRNA4: GP130-E16-gRNA7: Cas9 protein: single-stranded Donor DNA is 1:1:4:2.
[0040] The gene editing system described in the present application is used in the construction of a GP130 gene mutant pig recombinant cell.
[0041] A recombinant cell obtained by co-transfecting a pig primary fibroblast cell with the gene editing system described in the present application and verified.
[0042] The gene editing system and the recombinant cell are used to construct a gastric cancer model pig with a mutated GP130 gene.
[0043] The application also protects a pig tissue, a pig organ and / or a pig cell of the model pig prepared by the recombinant cell.
[0044] The application also protects the use of the recombinant cell, the pig tissue, the pig organ, the pig cell or the gastric cancer model pig prepared by the recombinant cell in screening a gastric cancer treatment drug, evaluating the efficacy of a gastric cancer treatment drug, evaluating the curative effect of a gastric cancer gene therapy and / or a cell therapy or researching the pathogenesis of gastric cancer.
[0045] Compared with the prior art, the application has at least the following beneficial effects:
[0046] (1) The research object (pig) of the application has better applicability than other animals (mice, primates).
[0047] Mice and other rodents are very different from humans in terms of body size, organ size, physiology, pathology and the like, and cannot truly simulate the normal physiological and pathological states of humans. Studies have shown that more than 95% of drugs verified effective in mice are ineffective in human clinical trials. As for large animals, primates are the animals most closely related to humans, but they are small in size, mature late (6-7 years old for mating), and are single-birth animals, and the population expansion rate is extremely slow, and the feeding cost is very high. In addition, the cloning efficiency of primate animals is low, difficult and high in cost.
[0048] Pigs, as model animals, do not have the above-mentioned shortcomings. Pigs are the animals most closely related to humans except primates, and their body size, weight, organ size and the like are similar to those of humans, and are very similar to humans in terms of anatomy, physiology, immunology, nutritional metabolism, disease pathogenesis and the like. At the same time, pigs mature early (4-6 months), have high reproductive capacity, and can form a large population in 2-3 years. In addition, the cloning technology of pigs is very mature, and the cloning and feeding costs are much lower than those of primates. Therefore, pigs are very suitable as animal models for human diseases.
[0049] (2) The pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (pKG-GE4 for short) vector constructed by the application uses the strong promoter T7lac to express the target protein, which can efficiently express the target protein. The signal peptide of the bacterial periplasmic alkaline phosphatase (phoA) is used to guide the secretory expression of the target protein into the bacterial periplasmic cavity, so as to separate the bacterial intracellular protein, and the target protein secreted into the bacterial periplasmic cavity is soluble expression. Meanwhile, the TrxA and Cas9 proteins are fused and expressed, the TrxA can help the co-expressed target protein to form a disulfide bond, improve the stability, folding correctness of the protein, increase the solubility and activity of the target protein. In order to facilitate the purification of the target protein, the His tag is designed, which can purify the target protein by one-step Ni column affinity chromatography, greatly simplifying the purification process of the target protein. Meanwhile, an enterokinase cleavage site is designed after the His tag, which facilitates the removal of the fused TrxA-His polypeptide fragment, and the natural form of the Cas9 protein is obtained. After the fusion protein is cleaved by the enterokinase with the His tag, the TrxA-His polypeptide fragment and the enterokinase with the His tag can be removed by one-step affinity chromatography, and the natural form of the Cas9 protein is obtained, avoiding the damage and loss of the target protein caused by multiple purification and dialysis. Meanwhile, an NLS site is designed at the N and C terminals of the Cas9, respectively, so that the Cas9 can more effectively enter the nucleus for gene editing. In addition, the E. coli BL21 (DE3) strain is selected as the target protein expression strain, which can efficiently express the foreign genes cloned in the expression vector containing the bacteriophage T7 promoter (such as pET-32a). Meanwhile, the codon of the Cas9 protein is optimized to adapt to the codon bias of the expression strain, thereby improving the expression level of the target protein. In addition, the expression of the target protein is induced by IPTG at low temperature after the bacteria grow to a certain number, which can avoid the influence of the early expression of the target protein on the growth of the host bacteria, and the induction of expression at low temperature also significantly improves the solubility of the expressed target protein. After the above optimization design and experimental implementation, the activity of the obtained Cas9 protein is significantly higher than that of the commercial Cas9 protein.
[0050] (3) The Cas9 high-efficiency protein complex constructed and expressed by the application is combined with the gRNA for in vitro transcription to perform gene editing, and the optimal dosage ratio of Cas9 and gRNA is optimized. In combination with the synthesized ssODN as the Donor DNA, the ratio of single-cell clones of the target site point mutation is 22.5%, which is higher than the conventional point mutation efficiency (<5%).
[0051] (4) The somatic cell nuclear transfer animal cloning using the target gene point mutation single cell clone strain obtained by the application can directly obtain the cloned pig containing the target gene point mutation, and the mutation can be stably inherited.
[0052] The method of performing embryo transfer after microinjection of gene editing materials into fertilized eggs in the mouse model making has a very low probability (less than 1%) of directly obtaining a point mutation offspring, and needs to be hybridized and selected, which is not suitable for long gestation period large animal (such as pig) model making. Therefore, the application adopts the method of editing and screening positive editing single cell clone of primary cells in vitro which is difficult and challenging, and then directly obtains the corresponding disease model pig through somatic cell nuclear transfer animal cloning technology, which can greatly shorten the model pig making cycle and save manpower, material resources and financial resources.
[0053] The application lays a solid foundation for obtaining a GP130 point mutation model pig similar to the development process of human gastric cancer disease through gene editing means, which will help to research and reveal the pathogenesis of GP130 mutation leading to gastric cancer, and can be used for drug screening, drug efficacy detection, gene and cell therapy research, etc., and can provide effective experimental data for further clinical application, and further provide powerful experimental means for preventing and treating human gastric cancer. The application has great application value for the research and development of human gastric cancer treatment drugs and preclinical testing. BRIEF DESCRIPTION OF DRAWINGS
[0054] Figure 1 It is a structural schematic diagram of plasmid pET-32a.
[0055] Figure 2 It is a structural schematic diagram of plasmid pKG-GE4.
[0056] Figure 3 It is an electrophoresis diagram of step 3.3.3 in Example 3.
[0057] Figure 4 It is an electrophoresis diagram of step 3.4.3 in Example 3.
[0058] Figure 5 It is an electrophoresis diagram of step 4.2.3 in Example 4.
[0059] Figure 6 It is an electrophoresis diagram of step 4.2.4 in Example 4.
[0060] Figure 7 It is an electrophoresis diagram of step 4.6.4 in Example 4.
[0061] Figure 8 It is an electrophoresis diagram of step 5.1.3 in Example 5.
[0062] Figure 9Electropherogram for Example 5, Step 5.6.3.
[0063] Figure 10 Example sequencing peak pattern for Example 5, Step 5.6.4, determined to be wild type.
[0064] Figure 11 Example sequencing peak pattern for Example 5, Step 5.6.4, determined to be heterozygous mutant.
[0065] Figure 12 Example sequencing peak pattern for Example 5, Step 5.6.4, determined to be homozygous mutant with two different alleles.
[0066] Figure 13 Example sequencing peak pattern for Example 5, Step 5.6.4, determined to be homozygous mutant with two identical alleles.
[0067] Figure 14 Example sequencing peak pattern for Example 5, Step 5.6.4, determined to be heterozygous mutant with a point mutation at the target site.
[0068] Figure 15 Example sequencing peak pattern for Example 5, Step 5.6.4, determined to be homozygous mutant with a point mutation at the target site. DETAILED DESCRIPTION
[0069] Construction of prokaryotic Cas9 high-efficiency expression vector (pKG-GE4)
[0070] Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (pKG-GE4, plasmid map as shown in Figure 2 ) was constructed using plasmid pET-32a (structure diagram as shown in Figure 1) As a backbone, the main modifications are as follows: ① The coding region of TrxA protein is retained, which can help the expressed target protein form disulfide bond, increase the solubility and activity of the target protein, but the signal peptide (SP) sequence of alkaline phosphatase (phoA) is added before this sequence, which can guide the expressed target protein to be secreted into the periplasmic cavity of bacteria, and can be cleaved by prokaryotic periplasmic signal peptide enzyme; ② The His-Tag tag group is added after the TrxA protein coding sequence, which can be used for enrichment of the expressed target protein; ③ The enterokinase (EK) cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) is added downstream of the His-Tag tag, and the purified protein will remove the His-Tag tag and the upstream fused TrxA protein under the action of enterokinase. ④ The coding sequence of the Cas9 protein suitable for expression in E. coli BL21 (DE3) strain after codon optimization is inserted, and the nuclear localization signal coding sequence (NLS) is added upstream and downstream of the gene, which increases the nuclear localization ability of the purified Cas9 protein in the later stage.
[0071] The construction method of pKG-GE4 vector is as follows:
[0072] (1) Preparation of backbone vector
[0073] The plasmid pET-32a is digested with XbaI and XhoI, and the vector fragment (about 5329 bp) is recovered.
[0074] (2) Whole gene synthesis insertion sequence
[0075] The whole gene synthesis sequence shown in SEQ ID NO. 2 comprises the aforementioned alkaline phosphatase (phoA) signal peptide (phoA: SP) sequence, TrxA protein coding sequence, His-Tag tag group sequence, EK cleavage site sequence, nuclear localization signal (SV40 NLS) sequence, Cas9 protein (spCas9) coding sequence, and nucleoplasmin NLS sequence in turn, and comprises 25 base pairs homologous to the backbone vector sequence at the N- and C-termini of the whole gene synthesis.
[0076] (3) Ligation of whole gene synthesis fragment and backbone vector
[0077] The backbone vector recovered from step (1) and the sequence synthesized in step (2) were recombined to obtain plasmid pKG-GE4, and the nucleotide sequence is shown in SEQ ID NO. 1. In SEQ ID NO. 1, nucleotides 5121-5139 constitute a T7 promoter, nucleotides 5140-5164 encode a lac operator, nucleotides 5178-5201 encode a ribosome binding site (RBS), nucleotides 5209-5271 encode a phoA (alkaline phosphatase) signal peptide (SP), nucleotides 5272-5598 encode a TrxA protein, nucleotides 5620-5637 encode a His-Tag tag, nucleotides 5638-5652 encode an enterokinase cleavage site, nucleotides 5656-5670 encode an SV40 nuclear localization signal (NLS), nucleotides 5701-9801 encode a spCas9 protein (whose codons have been optimized for expression in E. coli BL21 (DE3) strain), nucleotides 9802-9849 encode a nucleoplasmin nuclear localization signal (NLS), and nucleotides 9902-9949 encode a T7 terminator.
[0078] Example 2 Induced expression, purification, cleavage of pKG-GE4 fusion protein TrxA-His-EK-NLS-spCas9-NLS, and purification of pKG-GE4-Cas9 protein
[0079] 2.1 Induced expression of pKG-GE4 fusion protein TrxA-His-EK-NLS-spCas9-NLS
[0080] The correct pKG-GE4 plasmid was identified and transformed into E. coli expression strain BL21 (DE3) (Wuhan Lingmo Bio Co., Ltd.), and then plated on ampicillin (Amp R ) plates and cultured overnight. A single colony was selected and inoculated into 100 μg / ml ampicillin-containing LB liquid medium, and cultured at 37°C and 200 rpm overnight. The overnight culture was then inoculated into 500 ml LB medium at a ratio of 1:200, and cultured at 30°C and 230 rpm until the OD600 reached about 1.0. The BL21 (DE3) strain was induced to express the target protein by adding isopropyl thiogalactoside (IPTG) at a final concentration of 0.5 mM, and then incubated at 25°C for 12 hours for low-temperature induction of soluble expression of the target protein. The bacterial cells were collected by centrifugation at 4°C and 10,000 g for 15 minutes, and the bacterial cells were washed with PBS and centrifuged to collect the bacterial cell pellet.
[0081] 2.2 Purification of pKG-GE4 fusion protein TrxA-His-EK-NLS-spCas9-NLS
[0082] 2.2.1 Crude extraction of fusion protein
[0083] The crude extraction buffer is 20mM Tris-HCl pH 8.0, 0.5M NaCl, 5mM Imidazole, 1mM PMSF. The crude extraction method is: add 10ml of the above buffer to each gram of wet bacteria, suspend the bacteria, crush with a homogenizer, 1000 par cycle for three times. Then centrifuge the bacterial suspension at 15000g for 30min at 4°C, collect the supernatant, filter through a 0.22μm filter membrane for the next step of affinity chromatography protein purification.
[0084] 2.2.2 Purification of fusion protein
[0085] The Ni-NTA agarose column (Genscript, L00250 / L00250-C, 10ml of packing) is used for purification of the fusion protein. First, equilibrate the Ni column with 5 column volumes of equilibration buffer (20mM Tris-HCl pH 8.0, 0.5M NaCl, 5mM Imidazole) at a flow rate of 1ml / min, then load the filtered bacterial supernatant onto the equilibrated Ni column, wash the Ni column with 5 column volumes of equilibration buffer (flow rate of 1ml / min), then wash away the impurities with 5 column volumes of buffer (20mM Tris-HCl pH 8.0, 0.5M NaCl, 50mM Imidazole) (flow rate of 1ml / min), finally elute the target protein with 10 column volumes of elution buffer (20mM Tris-HCl pH 8.0, 0.5M NaCl, 500mM Imidazole) (flow rate of 0.5-1ml / min).
[0086] 2.3 Enzymatic digestion of pKG-GE4 fusion protein (TrxA-His-EK-NLS-spCas9-NLS) and purification of pKG-GE4-Cas9 protein
[0087] (1) Take 15 ml of the solution collected after the column in step 2.2.2 (a total of about 90-100 ml), use Amicon ultrafiltration tube (Sigma, UFC9100) to concentrate it to 200 μl, then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0, which is the optimal buffer system for the recombinant bovine enterokinase enzyme cutting reaction of the next step) to reduce the concentrations of NaCl and Imidazole to 100 mM, which is conducive to the subsequent recombinant bovine enterokinase enzyme cutting reaction. All the post-column solutions, a total of 6 ultrafiltration tubes were used for protein concentration, a total of 1.2 ml of protein concentrate was obtained, and finally diluted to 6 ml.
[0088] (2) Add commercially available His-tagged recombinant bovine enterokinase (Shenguo Biotech, C620031, recombinant bovine enterokinase light chain with His tag) to the solution obtained in step (1), and incubate at 25°C for 16 hours. 2 units of enterokinase are added for every 50 μg of protein.
[0089] (3) Mix the solution (a total of 6 ml) obtained after step (2) with 80 μl of Ni-NTA resin (Genscript, L00250 / L00250-C) per milliliter of solution, rotate for 15 min at room temperature, then centrifuge at 7000g for 3 min, separate the supernatant from the resin, and collect the supernatant, which is the NLS-spCas9-NLS target protein after removing TrxA-His after enzyme cutting. The TrxA-His polypeptide fragment and His-tagged enterokinase EK are both bound to the Ni-NTA resin, thereby separating and purifying the Cas9 protein in the supernatant.
[0090] (4) Concentrate the supernatant obtained in step (3) to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100), then add the enzyme storage solution (containing 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% glycerol, pH 7.4) prepared in advance, adjust the final protein concentration to 5 mg / ml, which is the NLS-spCas9-NLS protein solution (named pKG-GE4-Cas9 protein), and store it at -80°C for future use.
[0091] Example 3 Optimal dosage ratio optimization of pKG-GE4-Cas9 and gRNA and comparison of cutting efficiency with commercial Cas9 protein
[0092] 3.1 TTN gene target gRNA design and transcription
[0093] 3.1.1 Use Benchling to design gRNA target for TTN gene, and determine the following two gRNA target sequences after pre-screening:
[0094] TTN-gRNA1 : AGAGCACAGTCAGCCTGGCG (SEQ ID NO. 3)
[0095] TTN-gRNA2: CTTCCAGAATTGGATCTCCG (SEQ ID NO. 4)
[0096] 3.1.2 Design and synthesis of different segments of gRNA molecules (synthesized by GenScript)
[0097] T7-gRNA1 : GGCTTGTCGGACTCTTCGCTATTACGCCAGCTGGCGAAGGGGGAT
[0098] T7-gRNA2: TGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTCGCCAGC
[0099] T7-gRNA3: ACGCCAGGGTTTTCCCAGTCACGACGTTAGGAAATTAATACGACTCACTATAGG
[0100] TTN-g1 T7-gRNA4: TTCTAGCTCTAAAACCGCCAGGCTGACTGTGCTCTCCTATAGTGAGTCGTATTAATTTC
[0101] TTN-g1 T7-gRNA5: CCTGGCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT
[0102] TTN-g2 T7-gRNA4: TTCTAGCTCTAAAACCGGAGATCCAATTCTGGAAGCCTATAGTGAGTCGTATTAATTTC
[0103] TTN-g2 T7-gRNA5: ATCTCCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT
[0104] T7-gRNA6: AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTAT
[0105] 3.1.3 Design of primers for identification of fragments containing TTN gRNA target sites
[0106] TTN-F55: TACGGAATTGGGGAGCCAGCGGA (SEQ ID NO. 5)
[0107] TTN-R560: CAAAGTTAACTCTCTGTGTCT (SEQ ID NO. 6)
[0108] 3.1.4 Amplification of transcription template
[0109] The sequence of TTN-T7-gRNA1 transcription template is shown in SEQ ID NO. 7, which is prepared by using 6 synthetic primers of T7-gRNA1, T7-gRNA2, T7-gRNA3, TTN-g1T7-gRNA4, TTN-g1T7-gRNA5, T7-gRNA6 by overlap extension PCR amplification technology. The sequence contains a T7 promoter, which can initiate transcription of the relevant sequence. After amplification, the target band is cut and gel recovery is performed according to the instructions of Fast Pure Gel DNA Extraction Mini Kit (Vazyme, DC301). The recovered product is used as a transcription template.
[0110] The sequence of TTN-T7-gRNA2 transcription template is shown in SEQ ID NO. 8, which is prepared by using 6 synthetic primers of T7-gRNA1, T7-gRNA2, T7-gRNA3, TTN-g2T7-gRNA4, TTN-g2T7-gRNA5, T7-gRNA6 by overlap extension PCR amplification technology. The sequence contains a T7 promoter, which can initiate transcription of the relevant sequence. After amplification, the target band is cut and gel recovery is performed according to the instructions of Fast Pure Gel DNA Extraction Mini Kit (Vazyme, DC301). The recovered product is used as a transcription template.
[0111] 3.1.5 Transcription of gRNA
[0112] The transcription template prepared in step 3.1.4 is used for in vitro transcription of gRNA with Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and then the transcribed gRNA is recovered and purified with MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) according to the instructions. The obtained product is the gRNA that can be used for cell electroporation.
[0113] 3.2 Preparation of porcine primary fibroblasts
[0114] 3.2.1 Take 0.5g of freshly born ear tissue from Jiangxiang pig, remove hair and bone tissue, soak in 75% alcohol for 30-40s;
[0115] 3.2.2 Wash 5 times with PBS containing 5% P / S (Gibco Penicillin-Streptomycin) and once with PBS without P / S;
[0116] The formula of 5% P / S PBS is: 5% P / S (Gibco Penicillin-Streptomycin) + 95% PBS, 5%, 95% are volume percentage.
[0117] 3.2.3 Cut the tissue with scissors, add 5mL of 0.1% collagenase (Sigma) solution, shake at 37°C for 1h;
[0118] 3.2.4 Centrifuge at 500g for 5min, remove the supernatant, resuspend the precipitate with 1mL of complete medium, and plate into a 10cm cell culture dish containing 10mL of complete medium and sealed with 0.2% gelatin (VWR).
[0119] The formula of cell complete medium is: 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% P / S (Gibco Penicillin-Streptomycin) + 1% HEPES (Solarbio), 15%, 83%, 1%, 1% are volume percentage.
[0120] 3.2.5 Incubate in a constant temperature incubator at 37°C, 5% CO2 (volume percentage), 5% O2 (volume percentage);
[0121] 3.2.6 When the cells are cultured to about 60% of the bottom of the dish, use 0.25% (Gibco) trypsin to digest the cells, then add complete medium to stop digestion, transfer the cell suspension into a 15mL centrifuge tube, centrifuge at 400g for 4min, discard the supernatant, and obtain the cell precipitate for the next cell transfection experiment.
[0122] 3.3 Optimization of the ratio of gRNA to pKG-GE4-Cas9
[0123] 3.3.1 Co-transfection grouping
[0124] Group 1: Transcribed TTN-T7-gRNA1, TTN-T7-gRNA2 and pKG-GE4-Cas9 protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 0.5 μg TTN-T7-gRNA1: 0.5 μg TTN-T7-gRNA2: 4 μg pKG-GE4-Cas9.
[0125] Group 2: Transcribed TTN-T7-gRNA1, TTN-T7-gRNA2 and pKG-GE4-Cas9 protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 0.75 μg TTN-T7-gRNA1: 0.75 μg TTN-T7-gRNA2: 4 μg pKG-GE4-Cas9.
[0126] Group 3: Transcribed TTN-T7-gRNA1, TTN-T7-gRNA2 and pKG-GE4-Cas9 protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-T7-gRNA1: 1 μg TTN-T7-gRNA2: 4 μg pKG-GE4-Cas9.
[0127] Group 4: Transcribed TTN-T7-gRNA1, TTN-T7-gRNA2 and pKG-GE4-Cas9 protein were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1.25 μg TTN-T7-gRNA1: 1.25 μg TTN-T7-gRNA2: 4 μg pKG-GE4-Cas9.
[0128] Group 5: Transcribed TTN-T7-gRNA1, TTN-T7-gRNA2 were co-transfected into porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg TTN-T7-gRNA1: 1 μg TTN-T7-gRNA2.
[0129] 3.3.2 Co-transfection operation method
[0130] The transfection experiment was performed using the mammalian cell transfection kit (Neon kit) and Neon TM transfection system electroporator.
[0131] 1) The DNA was prepared according to the above grouping, and care was taken to avoid air bubbles during mixing;
[0132] 2) The cell pellet prepared in 3.2.6 was washed with 1 ml PBS buffer (Solarbio) and transferred to a 1.5 ml centrifuge tube, centrifuged at 600g for 6 min, the supernatant was discarded, and the cells were resuspended with 11 μL of Opti-MEM resuspension solution, avoiding the generation of bubbles during resuspension;
[0133] 3) 10 μL of the cell suspension was aspirated and added to the transfection DNA solution in step 1) and mixed well, taking care not to generate bubbles during mixing;
[0134] 4) The transfection cup provided with the kit was placed in the cup slot of the Neon™ transfection system, and 3 mL of Buffer E was added;
[0135] 5) 10 μL of the mixture obtained in step 3) was aspirated with the transfection gun and inserted into the shock cup, and the transfection program (1450V 10ms 3 pulse) was selected. After transfection by electroporation, the mixture in the transfection gun was immediately transferred to a 6-well plate, each well containing 3 mL of complete culture medium (15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% P / S (Gibco Penicillin-Streptomycin) + 1% HEPES (Solarbio));
[0136] 6) After mixing, it was placed in a constant temperature incubator at 37°C, 5% CO2, 5% O2 for culture;
[0137] 7) The medium was changed 12-18h after transfection, and the cells were digested with 0.25% (Gibco) trypsin and collected in a 1.5 mL centrifuge tube 36-48h after transfection.
[0138] 3.3.3 Analysis of gene editing efficiency
[0139] The genomic DNA of the cells collected in 3.3.2 was extracted, and a primer pair composed of TTN-F55 and TTN-R560 was used for PCR amplification, followed by 1% agarose gel electrophoresis (see Figure 3 ). The 505bp band is the wild type band (WT), and the 254bp band (band 505bp theoretical deletion 251bp) is the deletion mutant band (MT).
[0140] The gene deletion mutation efficiency = (MT gray level / MT band bp number) / (WT gray level / WT band bp number + MT gray level / MT band bp number) x 100%. According to the calculation, the first group of gene deletion mutation efficiency is 19.9%, the second group of gene deletion mutation efficiency is 39.9%, the third group of gene deletion mutation efficiency is 79.9%, and the fourth group of gene deletion mutation efficiency is 44.3%.
[0141] The results show that when the mass ratio of two gRNAs to pKG-GE4-Cas9 protein is 1:1:4, the actual amount used is 1 μg:1 μg:4 μg, the gene editing efficiency is the highest, and the optimal amount of two gRNAs to pKG-GE4-Cas9 protein is determined to be 1 μg:1 μg:4 μg.
[0142] 3.4 Comparison of gene editing efficiency of pKG-GE4-Cas9 protein and commercial Cas9 protein
[0143] 3.4.1 Grouping of co-transfection
[0144] Cas9-A group: co-transfect the transcribed TTN-T7-gRNA1, TTN-T7-gRNA2 and commercial Cas9-A protein into pig primary fibroblasts. Ratio: about 100,000 pig primary fibroblasts: 1 μg TTN-T7-gRNA1: 1 μg TTN-T7-gRNA2: 4 μg Cas9-A.
[0145] pKG-GE4 group: co-transfect the transcribed TTN-T7-gRNA1, TTN-T7-gRNA2 and pKG-GE4-Cas9 protein into pig primary fibroblasts. Ratio: about 100,000 pig primary fibroblasts: 1 μg TTN-T7-gRNA1: 1 μg TTN-T7-gRNA2: 4 μg pKG-GE4-Cas9.
[0146] Cas9-B group: co-transfect the transcribed TTN-T7-gRNA1, TTN-T7-gRNA2 and commercial Cas9-B protein into pig primary fibroblasts. Ratio: about 100,000 pig primary fibroblasts: 1 μg TTN-T7-gRNA1: 1 μg TTN-T7-gRNA2: 4 μg Cas9-B.
[0147] Control group: co-transfect the transcribed TTN-T7-gRNA1, TTN-T7-gRNA2 into pig primary fibroblasts. Ratio: about 100,000 pig primary fibroblasts: 1 μg TTN-T7-gRNA1: 1 μg TTN-T7-gRNA2.
[0148] 3.4.2 Co-transfection operation method
[0149] The same as step 3.3.2 in this embodiment.
[0150] 3.4.3 Analysis of gene editing efficiency
[0151] The genomic DNA of the cells collected in 3.4.2 was extracted, and PCR amplification was performed using a primer pair composed of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis (see Figure 4 ). The 505 bp band is the wild type band (WT), and the band of about 254 bp (band 505 bp, theoretically missing 251 bp) is the deletion mutant band (MT).
[0152] The gene deletion mutation efficiency = (MT gray level / MT band bp number) / (WT gray level / WT band bp number + MT gray level / MT band bp number) x 100%. According to the calculation, the gene deletion mutation efficiency of the commercial Cas9-A protein is 28.5%, the gene deletion mutation efficiency of the pKG-GE4-Cas9 protein is 85.6%, and the gene deletion mutation efficiency of the commercial Cas9-B protein is 16.6%.
[0153] The results show that compared with the commercial Cas9 protein, the use of the pKG-GE4-Cas9 protein prepared by the application can significantly improve the gene editing efficiency.
[0154] Example 4 Screening of GP130 gene high-efficiency gRNA target points
[0155] 4.1 Extraction of genomic DNA
[0156] The genomic DNA of the ear tissues of 18 pigs (male A, B, C, D, E, F, G, H, and female 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) was column extracted using the FastPure Cell / Tissue DNA Isolation Mini Kit (Vazyme Cat. DC102-01) of Vazyme Company, and quantified using NanoDrop, and stored at -20℃ for standby.
[0157] 4.2 Analysis of GP130 gene pre-set point mutation sites and adjacent genomic sequence conservation
[0158] 4.2.1 Pig GP130 gene information
[0159] The interleukin 6 cytokine family signal transducer gene (IL6ST, also known as GP130) is located on chromosome 16, and the GeneID is 100037294, Sus scrofa. The amino acid sequence of the pig GP130 gene encoding protein is shown in SEQ ID NO. 9. In the pig genomic DNA, the Y777F position to be mutated is encoded by the 16th exon (the 16th exon sequence of the pig GP130 gene encoding protein is shown in SEQ ID NO. 10).
[0160] 4.2.2 PCR amplification primer design of exon and adjacent genomic sequence of GP130 gene predisposed point mutation site
[0161] According to the pig GP130 genomic sequence
[0162] ( https: / / www.ncbi.nlm.nih.gov / nuccore / NC_010458.4?report=genbank&from=35101304&to=35151832&strand=true Figure 5 ), the primers were designed to amplify the exon 16 site of GP130 gene of the aforementioned 18 pig genomic samples.
[0163] Primer design was performed using Oligo7, and the design results were as follows:
[0164] GP130-E16-F128: TTTCACTGATGTAAGTGTTGTGG (SEQ ID NO. 11)
[0165] GP130-E16-R545: TGGACTGGTTTCGTGTTGACT (SEQ ID NO. 12)
[0166] GP130-E16-F131: CACTGATGTAAGTGTTGTGGAAA (SEQ ID NO. 13)
[0167] GP130-E16-R432: AATCTAACAAGGGCTGGGTGG (SEQ ID NO. 14)
[0168] 4.2.3 GP130 genomic PCR amplification primer screening
[0169] Using the pig (female 1#) ear tissue extracted genome as the template, using the designed two upstream primers and two downstream primers combination, Max enzyme (Vazyme company, product number: P505) for PCR, the product was subjected to 1% agarose gel electrophoresis to screen the good amplification primer, the results were as Figure 6 , group 1: GP130-E16-F128 / GP130-E16-R432; group 2: GP130-E16-F128 / GP130-E16-R545; group 3: GP130-E16-F131 / GP130-E16-R432; group 4: GP130-E16-F131 / GP130-E16-R545; the GP130-E16-F131 / GP130-E16-R545 primer pair was preferred for amplifying the target fragment.
[0170] 4.2.4 18 pig GP130 gene fragment PCR amplification
[0171] Genomic DNA of 18 pigs as templates (male A, B, C, D, E, F, G, H, female 1, 2, 3, 4, 5, 6, 7, 8, 9, 10) were amplified by GP130-E16-F131 / GP130-E16-R545 and Max enzyme, and the products were subjected to 1% agarose gel electrophoresis, and the results were as follows https: / / benchling.com / .
[0172] 4.2.5 GP130 gene sequence conservation analysis
[0173] The PCR amplification products were sequenced using amplification primers (sequenced by Bio Basic Inc.), and the sequencing results were compared and analyzed with the GP130 gene sequence in the public database, and the conserved region common to 18 pigs was selected for gRNA target design.
[0174] 4.3 gRNA target design and expression vector construction
[0175] 4.3.1 Design of target gRNA using Benchling
[0176] The designed target has avoided possible mutation sites, and Benchling (https: / / benchling.com / ) is used to design target gRNA. Figure 7 ) for target gRNA design.
[0177] The GP130 gene knockout gRNA target design is as follows:
[0178] GP130-E16-gRNA1: TGTGTACCACAGTGGAATAC
[0179] GP130-E16-gRNA2: CACTGTCCAGTATTCCACTG
[0180] GP130-E16-gRNA3: GTAGCCACTGTGTACCACAG
[0181] GP130-E16-gRNA4: TATTCCACTGTGGTACACAG (SEQ ID NO. 15)
[0182] GP130-E16-gRNA5: GACACAGTAGTGGTATTGGA
[0183] GP130-E16-gRNA6: GGACACAGTAGTGGTATTGG
[0184] GP130-E16-gRNA7: TCATCACTGCTAGAAATGCT (SEQ ID NO. 16)
[0185] GP130-E16-gRNA8: CTTCGTGCATGTCATCTTCT
[0186] Synthetic GP130 gene 6 target site insertion sequence complementary DNA oligos are as follows:
[0187] GP130-E16-gRNA1-S: caccgTGTGTACCACAGTGGAATAC
[0188] GP130-E16-gRNA1-A: aaacGTATTCCACTGTGGTACACAc
[0189] GP130-E16-gRNA2-S: caccgCACTGTCCAGTATTCCACTG
[0190] GP130-E16-gRNA2-A: aaacCAGTGGAATACTGGACAGTGc
[0191] GP130-E16-gRNA3-S: caccGTAGCCACTGTGTACCACAG
[0192] GP130-E16-gRNA3-A: aaacCTGTGGTACACAGTGGCTAC
[0193] GP130-E16-gRNA4-S: caccgTATTCCACTGTGGTACACAG (SEQ ID NO. 17)
[0194] GP130-E16-gRNA4-A: aaacCTGTGTACCACAGTGGAATAc (SEQ ID NO. 18)
[0195] GP130-E16-gRNA5-S: caccGACACAGTAGTGGTATTGGA
[0196] GP130-E16-gRNA5-A: aaacTCCAATACCACTACTGTGTC
[0197] GP130-E16-gRNA6-S: caccGGACACAGTAGTGGTATTGG
[0198] GP130-E16-gRNA6-A: aaacCCAATACCACTACTGTGTCC
[0199] GP130-E16-gRNA7-S: caccgTCATCACTGCTAGAAATGCT (SEQ ID NO. 19)
[0200] GP130-E16-gRNA7-A: aaacAGCATTTCTAGCAGTGATGAc (SEQ ID NO. 20)
[0201] GP130-E16-gRNA8-S: caccgCTTCGTGCATGTCATCTTCT
[0202] GP130-E16-gRNA8-A: aaacAGAAGATGACATGCACGAAGc
[0203] GP130-E16-gRNA1-S, GP130-E16-gRNA1-A, GP130-E16-gRNA2-S, GP130-E16-gRNA2-A, GP130-E16-gRNA3-S, GP130-E16-gRNA3-A, GP130-E16-gRNA4-S, GP130-E16-gRNA4-A, GP130-E16-gRNA5-S, GP130-E16-gRNA5-A, GP130-E16-gRNA6-S, GP130-E16-gRNA6-A, GP130-E16-gRNA7-S, GP130-E16-gRNA7-A, GP130-E16-gRNA8-S, GP130-E16-gRNA8-A are all single-stranded DNA molecules.
[0204] 4.3.2 gRNA vector construction
[0205] 1) Mix and anneal the synthesized GP130-E16-gRNA1-S and GP130-E16-gRNA1-A to obtain a double-stranded DNA molecule with sticky ends. Link the double-stranded DNA molecule with sticky ends and the vector skeleton pKG-U6gRNA (for details of construction method, see CN112442515A, specific embodiment 1.2 Construction of MSTN and FNDC5 gene gRNA target vector to detect the efficiency of the modified cas9 vector) to obtain plasmid pKG-U6gRNA(GP130-E16-gRNA1). This plasmid will transcribe gRNA corresponding to the sequence of GP130-E16-gRNA1 in the transfected cells.
[0206] 2) Mix and anneal the synthesized GP130-E16-gRNA2-S and GP130-E16-gRNA2-A to obtain a double-stranded DNA molecule with sticky ends. Link the double-stranded DNA molecule with sticky ends and the vector backbone pKG-U6gRNA to obtain the plasmid pKG-U6gRNA(GP130-E16-gRNA2). This plasmid will transcribe a gRNA corresponding to the GP130-E16-gRNA2 sequence in the transfected cell.
[0207] 3) Mix and anneal the synthesized GP130-E16-gRNA3-S and GP130-E16-gRNA3-A to obtain a double-stranded DNA molecule with sticky ends. Link the double-stranded DNA molecule with sticky ends and the vector backbone pKG-U6gRNA to obtain the plasmid pKG-U6gRNA(GP130-E16-gRNA3). This plasmid will transcribe a gRNA corresponding to the GP130-E16-gRNA3 sequence in the transfected cell.
[0208] 4) Mix and anneal the synthesized GP130-E16-gRNA4-S and GP130-E16-gRNA4-A to obtain a double-stranded DNA molecule with sticky ends. Link the double-stranded DNA molecule with sticky ends and the vector backbone pKG-U6gRNA to obtain the plasmid pKG-U6gRNA(GP130-E16-gRNA4). This plasmid will transcribe a gRNA corresponding to the GP130-E16-gRNA4 sequence in the transfected cell.
[0209] 5) Mix and anneal the synthesized GP130-E16-gRNA5-S and GP130-E16-gRNA5-A to obtain a double-stranded DNA molecule with sticky ends. Link the double-stranded DNA molecule with sticky ends and the vector backbone pKG-U6gRNA to obtain the plasmid pKG-U6gRNA(GP130-E16-gRNA5). This plasmid will transcribe a gRNA corresponding to the GP130-E16-gRNA5 sequence in the transfected cell.
[0210] 6) Mix and anneal the synthesized GP130-E16-gRNA6-S and GP130-E16-gRNA6-A to obtain a double-stranded DNA molecule with sticky ends. Link the double-stranded DNA molecule with sticky ends and the vector backbone pKG-U6gRNA to obtain the plasmid pKG-U6gRNA(GP130-E16-gRNA6). This plasmid will transcribe a gRNA corresponding to the GP130-E16-gRNA6 sequence in the transfected cell.
[0211] 7) Mix and anneal the synthesized GP130-E16-gRNA7-S and GP130-E16-gRNA7-A to get double-stranded DNA molecules with sticky ends. Link the double-stranded DNA molecules with sticky ends and the vector backbone pKG-U6gRNA to get plasmid pKG-U6gRNA(GP130-E16-gRNA7). This plasmid will transcribe gRNA corresponding to the sequence of GP130-E16-gRNA7 in the transfected cells.
[0212] 8) Mix and anneal the synthesized GP130-E16-gRNA8-S and GP130-E16-gRNA8-A to get double-stranded DNA molecules with sticky ends. Link the double-stranded DNA molecules with sticky ends and the vector backbone pKG-U6gRNA to get plasmid pKG-U6gRNA(GP130-E16-gRNA8). This plasmid will transcribe gRNA corresponding to the sequence of GP130-E16-gRNA8 in the transfected cells.
[0213] 4.3.3 gRNA vector identification
[0214] Pick single colonies from LB plates and put them into LB culture with corresponding antibiotics. After 12-16h incubation at 37℃ in a constant temperature shaker, extract plasmids and send them to General Biotech for sequencing. After sequence alignment, confirm that pKG-U6gRNA(GP130-E16-gRNA1), pKG-U6gRNA(GP130-E16-gRNA2), pKG-U6gRNA(GP130-E16-gRNA3), pKG-U6gRNA(GP130-E16-gRNA4), pKG-U6gRNA(GP130-E16-gRNA5), pKG-U6gRNA(GP130-E16-gRNA6), pKG-U6gRNA(GP130-E16-gRNA7) and pKG-U6gRNA(GP130-E16-gRNA8) vectors are successfully constructed.
[0215] 4.4 Preparation of porcine primary fibroblasts
[0216] The same as 3.2 in Example 3.
[0217] 4.5 Co-transfect porcine primary fibroblasts with the constructed gRNA plasmids and Cas9 plasmid (pKG-GE3).
[0218] 4.5.1 Co-transfection grouping
[0219] The first group: the plasmid pKG-U6gRNA(GP130-E16-gRNA1) and the plasmid pKG-GE3 (the construction method is shown in the specific embodiment 1.1 Cas9 high-efficiency expression vector construction of CN112442515A) are co-transfected into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(GP130-E16-gRNA1): 1.08 μg of plasmid pKG-GE3.
[0220] The second group: the plasmid pKG-U6gRNA(GP130-E16-gRNA2) and the plasmid pKG-GE3 are co-transfected into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(GP130-E16-gRNA2): 1.08 μg of plasmid pKG-GE3.
[0221] The third group: the plasmid pKG-U6gRNA(GP130-E16-gRNA3) and the plasmid pKG-GE3 are co-transfected into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(GP130-E16-gRNA3): 1.08 μg of plasmid pKG-GE3.
[0222] The fourth group: the plasmid pKG-U6gRNA(GP130-E16-gRNA4) and the plasmid pKG-GE3 are co-transfected into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(GP130-E16-gRNA4): 1.08 μg of plasmid pKG-GE3.
[0223] The fifth group: the plasmid pKG-U6gRNA(GP130-E16-gRNA5) and the plasmid pKG-GE3 are co-transfected into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(GP130-E16-gRNA5): 1.08 μg of plasmid pKG-GE3.
[0224] The sixth group: the plasmid pKG-U6gRNA(GP130-E16-gRNA6) and the plasmid pKG-GE3 are co-transfected into porcine primary fibroblasts. The ratio is about 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA(GP130-E16-gRNA6): 1.08 μg of plasmid pKG-GE3.
[0225] Group 7: Plasmid pKG-U6gRNA(GP130-E16-gRNA7) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. The ratio was about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(GP130-E16-gRNA7): 1.08 μg plasmid pKG-GE3.
[0226] Group 8: Plasmid pKG-U6gRNA(GP130-E16-gRNA8) and plasmid pKG-GE3 were co-transfected into porcine primary fibroblasts. The ratio was about 200,000 porcine primary fibroblasts: 0.92 μg plasmid pKG-U6gRNA(GP130-E16-gRNA8): 1.08 μg plasmid pKG-GE3.
[0227] Group 9: Porcine primary fibroblasts were subjected to electroporation without plasmid under the same electroporation parameters.
[0228] 4.5.2 Co-transfection operation method
[0229] The same as 3.3.2 in Example 3.
[0230] 4.6 Editing efficiency analysis of different target sites of GP130 gene
[0231] 4.6.1 10 μL KAPA2G lysis solution was added to each of the five groups of cells collected in the 1.5 mL centrifuge tube in step 4.5.2 to lyse the cells and obtain cell lysate releasing genomic DNA
[0232] The KAPA2G lysis solution system is as follows:
[0233] 10x extract Buffer 1 μL
[0234] Enzyme 0.2 μL
[0235] ddH2O 8.8 μL
[0236] 75°C for 15 min—95°C for 5 min—4°C, after the reaction, the cell lysate was stored at -20°C;
[0237] 4.6.2 The primers for GP130 gene E4 described above, GP130-E16-F131 / GP130-E16-R545, were used to amplify the target region of GP130 gene by PCR, and the cell lysate described above was used as the DNA template to detect the mutation of the target gene, and the length of the target PCR product was 414 bp;
[0238] 4.6.3 GP130 target gene was amplified by conventional PCR reaction;
[0239] 4.6.4 Analysis of editing efficiency of different targets in the GP130 gene
[0240] The PCR reaction products were subjected to 1% agarose gel electrophoresis, such as... Figure 8 After the target product was gel-extracted and recovered, it was sent to a sequencing company for sequencing. The sequencing results were then analyzed using the web-based Synthego ICE tool. The resulting editing efficiencies for different target sites (GP130-E16-gRNA1, GP130-E16-gRNA2, GP130-E16-gRNA3, GP130-E16-gRNA4, GP130-E16-gRNA5, GP130-E16-gRNA6, GP130-E16-gRNA7, and GP130-E16-gRNA8) were 20%, 24%, 43%, 48%, 14%, 10%, 52%, and 4%, respectively. The results indicate that GP130-E16-gRNA4 and GP130-E16-gRNA7 have higher editing efficiencies.
[0241] Example 5: Preparation of a single-cell clone of Congjiang Xiang pig with a point mutation in the GP130 gene
[0242] 5.1 Preparation and transcription of GP130 gene gRNA target template for high efficiency
[0243] 5.1.1 Two highly efficient gRNA targets screened in Example 4 were selected.
[0244] GP130-E16-gRNA4: TATTCCACTGTGGTACACAG (SEQ ID NO.15)
[0245] GP130-E16-gRNA7: TCATCACTGCTAGAAATGCT (SEQ ID NO.16)
[0246] 5.1.2 Design and synthesize different segment sequences of the target gRNA transcription template (synthesized by a gene synthesis company).
[0247] The sequences of T7-gRNA1, T7-gRNA2, T7-gRNA3, and T7-gRNA6 are the same as those in step 3.1.2 of Example 3;
[0248] GP130-g4T7-gRNA4:
[0249] TTCTAGCTCTAAAACCTGTGTACCACAGTGGAATAACCTATAGTGAGTCGTATTAATTTC(SEQ IDNO.21)
[0250] GP130-g4T7-gRNA5:
[0251] TACACAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT (SEQ ID NO. 22)
[0252] GP130-g7T7-gRNA4:
[0253] TTCTAGCTCTAAAACAGCATTTCTAGCAGTGATGACCTATAGTGAGTCGTATTAATTTC (SEQ ID NO. 23)
[0254] GP130-g7T7-gRNA5:
[0255] AAATGCTGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTT (SEQ ID NO. 24)
[0256] 5.1.3 Amplification of transcription template
[0257] The GP130-T7-gRNA4 transcription template sequence is shown as SEQ ID NO. 25, which is made by overlap extension PCR amplification technology using 6 synthetic primers of T7-gRNA1, T7-gRNA2, T7-gRNA3, GP130-g4T7-gRNA4, GP130-g4T7-gRNA5, and T7-gRNA6. The sequence contains a T7 promoter that can initiate transcription of the relevant sequence. The amplification results are shown in Figure 8 The target band was cut and gel recovery was performed according to the instructions of Fast Pure Gel DNA Extraction Mini Kit (Vazyme, DC301), and the recovered product was used as the transcription template.
[0258] The GP130-T7-gRNA7 transcription template sequence is shown as SEQ ID NO. 26, which is made by overlap extension PCR amplification technology using 6 synthetic primers of T7-gRNA1, T7-gRNA2, T7-gRNA3, GP130-g7T7-gRNA4, GP130-g7T7-gRNA5, and T7-gRNA6. The sequence contains a T7 promoter that can initiate transcription of the relevant sequence. The amplification results are shown in Figure 9 The target band was cut and gel recovery was performed according to the instructions of Fast Pure Gel DNA Extraction Mini Kit (Vazyme, DC301), and the recovered product was used as the transcription template.
[0259] 5.1.4 Transcription of high efficiency gRNA
[0260] The transcription template prepared in step 5.1.3 was used for in vitro transcription of gRNA with Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), and the transcribed gRNA was recovered and purified with MEGA clear TM Transcription Clean-Up Kit (Thermo, AM1908) according to the instructions, and the obtained product was gRNA that could be used for cell electroporation.
[0261] 5.2 Synthesis of single-stranded Donor DNA containing GP130 mutation site
[0262] Single-stranded DNA corresponding to the amino acid mutation of human GP130 Y689F was synthesized as Donor DNA. The single-stranded DNA contained synonymous mutations of GP130-E16-gRNA4 and GP130-E16-gRNA target PAM or 3' end sequence adjacent to PAM in addition to the target site mutation, and was named GP130-mutant-ss183, with the sequence shown in SEQ ID NO. 27.
[0263] 5.3 Preparation of porcine primary fibroblasts
[0264] As in 3.2 of Example 3.
[0265] 5.4 Transfection of porcine primary fibroblasts
[0266] Transcribed GP130-T7-gRNA4 and GP130-T7-gRNA7, pKG-GE4-Cas9 protein, and GP130-mutant-ss183 Donor DNA were used to co-transfect porcine primary fibroblasts. The ratio was about 100,000 porcine primary fibroblasts: 1 μg GP130-T7-gRNA4: 1 μg GP130-E16-gRNA7: 4 μg pKG-GE4-Cas9 protein: 2 μg GP130-mutant-ss183. The co-transfection method was the same as that in 3.3.2 of Example 3.
[0267] 5.5 Screening of single-cell clones of GP130-mutant-ss183 Donor DNA that have undergone homologous recombination (HDR)
[0268] 5.5.1 The population cells obtained by electrotransformation for 48h in step 5.4 were digested with trypsin, neutralized in complete medium, centrifuged at 500g for 5min, the supernatant was removed, the precipitate was resuspended with 200μL complete medium and appropriately diluted, and a single cell was picked up with a mouth pipette and transferred to a 96-well plate containing 100μL complete medium in each well.
[0269] 5.5.2 The culture was carried out in a constant temperature incubator at 37℃, 5% CO2, 5% O2, and the cell culture medium was changed every 2-3 days. During the period, the growth of cells in each well was observed under a microscope to exclude wells without cells and non-single cell clones.
[0270] 5.5.3 When the cells in the wells of the 96-well plate grew to cover the bottom of the wells, the cells were digested with trypsin and collected, 2 / 3 of the cells were inoculated into a 6-well plate containing complete medium, and the remaining 1 / 3 of the cells were collected in a 1.5mL centrifuge tube for subsequent genotype determination.
[0271] 5.5.4 When the 6-well plate grew to 80% confluence, the cells were digested with 0.25% (Gibco) trypsin and collected, and the cells were cryopreserved using cell cryopreservation solution (90% complete medium + 10% DMSO, by volume).
[0272] 5.6 Genotype identification of single cell clones
[0273] 5.6.1 10μL KAPA2G lysis solution was added to the cells collected in a 1.5mL centrifuge tube in step 5.5.3 to lyse the cells, obtaining a cell lysate releasing genomic DNA.
[0274] The KAPA2G lysis solution was prepared as follows:
[0275] 10×extract Buffer 1μL
[0276] Enzyme 0.2μL
[0277] ddH2O 8.8μL
[0278] 75℃ 15min—95℃ 5min—4℃, after the reaction was completed, the cell lysate was stored at -20℃;
[0279] 5.6.2 The primers GP130-E16-F131 / GP130-E16-R545 for E6 of the GP130 gene were used to amplify the target region of the GP130 gene by PCR, and the cell lysate described above was used as the DNA template to detect the target gene mutation of single cell clones. The length of the target PCR product was 414bp.
[0280] 5.6.3 The PCR products were electrophoresed, and the electrophoresis results are shown in Figure 10 to Figure 15 , and the lane numbers are consistent with the single cell clone numbers. The PCR amplification products were recovered and sequenced.
[0281] 5.6.4 The sequencing results were compared with the mutation sequence information of the GP130 target site, so as to determine whether the single cell clone strain was a successful mutation strain of the target site.
[0282] The genotypes of the single cell clones numbered 2, 6, 22, 36, and 37 were wild type. The genotypes of the single cell clones numbered 1, 3, 8, 9, 12, 16, 17, 23, 25, 26, 28, 30, 32, 33, 35, and 38 were heterozygous mutant type. The genotypes of the single cell clones numbered 4, 11, 18, 21, 24, 34, and 39 were homozygous mutant type with different variations in both alleles. The genotypes of the single cell clones numbered 5, 7, 10, 13, 14, 15, 19, 20, 27, 29, and 40 were homozygous mutant type with the same variation in both alleles. Among them, the single cell clones numbered 9, 17, 23, 32, and 35 were heterozygous mutant type of the target site point mutation, and the single cell clones numbered 13, 27, 29, and 40 were homozygous mutant type of the target site point mutation. The ratio of obtaining GP130 gene editing single cell clones was 87.5%, and the ratio of obtaining single cell clones of the target site point mutation was 22.5%.
[0283] An exemplary sequencing alignment result is shown in Figure 10 , wherein Figure 11 is the alignment result of forward sequencing and reverse sequencing of clone number GP130-ss183-2 with the wild type sequence of the target site, and is determined as wild type; Figure 12 is the alignment result of forward sequencing and reverse sequencing of clone number GP130-ss183-3 with the wild type sequence of the target site, and is determined as heterozygous mutant type; Figure 13 is the alignment result of forward sequencing and reverse sequencing of clone number GP130-ss183-4 with the wild type sequence of the target site, and is homozygous mutant type with different variations in both alleles; Figure 14 is the alignment result of forward sequencing and reverse sequencing of clone number GP130-ss183-7 with the wild type sequence of the target site, and is homozygous mutant type with the same variation in both alleles; Figure 15 is the alignment result of forward sequencing of clone number GP130-ss183-23 with the wild type sequence of the target site, and is heterozygous mutant type of the target site point mutation; is the alignment result of forward sequencing of clone number GP130-ss183-13 with the wild type sequence of the target site, and is homozygous mutant type of the target site point mutation.
[0284] The genotypes of each single cell clone of GP130 were analyzed by specific sequences, as shown in Table 1:
[0285] Table 1: Genotype determination results of GP130 gene point mutation single cell clones
[0286]
[0287]
[0288]
[0289]
[0290] The present application has been described in detail. For those skilled in the art, without departing from the spirit and scope of the present application, and without unnecessary experiments, the present application can be implemented in a wide range of equivalent parameters, concentrations and conditions. Although the present application gives a special example, it should be understood that further improvements can be made to the present application. In general, according to the principle of the present application, the present application intends to include any changes, uses or improvements of the present application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the present application. Some basic features can be applied within the scope of the following attached claims. SEQUENCE LISTING <110> Nanjing Qi-zhen Gene Engineering Co., Ltd. <120> Gene editing system for constructing gastric cancer model pig nuclear transfer donor cells with GP130 gene mutation and application thereof <160> 27 <170> SIPOSequenceListing 1.0 <210> 1 <211> 9974 <212> DNA <213> Artificial Sequence <400> 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600 gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660 ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720 agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780 agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840 tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900 tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960 cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020 aggaccgaag gagctaaccg cttttttgca caacatgggg gatcatgtaa ctcgccttga 1080 tcgttgggaa ccggagctga atgaagccat accaaacgac gagcgtgaca ccacgatgcc 1140 tgcagcaatg gcaacaacgt tgcgcaaact attaactggc gaactactta ctctagcttc 1200 ccggcaacaa ttaatagact ggatggaggc ggataaagtt gcaggaccac ttctgcgctc 1260 ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320 cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttatctacac 1380 gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgcctc 1440 actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1500 aaaacttcat ttttaattta aaaggatcta ggtgaagatc ctttttgata atctcatgac 1560 caaaatccct taacgtgagt tttcgttcca ctgagcgtca gaccccgtag aaaagatcaa 1620 aggatcttct tgagatcctt tttttctgcg cgtaatctgc tgcttgcaaa caaaaaaacc 1680 accgctacca gcggtggttt gtttgccgga tcaagagcta ccaactcttt ttccgaaggt 1740 aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1800 ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1860 agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1920 accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1980 gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 2040 tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220 cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280 ttttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400 gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatatgg 2460 tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatac actccgctat 2520 cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580 gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640 gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700 catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760 tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820 ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880 tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc 2940 ggttactgga acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa 3000 AAATCCTTCT GGGTTATGCT GAGCGCTTCG TTGTTACAGA TGTTGGTGTT CCACAGGGTA 3060 GCCAGCAGCA TCCTGCGATG CAGATCCGGA ACATAATGGT GCAGGGCGCT GACTTCCGCG 3120 TTTCCAGACT TTACGAAACA CGGAAACCGA AGACCATTC A GTGTGTGTCT CAGGTCGCAG 3180 ACGTTTTGCA GCAGCAGTCG CTTCACGTTC GCTCGGCGTA TCAGTGATTC ATTCTGCTAAC 3240 CAGTAAGGCA ACCCCGCCAG CCTAGCCGGG TCCTCAACGA CAGGAGCACG ATCATGCGCA 3300 CCCCTGGGGC CGCCATGCCG GCGATAATGG CCTGCTTCTC GCCGAAACGT TTGCTGGCGG 3360 GACCAGTGAC GAAGGCTTGA GC GAGGGCGTG CAAGATTCCG AATAACGCA AGCGACAGGC 3420 CGATCATCGT CGCGCTCCAG CGAAAGCGGT CCTCGCCGAA AATGACCCAG AGCGCTGCCG 3480 GCACCTGTCC TACGAGTTGC ATGATAAAGA AGACAGTCA TAAGTGCGGC GACGATAGTC 3540 TGCCCCGCCC CACC GGAAGGAGC TGACTGGGTT GAAGGCCTC CAAGGGCATCG GTCGAG 3600 ATCCCGGTGC CTAATGAGTG AGCTAAGTTC ATT AATTGCGTT GCCTCCTCCT GCCCGCTT 3660 TCCAGTCGGG AAACCTGTCG TGCCAGCTGC ATTAATGAAT C GGC A AC GCGCGGGGAG AG 3720 GCGTTATGGGCAGAAGGTGGTTTTTCTTTTCACTGTGAGACGGGCAACAGC 3780 TGATTGCCCTTCACCACCTGGCCCTGAGAGAGTTGCAGCAAGCGGTCCAC 3840 CCCAGCAGGCAGAAATCCTGTTTGATGGTGGTAAACGGCGGGATATAACA 3900 TCGTTATCGTCTCCACTACCGAGATGTCCGCACCAACGCACCCCAGACTC 3960 ATGGCGCGATCGCGCCCAGCGCCATCTGATCGTTGGCAACCAGCATCGC 4020 ATGCCCTCATTCAGCATTTCATGCTTTGTTCGAAAACCGGACATGGCA 4080 TCCCCTTCCTATCGGCTGAATTTGATTGCGAGTGAGATATTTATGCCAG 4140 CGCAGACGCACCGAGACAGAATTTAAAGGGCCCCTAACAAGCGATTTGC 4200 AATGCGACCAAGATGCTCCACGCCCTGTCGCGTACCGTCTTCTGGGAG 4260 AATGCGACCAAGATGCTCCACGCCCTGTCGCGTACCGTCTTCTGGGAG 4260 TCCACAGCAATGGCATCCTGGTTCAGCGGATAGTTAATGATCAGCCCAC 4380 TGCACGAGAAGATCGTGCACCGCCGCTTTACAGCTTCGACGCCGCTTCG 4440 GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC 60 GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC 60 GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC 60 GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC 60 GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC 60 GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC 60 GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC 60 GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC 60 GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC 60 GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC 60 GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC 60 GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC GCGCGCGCGC 60 ttcccctcta gaaataattt tgtttaactt taagaaggag atatacatgt gaaacaaagc 5220 actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat 5280 aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg 5340 atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400 gatgaaatcg ctgacgaata tcagggcaaa ctgaccgttg caaaactgaa catcgatcaa 5460 aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa 5520 aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580 ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640 gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700 gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760 actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820 tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880 acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940 ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000 gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060 attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120 ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180 atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240 gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300 aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360 ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420 atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480 gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540 atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600 ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660 attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720 cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780 tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840 aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900 cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960 atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020 aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080 ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140 gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200 ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260 aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320 ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380 aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440 ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500 aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560 accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620 ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680 ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740 ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800 ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860 gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920 aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980 gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040 aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100 gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160 atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220 gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280 aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340 tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400 aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460 gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520 aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580 ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640 caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700 ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760 GCGCGAAGAG GCGGAGGAGG GCGGCGGCGG GCGGCGGCGG GCGGCGGCGG 60 GCGCGAAGAG GCGGAGGAGG GCGGCGGCGG GCGGCGGCGG 60 GCGCGAAGAG GCGGAGGAGG GCGGCGGCGG GCGGCGGCGG 60 GCGCGAAGAG GCGGAGGAGG GCGGCGGCGG GCGGCGGCGG 60 GCGCGAAGAG GCGGAGGAGG GCGGCGGCGG GCGGCGGCGG 60 GCGCGAAGAG GCGGAGGAGG GCGGCGGCGG GCGGCGGCGG 60 GCGCGAAGAG GCGGAGGAGG GCGGCGGCGG GCGGCGGCGG 60 GCGCGAAGAG GCGGAGGAGG GCGGCGGCGG GCGGCGGCGG 60 GCGCGAAGAG GCGGAGGAGG GCGGCGGCGG GCGGCGGCGG 60 GCGCGAAGAG GCGGAGGAGG GCGGCGGCGG GCGGCGGCGG 60 GCGCGAAGAG GCGGAGGAGG GCGGCGGCGG GCGGCGGCGG 60 GCGCGAAGAG GCGGAGGAGG GCGGCGGCGG GCGGCGGCGG 60 CACAACACTACCTGGACGAGATCATCGAACAGATTTCTGAATTTCCTAAACGTGTGATT 9540 CTGGCTGATGC GAATCTGGAT AAAGTTCTGT CTGCCTATAACAAGCATCGTGACAAACC G 9600 ATCCGCGAAC AGGCTGAGAAC ATCATCCACC TGTTCACTCT GACTAACCTGG GC GCACA 9660 GCGGCTTTCA AGTACTTTGA TACCACCATT GACC GCAAGCGTTACACCTCCACTAAAGAA 9720 GTGCTGGACG CGACTCTGAT CCACCAGTCC ATCACCGGTC GTACGAGACCCGTATCGAT 9780 CTGAGCCAGCT GGGCGGTGACA AAAGGCCGGC GGCCACGAAA AAGGCCGGCC AGGCAA AA 9840 AAGAAAAAGTGACAAAGCCC GAAAGGAAGC TGAGTTGGCT GCTGCCACCG CTGAGCAATA 9900 ACTAGCATAACCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTGCTGA AAGGAGG 9960 AACTATATCCGGAT 9974 <210> 2 <211> 4694 <212> DNA <213> Artificial Sequence <400> 2 TAACTTTAAAGAAGGAGATATACATGTGAAAACAAAGC ACTATTGCAC TGGC ACTCTTACC 60 GTTACTGTTTACCCCTGTGACA AAAGCCATGAGCGATAAAATTATTCACCTGACTGACGA 120 CAGTTTTGAC AC G GATGTACT C AAAGCGGAC GGGGC GATC CTCGTCGATT TCTGGGCAGA 180 GTGGTGC GGTCCGTGCAAAATGATCGCCCCGATTCTGGATGAAATCGCTGACGAATATCA 240 GGGCAAAC TG ACCGT T G C AA A AC T G A AC AT C G AT C AA A AC C C TGG C AC T G C G C C G AA AT A 300 TGGCATCCGTGGTATCCC GAC T C G G C G C G T T C AA A AC G G T G A AGT G G C G G C A AC C AA 360 AGTGGGTGC ACTGTCTAAAGTCAGTTGAAAGAGTTCCTCGACGCTAACCTGGCCGGTTC 420 TG G T T C T G G C C AT AT G C AC C AT C AT C AT C AT C AT G AC G AT G AC G AT A AGA T G CCC A AAA A A 480 GAAACGAAAGGTGGGTATCCACGGAGTCCCAGCAGCCGACA AAA AAT AT AG C AT C G GC C T 540 GGACATCGGTACCAACAGCGT TGGCTGGGC AGT G AT C ACT G AT G A AT AC A A AGT T C AT C 600 CAAAAAATTTAAAGTACTGGGCAACACCGACCGTCAC T C T AT C AAA A A A AC C T G AT T G G 660 TGCTCTGCTGT TTGACAGCGGC GAAAC T G C T G AGGCTACCCGTCTGAAACGTACGGCTCG 720 CCGTCGCTACACTCGTCGTAAAAACC G C AT C T G T T AT C T G C AGGAAATTTCTCTAACGA 780 AATGGCAAAGTTGATGATAGCTTCTTTCATCGTCTGGAA GAGAGCTTCC T G GT G GAAGA 840 agataaaaaa cacgaacgtc acccgatttt cggtaacatt gtggatgagg ttgcctacca 900 cgagaaatat ccgaccatct accatctgcg taaaaaactg gttgatagca ctgacaaagc 960 ggatctgcgt ctgatctacc tggctctggc acacatgatc aaattccgtg gtcacttcct 1020 gatcgaaggt gatctgaacc ctgataactc cgacgtggac aaactgttca ttcagctggt 1080 tcagacctat aaccagctgt tcgaagaaaa cccgatcaac gcgtccggtg tagacgctaa 1140 ggcaattctg tctgcgcgtc tgtctaagtc tcgtcgtctg gaaaacctga ttgcgcaact 1200 gccaggtgaa aagaaaaacg gcctgttcgg caatctgatc gccctgtccc tgggtctgac 1260 tccgaacttt aaatccaact ttgacctggc ggaagatgcc aagctgcagc tgagcaaaga 1320 tacctatgac gatgacctgg ataacctgct ggcacagatc ggtgatcagt atgccgatct 1380 gttcctggcc gcgaaaaacc tgtctgatgc gattctgctg tctgatatcc tgcgcgttaa 1440 cactgaaatt actaaagcgc cgctgagcgc atccatgatt aaacgttacg atgaacacca 1500 ccaggatctg accctgctga aagcgctggt gcgtcagcag ctgccggaaa aatacaagga 1560 gatcttcttc gaccagagca aaaacggtta cgcgggctac attgatggtg gtgcatctca 1620 ggaggaattc tacaaattca ttaaaccgat cctggaaaaa atggatggta ctgaagagct 1680 gctggttaaa ctgaatcgtg aagatctgct gcgcaaacag cgtaccttcg ataacggttc 1740 catcccgcat cagattcatc tgggcgaact gcacgctatc ctgcgccgtc aggaagactt 1800 ttatccgttc ctgaaagaca accgtgagaa aattgaaaaa atcctgacct tccgtattcc 1860 gtactatgta ggtccgctgg cgcgtggtaa ctcccgtttc gcttggatga cccgcaaaag 1920 cgaagaaacc atcaccccgt ggaatttcga agaagtcgtt gacaaaggcg cgtccgcgca 1980 gtctttcatc gaacgcatga cgaacttcga caaaaacctg ccgaacgaga aagtgctgcc 2040 gaaacactct ctgctgtacg agtacttcac tgtgtacaac gaactgacca aagtgaaata 2100 cgtcaccgaa ggtatgcgta aaccggcatt cctgtccggt gagcaaaaaa aagcaatcgt 2160 ggatctgctg ttcaaaacca accgtaaagt aaccgtgaaa cagctgaagg aagactattt 2220 caagaaaatc gaatgttttg attctgttga aatctccggc gtggaagatc gcttcaatgc 2280 gtccctgggt acgtatcacg acctgctgaa aattatcaaa gacaaagatt ttctggacaa 2340 cgaggaaaac gaagacatcc tggaggatat tgtactgacc ctgaccctgt tcgaagaccg 2400 tgagatgatc gaagaacgcc tgaaaaccta cgcccacctg ttcgatgaca aggtaatgaa 2460 gcagctgaaa cgtcgtcgtt ataccggctg gggtcgtctg tcccgtaaac tgatcaatgg 2520 catccgtgat aaacagtctg gcaaaaccat cctggacttc ctgaaatccg acggtttcgc 2580 gaatcgtaac ttcatgcaac tgattcatga cgattctctg actttcaaag aagacatcca 2640 gaaagcacag gtttccggcc agggtgactc tctgcacgag cacattgcca atctggctgg 2700 ttctccggct attaaaaagg gtattctgca gactgtgaaa gtagttgatg agctggtcaa 2760 agtaatgggc cgtcacaagc cggaaaacat tgtgatcgaa atggcacgtg aaaaccagac 2820 gacccagaaa ggtcagaaaa actctcgtga acgcatgaaa cgtatcgaag aaggcatcaa 2880 agaactgggc tctcagatcc tgaaggaaca ccctgtagaa aatacccagc tgcagaacga 2940 aaagctgtat ctgtattacc tgcagaacgg ccgcgatatg tatgtggacc aggaactgga 3000 tatcaaccgc ctgtccgatt acgatgtaga tcacatcgtg ccgcaaagct tcctgaaaga 3060 cgacagcatt gacaacaaag tactgacccg ttctgataag aaccgtggca aatccgataa 3120 cgtcccgtct gaagaagttg ttaaaaaaat gaaaaactat tggcgtcagc tgctgaacgc 3180 gaaactgatc acccagcgta agttcgacaa tctgactaaa gctgagcgcg gtggtctgtc 3240 cgaactggat aaagcgggtt ttatcaaacg ccagctggtt gaaacccgtc agatcacgaa 3300 gcacgttgcg cagattctgg actctcgtat gaacaccaaa tacgacgaaa acgacaaact 3360 gatccgcgag gttaaggtta tcaccctgaa aagcaaactg gtatccgatt ttcgtaaaga 3420 ctttcagttc tacaaagtgc gcgaaattaa caactatcac cacgctcacg atgcatatct 3480 gaatgcagtt gttggcacgg cgctgatcaa aaagtatccg aaactggaat ctgaattcgt 3540 atacggcgat tacaaagtgt atgacgttcg taagatgatc gcaaaatccg agcaggaaat 3600 tggtaaggcg acggcgaaat acttctttta ttccaatatt atgaactttt tcaaaaccga 3660 aatcaccctg gcgaatggtg aaattcgtaa acgcccgctg atcgaaacca acggtgaaac 3720 TGTTGGGACAAAGGCCGAC T TCGCGACCGTGC GTA AAGTCTGTCTAT 3780 GCCGCAAGTGAACATCGTCAAGAAGACCGAAGTACAAACCGGC GGT TTA GCAAAGAGAG 3840 CATTCTGCCAAAACGTAAC TCCGACAAC T GATCGCGCGCAAGAAAGACTGGGATCCGAA 3900 AAAATACGGTGGTTTCGAT TCC AACC GT TGC T TATTCCTTCTGGTGGTAGCCAAAGT 3960 TGAGAAAGGTAAAAGCAA A AACTGAAATCCGTA AAGGA ACTGCTGGGTATTACTATCAT 4020 GGAGCGTAGCTCCTTCGAAAAAAACCCGATCGATTTTCTGGAAGCGAAAGGCTATAAAGA 4080 AGTCAA A AAGGACCTGATCATCAAAC TGC C AAAATACAGCCTGTTCGAGCTGGAAAACGG 4140 CCGTAAACGTATGCTGGCATCTGC GGGCGA ACTGCAGAAAGGCAACGAGCTGGCTCTGCC 4200 GTCCAAATACGTGAAC TTTCTGTACCTGGCCTCTC ACTACGAAAAACTGAAAGGT TCCCC 4260 GGAAGACAACGAACAGAAACAGCTGTTCGT AGAGCAGCACAAACACTACCTGGACGAGAT 4320 CATCGAACA GATTTCTGAA TTTTCTAAACGTGTGAT TCTGGCTGATGC GAATCTGGATAA 4380 AGTTCTGTCTGCCTATAACAAGCATCGTGA CAAACC GATCCGC GAACAGGCTGAGAACAT 4440 catccacctg ttcactctga ctaacctggg cgcgccagcg gctttcaagt actttgatac 4500 caccattgac cgcaagcgtt acacctccac taaagaagtg ctggacgcga ctctgatcca 4560 ccagtccatc accggtctgt acgagacccg tatcgatctg agccagctgg gcggtgacaa 4620 aaggccggcg gccacgaaaa aggccggcca ggcaaaaaag aaaaagtgac aaagcccgaa 4680 aggaagctga gttg 4694 <210> 3 <211> 20 <212> DNA <213> Artificial Sequence <400> 3 agagcacagt cagcctggcg 20 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 cttccagaat tggatctccg 20 <210> 5 <211> 23 <212> DNA <213> Artificial Sequence <400> 5 tacggaattg gggagccagc gga 23 <210> 6 <211> 21 <212> DNA <213> Artificial Sequence <400> 6 caaagttaac tctctgtgtc t 21 <210> 7 <211> 225 <212> DNA <213> Artificial Sequence <400> 7 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 8 <211> 225 <212> DNA <213> Artificial Sequence <400> 8 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 9 <211> 937 <212> PRT <213> Sus scrofa <400> 9 Met Leu Thr Leu Gin Thr Trp Val Val Gin Ala Leu Phe lie Phe Leu 1 5 10 15 Thr Thr Lys Cys Lys Gly Glu Leu Leu Asp Pro Cys Gly His lie Ser 20 25 30 Pro Glu Ser Pro Val lie Gin Leu Gly Ser Asn Phe Thr Ala Val Cys 35 40 45 Val Leu Lys Glu Lys Cys Met Asp His Tyr His Val Asn Ala Ser Tyr 50 55 60 lie Phe Trp Lys Thr Asn His Val Thr lie Pro Tyr Glu Gin Tyr Asn 65 70 75 80 Val lie Asn Arg Thr Ala Ser Ser Val Thr Phe Arg Asp lie Ser Leu 85 90 95 Leu Asn lie Gin Leu Thr Cys Asn lie Arg Thr Phe Gly Gin lie Asp 100 105 110 Gln Asn Val Tyr Gly lie Arg lie lie Ser Gly Leu Pro Pro Glu Lys 115 120 125 Pro Lys Asn Leu Ser Cys lie Val Asn Glu Gly Lys Lys Met Met Cys 130 135 140 Gln Trp Asp Pro Gly Arg Glu Thr His Leu Glu Thr Asn Phe Thr Leu 145 150 155 160 Lys Ser Glu Trp Ala Thr Glu Lys Phe Asp Asp Cys Lys Ala Lys Arg 165 170 175 Asp Ile Pro Thr Ser Cys Thr Val Asp Tyr Ser Pro Val Tyr Phe Val 180 185 190 Asn Ile Glu Val Trp Val Glu Ala Glu Asn Ala Leu Gly Lys Val Thr 195 200 205 Ser Asp His Ile Asn Phe Asp Pro Val Asp Lys Val Lys Pro Asn Pro 210 215 220 Pro His Asn Leu Ser Val Ser Asn Ser Glu Glu Leu Ser Ser Ile Leu 225 230 235 240 Lys Leu Thr Trp Ile Asn Ser Ser Ile Arg Asn Phe Ile Arg Leu Lys 245 250 255 Tyr Asn Ile Gln Tyr Arg Thr Lys Ala Ala Ser Thr Trp Asn Gln Ile 260 265 270 Cys Ile Ser Ser Lys Asp Gln Gln Glu Asp Ile Gln Ile Glu Asn Thr 275 280 285 Ala Glu Ile Glu Ile Pro Pro Glu Asp Thr Ala Ser Thr Arg Ser Ser 290 295 300 Phe Thr Val Gln Asp Leu Lys Pro Phe Thr Glu Tyr Val Phe Arg Ile 305 310 315 320 Arg Cys Met Lys Glu Asp Gly Lys Gly Phe Trp Ser Asp Trp Ser Glu 325 330 335 Glu Ala Ser Gly Val Thr Tyr Glu Asp Arg Pro Ser Lys Ala Pro Ser 340 345 350 Phe Trp Tyr Lys Ile Glu Pro Ser His Thr His Gly Tyr Arg Ser Val 355 360 365 Gln Leu Met Trp Lys Thr Leu Pro Pro Phe Glu Ala Asn Gly Lys Ile 370 375 380 Leu Asp Tyr Glu Val Thr Leu Thr Arg Trp Lys Ser Arg Leu Gln Asn 385 390 395 400 Tyr Thr Val Asn Asp Thr Lys Leu Thr Val Asn Leu Thr Asn Asp Arg 405 410 415 Tyr Ile Ala Thr Leu Thr Ala Arg Asn Met Val Gly Lys Ser Asp Ala 420 425 430 Ser Val Leu Thr Ile Pro Ala Cys Asp Phe Gln Ala Thr His Pro Ile 435 440 445 Lys Asp Leu Lys Ala Phe Pro Lys Asp Asn Met Leu Trp Val Glu Trp 450 455 460 Thr Ala Pro Asn Glu Ser Val Asn Arg Tyr Val Leu Glu Trp Cys Val 465 470 475 480 Leu Ser Asp Lys Ser Pro Cys Ile Pro Asp Trp Gln Gln Glu Asp Gly 485 490 495 Thr Val His Arg Thr Tyr Leu Arg Gly Asn Leu Ala Glu Ser Lys Cys 500 505 510 Tyr Leu Ile Thr Val Thr Pro Val Tyr Ala Asp Gly Pro Gly Ser Pro 515 520 525 Glu Ser Ile Lys Ala Tyr Leu Lys Gln Ala Pro Pro Ser Lys Gly Pro 530 535 540 Thr Val Arg Thr Lys Lys Val Gly Lys Asn Glu Ala Val Leu Glu Trp 545 550 555 560 Asp Gln Leu Pro Val Asp Val Gln Asn Gly Phe Ile Arg Asn Tyr Thr 565 570 575 Ile Phe Tyr Arg Thr Val Ile Gly Asn Glu Thr Ala Val Asn Val Asp 580 585 590 Ser Ser His Thr Glu Tyr Thr Leu Ser Ser Leu Thr Ser Asp Thr Leu 595 600 605 Tyr Met Val Arg Met Ala Ala Tyr Thr Asp Glu Gly Gly Lys Asp Gly 610 615 620 Pro Glu Phe Thr Phe Thr Thr Pro Lys Phe Ala Gln Gly Glu Ile Glu 625 630 635 640 Ala Ile Val Val Pro Val Cys Leu Ala Phe Leu Leu Thr Thr Leu Leu 645 650 655 Gly Val Leu Phe Cys Phe Asn Lys Arg Asp Leu Ile Lys Lys His Ile 660 665 670 Trp Pro Asn Val Pro Asp Pro Ser Lys Ser His Ile Ala Gln Trp Ser 675 680 685 Pro His Thr Pro Pro Arg His Phe Asn Ser Lys Asp Gln Met Tyr Pro 690 695 700 Asp Gly Asn Phe Thr Asp Val Ser Val Val Glu Ile Glu Ala Asn Asp 705 710 715 720 Lys Lys Pro Phe Pro Glu Asp Leu Lys Ser Leu Asp Ile Phe Lys Lys 725 730 735 Glu Lys Ile Asn Thr Glu Gly His Ser Ser Gly Ile Gly Gly Ser Ser 740 745 750 Cys Met Ser Ser Ser Arg Pro Ser Ile Ser Ser Ser Asp Glu Asn Glu 755 760 765 Ser Ala Gln Asn Thr Ser Ser Thr Val Gln Tyr Ser Thr Val Val His 770 775 780 Ser Gly Tyr Arg His Gin Val Pro Ser Val Gin Val Phe Ser Arg Ser 785 790 795 800 Glu Ser Thr Gin Pro Leu Leu Asp Ser Glu Glu Arg Pro Glu Glu Leu 805 810 815 Gln Leu Val Asp Asn Val Asp Gly Ser Asp Gly lie Leu Pro Arg Gin 820 825 830 Gln Tyr Phe Lys Gin Asn Cys Gin His Glu Thr Ser Pro Asp lie Ser 835 840 845 His Phe Glu Arg Ser Lys Gin Val Ser Ser Val Asn Glu Asp Phe Val 850 855 860 Arg Leu Lys Gin Gin Gin lie Ser Asp Cys lie Ser Gin Pro Tyr Gly 865 870 875 880 Ser Gly Gin Met Lys Met Phe Gin Glu Val Ser Ala Thr Asp Ala Phe 885 890 895 Gly Pro Gly Thr Glu Gly Gin Val Glu Arg Phe Glu Thr Val Gly Met 900 905 910 Glu Ala Ala lie Asp Glu Gly Met Pro Lys Ser Tyr Leu Pro Gin Thr 915 920 925 Val Arg Arg Gly Gly Tyr Met Pro Gin 930 935 <210> 10 <211> 825 <212> DNA <213> Pig (Sus scrofa) <400> 10 tatatatatt ataattaata tttataatta ttctagcatt tgtaaatgaa catgcactgt 60 aggtaaataa tctgttttct ctcttttaag cattttaatt caaaagatca aatgtatcca 120 gatggaaatt tcactgatgt aagtgttgtg gaaatagaag caaatgacaa aaaacctttt 180 ccagaagatc tgaaatcatt ggacatattc aagaaggaaa aaattaatac tgaaggacac 240 agtagtggta ttggagggtc ttcgtgcatg tcatcttcta ggccaagcat ttctagcagt 300 gatgaaaatg aatctgcaca gaacacttca agcactgtcc agtattccac tgtggtacac 360 agtggctaca gacaccaggt accatcggtc caagtcttct cacggtccga gtccacccag 420 cccttgttag attctgaaga gcggccagaa gagctacagc tagtagataa tgtagatgga 480 agtgatggca ttttacccag acaacagtat ttcaaacaaa actgtagtca acacgaaacc 540 agtccagata tttcacattt tgaaaggtca aagcaagttt catcagtcaa tgaagatttt 600 gttagactta aacagcagca gatttcagat tgtatttcac agccctatgg atctgggcaa 660 atgaaaatgt ttcaggaagt ttctgcaaca gatgcttttg gtccaggcac tgagggacaa 720 gtagagagat ttgaaacagt tgggatggag gctgcaattg atgaaggaat gcccaaaagt 780 tacttaccac agactgtaag acgaggtggc tacatgcctc agtga 825 <210> 11 <211> 23 <212> DNA <213> Artificial Sequence <400> 11 tttcactgat gtaagtgttg tgg 23 <210> 12 <211> 21 <212> DNA <213> Artificial Sequence <400> 12 tggactggtt tcgtgttgac t 21 <210> 13 <211> 23 <212> DNA <213> Artificial Sequence <400> 13 cactgatgta agtgttgtgg aaa 23 <210> 14 <211> 21 <212> DNA <213> Artificial Sequence <400> 14 aatctaacaa gggctgggtg g 21 <210> 15 <211> 20 <212> DNA <213> Artificial Sequence <400> 15 tattccactg tggtacacag 20 <210> 16 <211> 20 <212> DNA <213> Artificial Sequence <400> 16 tcatcactgc tagaaatgct 20 <210> 17 <211> 25 <212> DNA <213> Artificial Sequence <400> 17 caccgtattc cactgtggta cacag 25 <210> 18 <211> 25 <212> DNA <213> Artificial Sequence <400> 18 aaacctgtgt accacagtgg aatac 25 <210> 19 <211> 25 <212> DNA <213> Artificial Sequence <400> 19 caccgtcatc actgctagaa atgct 25 <210> 20 <211> 25 <212> DNA <213> Artificial Sequence <400> 20 aaacagcatt tctagcagtg atgac 25 <210> 21 <211> 59 <212> DNA <213> Artificial Sequence <400> 21 ttctagctct aaaacctgtg taccacagtg gaatacctat agtgagtcgt attaatttc 59 <210> 22 <211> 59 <212> DNA <213> Artificial Sequence <400> 22 tacacaggtt ttagagctag aaatagcaag ttaaaataag gctagtccgt tatcaactt 59 <210> 23 <211> 59 <212> DNA <213> Artificial Sequence <400> 23 ttctagctct aaaacagcat ttctagcagt gatgacctat agtgagtcgt attaatttc 59 <210> 24 <211> 59 <212> DNA <213> Artificial Sequence <400> 24 aaatgctgtt ttagagctag aaatagcaag ttaaaataag gctagtccgt tatcaactt 59 <210> 25 <211> 225 <212> DNA <213> Artificial Sequence <400> 25 GGCTTGTTCG GACTCTTCG CTATTACGCC AGCTGGCGAA GGGGGATGTG CTGCAAGGC GAT 60 TAAGTTGGGT AACGCCAGG GTTTTCCCAG TCACGACGTT AGGAAATTA ATACGACTCA CT 120 ATAGGTATTCC ACTGTGGTA CAGGTTTTAG AGCTAGAAAT AGCAAGTTAA AATAAGGC 180 TAGTCCGTAT CAACTTGAAT AAGTGGCACCG AGTCGGTGC TTTT 225 <210> 26 <211> 225 <212> DNA <213> Artificial Sequence <400> 26 GGCTTGTTCG GACTCTTCG CTATTACGCC AGCTGGCGAA GGGGGATGTG CTGCAAGGC GAT 60 TAAGTTGGGT AACGCCAGG GTTTTCCCAG TCACGACGTT AGGAAATTA ATACGACTCA CT 120 ATAGGTATTC CACTGTGGTA CAGGTTTTAG AGCTAGAAAT AGCAAGTTAA AATAAGGC 180 TAGTCCGTAT CAACTTGAAT AAGTGGCACCG AGTCGGTGC TTTT 225 <210> 27 <211> 183 <212> DNA <213> Artificial Sequence <400> 27 AAGGACACAG TAGTGGGATT GGAGGGTCTT CTGTGCAATG TCATCTTAGG CCAACGATTT 60 ctagcagtga tgaaaatgaa tctgcacaga acacttcaag cactgtccag ttttccactg 120 tagtacacag tggctacaga caccaggtac catcggtcca agtcttctca cggtccgagt 180 cca 183
Claims
1. A gene editing system for constructing a GP130 gene-mutated pig nuclear transfer donor cell, characterized by The gene editing system comprises a specific fusion protein containing Cas9 protein, a gRNA targeting GP130 gene, and a single-stranded Donor DNA containing a GP130 mutation site; the gene sequence of the specific fusion protein containing Cas9 protein is shown as SEQ ID NO. 2; the target of the gRNA targeting GP130 gene is selected from GP130-E16-gRNA4 shown as SEQ ID NO. 15 and GP130-E16-gRNA7 shown as SEQ ID NO. 16; the gRNA targeting GP130 gene is obtained by in vitro gRNA transcription from a GP130-T7-gRNA4 transcription template shown as SEQ ID NO. 25 and a GP130-T7-gRNA7 transcription template shown as SEQ ID NO. 26, respectively; the sequence of the single-stranded Donor DNA containing a GP130 mutation site is shown as SEQ ID NO. 27; the mass ratio of GP130-E16-gRNA4: GP130-E16-gRNA7: the specific fusion protein containing Cas9 protein: the single-stranded Donor DNA is 1:1:4:
2.
2. The use of the gene editing system of claim 1 in constructing a GP130 gene mutant pig recombinant cell.
3. A recombinant cell, characterized in that The pig primary fibroblast cell obtained after verification by co-transfecting the gene editing system of claim 1.
4. The use of the gene editing system of claim 1 and the recombinant cell of claim 3 in constructing a GP130 gene mutant pig.
Citation Information
Patent Citations
Application of gRNA target combinations in construction of hemophilia model pig cell line
CN112442515A
Gene editing system for constructing LMNA gene mutation dilated cardiomyopathy model porcine nuclear transplantation donor cells and application of gene editing system
CN114990157A