Construction of gene editing system for nuclear donor cells of congenital agammaglobulinemia model pig and its application

By constructing a gene editing system using BTK gene-mutated porcine nuclear transplantation donor cells, the problem of mouse models being unable to simulate human physiology and pathology was solved, and a porcine model of gamma globulin deficiency was successfully bred, enabling efficient gene editing and drug research.

CN115247174BActive Publication Date: 2025-10-28NANJING KGENE GENETIC ENG CO LTD
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202111373702.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-11-19
Publication Date
2025-10-28
Estimated Expiration
2041-11-19

Smart Images

  • Figure BDA0003363068100000151
    Figure BDA0003363068100000151
  • Figure BDA0003363068100000161
    Figure BDA0003363068100000161
  • Figure HDA0003363068110000011
    Figure HDA0003363068110000011
Patent Text Reader

Abstract

This invention discloses a gene-editing system for constructing porcine nuclear transplantation donor cells for a congenital agammaglobulinemia model and its applications. This invention provides a kit comprising BTK-gRNA2 (SEQ ID NO: 18), BTK-gRNA4 (SEQ ID NO: 19), and NCN protein. This invention also provides a method for preparing recombinant cells, comprising the following steps: co-transfecting porcine cells with BTK-gRNA2, BTK-gRNA4, and NCN protein to obtain recombinant cells. The recombinant cells are recombinant cells with a mutated BTK gene. The kits described above are used for: preparing recombinant cells; preparing porcine models of agammaglobulinemia; preparing cell models, tissue models, or organ models of agammaglobulinemia. This invention has significant application value for the development of drugs for agammaglobulinemia and for elucidating the pathogenesis of this disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically to the field of gene editing technology, and more specifically relates to a gene editing system for constructing donor cells for nuclear transplantation of pigs with BTK gene mutations in a model of congenital agammaglobulinemia and its application. Background Technology

[0002] There are two types of agammaglobulinemia: ① Bruton's type, which is more common and is an X-linked agammaglobulinemia of infancy, related to X-linked recessive inheritance, occurring only in boys, with symptoms appearing after six months of age; ② Autosomal recessive type, which can affect both males and females, and can also occur in adults. The characteristics of this disease are: a significant decrease or even absence of B cells in the blood; a decrease or absence of serum immunoglobulins (IgM, IgG, IgA); arrested development of pre-B cells in the bone marrow; incomplete development or primitive state of germinal centers in lymph nodes, tonsils, and other lymphoid tissues throughout the body; sparse non-thymus-dependent lymphocytes in the spleen and lymph nodes; absence of plasma cells throughout the body; and normal T-cell system and cellular immune response.

[0003] Due to immunodeficiency, patients often experience recurrent bacterial infections, particularly susceptible to Haemophilus influenzae, Streptococcus pyogenes, Staphylococcus aureus, and Streptococcus pneumoniae. These infections can cause otitis media, sinusitis, bronchitis, pneumonia, meningitis, or sepsis, and may even lead to death. Injection of gamma globulin can control the infection, but because it cannot increase secretory IgA (SIgA) levels in the respiratory tract mucosa, nasal and lung infections are highly prone to recurrence.

[0004] Bruton's type, also known as X-linked agammaglobulinemia (XLA), is a rare X-linked inherited disorder caused by mutations in the Bruton's tyrosine kinase (BTK) gene. BTK is an important component of the B-cell receptor signaling pathway, which plays a crucial role in B-cell growth and development as well as B-cell-mediated adaptive humoral immune responses. In XLA patients, the BTK gene mutation leads to defects in the development and maturation of B cells in the bone marrow, resulting in a significant reduction or complete absence of mature B cells in the peripheral blood. Due to the lack of mature B cells (less than 1%), XLA patients experience significantly reduced levels of all major immunoglobulins (Ig) in their serum, thus making them susceptible to severe and chronic bacterial infections.

[0005] For gamma globulin deficiency, research is needed on drugs or methods to inhibit, treat, or alleviate XLA, as well as to study its pathogenesis. All of this requires the use of animal models. Currently, the most commonly used animal model is the mouse model; however, mice differ greatly from humans in body size, organ size, physiology, and pathology, and cannot realistically simulate normal human physiological and pathological states. Pigs, as large animals, are similar in size and physiological function to humans, are easy to breed and raise on a large scale, and have lower ethical and animal protection requirements, making them ideal animal models for human diseases.

[0006] Gene editing is a biotechnology that has seen significant development in recent years. It encompasses everything from homologous recombination-based gene editing to nuclease-based technologies such as ZFN, TALEN, and CRISPR / Cas9, with CRISPR / Cas9 currently being the most advanced. Gene editing technology is increasingly being applied to the creation of animal models. Summary of the Invention

[0007] The purpose of this invention is to provide a gene editing system for constructing BTK gene-mutated porcine nuclear transplantation donor cells and its applications.

[0008] This invention provides a kit comprising BTK-gRNA2, BTK-gRNA4 and NCN protein.

[0009] This invention provides a kit comprising BTK-gRNA2, BTK-gRNA4 and PRONCN proteins.

[0010] This invention provides a kit comprising BTK-gRNA2, BTK-gRNA4, and a specific plasmid.

[0011] This invention provides the application of BTK-gRNA2, BTK-gRNA4 and NCN proteins in the preparation kit.

[0012] This invention also provides the application of BTK-gRNA2, BTK-gRNA4 and PRONCN proteins in the preparation kit.

[0013] This invention also provides the application of BTK-gRNA2, BTK-gRNA4, and specific plasmids in the preparation kit.

[0014] The kits described above also include porcine cells.

[0015] The above-described kits are intended for use as follows (a), (b), or (c): (a) to prepare recombinant cells; (b) to prepare a gamma globulin deficiency model pig; (c) to prepare a gamma globulin deficiency cell model, a gamma globulin deficiency tissue model, or a gamma globulin deficiency organ model.

[0016] The present invention also provides a method for preparing recombinant cells, comprising the following steps: co-transfecting porcine cells with BTK-gRNA2, BTK-gRNA4 and NCN protein to obtain recombinant cells.

[0017] The co-transfection specifically employs an electroporation transfection method.

[0018] The specific parameter settings for electroporation transfection are: 1450V, 10ms, 3pulse.

[0019] The co-transfection can be specifically performed using a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system electroporator.

[0020] The ratio of BTK-gRNA2, BTK-gRNA4 and NCN protein is as follows: 0.8-1.2 μg BTK-gRNA2: 0.8-1.2 μg BTK-gRNA4: 3-5 μg NCN protein.

[0021] The ratio of BTK-gRNA2, BTK-gRNA4 and NCN protein is as follows: 1 μg BTK-gRNA2 : 1 μg BTK-gRNA4 : 4 μg NCN protein.

[0022] The ratio of porcine cells, BTK-gRNA2, BTK-gRNA4, and NCN protein is as follows: 100,000 porcine cells: 0.8-1.2 μg BTK-gRNA2: 0.8-1.2 μg BTK-gRNA4: 3-5 μg NCN protein.

[0023] The ratio of porcine cells, BTK-gRNA2, BTK-gRNA4, and NCN protein was as follows: 100,000 porcine cells: 1 μg BTK-gRNA2: 1 μg BTK-gRNA4: 4 μg NCN protein.

[0024] The BTK-gRNA2 described above is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 18.

[0025] Specifically, the BTK-gRNA2 is shown in SEQ ID NO: 18.

[0026] Specifically, the BTK-gRNA2 is shown in SEQ ID NO: 11.

[0027] The BTK-gRNA4 described above is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 19.

[0028] Specifically, the BTK-gRNA4 is shown in SEQ ID NO: 19.

[0029] Specifically, the BTK-gRNA4 is shown in SEQ ID NO: 13.

[0030] Any of the NCN proteins mentioned above is a Cas9 protein or a fusion protein containing a Cas9 protein.

[0031] Specifically, the NCN protein is shown in SEQ ID NO: 3.

[0032] The porcine cells mentioned above are porcine fibroblasts.

[0033] The porcine cells mentioned above are primary porcine fibroblasts.

[0034] The porcine cells mentioned above can specifically be primary fibroblasts of male pigs.

[0035] The method for preparing the NCN protein includes the following steps:

[0036] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria;

[0037] (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and induced at 25°C, and then the bacterial cells were collected.

[0038] (3) The collected bacterial cells were broken down to collect the crude protein solution;

[0039] (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography;

[0040] (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein.

[0041] The plasmid pKG-GE4 contains the fusion gene shown in nucleotides 5209-9852 of SEQ ID NO: 1.

[0042] The preparation method of the NCN protein specifically includes the following steps:

[0043] (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria.

[0044] (2) Inoculate the recombinant bacteria obtained in step (1) into liquid LB medium containing ampicillin and culture with shaking;

[0045] (3) Inoculate the bacterial culture obtained in step (2) into liquid LB medium and culture at 30°C with shaking at 230 rpm until OD. 600nm The value was 1.0, then IPTG was added to make the concentration in the system 0.5mM, and then the cells were cultured at 25℃ and 230rpm for 12 hours with shaking, and then the cells were collected by centrifugation.

[0046] (4) Take the bacterial cells obtained in step (3) and wash them with PBS buffer;

[0047] (5) Take the bacterial cells obtained in step (4), add crude extraction buffer and suspend the bacterial cells, then break the bacterial cells, then centrifuge and collect the supernatant, filter with a 0.22 μm pore size filter membrane and collect the filtrate;

[0048] (6) The His6-tagged fusion protein (the fusion protein shown in SEQ ID NO: 2) was purified from the filtrate obtained in step (5) by affinity chromatography;

[0049] (7) Take the column-passed solution collected in step (6), concentrate it using an ultrafiltration tube, and then dilute it with 25 mM Tris-HCl (pH 8.0);

[0050] (8) Add the recombinant bovine enterokinase with the His6 tag to the solution obtained in step (7) and digest it with enzymes;

[0051] (9) Mix the solution from step (8) with Ni-NTA resin, incubate, and then centrifuge to collect the supernatant.

[0052] (10) Take the supernatant obtained in step (9), concentrate it using an ultrafiltration tube, and then add it to the enzyme storage solution to obtain the NCN protein solution.

[0053] The specific method for purifying the His6-tagged fusion protein from the filtrate obtained in step (5) using affinity chromatography is as follows:

[0054] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in step (5) (flow rate: 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate: 1 ml / min) to remove contaminating proteins; then elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0055] The PRONCN protein described above comprises the following components from upstream to downstream: signal peptide, molecular chaperone protein, protein tag, protease cleavage site, nuclear localization signal, Cas9 protein, and nuclear localization signal.

[0056] The function of the signal peptide is to promote the secretory expression of a protein. The signal peptide can be selected from the Escherichia coli alkaline phosphatase (phoA) signal peptide, Staphylococcus aureus protein A signal peptide, Escherichia coli outer membrane protein (ompa) signal peptide, or any other prokaryotic gene signal peptide, preferably the alkaline phosphatase signal peptide (phoA signal peptide). The alkaline phosphatase signal peptide is used to guide the secretory expression of the target protein into the bacterial periplasmic lumen, thereby separating it from the intracellular protein. The target protein secreted into the bacterial periplasmic lumen is soluble and can be cleaved by the signal peptidase in the bacterial periplasmic lumen.

[0057] The function of the molecular chaperone protein is to increase the solubility of the protein. The molecular chaperone can be any protein that helps form disulfide bonds, preferably a thioreduction protein (TrxA protein). A thioreduction protein, acting as a molecular chaperone, helps the co-expressed target protein (e.g., Cas9 protein) form disulfide bonds, improving protein stability, correct folding, and increasing the solubility and activity of the target protein.

[0058] The protein tag is used for protein purification. The tag can be a His tag (His-Tag, His6 protein tag), GST tag, Flag tag, HA tag, c-Myc tag, or any other protein tag, with a His tag being more preferred. The His tag can bind to a Ni column, enabling one-step Ni column affinity chromatography to purify the target protein, greatly simplifying the purification process.

[0059] The function of the protease cleavage site is to cleave the non-functional segment after purification to release the native form of Cas9 protein. The protease can be selected from enterokinase, factor Xa, thrombin, TEV protease, HRV 3C protease, WELQut protease, or any other endopeptide, with enterokinase being more preferred. EK is an enterokinase cleavage site, facilitating the cleavage of the fused TrxA-His segment using enterokinase to obtain the native form of Cas9 protein. In this application, after cleaving the fusion protein with a His-tagged commercial enterokinase, the TrxA-His segment and the His-tagged enterokinase can be removed by a single affinity chromatography to obtain the native form of Cas9 protein, avoiding the damage and loss of the target protein caused by multiple purification dialysis processes.

[0060] The nuclear localization signal can be any nuclear localization signal, preferably the SV40 nuclear localization signal and / or the nucleoplasmin nuclear localization signal. The NLS is the nuclear localization signal; an NLS site is designed at both the N-terminus and C-terminus of Cas9, enabling Cas9 to more effectively enter the cell nucleus for gene editing.

[0061] The Cas9 protein may be saCas9 or spCas9, preferably spCas9 protein.

[0062] The PRONCN protein is shown in SEQ ID NO: 2.

[0063] Each of the above-mentioned specific plasmids comprises the following elements from upstream to downstream: promoter, operon, ribosome binding site, gene encoding PRONCN protein, and terminator.

[0064] The promoter may specifically be the T7 promoter. The T7 promoter is a strong prokaryotic expression promoter that can efficiently drive the expression of exogenous genes.

[0065] The operon can specifically be the Lac operon. The Lac operon is a regulatory element for lactose-induced expression. After the bacteria have grown to a certain number, the expression of the target protein can be induced by IPTG at low temperature, which can avoid the impact of premature expression of the target protein on the growth of the host bacteria. Induction at low temperature also significantly improves the solubility of the expressed target protein.

[0066] The ribosome binding site is the ribosome binding site during protein translation, which is essential for protein translation.

[0067] The terminator can specifically be a T7 terminator. The T7 terminator can effectively terminate gene transcription at the end of the target gene, preventing other downstream sequences outside the target gene from being transcribed and translated.

[0068] For the codons of spCas9 protein, this application has optimized the codons to fully adapt to the codon preferences of the high-efficiency E. coli expression strain E. coli BL21(DE3) selected in this application, thereby improving the expression level of Cas9 protein.

[0069] The T7 promoter is shown as nucleotides 5121-5139 in SEQ ID NO: 1.

[0070] The Lac operon is shown as nucleotides 5140-5164 in SEQ ID NO: 1.

[0071] The ribosome binding site is shown as nucleotides 5178-5201 in SEQ ID NO: 1.

[0072] The coding sequence of the alkaline phosphatase signal peptide is shown as nucleotides 5209-5271 in SEQ ID NO: 1.

[0073] The coding sequence of the TrxA protein is shown as nucleotides 5272-5598 in SEQ ID NO: 1.

[0074] The coding sequence of His-Tag is shown as nucleotides 5620-5637 in SEQ ID NO: 1.

[0075] The coding sequence of the enterokinase cleavage site is shown as nucleotides 5638-5652 in SEQ ID NO: 1.

[0076] The coding sequence of the nuclear localization signal is shown as nucleotides 5656-5670 in SEQ ID NO: 1.

[0077] The coding sequence of the spCas9 protein is shown as nucleotides 5701-9801 in SEQ ID NO: 1.

[0078] The coding sequence of the nuclear localization signal is shown as nucleotides 9802-9849 in SEQ ID NO: 1.

[0079] The T7 terminator is nucleotides 9902-9949 in SEQ ID NO: 1.

[0080] Specifically, the specific plasmid is plasmid pKG-GE4.

[0081] The plasmid pKG-GE4 contains the DNA molecule represented by nucleotides 5121-9949 of SEQ ID NO: 1.

[0082] Specifically, any of the plasmids pKG-GE4 described above is shown in SEQ ID NO: 1.

[0083] This invention also protects recombinant cells prepared by any of the methods described above.

[0084] The recombinant cells are recombinant cells with a mutation in the BTK gene.

[0085] The recombinant cells can specifically be hemizygous mutant single-cell clones that are not triplet mutations as shown in Table 1.

[0086] A non-3-fold mutation refers to a deletion mutation and / or insertion mutation in which the number of deleted and / or inserted nucleotides is not a multiple of 3.

[0087] This invention also protects the use of the recombinant cells in the preparation of a gamma globulin deficiency model pig.

[0088] Using the recombinant cells as nuclear transfer donor cells for somatic cell cloning, cloned pigs can be obtained, which are gamma globulin deficiency model pigs.

[0089] The present invention also protects porcine tissues of model pigs prepared using the recombinant cells, namely, a gamma globulin deficiency tissue model.

[0090] The present invention also protects porcine organs of model pigs prepared using the recombinant cells, namely, organ models of gamma globulin deficiency.

[0091] The present invention also protects porcine cells of model pigs prepared using the recombinant cells, namely, a gamma globulin deficiency cell model.

[0092] The present invention also protects the application of the recombinant cells, the gamma globulin deficiency tissue model, the gamma globulin deficiency organ model, the gamma globulin deficiency cell model, or the gamma globulin deficiency model pig, as follows (d1) or (d2) or (d3) or (d4):

[0093] (d1) Screening for drugs to treat hypogammaglobulinemia;

[0094] (d2) Efficacy evaluation of drugs for gamma globulin deficiency;

[0095] (d3) Evaluate the efficacy of gene therapy and / or cell therapy for agammaglobulinemia;

[0096] (d4) To study the pathogenesis of gamma globulin deficiency.

[0097] The pig mentioned above can specifically refer to the Congjiang Xiang pig.

[0098] The pig mentioned above can specifically be a male Congjiang Xiang pig.

[0099] Any of the above-mentioned gamma globulin deficiency is caused by a mutation in the BTK gene.

[0100] Porcine BTK gene information: Encodes Bruton's tyrosine kinase; located on the X chromosome; Gene ID is 100627308, Susscrofa.

[0101] The amino acid sequence encoded by the porcine BTK gene is shown in SEQ ID NO: 8.

[0102] The porcine BTK gene contains the DNA segment shown in SEQ ID NO: 9.

[0103] Any of the above-described mutations are deletions and / or insertions and / or substitutions of one or more nucleotides.

[0104] Any of the above-described mutations is the deletion of one or more nucleotides.

[0105] Any of the above mutations is an insertion of one or more nucleotides.

[0106] Any of the above-described mutations are deletions and insertions of one or more nucleotides.

[0107] Any of the above-mentioned gamma globulin deficiency is congenital gamma globulin deficiency.

[0108] Compared with the prior art, the present invention has at least the following beneficial effects:

[0109] (1) The research object of this invention (pig) has better applicability than other animals (mice, mice, primates).

[0110] Rodents such as mice and rats differ greatly from humans in body size, organ size, physiology, and pathology, making it impossible to realistically simulate normal human physiological and pathological states. Studies have shown that over 95% of drugs proven effective in mice and rats are ineffective in human clinical trials. Among large animals, primates are the closest relatives to humans, but they are small, reach sexual maturity late (mating begins at 6-7 years old), and are single-birth animals, resulting in extremely slow population expansion and high rearing costs. Furthermore, primate cloning is inefficient, difficult, and costly.

[0111] Pigs, as model animals, do not have the aforementioned drawbacks. Pigs are the closest relatives to humans besides primates, and their body size, weight, and organ size are similar to humans. They are also remarkably similar to humans in anatomy, physiology, immunology, nutritional metabolism, and disease pathogenesis. Furthermore, pigs reach sexual maturity early (4-6 months), have high reproductive capacity, produce multiple offspring per litter, and can form a large herd within 2-3 years. In addition, pig cloning technology is very mature, and the costs of cloning and raising pigs are much lower than for primates. Therefore, pigs are very suitable animals to serve as human disease models.

[0112] (2) The vector constructed in this invention uses the strong promoter T7-lac, which can efficiently express the target protein, to express the target protein. The signal peptide of bacterial periplasmic protein alkaline phosphatase (phoA) guides the secretion of the target protein into the bacterial periplasmic lumen, thereby separating it from intracellular proteins. The target protein secreted into the bacterial periplasmic lumen is soluble. Simultaneously, the thioreduction protein TrxA is fused with the Cas9 protein for expression. TrxA helps the co-expressed target protein form disulfide bonds, improving protein stability, correct folding, and increasing the solubility and activity of the target protein. To facilitate the purification of the target protein, a His tag is designed, allowing for one-step Ni column affinity chromatography purification of the target protein, greatly simplifying the purification process. Furthermore, an enterokinase cleavage site is designed after the His tag to facilitate the removal of the fused TrxA-His polypeptide fragment, yielding the native form of the Cas9 protein. After cleaving the fusion protein with a His-tagged enterokinase, the TrxA-His polypeptide fragment and the His-tagged enterokinase can be removed by a single affinity chromatography step, yielding the native form of Cas9 protein. This avoids the damage and loss to the target protein caused by multiple purification dialysis steps. Furthermore, this invention also designs an NLS site at the N-terminus and C-terminus of Cas9, enabling Cas9 to more effectively enter the cell nucleus for gene editing. Additionally, this invention selects E. coli BL21(DE3) as the target protein expression strain, which can efficiently express exogenous genes cloned into expression vectors containing the phage T7 promoter (such as pET-32a). Moreover, this invention optimizes the codons for the Cas9 protein to perfectly suit the codon preferences of the expression strain, thereby improving the expression level of the target protein. Furthermore, this invention induces the expression of the target protein with IPTG at low temperature after the bacteria have grown to a certain quantity, avoiding the impact of premature expression on host bacterial growth. Low-temperature induction also significantly improves the solubility of the expressed target protein. After the above-mentioned optimization design and experimental implementation, the activity of the obtained Cas9 protein was significantly improved compared with that of the commercial Cas9 protein.

[0113] (3) Gene editing was performed using the Cas9 high-efficiency protein constructed and expressed in this invention in combination with in vitro transcribed gRNA, and the optimal ratio of Cas9 and gRNA was optimized. The final rate of gene-edited single-cell clones was as high as 89.2%, which is much higher than the conventional gene editing efficiency (10-30%).

[0114] (4) Using the target gene knockout single-cell clone obtained by the present invention to perform somatic cell nuclear transfer animal cloning, the target gene knockout clone pig can be directly obtained, and the gene mutation can be stably inherited.

[0115] The method of microinjecting gene-edited material into fertilized eggs followed by embryo transfer, used in mouse model creation, has a relatively low probability of directly obtaining gene-mutated offspring, requiring crossbreeding and selection of offspring. This method is not suitable for creating models of large animals (such as pigs) with long gestation periods. Therefore, this invention employs a technically challenging method of primary cell in vitro editing, Cas9 protein and double gRNA cleavage, and screening for positively edited single-cell clones. Subsequently, somatic cell nuclear transfer animal cloning technology is used to directly obtain pig models of the corresponding disease. This significantly shortens the pig model creation cycle and saves manpower, material resources, and financial resources.

[0116] This invention utilizes CRISPR / Cas9 technology combined with dual gRNA editing to knock out the BTK gene, mimicking the natural pathogenesis and genetic characteristics of agammaglobulinemia. A single-cell clone with the BTK gene knockout was obtained, laying the foundation for later development of agammaglobulinemia model pigs using somatic cell nuclear transfer animal cloning technology. This invention will contribute to the research and elucidation of the pathogenesis of agammaglobulinemia caused by BTK gene dysfunction. It can also be used for drug screening, efficacy evaluation, gene therapy, and cell therapy research, providing effective experimental data for further clinical applications and thus offering a powerful experimental tool for the successful treatment of human agammaglobulinemia. This invention has significant application value for the development of drugs for agammaglobulinemia and for elucidating the pathogenesis of this disease. Attached Figure Description

[0117] Figure 1 This is a schematic diagram of the structure of plasmid pET-32a.

[0118] Figure 2 This is a schematic diagram of the structure of plasmid pKG-GE4.

[0119] Figure 3 This is an electrophoresis diagram showing the optimized ratio of gRNA to NCN protein in Example 3.

[0120] Figure 4 This is an electrophoresis diagram comparing the gene editing efficiency of NCN protein and commercial Cas9 protein in Example 3.

[0121] Figure 5 This is an electrophoresis image of PCR amplification performed using different primer pairs with genome extracted from ear tissue of pig No. 1 as a template in Example 4.

[0122] Figure 6 The image shows electrophoresis diagrams of PCR amplification performed in Example 4 using primer pairs consisting of BTK-E15-JDF42 and BTK-E15-JDR485, with genomic DNA from 18 pigs as templates.

[0123] Figure 7 This is an electrophoresis diagram comparing the editing efficiency of different target sites in Example 4.

[0124] Figure 8 The results of forward sequencing and wild-type sequence alignment of single-cell clone number 5 are shown.

[0125] Figure 9 The results of forward sequencing of single-cell clone number 1 are compared with wild-type sequences. Detailed Implementation

[0126] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0127] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available. The recombinant plasmids constructed in the examples have all been sequenced and verified. The commercially available Cas9-A protein is a commercially available, effective Cas9 protein. The commercially available Cas9-B protein is a commercially available, effective Cas9 protein. Complete culture medium (% by volume): 15% fetal bovine serum (Gibco) + 83% DMEM medium (Gibco) + 1% Penicillin-Streptomycin (Gibco) + 1% HEPES (Solarbio). Cell culture conditions: 37°C, incubator with 5% CO2 and 5% O2.

[0128] The primary porcine fibroblasts used in the examples were all prepared from newly formed ear tissue of Jiangxian pigs. The method for preparing primary porcine fibroblasts was as follows: ① Take 0.5g of pig ear tissue, remove hair and bone tissue, then soak in 75% alcohol for 30-40s, then wash 5 times with PBS buffer containing 5% (v / v) Penicillin-Streptomycin (Gibco), and then wash once with PBS buffer; ② Cut the tissue into small pieces with scissors, digest with 5mL of 0.1% collagenase solution (Sigma) at 37℃ for 1h, then centrifuge at 500g for 5min and discard the supernatant; ③ Resuspend the precipitate in 1mL of complete culture medium, then place it into a 10cm diameter cell culture dish containing 10mL of complete culture medium and sealed with 0.2% gelatin (VWR), and culture until the cells reach approximately 60% confluence with the bottom of the dish; ④ After completing step ③, digest with trypsin and collect the cells, then resuspend them in complete culture medium. These cells are then used for subsequent electroporation experiments.

[0129] Example 1: Construction of plasmids

[0130] I. Construction of plasmid pKG-GE3

[0131] The plasmid pKG-GE3 is a circular plasmid, as shown in SEQ ID NO: 2 of patent application 202010084343.6. (SEQ ID NO: 2 in patent application 202010084343.6) In NO:2, nucleotides 395-680 form the CMV enhancer, nucleotides 682-890 form the EF1a promoter, nucleotides 986-1006 encode the nuclear localization signal (NLS), nucleotides 1016-1036 encode the nuclear localization signal (NLS), nucleotides 1037-5161 encode the Cas9 protein, nucleotides 5162-5209 encode the nuclear localization signal (NLS), nucleotides 5219-5266 encode the nuclear localization signal (NLS), and nucleotides 5276-5332 encode the self-cleaving polypeptide P2A (the amino acid sequence of the self-cleaving polypeptide P2A is "ATNFSLLKQAGDVEENPGP", and the self-cleavage occurs at the following location: Nucleotides 5333-6046 (between the first and second amino acid residues at the C-terminus) encode the EGFP protein, nucleotides 6056-6109 encode the self-cleaving polypeptide T2A (the amino acid sequence of the self-cleaving polypeptide T2A is “EGRGSLLTCGDVEENPGP”, and the self-cleavage occurs between the first and second amino acid residues at the C-terminus), nucleotides 6110-6703 encode the Puromycin protein (abbreviated as Puro protein), nucleotides 6722-7310 form the WPRE sequence element, nucleotides 7382-7615 form the 3'LTR sequence element, and nucleotides 7647-7871 form the bGH poly(A)signal sequence element. In SEQ ID NO: 2 of patent application 202010084343.6, nucleotides 911-6706 form a fusion gene to express the fusion protein. Due to the presence of the self-cleaving peptide P2A and the self-cleaving peptide T2A, the fusion protein spontaneously forms the following three proteins: a protein with Cas9 protein, a protein with EGFP protein, and a protein with Puro protein.

[0132] II. Construction of plasmid pKG-U6gRNA

[0133] The pKG-U6gRNA vector, or plasmid pKG-U6gRNA, is a circular plasmid, as shown in SEQ ID NO: 3 of patent application 202010084343.6. In SEQ ID NO: 3 of patent application 202010084343.6, nucleotides 2280-2539 form the hU6 promoter, and nucleotides 2558-2637 are used for transcription to form the gRNA backbone. In use, a DNA molecule of approximately 20 bp (the target sequence binding region for gRNA transcription) is inserted into the plasmid pKG-U6gRNA to form a recombinant plasmid. The recombinant plasmid is then transcribed into gRNA in cells.

[0134] III. Construction of High-Efficiency Prokaryotic Cas9 Expression Vectors

[0135] A schematic diagram of the structure of plasmid pET-32a is shown below. Figure 1 .

[0136] Plasmid pKG-GE4 was obtained by modifying plasmid pET-32a. Plasmid pET32a-T7lac-phoA:SP-TrxA-His-EK-NLS-spCas9-NLS-T7ter (abbreviated as plasmid pKG-GE4), as shown in SEQ ID NO: 1, is a circular plasmid; its structural diagram is shown below. Figure 2 .

[0137] In SEQ ID NO: 1, nucleotides 5121-5139 form the T7 promoter, nucleotides 5140-5164 encode the Lac operator, nucleotides 5178-5201 form the ribosome binding site (RBS), nucleotides 5209-5271 encode the alkaline phosphatase signal peptide (phoA signal peptide), nucleotides 5272-5598 encode the TrxA protein, nucleotides 5620-5637 encode the His-Tag (also known as the His6 tag), nucleotides 5638-5652 encode the enterokinase cleavage site (EK cleavage site), nucleotides 5656-5670 encode the nuclear localization signal, nucleotides 5701-9801 encode the spCas9 protein, nucleotides 9802-9849 encode the nuclear localization signal, and nucleotides 9902-9949 form the T7 terminator. The nucleotides encoding the spCas9 protein have been codon-optimized for Escherichia coli BL21(DE3) strain.

[0138] The main modifications to plasmid pKG-GE4 are as follows: ① The coding region of the TrxA protein was retained. The TrxA protein can help the expressed target protein form disulfide bonds, increasing the solubility and activity of the target protein. An alkaline phosphatase signal peptide coding sequence was added before the TrxA protein coding region. The alkaline phosphatase signal peptide can guide the expressed target protein to be secreted into the bacterial periplasmic lumen and can be cleaved by prokaryotic periplasmic signal peptidase. ② A His-Tag coding sequence was added after the TrxA protein coding sequence. The His-Tag can be used for... Enrichment of the target protein; ③ Add the coding sequence of the enterokinase cleavage site DDDDK (Asp-Asp-Asp-Asp-Lys) downstream of the His-Tag coding sequence. The purified protein will remove His-Tag and the upstream fused TrxA protein under the action of enterokinase; ④ Insert the Cas9 gene of suitable Escherichia coli BL21(DE3) strain with optimized codons, and add nuclear localization signal coding sequences upstream and downstream of this gene to increase the nuclear localization ability of the purified Cas9 protein in the later stage.

[0139] The fusion gene in plasmid pKG-GE4, as shown in nucleotides 5209-9852 of SEQ ID NO: 1, encodes the fusion protein shown in SEQ ID NO: 2 (fusion protein TrxA-His-EK-NLS-spCas9-NLS, abbreviated as PRONCN protein). Due to the presence of alkaline phosphatase signal peptide and enterokinase cleavage site, the fusion protein is cleaved by enterokinase to form the protein shown in SEQ ID NO: 3. The protein shown in SEQ ID NO: 3 is named NCN protein.

[0140] Example 2: Preparation and purification of NCN protein

[0141] I. Induced Expression

[0142] 1. Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria.

[0143] 2. Inoculate the recombinant bacteria obtained in step 1 into liquid LB medium containing 100 μg / ml ampicillin and culture overnight at 37°C with shaking at 200 rpm.

[0144] 3. Inoculate the bacterial culture obtained in step 2 into liquid LB medium and incubate at 30°C with shaking at 230 rpm until OD reaches 100%. 600nm The concentration was set to 1.0, then isopropyl thiogalactoside (IPTG) was added to a concentration of 0.5 mM in the system. The mixture was then cultured at 25°C and 230 rpm for 12 hours with shaking. Finally, the cells were collected by centrifugation at 4°C and 10,000 g for 15 minutes.

[0145] 4. Take the bacterial cells obtained in step 3 and wash them with PBS buffer.

[0146] II. Purification of the fusion protein TrxA-His-EK-NLS-spCas9-NLS

[0147] 1. Take the bacterial cells obtained in step one, add crude extraction buffer and suspend the bacterial cells, then homogenize the bacterial cells using a homogenizer (1000 rpm for three cycles), then centrifuge at 4°C and 15000g for 30 min, collect the supernatant, filter the supernatant through a 0.22μm pore size filter membrane, and collect the filtrate. In this step, 10 ml of crude extraction buffer is prepared for every gram of wet bacterial cells.

[0148] Crude extraction buffer: containing 20mM Tris-HCl (pH 8.0), 0.5M NaCl, 5mM Imidazole, 1mM PMSF, with the balance being ddH2O.

[0149] 2. Affinity chromatography was used to purify the fusion protein.

[0150] First, equilibrate the Ni-NTA agarose column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then load 50 ml of the filtrate obtained in step 1 (flow rate: 0.5-1 ml / min); then wash the column with 5 column volumes of equilibration buffer (flow rate: 1 ml / min); then wash the column with 5 column volumes of buffer (flow rate: 1 ml / min) to remove contaminating proteins; finally, elute with 10 column volumes of elution buffer at a flow rate of 0.5-1 ml / min, and collect the post-column solution (90-100 ml).

[0151] Ni-NTA agarose column: GenScript, L00250 / L00250-C, 10ml packing material.

[0152] Equilibrium solution: contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 5 mM Imidazole, and the balance is ddH2O.

[0153] Buffer solution: containing 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 50 mM Imidazole, with the balance being ddH2O.

[0154] Eluent: Contains 20 mM Tris-HCl (pH 8.0), 0.5 M NaCl, 500 mM Imidazole, and the balance is ddH2O.

[0155] III. Enzymatic digestion of the fusion protein TrxA-His-EK-NLS-spCas9-NLS and purification of the NCN protein

[0156] 1. Take 15 ml of the post-column solution collected in step 2, concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, 15 ml capacity), and then dilute it to 1 ml with 25 mM Tris-HCl (pH 8.0). Use 6 ultrafiltration tubes to obtain a total of 6 ml.

[0157] 2. Add the commercially available His6-tagged recombinant bovine enterokinase (Sangon Biotech, C620031, Recombinant Bovine Enterokinase Light Chain, His6-tagged) to the solution obtained in step 1 (approximately 6 ml), and digest at 25°C for 16 hours. Add 2 units of enterokinase per 50 μg of protein.

[0158] 3. Take the solution from step 2 (about 6 ml), mix it with 480 μl of Ni-NTA resin (GenScript, L00250 / L00250-C), mix by rotation at room temperature for 15 min, then centrifuge at 7000 g for 3 min, and collect the supernatant (4-5.5 ml).

[0159] 4. Take the supernatant obtained in step 3 and concentrate it to 200 μl using an Amicon ultrafiltration tube (Sigma, UFC9100, capacity 15 ml). Then add it to the enzyme storage solution and adjust the protein concentration to 5 mg / ml to obtain the NCN protein solution.

[0160] Sequencing revealed that the N-terminal 15 amino acid residues in the NCN protein solution are as shown in positions 1 to 15 of SEQ ID NO: 3, which is the NCN protein.

[0161] The NCN protein used in subsequent embodiments was provided by an NCN protein solution.

[0162] Enzyme stock solution (pH 7.4): contains 10 mM Tris, 300 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 50% (v / v) glycerol, with the balance being ddH2O.

[0163] Example 3: Performance of NCN protein

[0164] The following two gRNA targets targeting the TTN gene were selected:

[0165] TTN-gRNA1: AGAGCACAGTCAGCCTGGCG;

[0166] TTN-gRNA2:CTTCCAGAATTGGATCTCCG.

[0167] The primers used to identify target fragments containing gRNA from the TTN gene are as follows:

[0168] TTN-F55: TACGGAATTGGGGAGCCAGCGGA;

[0169] TTN-R560: CAAAGTTAACTCTCTGTGTCT.

[0170] I. Preparation of gRNA

[0171] 1. Preparation of TTN-T7-gRNA1 and TTN-T7-gRNA2 transcription templates

[0172] The TTN-T7-gRNA1 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 4.

[0173] The TTN-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 5.

[0174] 2. Obtain gRNA through in vitro transcription

[0175] Using TTN-T7-gRNA1 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The TTN-gRNA1 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA1 is a single-stranded RNA, as shown in SEQ ID NO: 6.

[0176] Using TTN-T7-gRNA2 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The TTN-gRNA2 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). TTN-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 7.

[0177] II. Optimization of the ratio of gRNA to NCN protein

[0178] 1. Co-transfection of porcine primary fibroblasts

[0179] Group 1: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 0.5 μg TTN-gRNA1 : 0.5 μg TTN-gRNA2 : 4 μg NCN protein.

[0180] Group 2: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 0.75 μg TTN-gRNA1 : 0.75 μg TTN-gRNA2 : 4 μg NCN protein.

[0181] Group 3: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg NCN protein.

[0182] Group 4: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. The ratio was approximately 100,000 porcine primary fibroblasts: 1.25 μg TTN-gRNA1 : 1.25 μg TTN-gRNA2 : 4 μg NCN protein.

[0183] Group 5: TTN-gRNA1 and TTN-gRNA2 were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1: 1 μg TTN-gRNA2.

[0184] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0185] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0186] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0187] See electrophoresis image Figure 3The 505bp band is the wild-type band (WT), and the band around 254bp (the wild-type band theoretically has a deletion of 251bp) is the deletion mutation band (MT).

[0188] Gene deletion mutation efficiency = (MT gray level / MT band bp) / (WT gray level / WT band bp + MT gray level / MT band bp) × 100%. The gene deletion mutation efficiency of the first group is 19.9%, the gene deletion mutation efficiency of the second group is 39.9%, the gene deletion mutation efficiency of the third group is 79.9%, and the gene deletion mutation efficiency of the fourth group is 44.3%. No mutation occurred in the fifth group.

[0189] The results showed that the gene editing efficiency was highest when the mass ratio of the two gRNAs to the NCN protein was 1:1:4, and the actual dosage was 1 μg:1 μg:4 μg. Therefore, the optimal dosage of the two gRNAs to the NCN protein was determined to be 1 μg:1 μg:4 μg.

[0190] III. Comparison of gene editing efficiency between NCN protein and commercial Cas9 protein

[0191] 1. Co-transfection of porcine primary fibroblasts

[0192] Cas9-A group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-A protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-A protein.

[0193] pKG-GE4 group: TTN-gRNA1, TTN-gRNA2, and NCN protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg NCN protein.

[0194] Cas9-B group: TTN-gRNA1, TTN-gRNA2, and commercial Cas9-B protein were co-transfected into porcine primary fibroblasts. Ratio: approximately 100,000 porcine primary fibroblasts : 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2 : 4 μg Cas9-B protein.

[0195] Control group: porcine primary fibroblasts were co-transfected with TTN-gRNA1 and TTN-gRNA2. Ratio: approximately 100,000 porcine primary fibroblasts: 1 μg TTN-gRNA1 : 1 μg TTN-gRNA2.

[0196] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0197] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0198] 3. After completing step 2, cells were digested and collected with trypsin, genomic DNA was extracted, and PCR amplification was performed using primers consisting of TTN-F55 and TTN-R560, followed by 1% agarose gel electrophoresis.

[0199] See electrophoresis image Figure 4 The gene deletion mutation efficiency using commercial Cas9-A protein was 28.5%, that using NCN protein was 85.6%, and that using commercial Cas9-B protein was 16.6%.

[0200] The results showed that, compared with commercially available Cas9 protein, the NCN protein prepared using this invention significantly improved gene editing efficiency.

[0201] Example 4: Screening for highly efficient gRNA targets of the BTK gene

[0202] Porcine BTK gene information: Encodes Bruton's tyrosine kinase; located on the X chromosome; Gene ID: 100627308, Susscrofa. The amino acid sequence of the protein encoded by the porcine BTK gene is shown in SEQ ID NO: 8. In the porcine genomic DNA, the BTK gene has 19 exons, and a partial sequence (including exon 15 and 400 bp upstream and downstream) is shown in SEQ ID NO: 9.

[0203] I. Conservation analysis of the pre-defined deletion region of the BTK gene and adjacent genomic sequences

[0204] Eighteen newborn Congjiang Xiang pigs were selected, including 10 females (named 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10) and 8 males (named A, B, C, D, E, F, G, and H).

[0205] BTK-E15-JDF42:AACTTGTTACTATGGTCCCTTAT;

[0206] BTK-E15-JDR413:TTGGACCCAGGCTAATCCTTCTG;

[0207] BTK-E15-JDF81: AGGCCAACTCCTTTCCTCCCAAG;

[0208] BTK-E15-JDR485: GAAATGATGTTCCAACAACCCT.

[0209] Genomic DNA was extracted from ear tissue of pig genotype 1 as a template. PCR amplification was performed using different primer pairs, followed by 1% agarose gel electrophoresis. See the electrophoresis image below. Figure 5 . Figure 5 In the study, primer pairs were used in four groups: Group 1: BTK-E15-JDF42 and BTK-E15-JDR413; Group 2: BTK-E15-JDF42 and BTK-E15-JDR485; Group 3: BTK-E15-JDF81 and BTK-E15-JDR413; and Group 4: BTK-E15-JDF81 and BTK-E15-JDR485. The results showed that the primer pair consisting of BTK-E15-JDF42 and BTK-E15-JDR485 was preferred for amplifying the target fragment.

[0210] Using genomic DNA from 18 pigs as templates, PCR amplification was performed using primer pairs consisting of BTK-E15-JDF42 and BTK-E15-JDR485, followed by 1% agarose gel electrophoresis. (See electrophoresis image below.) Figure 6 PCR amplification products were recovered and sequenced. The sequencing results were compared and analyzed with BTK gene sequences in public databases. Conserved regions common to 18 pigs were selected for gRNA target design.

[0211] II. Target Screening

[0212] Several targets were initially screened by NGG (avoiding possible mutation sites), and 6 targets were further screened out after preliminary experiments.

[0213] The six target points are as follows:

[0214] BTK-E15-gRNA1:CAGCTGCACCAGCTTCTCGT;

[0215] BTK-E15-gRNA2:TCTCCCTCAGGTAGTTCAGG;

[0216] BTK-E15-gRNA3: CTGCCTCCTGAACTACCTGA;

[0217] BTK-E15-gRNA4:GCAGCTGCTGGAGATGTGCA;

[0218] BTK-E15-gRNA5:ATCACTGAGTACATGGCCAA;

[0219] BTK-E15-gRNA6: GTAGTTCAGGAGGCAGCCAT.

[0220] III. Preparation of gRNA

[0221] The pKG-U6gRNA plasmid was digested with restriction endonuclease BbsI, and the vector backbone (a large linear fragment of about 3kb) was recovered.

[0222] BTK-E15-gRNA1-S and BTK-E15-gRNA1-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (BTK-E15-gRNA1). Plasmid pKG-U6gRNA (BTK-E15-gRNA1) expresses the expression shown in SEQ ID NO: 10.

[0223] sgRNA BTK-E15-gRNA1 .

[0224] sgRNA BTK-E15-gRNA1 (SEQ ID NO: 10):

[0225] CAGCUGCACCAGCUUCUCGUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0226] BTK-E15-gRNA2-S and BTK-E15-gRNA2-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (BTK-E15-gRNA2). Plasmid pKG-U6gRNA (BTK-E15-gRNA2) was expressed as shown in SEQ ID NO: 11.

[0227] sgRNA BTK-E15-gRNA2 .

[0228] sgRNA BTK-E15-gRNA2 (SEQ ID NO: 11):

[0229] UCUCCCUCAGGUAGUUCAGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0230] BTK-E15-gRNA3-S and BTK-E15-gRNA3-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (BTK-E15-gRNA3). Plasmid pKG-U6gRNA (BTK-E15-gRNA3) expresses the expression shown in SEQ ID NO: 12.

[0231] sgRNA BTK-E15-gRNA3 .

[0232] sgRNA BTK-E15-gRNA3 (SEQ ID NO: 12):

[0233] CUGCCUCCUGAACUACCUGAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0234] BTK-E15-gRNA4-S and BTK-E15-gRNA4-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (BTK-E15-gRNA4). Plasmid pKG-U6gRNA (BTK-E15-gRNA4) expresses the expression shown in SEQ ID NO: 13.

[0235] sgRNA BTK-E15-gRNA4 .

[0236] sgRNA BTK-E15-gRNA4 (SEQ ID NO: 13):

[0237] GCAGCUGCUGGAGAUGUGCAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0238] BTK-E15-gRNA5-S and BTK-E15-gRNA5-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (BTK-E15-gRNA5). Plasmid pKG-U6gRNA (BTK-E15-gRNA5) was expressed as shown in SEQ ID NO: 14.

[0239] sgRNA BTK-E15-gRNA5 .

[0240] sgRNA BTK-E15-gRNA5 (SEQ ID NO: 14):

[0241] AUCACUGAGUACAUGGCCAAguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0242] BTK-E15-gRNA6-S and BTK-E15-gRNA6-A were synthesized separately, then mixed and annealed to obtain a double-stranded DNA molecule with sticky ends. The sticky-ended double-stranded DNA molecule was ligated to a vector backbone to obtain plasmid pKG-U6gRNA (BTK-E15-gRNA6). Plasmid pKG-U6gRNA (BTK-E15-gRNA6) expresses the expression shown in SEQ ID NO: 15.

[0243] sgRNA BTK-E15-gRNA6 .

[0244] sgRNA BTK-E15-gRNA6 (SEQ ID NO: 15):

[0245] GUAGUUCAGGAGGCAGCCAUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuu

[0246] BTK-E15-gRNA1-S:caccgCAGCTGCACCAGCTTCTCGT;

[0247] BTK-E15-gRNA1-A:aaacACGAGAAGCTGGTGCAGCTGc;

[0248] BTK-E15-gRNA2-S: caccgTCTCCCTCAGGTAGTTCAGG;

[0249] BTK-E15-gRNA2-A:aaacCCTGAACTACCTGAGGGAGAc;

[0250] BTK-E15-gRNA3-S:caccgCTGCCTCCTGAACTACCTGA;

[0251] BTK-E15-gRNA3-A:aaacTCAGGTAGTTCAGGAGGCAGc;

[0252] BTK-E15-gRNA4-S:caccGCAGCTGCTGGAGATGTGCA;

[0253] BTK-E15-gRNA4-A:aaacTGCACATCTCCAGCAGCTGC;

[0254] BTK-E15-gRNA5-S:caccgATCACTGAGTACATGGCCAA;

[0255] BTK-E15-gRNA5-A:aaacTTGGCCATGTACTCAGTGATc;

[0256] BTK-E15-gRNA6-S: caccGTAGTTCAGGAGGCAGCCAT;

[0257] BTK-E15-gRNA6-A:aaacATGGCTGCCTCCTGAACTAC.

[0258] BTK-E15-gRNA1-S, BTK-E15-gRNA1-A, BTK-E15-gRNA2-S, BTK-E15-gRNA2-A, BTK-E15-gRNA3-S, BTK-E15-gRNA3-A, BTK-E15-gRNA4-S, BTK-E15-gRNA4-A, BTK-E15-gRNA5-S, BTK-E15-gRNA5-A, BTK-E15-gRNA6-S, and BTK-E15-gRNA6-A are all single-stranded DNA molecules.

[0259] IV. Comparison of editing efficiency for different target combinations

[0260] 1. Co-transfection

[0261] Group 1: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (BTK-E15-gRNA1) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (BTK-E15-gRNA1): 1.08 μg of plasmid pKG-GE3.

[0262] Group 2: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (BTK-E15-gRNA2) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (BTK-E15-gRNA2): 1.08 μg of plasmid pKG-GE3.

[0263] Group 3: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (BTK-E15-gRNA3) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (BTK-E15-gRNA3): 1.08 μg of plasmid pKG-GE3.

[0264] Group 4: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (BTK-E15-gRNA4) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (BTK-E15-gRNA4): 1.08 μg of plasmid pKG-GE3.

[0265] Group 5: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (BTK-E15-gRNA5) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (BTK-E15-gRNA5) : 1.08 μg of plasmid pKG-GE3.

[0266] Group 6: Porcine primary fibroblasts were co-transfected with plasmid pKG-U6gRNA (BTK-E15-gRNA6) and plasmid pKG-GE3. The ratio was approximately 200,000 porcine primary fibroblasts: 0.92 μg of plasmid pKG-U6gRNA (BTK-E15-gRNA6): 1.08 μg of plasmid pKG-GE3.

[0267] Group 7: Porcine primary fibroblasts were electroporated without plasmids using the same electroporation parameters.

[0268] Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0269] 2. After completing step 1, incubate in complete culture medium for 12-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0270] 3. After completing step 2, cells were digested and collected using trypsin, lysed, and genomic DNA was extracted. PCR amplification was performed using primer pairs consisting of BTK-E15-JDF42 and BTK-E15-JDR485, followed by 1% agarose gel electrophoresis. The mutation status of target genes in the cells was detected. See the electrophoresis image below. Figure 7 .

[0271] After gel extraction and recovery of the target product, it was sent to a sequencing company for sequencing. The sequencing results were then analyzed using the web-based Synthego ICE tool to determine the gene editing efficiency of different targets. The gene editing efficiencies of groups one through six were 15%, 45%, 31%, 58%, 27%, and 29%, respectively, while no gene editing occurred in group seven. The results indicate that BTK-E15-gRNA2 and BTK-E15-gRNA4 have high editing efficiencies.

[0272] Example 5: Preparation of a BTK gene knockout Congjiang Xiang pig single-cell clone

[0273] Two highly efficient gRNA targets (BTK-E15-gRNA2 and BTK-E15-gRNA4) selected from Example 4 were chosen.

[0274] I. Preparation of gRNA

[0275] 1. Preparation of BTK-T7-gRNA2 and BTK-T7-gRNA4 transcription templates

[0276] The BTK-T7-gRNA2 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 16.

[0277] The BTK-T7-gRNA4 transcription template is a double-stranded DNA molecule, as shown in SEQ ID NO: 17.

[0278] 2. Obtain gRNA through in vitro transcription

[0279] Using a BTK-T7-gRNA2 transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The BTK-gRNA2 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). BTK-gRNA2 is a single-stranded RNA, as shown in SEQ ID NO: 18.

[0280] BTK-gRNA2 (SEQ ID NO: 18):

[0281] GGUCUCCCUCAGGUAGUUCAGGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU

[0282] Using BTK-T7-gRNA4 as a transcription template, in vitro transcription was performed using the Transcript Aid T7 High Yield Transcription Kit (Fermentas, K0441), followed by MEGA clearing. TM The BTK-gRNA4 was recovered and purified using a Transcription Clean-Up Kit (Thermo, AM1908). BTK-gRNA4 is a single-stranded RNA, as shown in SEQ ID NO: 19.

[0283] BTK-gRNA4 (SEQ ID NO: 19):

[0284] GGGCAGCUGCUGGAGAUGUGCAGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU

[0285] II. Transfection of porcine primary fibroblasts

[0286] 1. BTK-gRNA2, BTK-gRNA4, and NCN protein were co-transfected into primary porcine fibroblasts (male nascent porcine cells obtained from the ear tissue of Jiangxiang pigs). The ratio was approximately 100,000 primary porcine fibroblasts: 1 μg BTK-gRNA2 : 1 μg BTK-gRNA4 : 4 μg NCN protein. Co-transfection was performed using electroporation with a mammalian nuclear transfection kit (Neon kit, Thermofisher) and a Neon™ transfection system (parameters set to 1450V, 10ms, 3 pulses).

[0287] 2. After completing step 1, incubate in complete culture medium for 16-18 hours, then replace with fresh complete culture medium. The total incubation time after electroporation is 48 hours.

[0288] 3. After completing step 2, digest and collect cells with trypsin, wash with complete culture medium, resuspend in complete culture medium, and then pick each single clone and transfer it to a 96-well plate (1 cell per well, 100 μl of complete culture medium per well) and culture for 2 weeks (replace with fresh complete culture medium every 2-3 days).

[0289] 4. After completing step 3, digest the cells with trypsin and collect them (about 2 / 3 of the cells obtained from each well are seeded into a 6-well plate containing complete culture medium, and the remaining 1 / 3 are collected in a 1.5 mL centrifuge tube).

[0290] 5. Take the 6-well plate from step 4, culture until the cells reach 80% confluence, digest with trypsin and collect the cells, and freeze the cells using cell cryopreservation solution (90% complete culture medium + 10% DMSO, volume ratio).

[0291] 6. Take the centrifuge tube from step 4, collect the cells, lyse the cells and extract genomic DNA. Perform PCR amplification using primers consisting of BTK-E15-JDF42 and BTK-E15-JDR485, followed by electrophoresis. Use porcine primary fibroblasts as wild-type controls (WT).

[0292] 7. After completing step 6, recover the PCR amplification products and sequence them.

[0293] The porcine BTK gene is located on the X chromosome; its allele is not present on the Y chromosome. Primary porcine fibroblasts are derived from male newborn Congjiang Xiang pigs. Therefore, the BTK gene-based genotype of these primary porcine fibroblasts, or recombinant cells derived from them, is either wild-type or mutant, and does not contain heterozygous cells.

[0294] The genotype of the primary porcine fibroblasts is wild-type (denoted as WT / Y, where Y represents the Y chromosome). If the sequencing results of a single-cell clone show a mutation compared to the sequencing results of the primary porcine fibroblasts (mutations include deletions, insertions, or substitutions of one or more nucleotides), the genotype of that single-cell clone is hemizygous mutant; if the sequencing results of a single-cell clone are consistent with the sequencing results of the primary porcine fibroblasts, the genotype of that single-cell clone is wild-type.

[0295] The results are shown in Table 1. Single-cell clones numbered 5, 8, 20, and 27 had wild-type genotypes. Single-cell clones numbered 1, 2, 3, 4, 6, 7, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 21, 22, 23, 24, 25, 26, 28, 29, 30, 31, 32, 33, 34, 35, 36, and 37 had hemizygous mutant genotypes. The success rate of obtaining BTK gene-edited single-cell clones was 89.2%.

[0296] Example sequencing alignment results are as follows Figure 8 and Figure 9 . Figure 8 The result is the alignment of the forward sequencing of single-cell clone number 5 with the wild-type sequence, and it is determined to be wild-type. Figure 9 The result is the alignment of the forward sequencing of single-cell clone number 1 with the wild-type sequence, which indicates that it is a hemizygous mutant.

[0297] Table 1. Genotyping results of BTK gene-edited single-cell clones

[0298]

[0299]

[0300] The hemizygous mutant single-cell clones with non-triple mutations listed in Table 1 can be used for subsequent cloned pig production. Using these cells as nuclear transfer donor cells for somatic cell cloning yields cloned pigs, specifically gamma globulin deficiency model pigs. A non-triple mutation refers to a deletion and / or insertion mutation where the number of deleted and / or inserted nucleotides is not a multiple of three.

[0301] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims. sequence list <110> Nanjing Qizhen Gene Engineering Co., Ltd. <120> Gene editing system for constructing a model of congenital agammaglobulinemia using porcine nuclear transplantation donor cells and its application <130> GNCYX213211 <160> 19 <170> SIPOSequenceListing 1.0 <210> 1 <211> 9974 <212> DNA <213> Artificial Sequence <400> 1 tggcgaatgg gacgcgccct gtagcggcgc attaagcgcg gcgggtgtgg tggttacgcg 60 cagcgtgacc gctacacttg ccagcgccct agcgcccgct cctttcgctt tcttcccttc 120 ctttctcgcc acgttcgccg gctttccccg tcaagctcta aatcgggggc tccctttagg 180 gttccgattt agtgctttac ggcacctcga ccccaaaaaa cttgattagg gtgatggttc 240 acgtagtggg ccatcgccct gatagacggt ttttcgccct ttgacgttgg agtccacgtt 300 ctttaatagt ggactcttgt tccaaactgg aacaacactc aaccctatct cggtctattc 360 ttttgattta taagggattt tgccgatttc ggcctattgg ttaaaaaatg agctgattta 420 acaaaaattt aacgcgaatt ttaacaaaat attaacgttt acaatttcag gtggcacttt 480 tcggggaaat gtgcgcggaa cccctatttg tttatttttc taaatacatt caaatatgta 540 tccgctcatg agacaataac cctgataaat gcttcaataa tattgaaaaa ggaagagtat 600 gagtattcaa catttccgtg tcgcccttat tccctttttt gcggcatttt gccttcctgt 660 ttttgctcac ccagaaacgc tggtgaaagt aaaagatgct gaagatcagt tgggtgcacg 720 agtgggttac atcgaactgg atctcaacag cggtaagatc cttgagagtt ttcgccccga 780 agaacgtttt ccaatgatga gcacttttaa agttctgcta tgtggcgcgg tattatcccg 840 tattgacgcc gggcaagagc aactcggtcg ccgcatacac tattctcaga atgacttggt 900 tgagtactca ccagtcacag aaaagcatct tacggatggc atgacagtaa gagaattatg 960 cagtgctgcc ataaccatga gtgataacac tgcggccaac ttacttctga caacgatcgg 1020 aggaccgaag gagctaccg cttttgca siacatgggg gatcatgtaa ctcgccttga 1080 tcgttgggaa ccggagctga atgaagccat accaacgac gagcgtgaca ccacgatgcc 1140 tgcagcaatg gcacaacgt tgcgcaacct atttactggc gaactactta ctctagcttc 1200 ccggcaacaa ttatagact ggatggaggc ggataagtt gcaggaccac ttctgcgctc 1260 ggcccttccg gctggctggt ttattgctga taaatctgga gccggtgagc gtgggtctcg 1320 cggtatcatt gcagcactgg ggccagatgg taagccctcc cgtatcgtag ttactacac 1380 gacggggagt caggcaacta tggatgaacg aaatagacag atcgctgaga taggtgccctc 1440 actgattaag cattggtaac tgtcagacca agtttactca tatatacttt agattgattt 1500 aaaacttcat ttttaattta aaaggatcta ggtgagatc cttttgata atctcatgac 1560 caaaatccct taacgtgagt ttcgttcca ctgagcgtca gaccccgtag aaagatcaa 1620 aggatctct tgagatcctt ttttctgcg cgtaatctcc tgcttgcaa CAaaaaacc 1680 accgctacca gcggtggtt gtttgccgga tcagagcta ccaaccttt ttccgaggt 1740 aactggcttc agcagagcgc agataccaaa tactgtcctt ctagtgtagc cgtagttagg 1800 ccaccacttc aagaactctg tagcaccgcc tacatacctc gctctgctaa tcctgttacc 1860 agtggctgct gccagtggcg ataagtcgtg tcttaccggg ttggactcaa gacgatagtt 1920 accggataag gcgcagcggt cgggctgaac ggggggttcg tgcacacagc ccagcttgga 1980 gcgaacgacc tacaccgaac tgagatacct acagcgtgag ctatgagaaa gcgccacgct 2040 tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc agggtcggaa caggagagcg 2100 cacgagggag cttccagggg gaaacgcctg gtatctttat agtcctgtcg ggtttcgcca 2160 cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg gggcggagcc tatggaaaaa 2220 cgccagcaac gcggcctttt tacggttcct ggccttttgc tggccttttg ctcacatgtt 2280 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 2340 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 2400 gcgcctgatg cggtattttc tccttacgca tctgtgcggt atttcacacc gcatatatgg 2460 tgcactctca gtacaatctg ctctgatgcc gcatagttaa gccagtatac actccgctat 2520 cgctacgtga ctgggtcatg gctgcgcccc gacacccgcc aacacccgct gacgcgccct 2580 gacgggcttg tctgctcccg gcatccgctt acagacaagc tgtgaccgtc tccgggagct 2640 gcatgtgtca gaggttttca ccgtcatcac cgaaacgcgc gaggcagctg cggtaaagct 2700 catcagcgtg gtcgtgaagc gattcacaga tgtctgcctg ttcatccgcg tccagctcgt 2760 tgagtttctc cagaagcgtt aatgtctggc ttctgataaa gcgggccatg ttaagggcgg 2820 ttttttcctg tttggtcact gatgcctccg tgtaaggggg atttctgttc atgggggtaa 2880 tgataccgat gaaacgagag aggatgctca cgatacgggt tactgatgat gaacatgccc 2940 ggttactgga acgttgtgag ggtaaacaac tggcggtatg gatgcggcgg gaccagagaa 3000 aaatcactca gggtcaatgc cagcgcttcg ttaatacaga tgtaggtgtt ccacagggta 3060 gccagcagca tcctgcgatg cagatccgga acataatggt gcagggcgct gacttccgcg 3120 tttccagact ttacgaaaca cggaaaccga agaccattca tgttgttgct caggtcgcag 3180 acgtttttgca gcagcagtcg cttcacgttc gctcgcgtat cggtgattca ttctgctaac 3240 cattaaggca acccccgccag cctagccggg tcctcaacga caggagcacg atcatgcgca 3300 cccgtggggc cgccatgccg gcgataatgg cctgcttctc gccgaaacgt ttggtggcgg 3360 gaccagtgac gaaggcttga gcgagggcgt gcaagattcc gaataccgca agcgacaggc 3420 cgatcatcgt cgcgctccag cgaaagcggt cctcgccgaa aatgacccag agcgctgccg 3480 gcacctgtcc tacgagttgc atgataaaga agacagtcat aagtgcggcg acgatagtca 3540 tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag 3600 atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 3660 tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 3720 gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 3780 tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 3840 cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 3900 tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3960 atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 4020 atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 4080 tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 4140 cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 4200 aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg 4260 ttgatgggtg tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct 4320 tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt 4380 tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 4440 gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc 4500 gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 4560 gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 4620 ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccaccgggga aacggtctga 4680. taagagacac cggcatactc tgcgacatcg fathercgtta ctggtttcac attcaccacc ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 4800. atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga agcagcccag 4860 tagtagttg aggccgttga gcaccgccgc cgcaaggaat ggtgcatgca aggagatggc 4920 gcccaacagt cccccggcca cggggcctgc caccataccc acgccgaaac aagcgctcat 4980. gagcccgaag tggcgagccc gatcttcccc atcggtgatg tcggcgatat aggcgccagc 5040. aaccgcacct gtggcgccgg tgatgccggc cacgatgcgt ccggcgtaga ggatcgagat 5100 cgatctcgat cccgcgaat fathercgact cactataggg gaattgtgag cggataacaa ttcccctcta gaataattt tgtttaactt taagaaggag atatacatat gaaacaaagc actattgcac tggcactctt accgttactg tttacccctg tgacaaaagc catgagcgat aaaattattc acctgactga cgacagtttt gacacggatg tactcaaagc ggacggggcg atcctcgtcg atttctgggc agagtggtgc ggtccgtgca aaatgatcgc cccgattctg 5400 gatgaaatcg ctgacgaata tcagggcaaa ctgaccgttg caaaactgaa catcgatcaa 5460 aaccctggca ctgcgccgaa atatggcatc cgtggtatcc cgactctgct gctgttcaaa 5520 aacggtgaag tggcggcaac caaagtgggt gcactgtcta aaggtcagtt gaaagagttc 5580 ctcgacgcta acctggccgg ttctggttct ggccatatgc accatcatca tcatcatgac 5640 gatgacgata agatgcccaa aaagaaacga aaggtgggta tccacggagt cccagcagcc 5700 gacaaaaaat atagcatcgg cctggacatc ggtaccaaca gcgttggctg ggcagtgatc 5760 actgatgaat acaaagttcc atccaaaaaa tttaaagtac tgggcaacac cgaccgtcac 5820 tctatcaaaa aaaacctgat tggtgctctg ctgtttgaca gcggcgaaac tgctgaggct 5880 acccgtctga aacgtacggc tcgccgtcgc tacactcgtc gtaaaaaccg catctgttat 5940 ctgcaggaaa ttttctctaa cgaaatggca aaagttgatg atagcttctt tcatcgtctg 6000 gaagagagct tcctggtgga agaagataaa aaacacgaac gtcacccgat tttcggtaac 6060 attgtggatg aggttgccta ccacgagaaa tatccgacca tctaccatct gcgtaaaaaa 6120 ctggttgata gcactgacaa agcggatctg cgtctgatct acctggctct ggcacacatg 6180 atcaaattcc gtggtcactt cctgatcgaa ggtgatctga accctgataa ctccgacgtg 6240 gacaaactgt tcattcagct ggttcagacc tataaccagc tgttcgaaga aaacccgatc 6300 aacgcgtccg gtgtagacgc taaggcaatt ctgtctgcgc gtctgtctaa gtctcgtcgt 6360 ctggaaaacc tgattgcgca actgccaggt gaaaagaaaa acggcctgtt cggcaatctg 6420 atcgccctgt ccctgggtct gactccgaac tttaaatcca actttgacct ggcggaagat 6480 gccaagctgc agctgagcaa agatacctat gacgatgacc tggataacct gctggcacag 6540 atcggtgatc agtatgccga tctgttcctg gccgcgaaaa acctgtctga tgcgattctg 6600 ctgtctgata tcctgcgcgt taacactgaa attactaaag cgccgctgag cgcatccatg 6660 attaaacgtt acgatgaaca ccaccaggat ctgaccctgc tgaaagcgct ggtgcgtcag 6720 cagctgccgg aaaaatacaa ggagatcttc ttcgaccaga gcaaaaacgg ttacgcgggc 6780 tacattgatg gtggtgcatc tcaggaggaa ttctacaaat tcattaaacc gatcctggaa 6840 aaaatggatg gtactgaaga gctgctggtt aaactgaatc gtgaagatct gctgcgcaaa 6900 cagcgtacct tcgataacgg ttccatcccg catcagattc atctgggcga actgcacgct 6960 atcctgcgcc gtcaggaaga cttttatccg ttcctgaaag acaaccgtga gaaaattgaa 7020 aaaatcctga ccttccgtat tccgtactat gtaggtccgc tggcgcgtgg taactcccgt 7080 ttcgcttgga tgacccgcaa aagcgaagaa accatcaccc cgtggaattt cgaagaagtc 7140 gttgacaaag gcgcgtccgc gcagtctttc atcgaacgca tgacgaactt cgacaaaaac 7200 ctgccgaacg agaaagtgct gccgaaacac tctctgctgt acgagtactt cactgtgtac 7260 aacgaactga ccaaagtgaa atacgtcacc gaaggtatgc gtaaaccggc attcctgtcc 7320 ggtgagcaaa aaaaagcaat cgtggatctg ctgttcaaaa ccaaccgtaa agtaaccgtg 7380 aaacagctga aggaagacta tttcaagaaa atcgaatgtt ttgattctgt tgaaatctcc 7440 ggcgtggaag atcgcttcaa tgcgtccctg ggtacgtatc acgacctgct gaaaattatc 7500 aaagacaaag attttctgga caacgaggaa aacgaagaca tcctggagga tattgtactg 7560 accctgaccc tgttcgaaga ccgtgagatg atcgaagaac gcctgaaaac ctacgcccac 7620 ctgttcgatg acaaggtaat gaagcagctg aaacgtcgtc gttataccgg ctggggtcgt 7680 ctgtcccgta aactgatcaa tggcatccgt gataaacagt ctggcaaaac catcctggac 7740 ttcctgaaat ccgacggttt cgcgaatcgt aacttcatgc aactgattca tgacgattct 7800 ctgactttca aagaagacat ccagaaagca caggtttccg gccagggtga ctctctgcac 7860 gagcacattg ccaatctggc tggttctccg gctattaaaa agggtattct gcagactgtg 7920 aaagtagttg atgagctggt caaagtaatg ggccgtcaca agccggaaaa cattgtgatc 7980 gaaatggcac gtgaaaacca gacgacccag aaaggtcaga aaaactctcg tgaacgcatg 8040 aaacgtatcg aagaaggcat caaagaactg ggctctcaga tcctgaagga acaccctgta 8100 gaaaataccc agctgcagaa cgaaaagctg tatctgtatt acctgcagaa cggccgcgat 8160 atgtatgtgg accaggaact ggatatcaac cgcctgtccg attacgatgt agatcacatc 8220 gtgccgcaaa gcttcctgaa agacgacagc attgacaaca aagtactgac ccgttctgat 8280 aagaaccgtg gcaaatccga taacgtcccg tctgaagaag ttgttaaaaa aatgaaaaac 8340 tattggcgtc agctgctgaa cgcgaaactg atcacccagc gtaagttcga caatctgact 8400 aaagctgagc gcggtggtct gtccgaactg gataaagcgg gttttatcaa acgccagctg 8460 gttgaaaccc gtcagatcac gaagcacgtt gcgcagattc tggactctcg tatgaacacc 8520 aaatacgacg aaaacgacaa actgatccgc gaggttaagg ttatcaccct gaaaagcaaa 8580 ctggtatccg attttcgtaa agactttcag ttctacaaag tgcgcgaaat taacaactat 8640 caccacgctc acgatgcata tctgaatgca gttgttggca cggcgctgat caaaaagtat 8700 ccgaaactgg aatctgaatt cgtatacggc gattacaaag tgtatgacgt tcgtaagatg 8760 atcgcaaaat ccgagcagga aattggtaag gcgacggcga aatacttctt ttattccaat 8820 attatgaact ttttcaaaac cgaaatcacc ctggcgaatg gtgaaattcg taaacgcccg 8880 ctgatcgaaa ccaacggtga aactggtgaa atcgtttggg acaaaggccg cgacttcgcg 8940 accgtgcgta aagttctgtc tatgccgcaa gtgaacatcg tcaagaagac cgaagtacaa 9000 accggcggtt ttagcaaaga gagcattctg ccaaaacgta actccgacaa actgatcgcg 9060 cgcaagaaag actgggatcc gaaaaaatac ggtggtttcg attctccaac cgttgcttat 9120 tccgttctgg tggtagccaa agttgagaaa ggtaaaagca aaaaactgaa atccgtaaag 9180 gaactgctgg gtattactat catggagcgt agctccttcg aaaaaaaccc gatcgatttt 9240 ctggaagcga aaggctataa agaagtcaaa aaggacctga tcatcaaact gccaaaatac 9300 agcctgttcg agctggaaaa cggccgtaaa cgtatgctgg catctgcggg cgaactgcag 9360 aaaggcaacg agctggctct gccgtccaaa tacgtgaact ttctgtacct ggcctctcac 9420 tacgaaaaac tgaaaggttc cccggaagac aacgaacaga aacagctgtt cgtagagcag 9480 cacaaacact acctggacga gatcatcgaa cagatttctg aattttctaa acgtgtgatt 9540 ctggctgatg cgaatctgga taaagttctg tctgcctata acaagcatcg tgacaaaccg 9600 atccgcgaac aggctgagaa catcatccac ctgttcactc tgactaacct gggcgcgcca 9660 gcggctttca agtactttga taccaccatt gaccgcaagc gttacacctc cactaaagaa 9720 gtgctggacg cgactctgat ccaccagtcc atcaccggtc tgtacgagac ccgtatcgat 9780 ctgagccagc tgggcggtga caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa 9840 aagaaaaagt gacaaagccc gaaaggaagc tgagttggct gctgccaccg ctgagcaata 9900 actagcataa ccccttgggg cctctaaacg ggtcttgagg ggttttttgc tgaaaggagg 9960 aactatatcc ggat 9974 <210> 2 <211> 1547 <212> PRT <213> Artificial Sequence <400> 2 Met Lys Gln Ser Thr Ile Ala Leu Ala Leu Leu Pro Leu Leu Phe Thr 1 5 10 15 Pro Val Thr Lys Ala Met Ser Asp Lys Ile Ile His Leu Thr Asp Asp 20 25 30 Ser Phe Asp Thr Asp Val Leu Lys Ala Asp Gly Ala Ile Leu Val Asp 35 40 45 Phe Trp Ala Glu Trp Cys Gly Pro Cys Lys Met Ile Ala Pro Ile Leu 50 55 60 Asp Glu Ile Ala Asp Glu Tyr Gln Gly Lys Leu Thr Val Ala Lys Leu 65 70 75 80 Asn Ile Asp Gln Asn Pro Gly Thr Ala Pro Lys Tyr Gly Ile Arg Gly 85 90 95 Ile Pro Thr Leu Leu Leu Phe Lys Asn Gly Glu Val Ala Ala Thr Lys 100 105 110 Val Gly Ala Leu Ser Lys Gly Gln Leu Lys Glu Phe Leu Asp Ala Asn 115 120 125 Leu Ala Gly Ser Gly Ser Gly His Met His His His His His His Asp 130 135 140 Asp Asp Asp Lys Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly 145 150 155 160 Val Pro Ala Ala Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr 165 170 175 Asn Ser Val Gly Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser 180 185 190 Lys Lys Phe Lys Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys 195 200 205 Asn Leu Ile Gly Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala 210 215 220 Thr Arg Leu Lys Arg Thr Ala Arg Arg Tyr Thr Arg Lys Asn 225 230 235 240 Arg With Cys Tyr Leu Gln Glu Phe Serves With Glu Met Ala Lys Val 245 250 255 Asp Asp Ser Phe Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu 260 265 270 Asp Lys Lys His Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu 275 280 285 Val Ala Tyr His Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys 290,295,300 Leu Val Asp Ser Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala 305 310 315 320 Leu Ala His Met Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp 325 330 335 Leu Asn Pro Asp Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val 340 345 350 Gln Thr Tyr Asn Gln Leu Phe Glu Glu Glu Asn Pro Ile Asn Ala Ser Gly 355 360 365 Val Asp Ala Lys Ala Leu Ser Ala Arg Ala Leu Ser Lys Ser Arg Arg 370 375 380 Leu Glu Asn Leu Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu 385 390 395 400 Phe Gly Asn Leu Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys 405 410 415 Ser Asn Phe Asp Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp 420 425 430 Thr Tyr Asp Asp Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln 435 440 445 Tyr Ala Asp Leu Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu 450 455 460 Leu Ser Asp Ile Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu 465 470 475 480 Ser Ala Ser Met Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr 485 490 495 Leu Leu Lys Ala Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu 500 505 510 Ile Phe Phe Asp Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly 515 520 525 Gly Ala Ser Gln Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu 530 535 540 Lys Met Asp Gly Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp 545 550 555 560 Leu Leu Arg Lys Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln 565 570 575 Ile His Leu Gly Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe 580 585 590 Tyr Pro Phe Leu Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr 595 600 605 Phe Arg Ile Pro Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg 610 615 620 Phe Ala Trp Met Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn 625 630 635 640 Phe Glu Glu Val Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu 645 650 655 Arg Met Thr Asn Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro 660 665 670 Lys His Ser Leu Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr 675 680 685 Lys Val Lys Tyr Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser 690 695 700 Gly Glu Gln Lys Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg 705 710 715 720 Lys Val Thr Val Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu 725 730 735 Cys Phe Asp Ser Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala 740 745 750 Ser Leu Gly Thr Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp 755 760 765 Phe Leu Asp Asn Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu 770 775 780 Thr Leu Thr Leu Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys 785 790 795 800 Thr Tyr Ala His Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg 805 810 815 Arg Arg Tyr Thr Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly 820 825 830 Ile Arg Asp Lys Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser 835 840 845 Asp Gly Phe Ala Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser 850 855 860 Leu Thr Phe Lys Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly 865 870 875 880 Asp Ser Leu His Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile 885 890 895 Lys Lys Gly Ile Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys 900 905 910 Val Met Gly Arg His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg 915 920 925 Glu Asn Gln Thr Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met 930 935 940 Lys Arg Ile Glu Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys 945 950 955 960 Glu His Pro Val Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu 965 970 975 Tyr Tyr Leu Gln Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp 980 985 990 Ile Asn Arg Leu Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser 995 1000 1005 Phe Leu Lys Asp Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp 1010 1015 1020 Lys Asn Arg Gly Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys 1025 1030 1035 1040 Lys Met Lys Asn Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr 1045 1050 1055 Gln Arg Lys Phe Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser 1060 1065 1070 Glu Leu Asp Lys Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg 1075 1080 1085 Gln Ile Thr Lys His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr 1090 1095 1100 Lys Tyr Asp Glu Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr 1105 1110 1115 1120 Leu Lys Ser Lys Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr 1125 1130 1135 Lys Val Arg Glu Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu 1140 1145 1150 Asn Ala Val Val Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu 1155 1160 1165 Ser Glu Phe Val Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met 1170 1175 1180 Ile Ala Lys Ser Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe 1185 1190 1195 1200 Phe Tyr Ser Asn Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala 1205 1210 1215 Asn Gly Glu Ile Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr 1220 1225 1230 Gly Glu Ile Val Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys 1235 1240 1245 Val Leu Ser Met Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln 1250 1255 1260 Thr Gly Gly Phe Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp 1265 1270 1275 1280 Lys Leu Ile Ala Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly 1285 1290 1295 Phe Asp Ser Pro Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val 1300 1305 1310 Glu Lys Gly Lys Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly 1315 1320 1325 Ile Thr Ile Met Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe 1330 1335 1340 Leu Glu Ala Lys Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys 1345 1350 1355 1360 Leu Pro Lys Tyr Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met 1365 1370 1375 Leu Ala Ser Ala Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro 1380 1385 1390 Ser Lys Tyr Val Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu 1395 1400 1405 Lys Gly Ser Pro Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln 1410 1415 1420 His Lys His Tyr Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser 1425 1430 1435 1440 Lys Arg Val Ile Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala 1445 1450 1455 Tyr Asn Lys His Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile 1460 1465 1470 Ile His Leu Phe Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys 1475 1480 1485 Tyr Phe Asp Thr Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu 1490 1495 1500 Val Leu Asp Ala Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu 1505 1510 1515 1520 Thr Arg Ile Asp Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala 1525 1530 1535 Thr Lys Lys Ala Gly Gln Ala Lys Lys Lys Lys 1540 1545 <210> 3 <211> 1399 <212> PRT <213> Artificial Sequence <400> 3 Met Pro Lys Lys Lys Arg Lys Val Gly Ile His Gly Val Pro Ala Ala 1 5 10 15 Asp Lys Lys Tyr Ser Ile Gly Leu Asp Ile Gly Thr Asn Ser Val Gly 20 25 30 Trp Ala Val Ile Thr Asp Glu Tyr Lys Val Pro Ser Lys Lys Phe Lys 35 40 45 Val Leu Gly Asn Thr Asp Arg His Ser Ile Lys Lys Asn Leu Ile Gly 50 55 60 Ala Leu Leu Phe Asp Ser Gly Glu Thr Ala Glu Ala Thr Arg Leu Lys 65 70 75 80 Arg Thr Ala Arg Arg Arg Tyr Thr Arg Arg Lys Asn Arg Ile Cys Tyr 85 90 95 Leu Gln Glu Ile Phe Ser Asn Glu Met Ala Lys Val Asp Asp Ser Phe 100 105 110 Phe His Arg Leu Glu Glu Ser Phe Leu Val Glu Glu Asp Lys Lys His 115 120 125 Glu Arg His Pro Ile Phe Gly Asn Ile Val Asp Glu Val Ala Tyr His 130 135 140 Glu Lys Tyr Pro Thr Ile Tyr His Leu Arg Lys Lys Leu Val Asp Ser 145 150 155 160 Thr Asp Lys Ala Asp Leu Arg Leu Ile Tyr Leu Ala Leu Ala His Met 165 170 175 Ile Lys Phe Arg Gly His Phe Leu Ile Glu Gly Asp Leu Asn Pro Asp 180 185 190 Asn Ser Asp Val Asp Lys Leu Phe Ile Gln Leu Val Gln Thr Tyr Asn 195 200 205 Gln Leu Phe Glu Glu Asn Pro Ile Asn Ala Ser Gly Val Asp Ala Lys 210 215 220 Ala Ile Leu Ser Ala Arg Leu Ser Lys Ser Arg Arg Leu Glu Asn Leu 225 230 235 240 Ile Ala Gln Leu Pro Gly Glu Lys Lys Asn Gly Leu Phe Gly Asn Leu 245 250 255 Ile Ala Leu Ser Leu Gly Leu Thr Pro Asn Phe Lys Ser Asn Phe Asp 260 265 270 Leu Ala Glu Asp Ala Lys Leu Gln Leu Ser Lys Asp Thr Tyr Asp Asp 275 280 285 Asp Leu Asp Asn Leu Leu Ala Gln Ile Gly Asp Gln Tyr Ala Asp Leu 290 295 300 Phe Leu Ala Ala Lys Asn Leu Ser Asp Ala Ile Leu Leu Ser Asp Ile 305 310 315 320 Leu Arg Val Asn Thr Glu Ile Thr Lys Ala Pro Leu Ser Ala Ser Met 325 330 335 Ile Lys Arg Tyr Asp Glu His His Gln Asp Leu Thr Leu Leu Lys Ala 340 345 350 Leu Val Arg Gln Gln Leu Pro Glu Lys Tyr Lys Glu Ile Phe Phe Asp 355 360 365 Gln Ser Lys Asn Gly Tyr Ala Gly Tyr Ile Asp Gly Gly Ala Ser Gln 370 375 380 Glu Glu Phe Tyr Lys Phe Ile Lys Pro Ile Leu Glu Lys Met Asp Gly 385 390 395 400 Thr Glu Glu Leu Leu Val Lys Leu Asn Arg Glu Asp Leu Leu Arg Lys 405 410 415 Gln Arg Thr Phe Asp Asn Gly Ser Ile Pro His Gln Ile His Leu Gly 420 425 430 Glu Leu His Ala Ile Leu Arg Arg Gln Glu Asp Phe Tyr Pro Phe Leu 435 440 445 Lys Asp Asn Arg Glu Lys Ile Glu Lys Ile Leu Thr Phe Arg Ile Pro 450 455 460 Tyr Tyr Val Gly Pro Leu Ala Arg Gly Asn Ser Arg Phe Ala Trp Met 465 470 475 480 Thr Arg Lys Ser Glu Glu Thr Ile Thr Pro Trp Asn Phe Glu Glu Val 485 490 495 Val Asp Lys Gly Ala Ser Ala Gln Ser Phe Ile Glu Arg Met Thr Asn 500 505 510 Phe Asp Lys Asn Leu Pro Asn Glu Lys Val Leu Pro Lys His Ser Leu 515 520 525 Leu Tyr Glu Tyr Phe Thr Val Tyr Asn Glu Leu Thr Lys Val Lys Tyr 530 535 540 Val Thr Glu Gly Met Arg Lys Pro Ala Phe Leu Ser Gly Glu Gln Lys 545 550 555 560 Lys Ala Ile Val Asp Leu Leu Phe Lys Thr Asn Arg Lys Val Thr Val 565 570 575 Lys Gln Leu Lys Glu Asp Tyr Phe Lys Lys Ile Glu Cys Phe Asp Ser 580 585 590 Val Glu Ile Ser Gly Val Glu Asp Arg Phe Asn Ala Ser Leu Gly Thr 595 600 605 Tyr His Asp Leu Leu Lys Ile Ile Lys Asp Lys Asp Phe Leu Asp Asn 610 615 620 Glu Glu Asn Glu Asp Ile Leu Glu Asp Ile Val Leu Thr Leu Thr Leu 625 630 635 640 Phe Glu Asp Arg Glu Met Ile Glu Glu Arg Leu Lys Thr Tyr Ala His 645 650 655 Leu Phe Asp Asp Lys Val Met Lys Gln Leu Lys Arg Arg Arg Tyr Thr 660 665 670 Gly Trp Gly Arg Leu Ser Arg Lys Leu Ile Asn Gly Ile Arg Asp Lys 675 680 685 Gln Ser Gly Lys Thr Ile Leu Asp Phe Leu Lys Ser Asp Gly Phe Ala 690 695 700 Asn Arg Asn Phe Met Gln Leu Ile His Asp Asp Ser Leu Thr Phe Lys 705 710 715 720 Glu Asp Ile Gln Lys Ala Gln Val Ser Gly Gln Gly Asp Ser Leu His 725 730 735 Glu His Ile Ala Asn Leu Ala Gly Ser Pro Ala Ile Lys Lys Gly Ile 740 745 750 Leu Gln Thr Val Lys Val Val Asp Glu Leu Val Lys Val Met Gly Arg 755 760 765 His Lys Pro Glu Asn Ile Val Ile Glu Met Ala Arg Glu Asn Gln Thr 770 775 780 Thr Gln Lys Gly Gln Lys Asn Ser Arg Glu Arg Met Lys Arg Ile Glu 785 790 795 800 Glu Gly Ile Lys Glu Leu Gly Ser Gln Ile Leu Lys Glu His Pro Val 805 810 815 Glu Asn Thr Gln Leu Gln Asn Glu Lys Leu Tyr Leu Tyr Tyr Leu Gln 820 825 830 Asn Gly Arg Asp Met Tyr Val Asp Gln Glu Leu Asp Ile Asn Arg Leu 835 840 845 Ser Asp Tyr Asp Val Asp His Ile Val Pro Gln Ser Phe Leu Lys Asp 850 855 860 Asp Ser Ile Asp Asn Lys Val Leu Thr Arg Ser Asp Lys Asn Arg Gly 865 870 875 880 Lys Ser Asp Asn Val Pro Ser Glu Glu Val Val Lys Lys Met Lys Asn 885 890 895 Tyr Trp Arg Gln Leu Leu Asn Ala Lys Leu Ile Thr Gln Arg Lys Phe 900 905 910 Asp Asn Leu Thr Lys Ala Glu Arg Gly Gly Leu Ser Glu Leu Asp Lys 915 920 925 Ala Gly Phe Ile Lys Arg Gln Leu Val Glu Thr Arg Gln Ile Thr Lys 930 935 940 His Val Ala Gln Ile Leu Asp Ser Arg Met Asn Thr Lys Tyr Asp Glu 945 950 955 960 Asn Asp Lys Leu Ile Arg Glu Val Lys Val Ile Thr Leu Lys Ser Lys 965 970 975 Leu Val Ser Asp Phe Arg Lys Asp Phe Gln Phe Tyr Lys Val Arg Glu 980 985 990 Ile Asn Asn Tyr His His Ala His Asp Ala Tyr Leu Asn Ala Val Val 995 1000 1005 Gly Thr Ala Leu Ile Lys Lys Tyr Pro Lys Leu Glu Ser Glu Phe Val 1010 1015 1020 Tyr Gly Asp Tyr Lys Val Tyr Asp Val Arg Lys Met Ile Ala Lys Ser 1025 1030 1035 1040 Glu Gln Glu Ile Gly Lys Ala Thr Ala Lys Tyr Phe Phe Tyr Ser Asn 1045 1050 1055 Ile Met Asn Phe Phe Lys Thr Glu Ile Thr Leu Ala Asn Gly Glu Ile 1060 1065 1070 Arg Lys Arg Pro Leu Ile Glu Thr Asn Gly Glu Thr Gly Glu Ile Val 1075 1080 1085 Trp Asp Lys Gly Arg Asp Phe Ala Thr Val Arg Lys Val Leu Ser Met 1090 1095 1100 Pro Gln Val Asn Ile Val Lys Lys Thr Glu Val Gln Thr Gly Gly Phe 1105 1110 1115 1120 Ser Lys Glu Ser Ile Leu Pro Lys Arg Asn Ser Asp Lys Leu Ile Ala 1125 1130 1135 Arg Lys Lys Asp Trp Asp Pro Lys Lys Tyr Gly Gly Phe Asp Ser Pro 1140 1145 1150 Thr Val Ala Tyr Ser Val Leu Val Val Ala Lys Val Glu Lys Gly Lys 1155 1160 1165 Ser Lys Lys Leu Lys Ser Val Lys Glu Leu Leu Gly Ile Thr Ile Met 1170 1175 1180 Glu Arg Ser Ser Phe Glu Lys Asn Pro Ile Asp Phe Leu Glu Ala Lys 1185 1190 1195 1200 Gly Tyr Lys Glu Val Lys Lys Asp Leu Ile Ile Lys Leu Pro Lys Tyr 1205 1210 1215 Ser Leu Phe Glu Leu Glu Asn Gly Arg Lys Arg Met Leu Ala Ser Ala 1220 1225 1230 Gly Glu Leu Gln Lys Gly Asn Glu Leu Ala Leu Pro Ser Lys Tyr Val 1235 1240 1245 Asn Phe Leu Tyr Leu Ala Ser His Tyr Glu Lys Leu Lys Gly Ser Pro 1250 1255 1260 Glu Asp Asn Glu Gln Lys Gln Leu Phe Val Glu Gln His Lys His Tyr 1265 1270 1275 1280 Leu Asp Glu Ile Ile Glu Gln Ile Ser Glu Phe Ser Lys Arg Val Ile 1285 1290 1295 Leu Ala Asp Ala Asn Leu Asp Lys Val Leu Ser Ala Tyr Asn Lys His 1300 1305 1310 Arg Asp Lys Pro Ile Arg Glu Gln Ala Glu Asn Ile Ile His Leu Phe 1315 1320 1325 Thr Leu Thr Asn Leu Gly Ala Pro Ala Ala Phe Lys Tyr Phe Asp Thr 1330 1335 1340 Thr Ile Asp Arg Lys Arg Tyr Thr Ser Thr Lys Glu Val Leu Asp Ala 1345 1350 1355 1360 Thr Leu Ile His Gln Ser Ile Thr Gly Leu Tyr Glu Thr Arg Ile Asp 1365 1370 1375 Leu Ser Gln Leu Gly Gly Asp Lys Arg Pro Ala Ala Thr Lys Lys Ala 1380 1385 1390 Gly Gln Ala Lys Lys Lys Lys 1395 <210> 4 <211> 225 <212> DNA <213> Artificial Sequence <400> 4 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggagagc acagtcagcc tggcggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 5 <211> 225 <212> DNA <213> Artificial Sequence <400> 5 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggcttcc agaattggat ctccggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 6 <211> 102 <212> RNA <213> Artificial Sequence <400> 6 ggagagcaca gucagccugg cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 7 <211> 102 <212> RNA <213> Artificial Sequence <400> 7 ggcuuccaga auuggaucuc cgguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaa guggcaccga gucggugcuu uu 102 <210> 8 <211> 659 <212> PRT <213> His sow <400> 8 Met Ala Ala Val Contains Glu Ser and Phe Contains Lys Arg Contains Gln Gln 1 5 10 15 Glu Lys Lys Thr Ser Pro Leu Asn Phe Lys Lys Arg Leu Phe Leu Leu 20 25 30 Thr Val Gln Lys Leu Ser Tyr Tyr Glu Tyr Asp Phe Glu Arg Gly Arg 35 40 45 Arg Gly Ser Lys Lys Gly Ser Ile Asp Val Glu Lys Ile Thr Cys Val 50 55 60 Glu Thr Val Val Pro Glu Lys Asn Pro Pro Pro Glu Arg Gln Ile Pro 65 70 75 80 Arg Arg Gly Glu Serp Glu Serp Glue Met Glu Gln Ile Ser Ile Ile Glu 85 90 95 Arg Phe Pro Tyr Pro Phe Gln Val Val Tyr Asp Glu Gly Pro Leu Tyr 100 105 110 Val Phe Ser Pro Thr Glu Glu Leu Arg Lys Arg Trp Ile His Gln Leu 115 120 125 Lys Ser Val Ile Arg Tyr Asn Ser Asp Leu Val Gln Lys Tyr His Pro 130 135 140 Cys Phe Trp Ile Asp Gly Gln Tyr Leu Cys Cys Ser Gln Thr Ala Lys 145 150 155 160 Asn Ala Met Gly Cys Gln Ile Leu Glu Asn Arg Asn Gly Ser Leu Lys 165 170 175 Pro Gly Ser Ser His Arg Lys Thr Lys Lys Pro Leu Pro Pro Thr Pro 180 185 190 Glu Glu Asp Gln Ile Leu Lys Lys Pro Leu Pro Pro Glu Pro Thr Ala 195 200 205 Ala Pro Val Ser Thr Ser Glu Leu Lys Lys Val Val Ala Leu Tyr Asp 210 215 220 Tyr Met Pro Met Asn Ala Asn Asp Leu Gln Leu Arg Lys Gly Asp Glu 225 230 235 240 Tyr Phe Ile Leu Glu Glu Ser Asn Leu Pro Trp Trp Arg Ala Arg Asp 245 250 255 Lys Asn Gly Gln Glu Gly Tyr Ile Pro Ser Asn Tyr Val Thr Glu Ala 260 265 270 Glu Asp Ser Ile Glu Met Tyr Glu Trp Tyr Ser Lys His Met Thr Arg 275 280 285 Ser Gln Ala Glu Gln Leu Leu Lys Gln Glu Gly Lys Glu Gly Gly Phe 290 295 300 Ile Val Arg Asp Ser Ser Lys Ala Gly Lys Tyr Thr Val Ser Val Phe 305 310 315 320 Ala Lys Ala Thr Gly Glu Pro Gln Gly Val Ile Arg His Tyr Val Val 325 330 335 Cys Ser Thr Pro Gln Ser Gln Tyr Tyr Leu Ala Glu Lys His Leu Phe 340 345 350 Ser Thr Ile Pro Glu Leu Ile Asn Tyr His Gln His Asn Ser Ala Gly 355 360 365 Leu Ile Ser Arg Leu Lys Tyr Pro Val Ser Gln Gln Asn Lys Asn Ala 370 375 380 Pro Ser Thr Ala Gly Leu Gly Tyr Gly Ser Trp Glu Ile Asp Pro Lys 385 390 395 400 Asp Leu Thr Phe Leu Lys Glu Leu Gly Thr Gly Gln Phe Gly Val Val 405 410 415 Lys Tyr Gly Lys Trp Arg Gly Gln Tyr Asp Val Ala Ile Lys Met Ile 420 425 430 Lys Glu Gly Ser Met Ser Glu Asp Glu Phe Ile Glu Glu Ala Lys Val 435 440 445 Met Met Asn Leu Ser His Glu Lys Leu Val Gln Leu Tyr Gly Val Cys 450 455 460 Thr Lys Gln Arg Pro Ile Phe Ile Ile Thr Glu Tyr Met Ala Asn Gly 465 470 475 480 Cys Leu Leu Asn Tyr Leu Arg Glu Met Arg His Arg Phe Gln Thr Gln 485 490 495 Gln Leu Leu Glu Met Cys Lys Asp Val Cys Glu Ala Met Glu Tyr Leu 500 505 510 Glu Ser Lys Gln Phe Leu His Arg Asp Leu Ala Ala Arg Asn Cys Leu 515 520 525 Val Asn Asp Gln Gly Val Val Lys Val Ser Asp Phe Gly Leu Ser Arg 530 535 540 Tyr Val Leu Asp Asp Glu Tyr Thr Ser Ser Val Gly Ser Lys Phe Pro 545 550 555 560 Val Arg Trp Ser Pro Pro Glu Val Leu Met Tyr Ser Lys Phe Ser Ser 565 570 575 Lys Ser Asp Ile Trp Ala Phe Gly Val Leu Met Trp Glu Ile Tyr Ser 580,585,590 Leu Gly Lys Met Pro Tyr Glu Arg Phe Thr Asn Ser Glu Thr Ala Glu 595,600,605 His Ile Ala Gln Gly Leu Arg Leu Tyr Arg Pro His Leu Ala Ser Glu 610 615 620 Arg Val Tyr Thr Ile Met Tyr Ser Cys Trp His Glu Lys Ala Asp Glu 625,630,635,640 Arg Pro Thr Phe Lys Ile Leu Leu Ser Asn Ile Leu Asp Val Met Asp 645,650,655 Glu Glu Ser <210> 9 <211> 1017 <212> DNA <213> On sow <400> 9 tcaacatgtg atttgtggga gtcctaactg ctaaggtact catttctctg ccttggattt 60 tggtggagaa gagtactgat catgggtggg taccatctta gtagcatctg ggggtgaaca 120 tagaaaatga gactttgaaa aggaagactg attctgatgt agccttagtg ctcattcagc 180 cctgggcttg tttcctgttc tactgatggg ctccaaatcc caactcacca tcacatatta 240 ggcacttctg gagttaggg tgggaaagaa gaaagtcaac ttgttactat ggtcccttat 300 ctgatactct attcccaggc caactccttt cctcccaagc ccccttctga atagtatgca 360 gagccagaaa gggggacta attcgttgac tctcctgtag gaatctttcc cacgagaagc 420 tggtgcagct gtacggtgtc tgcaccaaac agcgccccat attcatcatc actgagtaca 480 tggccaatgg ctgcctcctg aactacctga gggagatgcg ccaccgcttc cagactcagc 540 agctgctgga gatgtgcaag gatgtctgtg aagctatgga atacctggag tcaaagcagt 600 tcctccaccg agacctggta ggacctcaga aggattagcc tgggtccaag ggctgggggg 660 gggggtggaa gtagaaaagg aagacaagtg gatgaagagg gttgttggaa ccatcatttc 720 agttctagaa aacactcaaa gtttgctgag cctctccctc agaggtcagc cagtcaacaa 780 tctccaggct caacattacc agttctgcta ccatgggagt tagagcgccc actcccagcc 840 ccctaccatg acaaagaaat gctgggggtcc ttcaggggca aaagggcagc cctgcttccc 900 aacaggactg ctcttagcac agaagcatca tcgggttcca ccagagtcac aaactgggg 960 cccattggta catttggtgg ggttttttat gttatatatt aatgagcaaa cacttaa 1017 <210> 10 <211> 100 <212> RNA <213> Artificial Sequence <400> 10 cagcugcacc agcuucucgu guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 11 <211> 100 <212> RNA <213> Artificial Sequence <400> 11 ucucccucag guaguucagg guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 12 <211> 100 <212> RNA <213> Artificial Sequence <400> 12 cugccuccug aacuaccuga guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 13 <211> 100 <212> RNA <213> Artificial Sequence <400> 13 gcagcugcug gagaugca guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 14 <211> 100 <212> RNA <213> Artificial Sequence <400> 14 aucacugagu acauggccaa guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 15 <211> 100 <212> RNA <213> Artificial Sequence <400> 15 guaguucagg aggcagccau guuuuagagc uagaaauagc aaguuaaaau aaggcuaguc 60 cguuaucaac uugaaaaagu ggcaccgagu cggugcuuuu 100 <210> 16 <211> 225 <212> DNA <213> Artificial Sequence <400> 16 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 ataggtctcc ctcaggtagt tcagggtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 17 <211> 225 <212> DNA <213> Artificial Sequence <400> 17 ggcttgtcgg actcttcgct attacgccag ctggcgaagg gggatgtgct gcaaggcgat 60 taagttgggt aacgccaggg ttttcccagt cacgacgtta ggaaattaat acgactcact 120 atagggcagc tgctggagat gtgcagtttt agagctagaa atagcaagtt aaaataaggc 180 tagtccgtta tcaacttgaa aaagtggcac cgagtcggtg ctttt 225 <210> 18 <211> 102 <212> RNA <213> Artificial Sequence <400> 18 ggucucccuc agguaguuca ggguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102 <210> 19 <211> 102 <212> RNA <213> Artificial Sequence <400> 19 gggcagcugc uggagaugug caguuuuaga gcuagaaaua gcaaguuaaa auaaggcuag 60 uccguuauca acuugaaaaa guggcaccga gucggugcuu uu 102

Claims

1. A kit comprising BTK-gRNA2, BTK-gRNA4 and NCN protein; The BTK-gRNA2 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO: 18; the BTK-gRNA4 is an sgRNA, and its target sequence binding region is shown as nucleotides 3-22 in SEQ ID NO:

19. The NCN protein is shown in SEQ ID NO: 3; The method for preparing the NCN protein includes the following steps: (1) Plasmid pKG-GE4 was introduced into Escherichia coli BL21(DE3) to obtain recombinant bacteria; (2) The recombinant bacteria were cultured in liquid culture medium at 30°C, then IPTG was added and the culture was induced at 25°C, and then the bacterial cells were collected. (3) The collected bacterial cells were broken down to collect the crude protein solution; (4) The His6-tagged fusion protein was purified from the crude protein solution by affinity chromatography; (5) The His6-tagged fusion protein was digested with His6-tagged enterokinase, and then the His6-tagged protein was removed with Ni-NTA resin to obtain purified NCN protein. The plasmid pKG-GE4 is shown in SEQ ID NO: 1; The kit is intended for use as follows (a), (b), or (c): (a) to prepare recombinant cells; (b) to prepare a gamma globulin deficiency model pig; (c) to prepare a gamma globulin deficiency cell model, a gamma globulin deficiency tissue model, or a gamma globulin deficiency organ model.

2. Application of BTK-gRNA2, BTK-gRNA4, and NCN proteins in the preparation of the kit; BTK-gRNA2 is the BTK-gRNA2 described in claim 1; BTK-gRNA4 is the BTK-gRNA4 described in claim 1; NCN protein is the NCN protein described in claim 1; The kit is intended for use as follows (a), (b), or (c): (a) to prepare recombinant cells; (b) to prepare a gamma globulin deficiency model pig; (c) to prepare a gamma globulin deficiency cell model, a gamma globulin deficiency tissue model, or a gamma globulin deficiency organ model.

3. A method for preparing recombinant cells, comprising the following steps: co-transfecting porcine cells with BTK-gRNA2, BTK-gRNA4 and NCN protein to obtain recombinant cells; BTK-gRNA2 is the BTK-gRNA2 described in claim 1; BTK-gRNA4 is the BTK-gRNA4 described in claim 1; and NCN protein is the NCN protein described in claim 1.

Citation Information

Patent Citations

  • CRISPR / Cas9 system and application thereof in construction of swine-derived recombinant cells with insulin receptor substrate gene defects

    CN112522255A

  • Application of gRNA target combinations in construction of hemophilia model pig cell line

    CN112442515A

  • Btk knock-out pig Models and the uses thereof

    KR102270145B1