Translation promoter, translation template mRNA, transcription template DNA, method for producing translation template mRNA, and method for producing protein

By designing a combination of the first and second sequences of a translation promoter to form a complementary junction containing a poly-A sequence, the problem of 5'UTR shortening in cell-free protein synthesis systems was solved, achieving efficient synthesis of target proteins.

CN115298311BActive Publication Date: 2026-02-13NUPROTEIN CO LTD
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202180004878.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2021-03-03
Filing Date
2021-12-16
Publication Date
2026-02-13
Estimated Expiration
2041-12-16

AI Technical Summary

Technical Problem

In cell-free protein synthesis systems, current technologies have not clearly defined how to shorten the 5'UTR to improve translation efficiency, resulting in limited efficiency in the synthesis of target proteins.

Method used

Design a translation promoter consisting of a first sequence and a second sequence, wherein the first sequence is adjacent to the 5' end of the coding region and the second sequence is adjacent to the 3' end, forming a complementary sequence junction, and a poly-A sequence is included on the 3' side of the junction. Optimize the nucleic acid length and structure to shorten the 5' UTR.

Benefits of technology

Even with a shortened 5'UTR, the target protein can be synthesized effectively, improving both translation and synthesis efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115298311B_ABST
    Figure CN115298311B_ABST
Patent Text Reader

Abstract

Provided is a translation promoter capable of shortening a 5' UTR. The translation promoter is used in a cell-free protein synthesis system, and is a combination of a first sequence, which is a nucleic acid as a 5' untranslated region, and a second sequence, which is a nucleic acid as a 3' untranslated region, the first sequence being linked to the 5' end of a coding region encoding an amino acid sequence of a target protein, the second sequence being linked to the 3' end of the coding region, the first sequence and the second sequence having complementary sequences forming a joint, and the translation promoter is capable of solving the problem.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The disclosure in the present application relates to a translation facilitator, a translation template mRNA, a transcription template DNA, a method for producing a translation template mRNA, and a method for producing a protein. BACKGROUND

[0002] A synthetic system for synthesizing a protein in a cell-free manner is a synthetic system in which a medium containing intracellular elements related to protein synthesis is prepared, and transcription from a template DNA to translation is performed in a cell-free manner. Various cell-free protein synthesis systems are known. Such a synthetic system includes a system in which a template DNA as a transcription template is applied to a medium to synthesize a protein as a final product, and a system in which an mRNA as a translation template is applied to a medium to synthesize a protein.

[0003] In either of these systems, it is necessary to synthesize a transcription template DNA as an initial raw material. The synthesis of a transcription template DNA is usually performed by first cloning a cDNA encoding a protein to be synthesized, combining the cloned cDNA into a plasmid, and constructing a DNA region for expression containing a promoter, a coding region, a terminator, and the like. Then, the DNA region is excised from the plasmid, or PCR (Polymerase Chain Reaction) is directly performed on the plasmid as a template DNA.

[0004] It is considered that the structure of the template DNA has an influence on the expression efficiency in a cell-free protein synthesis system, and various attempts have been made on a vector for constructing an expression cassette. For example, it is reported that a specific translation facilitation sequence is introduced in a 5' untranslated region (5' UTR) (Patent Documents 1 and 2). In addition, it is also described that the life span of an mRNA as a translation template is prolonged, or the translation efficiency is improved by elongating a 3' untranslated region (3' UTR) (Patent Document 3). It is also reported that the 3' UTR of an mRNA is preferably 1000 bases or more (Patent Documents 4 and 5).

[0005] In addition, the use of a 3' UTR in a cell-free protein synthesis system using a yeast extract is also mentioned (Non-Patent Document 1).

[0006] On the other hand, it is also known that a transcription template DNA can be obtained in a 3' UTR of 200 bases or less by a nucleic acid amplification reaction, and by applying the transcription template DNA to a cell-free protein synthesis system, an mRNA and a protein can be efficiently obtained (see Patent Document 6).

[0007] However, in cell-free protein synthesis, it is necessary to synthesize a translation template mRNA from a transcription template DNA. From the viewpoint of the efficiency of the synthesis of mRNA, it is desirable that the 3'UTR, which is not related to the synthesis of the target protein, is shorter. However, it is desirable that the efficiency of the synthesis of the target protein is higher. Therefore, it is also known that: (1) a nucleic acid which is a 3'UTR linked to the 3' end of a coding region encoding an amino acid sequence of a target protein, (2) which includes a first region adjacent to the 3' end of the coding region and composed of 10 to 40 nucleic acid sequences, and a second region linked to the first region and composed of a consecutive poly A sequence of 2 to 40 A, (3) the first region has a hairpin structure, (4) whereby the efficiency of the synthesis of the target protein can be improved even if the 3'UTR is short.

[0008] Prior Art Documents

[0009] Patent Documents

[0010] Patent Document 1: Japanese Patent Application Laid-Open (JP-A) No. 2009-72207

[0011] Patent Document 2: Japanese Patent Application Laid-Open (JP-A) No. 2013-158342

[0012] Patent Document 3: Japanese Patent Application Laid-Open (JP-A) No. 2007-97438

[0013] Patent Document 4: Japanese Patent Application Laid-Open (JP-A) No. 2008-35701

[0014] Patent Document 5: Japanese Patent Application Laid-Open (JP-A) No. 2005-247857

[0015] Patent Document 6: International Publication No. WO 2016 / 143799

[0016] Patent Document 7: Japanese Patent (JP-B) No. 6738111

[0017] Non-Patent Documents

[0018] Non-Patent Document 1: Rui Gan et al., "A combined cell-free transcription-translation system from Saccharomyces cerevisiae for rapid and robust protein synthesis", Biotechonology Journal, 2014, 9, 641-651 SUMMARY

[0019] PROBLEMS TO BE SOLVED BY THE INVENTION

[0020] As described in Patent Documents 1 to 7 and Non-Patent Document 1, various studies have been made on 5'UTR and 3'UTR in the field of cell-free protein synthesis. However, although it is known that a specific translation-promoting sequence is introduced in 5'UTR as described in Patent Documents 1 and 2, a method for shortening 5'UTR is not clear.

[0021] The present disclosure was completed in order to solve the above-described conventional problems, and as a result of earnest studies, it has been newly found that (1) a combination of a UTR on the 5' end side of a coding region encoding an amino acid sequence of a target protein, i.e., a first sequence, and a UTR on the 3' end side, i.e., a second sequence, (2) by designing the first sequence and the second sequence to be able to form a junction, 5'UTR can be shortened.

[0022] That is, the present disclosure aims to provide a translation promoter, a translation template mRNA, a transcription template DNA, a production method of a translation template mRNA, and a production method of a protein, which can synthesize a target protein even if 5'UTR is short.

[0023] Solution to the problem

[0024] The present disclosure relates to a translation promoter, a translation template mRNA, a transcription template DNA, a production method of a translation template mRNA, and a production method of a protein as shown below.

[0025] (1) A translation promoter for a cell-free protein synthesis system,

[0026] the translation promoter is a combination of a first sequence and a second sequence,

[0027] the first sequence is a nucleic acid as a 5' untranslated region, which is connected adjacently to the 5' end of a coding region encoding an amino acid sequence of a target protein,

[0028] the second sequence is a nucleic acid as a 3' untranslated region, which is connected adjacently to the 3' end of the coding region,

[0029] the first sequence and the second sequence have complementary sequences that form a junction.

[0030] (2) The translation promoter according to the above (1), wherein the length of the nucleic acid of the first sequence is 3 or more.

[0031] (3) The translation promoter according to the above (1) or (2), wherein the length of the nucleic acid of the second sequence is 20 or more.

[0032] (4) The translation facilitator according to any one of the above (1) to (3), wherein the second sequence further includes an A (adenine) consecutive poly-A sequence on the 3' side of the junction.

[0033] (5) The translation facilitator according to any one of the above (1) to (4), wherein the first sequence and / or the second sequence includes one or more stems or stem loops.

[0034] (6) The translation facilitator according to any one of the above (1) to (5), wherein the sum of the number of nucleic acids on the 3' side of the junction of the first sequence and the number of nucleic acids on the 5' side of the junction of the second sequence is 25 or less.

[0035] (7) A translation template mRNA including: the translation facilitator according to any one of the above (1) to (6), and a coding region encoding an amino acid sequence of a target protein disposed between the first sequence and the second sequence.

[0036] (8) A transcription template DNA for a cell-free protein synthesis system,

[0037] The transcription template DNA includes:

[0038] a promoter region;

[0039] a coding region encoding an amino acid sequence of a target protein; and

[0040] the translation facilitator according to any one of the above (1) to (6),

[0041] the first sequence of the translation facilitator is disposed between the promoter region and the coding region,

[0042] the second sequence of the translation facilitator is joined adjacent to the 3' end of the coding region.

[0043] (9) A production method of a translation template mRNA for a cell-free protein synthesis system, including the following steps:

[0044] synthesizing the translation template mRNA using the transcription template DNA according to the above (8) in the absence of cells and in the presence of elements for transcribing the transcription template DNA into mRNA.

[0045] (10) A production method of a protein, including the following steps:

[0046] synthesizing the protein using the translation template mRNA according to the above (7) or the translation template mRNA produced by the production method of the translation template mRNA according to the above (9) in the absence of cells and in the presence of elements for translating the translation template mRNA into a protein.

[0047] Further, the disclosure of the present application relates to a translation template mRNA, a transcription template DNA, a method for producing a translation template mRNA, and a method for producing a protein as shown below.

[0048] (1) A translation template mRNA comprising:

[0049] a translation facilitator; and

[0050] a coding region encoding an amino acid sequence of a target protein,

[0051] the translation facilitator is a combination of a first sequence and a second sequence,

[0052] the first sequence is a nucleic acid as a 5' untranslated region that is joined adjacently to a 5' end of the coding region encoding the amino acid sequence of the target protein,

[0053] the second sequence is a nucleic acid as a 3' untranslated region that is joined adjacently to a 3' end of the coding region encoding the amino acid sequence of the target protein,

[0054] the first sequence and the second sequence form a junction when the translation template mRNA is analyzed using MXfold,

[0055] the sum of the number of nucleic acids on the 3' side of the junction of the first sequence and the number of nucleic acids on the 5' side of the junction of the second sequence is 25 or less.

[0056] (2) The translation template mRNA according to the above (1), wherein the length of the nucleic acid of the first sequence is 3 or more.

[0057] (3) The translation template mRNA according to the above (1), wherein the length of the nucleic acid of the second sequence is 20 or more.

[0058] (4) The translation template mRNA according to the above (2), wherein the length of the nucleic acid of the second sequence is 20 or more.

[0059] (5) The translation template mRNA according to any one of the above (1) to (4), wherein the second sequence further includes a poly A sequence of A (adenine) in succession on the 3' side of the junction.

[0060] (6) The translation template mRNA according to any one of the above (1) to (4), wherein the first sequence and / or the second sequence includes one or more stems or stem loops.

[0061] (7) The translation template mRNA according to the above (5), wherein the first sequence and / or the second sequence includes one or more stems or stem loops.

[0062] (8) A transcription template DNA for use in a cell-free protein synthesis system,

[0063] The transcription template DNA includes:

[0064] a region encoding the translation template mRNA according to any one of (1) to (7) above; and

[0065] a promoter region disposed at the 5' end of the first sequence.

[0066] (9) A method for producing a translation template mRNA for use in a cell-free protein synthesis system, comprising the following steps:

[0067] synthesizing a translation template mRNA using the transcription template DNA according to (8) above in the absence of cells and in the presence of elements for transcribing the transcription template DNA into an mRNA.

[0068] (10) A method for producing a protein, comprising the following steps:

[0069] synthesizing a protein using the translation template mRNA according to any one of (1) to (7) above or the translation template mRNA produced by the method for producing a translation template mRNA according to (9) above in the absence of cells and in the presence of elements for translating the translation template mRNA into a protein.

[0070] Effects of the Invention

[0071] If the translation promoter disclosed herein is used, a target protein can be synthesized even if the 5' UTR is short. BRIEF DESCRIPTION OF DRAWINGS

[0072] Figure 1 is a schematic diagram illustrating an outline of the translation promoter 1 and the translation template mRNA 10;

[0073] Figure 2 is a schematic diagram illustrating an outline of the junction C of the translation promoter 1 and the translation template mRNA 10;

[0074] Figure 3 is a schematic diagram illustrating the number of nucleic acids of the translation promoter 1 and the translation template mRNA 10;

[0075] Figure 4 is a schematic diagram illustrating an arbitrary additional structure of the translation promoter 1 and the translation template mRNA 10;

[0076] Figure 5 is a schematic diagram illustrating an outline of the transcription template DNA 100;

[0077] Figure 6The graph shows the fluorescence measurement results of GFP-HIS synthesized in Examples 1-19 and Comparative Example 1, with the measured value of Ω in Comparative Example 1 being 100 and the value relative to Comparative Example 1.

[0078] Figure 7A The graph shows the analysis of the translation template mRNAs of Examples 1 and 3 using the secondary structure prediction software MXfold, and the visualization of the secondary structures using Forna.

[0079] Figure 7B The graph shows the analysis of the translation template mRNAs of Examples 18 and 19 using the secondary structure prediction software MXfold, and the visualization of the secondary structures using Forna.

[0080] Figure 8 The graph shows the analysis of translation template mRNAs in Examples 20, 21, and 29 using the secondary structure prediction software MXfold, and the visualization of secondary structures using Forna.

[0081] Figure 9 The graph shows the fluorescence measurement results of GFP synthesized in Examples 20-29, with the measured value of Example 29 as 100 and the value relative to Example 29.

[0082] Figure 10 The graph shows the fluorescence measurement results of the synthesized GFP in Examples 29, 30 and Comparative Example 2, with the measured value of Comparative Example 2 being 100 and the value relative to Comparative Example 2. Detailed Implementation

[0083] The following provides a detailed description of the translation promoter, translation template mRNA, transcription template DNA, method for producing translation template mRNA, and method for producing proteins disclosed in this application. Furthermore, the following description is for ease of understanding, and the scope of the technical matters disclosed in this application is not limited to the following description. In addition to the examples below, appropriate modifications can, of course, be made within the scope of the spirit of this application without prejudice.

[0084] (Translation facilitator)

[0085] Reference Figure 1 and Figure 2 The implementation methods of translation facilitators are described. Figure 1 This is a schematic diagram illustrating the general overview of translation facilitators. Figure 2is a schematic diagram illustrating an outline of the junction of the translation facilitator. The translation facilitator 1 is a combination of a nucleic acid, i.e., the first sequence 2, as the 5' untranslated region and a nucleic acid, i.e., the second sequence 3, as the 3' untranslated region. The first sequence 2 is linked adjacent to the 5' end (the start codon) of the coding region 4 encoding the amino acid sequence of the target protein. The second sequence 3 is linked adjacent to the 3' end (the stop codon) of the coding region 4 encoding the amino acid sequence of the target protein. Also, there is a case where the "stop codon" is considered as the 3' untranslated region because it is not translated into an amino acid, but in the present specification, the "stop codon" is not included in the "second sequence 3". In other words, the "stop codon" is defined as the sequence of the coding region 4. However, this does not hinder the formation of a complementary pair of part of the stop codon. The first sequence 2 and the second sequence 3 have a complementary sequence CS forming the junction C.

[0086] The length of the nucleic acid of the first sequence 2 is not particularly limited as long as it forms the junction with the second sequence 3. The length of the nucleic acid of the first sequence 2 can be, for example, 1 or more, 2 or more, 3 or more, 4 or more, 5 or more. Also, in the case where the mRNA as the translation template is prepared by nucleic acid synthesis, as described above, the length of the first sequence 2 can be 1 or more. On the other hand, in the case where the translation template mRNA is prepared from the transcription template DNA by transcription, the transcription of the mRNA starts from the transcription start point on the 3' side of the promoter. Therefore, in the case where the translation template mRNA is prepared from the transcription template DNA, the length of the first sequence 2 can be at least the sequence of the transcription start point corresponding to the kind of the promoter.

[0087] The length of the first sequence 2 has no upper limit as long as it can form the junction with the second sequence 3 and in the range where the target protein can be synthesized. Also, the translation facilitator 1 disclosed in the present application is characterized in that the first sequence 2 can be made shorter than the existing 5' UTR by being designed to have the complementary sequence CS forming the junction with the second sequence 3. From the viewpoint of cost, the shorter the UTR, the better as long as the target protein can be synthesized. Therefore, the length of the nucleic acid of the first sequence 2 is not limited and can be, for example, 70 or less, 65 or less, 60 or less, 55 or less, 50 or less, 45 or less, 40 or less, 35 or less, 30 or less, 25 or less, 20 or less, 15 or less, 10 or less.

[0088] There is no particular limitation on the length of the nucleic acid in the second sequence 3, as long as it forms a junction with the first sequence 2. The length of the nucleic acid in the second sequence 3 can be, for example, 1 or more, 2 or more, 3 or more, 4 or more, or 5 or more. Furthermore, as described in Patent Documents 3-7, many reports indicate that the length of the 3'UTR affects the synthesis efficiency of the target protein. Therefore, from the viewpoint of improving the synthesis efficiency of the target protein, the nucleic acid in the second sequence 3 can be further lengthened, for example, to 20 or more, 25 or more, or 30 or more. The appropriate length can be adjusted according to the type of target protein and the length of the first sequence 2.

[0089] There is no upper limit to the length of the second sequence 3, as long as it can form a junction with the first sequence 2 and is within the range that allows for the synthesis of the target protein. However, similar to the first sequence 2, from a cost perspective, the shorter the UTR, the better, as long as the target protein can be synthesized. Therefore, the length of the nucleic acid in the second sequence 3 is not limited, and can be set to less than 55, 50, 45, 40, 35, 30, or 25.

[0090] Next, refer to Figure 2 A more detailed explanation of specific examples of the junction is provided. First, in this specification, "junction" refers to the region where the first sequence 2 and the second sequence 3 form a complementary pair. Furthermore, the "junction" may also be referred to as an adhesive portion, which is used to form a circular structure of the translation template mRNA when the first sequence 2 is attached to the 5' end of the coding region 4 and the second sequence 3 is attached to the 3' end of the coding region 4 to prepare the translation template mRNA.

[0091] There is no particular limitation on the number of complementary pairs (base pairs) forming junction C. The junction can be formed by all the nucleic acids (bases) contained in the first sequence 2 and / or the second sequence 3, or it can be formed by a portion of the nucleic acids. For example, in... Figure 2 In the example shown in (a), the joint C is formed by two adjacent sets of complementary pairs. Furthermore, in... Figure 2 In the example shown in (a), the two nucleic acids at the 5' end of the first sequence 2 form a complementary pair. The complementary nucleic acids can also be located downstream of the 5' end. In other words, the first sequence 2 can also include nucleic acids that do not form a complementary pair on the 5' side (upstream side) of the junction C. The second sequence 3 is similar to the first sequence 2; the complementary nucleic acids can form a complementary pair starting from the 3' end, or... Figure 2 As shown in example (a), complementary pairs are formed starting from the upstream side (5' side) of the 3' end.

[0092] like Figure 2As shown in (b), the junction C can also contain nucleic acid sequences that have not formed complementary pairs. In this case, the "junction" refers to the region from end to end of the complementary nucleic acid sequences. Figure 2 In the example shown in (b), the first sequence 2 has 5 nucleic acids, with 2 nucleic acids from the 5' end and 1 nucleic acid from the 3' end forming complementary pairs with the nucleic acids of the second sequence 3. Therefore, in Figure 2 In the example shown in (b), all the nucleic acids of the first sequence 2 form the junction C, and the junction C contains sequences that have not formed complementary pairs. On the other hand, in Figure 2 In the example shown in (b), a portion of the nucleic acid of the second sequence 3 forms the junction C, and the junction C contains sequences that have not formed complementary pairs.

[0093] like Figure 2 As shown in (c), the joint C may also contain more than one ring L. Figure 2 In the example shown in (c), one loop L is formed in the first sequence 2, but the number of loops L can be more than two. Furthermore, although the illustration is omitted, loops L can be formed only in the second sequence 3, or loops L can be formed in both the first sequence 2 and the second sequence 3.

[0094] like Figure 2 As shown in (d), the junction C may also contain more than one stem ring SL. Figure 2 In the example shown in (d), one stem loop SL is formed in the first sequence 2, but the number of SLs can be more than two. Furthermore, although the illustration is omitted, a stem loop SL can be formed only in the second sequence 3, or a stem loop SL can be formed in both the first sequence 2 and the second sequence 3.

[0095] Figure 2 The examples shown in (a) to (d) are merely examples of the configuration of joint C, and are not limited to the examples. Alternatively, Figure 2 The examples described in (a) to (d) are combined, for example, the first sequence 2 has a ring L, the second sequence 3 has a stem ring SL, etc. Furthermore, Figure 2 Examples (a) to (d) show the configuration of the junction C. For example, if the first sequence 2 has a sequence other than the one forming the junction C, the portion of the sequence that does not participate in the formation of the junction C may also contain a loop or a stem loop. Similarly, if the second sequence 3 has a sequence other than the one forming the junction C, the portion of the sequence that does not participate in the formation of the junction C may also contain a loop or a stem loop. There are no particular restrictions on the arrangement of the first sequence 2 and the second sequence 3, as long as it is within the range of forming the junction C and functioning as the translation promoter 1.

[0096] In addition, such as Figure 3As shown in example (a), even when sequences 2 and 3 contain nucleotides that do not form complementary pairs, the number of nucleotides that do not form complementary pairs can be adjusted. (See also...) Figure 3 The number of nucleic acids is specified. The nucleic acid sequence on the 3' side of the junction C of the first sequence 2, in other words, the nucleic acid sequence up to the start codon, is designated as sequence A (SQ.A). The nucleic acid sequence on the 5' side of the junction C of the second sequence 3, in other words, the nucleic acid sequence up to the stop codon, is designated as sequence B (SQ.B). Figure 1 In the example shown, sequence A = 2 and sequence B = 3. As shown in the embodiments described later, it is preferable that the number of sequences A and B in the protein expression is small. Although there is no limitation on the number of sequences A and B, it is preferred to be, for example, 25 or less, 20 or less, 15 or less, 13 or less, 11 or less, 10 or less, or 6 or less.

[0097] (Any additional structure of translation accelerator 1)

[0098] Reference Figure 4 and Figure 4 The arbitrary additional structures of translation accelerator 1 are described. Figure 4 This is a schematic diagram illustrating any additional structure of translation promoter 1. The second sequence 3 may also further include a continuous poly-A sequence 3a (adenine) at its 3' end. The poly-A sequence 3a can be as follows... Figure 4 As shown in (a), after the junction C connected to the second sequence 3, it can also be as follows: Figure 1 As shown in (b), it is connected to the 3' end of the second sequence 3 that follows the junction C.

[0099] Linking the polyA sequence 3a to the 3' end of mRNA can be expected to improve the translation efficiency of the target protein. The length of the polyA sequence 3a can be appropriately set within the range that improves the translation efficiency of the target protein. There is no limit to the length (number) of the polyA sequence 3a; for example, it can be set to 2 or more, 3 or more, 4 or more, 5 or more, 6 or more, 7 or more, 8 or more, 9 or more, 10 or more, 11 or more, 12 or more, 13 or more, 14 or more, or 15 or more. On the other hand, regarding the upper limit, as long as it is within the range that can synthesize the target protein, there is no particular restriction. However, from the perspective of primer design and cost, the length (number) of the polyA sequence 3a can be set to less than 50, less than 45, less than 40, less than 35, or less than 30.

[0100] (Implementation of translation template mRNA)

[0101] Reference Figure 4 and Figure 1 to Figure 4 The implementation method of the translation template mRNA is described. Translation template mRNA10 is...Figure 5 The first sequence 2 and the second sequence 3 of the translation facilitator 1 shown are provided with a coding region 4 that encodes the amino acid sequence of the target protein. By including the translation facilitator 1 disclosed in the present application, the 5' UTR of the translation template mRNA can be shortened. Although not shown in the figure, the coding region 4 can also include one or more structures selected from loops and stem loops.

[0102] Further, in the case where the nucleic acid sequence that does not form the junction C is present on the 3' side of the junction C of the first sequence 2, the nucleic acid sequence that does not form the junction C and the coding region 4 can also collectively form one or more structures selected from loops and stem loops. In the case where the nucleic acid sequence that does not form the junction C is present on the 5' side of the junction C of the second sequence 3, the nucleic acid sequence that does not form the junction C and the coding region 4 can also collectively form one or more structures selected from loops and stem loops.

[0103] In the case where the translation facilitator 1 is applied to the translation template mRNA, the nucleic acid on the 5' end side and the 3' end side of the coding region 4 is single-stranded. On the other hand, in the case where the translation facilitator 1 is applied to the transcription template DNA described later, the nucleic acid on the 5' end side and the 3' end side of the coding region 4 is double-stranded.

[0104] (transcription template DNA)

[0105] Reference Figure 5 An embodiment of the transcription template DNA will be described. Figure 5 is a schematic diagram that outlines the transcription template DNA. The transcription template DNA 100 includes a promoter region 5, a coding region 4 that encodes the amino acid sequence of the target protein, and a translation facilitator 1 (the first sequence 2 and the second sequence 3, and a poly A sequence 3a as needed). The translation facilitator 1 has been described above, and the promoter region 5 and the coding region 4 will be described in more detail below.

[0106] The promoter region 5 only needs to function as a transcription start portion when gene transcription is performed, and the sequence is not particularly limited, and a promoter sequence known in the art can be used. As the sequence constituting the promoter region 5, examples of well-known T7 promoter sequences, SP6 promoter sequences, T3 promoter sequences, and the like can be cited, but are not limited thereto.

[0107] The coding region 4 is only a nucleic acid sequence that encodes the amino acid of the target protein, and is linked in a manner operable by the promoter region 5, and is not particularly limited. Further, the first sequence 2 of the translation facilitator 1 is disposed between the promoter region 5 and the coding region 4.

[0108] Further, in Figure 5In the example shown, a sequence encoding a protein tag (N-terminal protein tag) that is attached to the target protein synthesized by the coding region 4 can be linked to the first sequence 2 side of the coding region 4, in addition to being linked immediately after the first sequence 2. By including the protein tag sequence, the target protein can be synthesized as a tagged fusion protein. Similarly, a sequence encoding a protein tag (C-terminal protein tag) that is attached to the target protein synthesized by the coding region 4 can be linked to the second sequence 3 side of the coding region 4. Either of the C-terminal protein tag sequence and the N-terminal protein tag sequence can be linked alone, or both can be linked.

[0109] The C-terminal protein tag and the N-terminal protein tag are, for example, a His (polyhistidine) tag, a GST (glutathione S-transferase) tag, an MBP (maltose binding protein) tag, a myc tag, a FLAG (flag) tag, and a BCCP (biotin carboxyl carrier protein) tag. In addition, as a visually detectable substance, for example, GFP (Green Fluorescent Protein), BFP (Blue Fluorescent Protein), CFP (Cyan Fluorescent Protein), RFP (Red Fluorescent Protein), YFP (Yellow Fluorescent Protein), EGFP (Enhanced Green Fluorescent Protein), ECFP (Enhanced Cyan Fluorescent Protein), ERFP (Enhanced Red Fluorescent Protein), EYFP (Enhanced Yellow Fluorescent Protein), TMR (TetraMethyl-Rhodamine), luciferase, and the like can be mentioned. Furthermore, the above-described C-terminal protein tag and N-terminal protein tag are merely examples, and other protein tags can also be used.

[0110] In addition, the C-terminal protein tag sequence and the N-terminal protein tag sequence can be directly linked to the N-terminal and / or C-terminal of any protein sequence, or can be linked via an appropriate linker sequence.

[0111] The transcription template DNA 100 is one of the elements used in the cell-free protein synthesis system described later. The transcription template DNA 100 can be a linear body synthesized by PCR or the like, or a circular body such as a plasmid. When the transcription template DNA 100 is in the form of a DNA double strand, the antisense strand has a poly-T sequence corresponding to the poly-A sequence 3a of the sense strand as the translation promoter 1.

[0112] The transcription template DNA 100 can be obtained by a publicly known chemical method or genetic engineering method, or can be obtained using a nucleic acid amplification reaction such as PCR using a gene or cDNA as a template, as described later. In addition, the translation template mRNA 10 can be obtained by a publicly known synthesis method of a translation template mRNA suitable for a two-step method or the like.

[0113] (Method for producing transcription template DNA)

[0114] The method for producing the transcription template DNA 100 for the cell-free protein synthesis system can include a step of synthesizing the transcription template DNA 100 by performing a nucleic acid amplification reaction on DNA containing a coding region 4 of a target protein. The transcription template DNA 100 can be obtained, for example, by performing a nucleic acid amplification reaction of PCR on DNA containing a coding region 4 encoding the amino acid sequence of a target protein, using a properly designed primer set.

[0115] In addition, the transcription template DNA 100 can be obtained using a vector. The template nucleic acid is obtained by inserting DNA containing at least a coding region 4 encoding the amino acid sequence of a protein into a vector. The vector thus prepared can be used as the transcription template DNA itself, or a DNA fragment equivalent to the transcription template DNA can be cut out from the vector and used.

[0116] The transcription template DNA 100 can be applied to the cell-free protein synthesis system as a PCR reaction solution (i.e., without purifying the transcription template DNA 100), or can be appropriately purified and applied to the cell-free protein synthesis system.

[0117] (Method for producing translation template mRNA)

[0118] The production method of the translation template mRNA for the cell-free protein synthesis system can include the following process: synthesizing the translation template mRNA 10 using the transcription template DNA 100 in the absence of cells and in the presence of elements for transcribing the transcription template DNA into mRNA. More specifically, for the transcription template DNA 100 from a PCR reaction solution or a vector containing the transcription template DNA 100, the transcription template DNA 100 is incubated with an RNA polymerase applicable to the promoter region 5 possessed by the transcription template DNA 100 and substrates for RNA synthesis (four ribonucleotide triphosphates) and the like under a composition containing components necessary for the transcription reaction at, for example, about 20°C to 60°C, preferably at about 30°C to 42°C, for an appropriate time, whereby the translation template mRNA 10 can be obtained. In addition, the above example shows the step of synthesizing the translation template mRNA 10 from the transcription template DNA 100. Alternatively, the translation template mRNA 10 can be directly synthesized by nucleic acid synthesis depending on the length of the mRNA.

[0119] The production method of the translation template mRNA 10 can be implemented as part of the transcription / translation system of the cell-free protein synthesis system, or as a process before the translation template mRNA 10 is applied to the translation system. The translation template mRNA 10 thus obtained can be applied to the translation system as a reaction solution.

[0120] (Method for producing protein)

[0121] The method for producing protein can include the following process: synthesizing protein using the translation template mRNA 10 in the absence of cells and in the presence of elements for translating the translation template mRNA into protein. The method for producing protein can also include the following process: synthesizing the translation template mRNA 10 using the transcription template DNA 100 in the absence of cells and in the presence of elements for transcribing the transcription template DNA into mRNA. Further, the method for producing protein can also include the following process: synthesizing the transcription template DNA 100 by performing a nucleic acid amplification reaction on a DNA containing the coding region 4 of the target protein. The method for producing protein disclosed in the present application uses the translation template mRNA 10 containing the translation facilitator 1 and the transcription template DNA 100, and thus can shorten the 5'UTR.

[0122] The embodiments disclosed in the present application will be specifically described below by citing examples, but the examples are only for illustrating the embodiments and do not represent a limitation or restriction on the scope of the invention disclosed in the present application.

[0123] Example

[0124] <Examples 1 to 19, Comparative Example 1>

[0125] (1) Structure of transcription template DNA

[0126] Reference Figure 5 A summary of the transcription template DNA used in Examples 1 to 19 and Comparative Example 1 will be described. As shown in Table 1, the transcription template DNA was composed of the following: Name

[0127] • 5' untranslated region (5'UTR): T7 promoter 5 + first sequence 2

[0128] • Coding region 4: GFP-His

[0129] • 3' untranslated region (3'UTR): second sequence 3 (nucleic acid length of 20) + poly A sequence 3a (length of A is 15)

[0130] In Examples 1 to 19 and Comparative Example 1, the length and kind of the first sequence 2 of the TRANSLATION ENHANCER were changed to conduct experiments. The sequences other than the first sequence 2 were as follows.

[0131] Table 1

[0132]

[0133] The first sequence 2 (First SEQ) of Examples 1 to 19 and Comparative Example 1 is shown in Table 2. In Examples 1 to 19, the length of the first sequence 2 was changed between 5 and 33. In addition, the Ω of Comparative Example 1 was a known 5'UTR (nucleic acid length of 66) TRANSLATION ENHANCER from tobacco mosaic virus, and the details are described in Japanese Patent Application Publication No. 2013-503640.

[0134] Table 2

[0135] Sequence of the first sequence that translates the facilitator (5' to 3') SEQ. ID. 1-1-A (Example 1) GGGCC 1-2-A (Example 2) 4 CGGCCTGA 1-3-A (Example 3) 5 GGGCCAAGA 1-4-A (Example 4) 6 GGGCCAAAGA 1-5-A (Example 5) 7 GGGCCAAAAGA 1-6-A (Example 6) 8 GGGCCGAAAAGA 1-7-A (Example 7) 9 GGGCCGGAAAAGA 1-8-A (Example 8) 10 GGGCCAGGAAAAGA 1-9-A (Example 9) 11 GGGCCGAGGAAAAGA 1-10-A (Example 10) 12 GGGCCAGAGGAAAAGA 1-11-A (Example 11) 13 GGGCCGAAGAAGAGGAAAAGA 1-12-A (Example 12) 14 GGGCCTTTTCAAGAAGAGGAAAAGA 1-13-A (Example 13) 15 GGGCCCTTTTCAAGAAGAGGAAAAGA 1-14-A (Example 14) 16 GGGCCACTTTTCAAGAAGAGGAAAAGA 1-15-A (Example 15) 17 GGGCCCACTTTTCAAGAAGAGGAAAAGA 1-16-A (Example 16) 18 GGGCCTCACTTTTCAAGAAGAGGAAAAGA 1-18-A (Example 17) 19 GGGCCGGTCACTTTTCAAGAAGAGGAAAAGA 1-19-A (Example 18) 20 GGGCCAGGTCACTTTTCAAGAAGAGGAAAAGA 1-20-A (Example 19) 21 GGGCCCAGGTCACTTTTCAAGAAGAGGAAAAGA Omega (Comparative Example 1) 22 GGGTATTTTTACAACAATTACCAACAACAACAAACAACAAACAACATTACAATTACTATTTACAATTAC Reagent 23

[0136] (2) Preparation of transcription template DNA by PCR

[0137] In Example 1, one set of primers (forward side: FW-1-1A, reverse side: RV) shown in Table 3 was designed, and the transcription template DNA was prepared by PCR. In addition, the primers were prepared by a trust synthesis service (Eurofin Genomics Co., Ltd.). The forward primers of Examples 2 to 19 used the forward primers in which the bold underlined portion (GGGCC) of FW-1-1-A of Table 3 below was replaced with the sequences of Examples 2 to 19 of Table 2, respectively. The reverse primers of Examples 2 to 19 used the same RV as Example 1. The Ω of Comparative Example 1 was prepared in the same manner as Example 1, except that FW-Ω (SEQ.ID.25) was used in the forward primer. ​

[0138] Table 3

[0139]

[0140] The composition of the reaction solution for PCR is shown in Table 4. In addition, the reaction cycle is shown in Table 5. Further, the reagents and equipment used are as follows.

[0141] • PCR enzyme: KOD-Plus-Neo, manufactured by TOYOBO Co., Ltd.

[0142] • Thermal Cycler: Mastecycler X50s, manufactured by Eppendorf Co., Ltd.

[0143] Table 4

[0144] Volume 10x pCR Buffer 5 μL 2 mM dNTPs 5 μL 3 μL 25 mM MgSO4 10 μM Fw Primer 1 μL 10 μM Rv Primer 1 μL Plasmid 1 ng KOD Polymerase DNA 1 μL Ultra-pure water 50 μL Reagent

[0145] Table 5

[0146]

[0147] (3) Transcription reaction

[0148] Next, using the prepared transcription template DNA, a translation template mRNA was prepared. The transcription reaction was performed using 2.5 μl of the previously prepared PCR reaction solution (containing the transcription template DNA) in the reaction solution shown in Table 5 below using PSS4050 manufactured by NUPROTEIN Co., Ltd., at 37°C for 3 hours.

[0149] Table 6

[0150] Volume 10x Transcription Buffer 2.5 μL 25 mM NTP Mix 2.5 μL 100 mM DTT 1.25 μL T7 RNA Polymerase 1 μL PCR Product 2.5 μL RNAase-free water 15.25 μL Reagent

[0151] In 25 μl of the transcription reaction solution, 10 μl of 4M ammonium acetate was added, mixed well, 100 μl of 100% ethanol was further added, mixed by inversion, and centrifuged for a few seconds using a benchtop centrifuge, and then left to stand at -20°C for 10 minutes. Then, centrifugation was performed (12,000 rpm, 15 minutes, 4°C). After removing the supernatant, centrifugation was performed using a benchtop centrifuge for a few seconds. The supernatant was again removed, and left to stand until the precipitate was dried. Then, 40 μl of RNase-free water (DEPC water) was added to 25 μl of the transcription reaction solution, and the precipitate was suspended well using a stirring bar. According to the PSS4050 protocol, nucleic acid concentration measurement was performed so that the amount of mRNA in 110 μl of the translation solution was 35 μg, filled to 80 μl, and used as a translation template mRNA solution.

[0152] (4) Translation reaction

[0153] Next, using a translation reaction solution of the following composition, the reaction was performed in a constant temperature chamber at 16°C for 10 hours. Further, a composition solution from which the translation template mRNA was removed from the following composition was prepared, and then, after the composition solution was returned to room temperature, the translation template mRNA was added, and the reaction was performed in a bubble-free manner by pumping. As for the wheat germ extract and the amino acid mix, PSS4050 manufactured by NUProtein Co. was used.

[0154] Table 7

[0155] Volume Wheat Germ Extract 20 μL Amino Acid Mix 40 μL mRNA Capacity 160 μL ​

[0156] After the reaction, the reaction solution was recovered in an eppendorf tube, and centrifugal separation was performed (15,000 rpm, 15 minutes, 4°C), and the supernatant was used as a GFP solution after completion of translation.

[0157] [Fluorescence measurement of synthesized GFP]

[0158] The synthesized GFP in Examples 1 to 19 and Comparative Example 1 was subjected to fluorescence measurement. As a sample, 220 μl of a solution containing the synthesized GFP was used, excitation light of wavelength 475 nm was irradiated, and the fluorescence from the GFP was measured using a microplate reader (absorption filter 500-550 nm). As the microplate reader, GloMax (registered trademark) microplate reader (Promega Co.) was used. The measurement results are shown in Figure 6 . Figure 6 is a graph in which the measured values of Examples 1 to 19 are expressed as relative values with respect to the measured value of Ω of Comparative Example 1, which is taken as 100.

[0159] Further, among the translation template mRNAs prepared in the examples, the translation template mRNAs of Examples 1, 3, 18, and 19 were analyzed using secondary structure prediction software MXfold (http: / / www.dna.bio.keio.ac.jp / mxfold / ), and the secondary structures were visualized using forna (http: / / rna.tbi.univie.ac.at / forna / ). Figure 7A and Figure 7B is an enlarged view of the vicinity of the junction C of the secondary structures of Examples 1, 3, 18, and 19 which were visualized.

[0160] Further, Figure 7A and Figure 7BThe "start" arrow in the figure indicates the A of the start codon, i.e., "AUG". The 5' side of the A of the start arrow corresponds to the first sequence 2. The "stop" in the figure indicates the G of the stop codon, i.e., "UAG". The 3' side of the G of the stop arrow corresponds to the second sequence 3.

[0161] By Figure 7A and Figure 7B It can be confirmed that the first sequence 2 and the second sequence 3 can form the junction C by designing the sequence of the translation promoter so as to contain the complementary sequence. Furthermore, by studying the length and the sequence of the first sequence 2 and the second sequence 3, it can be confirmed that, for example,

[0162] (1) The first sequence 2 can form a stem loop SL alone on the 3' side of the junction C (the side of the coding region 4) (Examples 18 and 19);

[0163] (2) A loop L can be formed in the junction C (Example 19);

[0164] (3) A loop L can be formed on the mRNA by the cooperation of the first sequence 2 and / or the second sequence 3 with the coding region 4 (Examples 1, 3 and 18). In addition, with respect to other examples, although the illustration of the secondary structure is omitted, as shown in Table 2, the 5 nucleic acid sequences on the 5' end side of the first sequence 2 are the same in all the examples, and the second sequence 3 is also the same in all the examples, and thus it is clear that the junction C can be formed.

[0165] As Figure 6 shown, even if the length of the nucleic acid of the first sequence 2 is only 5 (1-1-A), a protein can be synthesized from the mRNA, and the translation promoting effect shown in Example 3 in which the length is 9 (1-3-A) is about 2.5 times as large as that of Ω which is known as a translation promoter of 5' UTR. From the above results, it can be confirmed that the 5' UTR can be shortened by forming the junction C in the 5' UTR and the 3' UTR. In addition, the mechanism by which the 5' UTR can be shortened is not clear, but from the secondary structure of Figure 7A and Figure 7B , it is presumed that the position of the start codon and the stop codon becomes close by forming the junction C, and the next translation is rapidly started after the translation is finished.

[0166] <Examples 20 to 29>

[0167] To confirm the above presumption, an experiment changing the sum of the number of nucleic acids of the first sequence 2 from the junction C to the start codon and the second sequence 3 from the stop codon to the junction C was performed. Specifically, the first sequence 2 described in Examples 1 to 19 was set to the 10 nucleic acid sequences of Table 8 (SEQ. ID. 27). Also, the second sequence 3 was designed so that the "GGGCC" portion forms the junction, and the "AAAGA" portion does not form the junction C. That is, the nucleic acids (sequence A) from the junction C of the first sequence 2 to the start codon were fixed to 5.

[0168] The sequence forming the junction C of the second sequence 3 is shown in Table 8, and in Example 20, it was set to "GCCC" and designed so that the last G including the stop codon forms the junction C with "GGGCC" of the first sequence. Since the last G of the stop codon also forms the junction C, the number of nucleic acids from the stop codon to the junction C (sequence B) of Example 20 is 0.

[0169] In Example 21, on the basis of setting the sequence forming the junction C of the second sequence 3 to "GGCCC" and forming the junction C with "GGGCC" of the first sequence 2, it was designed so that the number of nucleic acids from the junction C to the stop codon (sequence B) is one of adenine (A) (the underlined bold character A in SEQ. ID. 30 of Table 8). Examples 22 to 28 adjust the length by adding only adenine (A) to the sequence B of Example 21, and therefore the description of the sequence table is omitted. The promoter is the same as in Examples 1 to 19, and the coding region 4 uses GFP shown in Table 8.

[0170] Table 8

[0171]

[0172] The outline of Examples 20 to 28 is described below. The length of sequence A is all 5. Sequence B is the number of adenine (A).

[0173] • Example 20 (1-4-A / RV0): Sequence B = 0, Sequence A+B = 5

[0174] • Example 21 (1-4-A / RV1A): Sequence B = 1, Sequence A+B = 6

[0175] • Example 22 (1-4-A / RV5A): Sequence B = 5, Sequence A+B = 10

[0176] • Example 23 (1-4-A / RV10A): Sequence B = 10, Sequence A+B = 15

[0177] • Example 24 (1-4-A / RV15A): Sequence B = 15, Sequence A+B = 20

[0178] • Example 25 (1-4-A / RV20A): Sequence B = 20, Sequence A+B = 25

[0179] • Example 26 (1-4-A / RV30A): Sequence B = 30, Sequence A+B = 35

[0180] • Example 27 (1-4-A / RV40A): Sequence B = 40, Sequence A+B = 45

[0181] • Example 28 (1-4-A / RV50A): Sequence B = 50, Sequence A+B = 55

[0182] • As a comparative example (Example 29, GFP-1+PlyA), a translation template mRNA was prepared in which (1) the number of nucleic acids of the first sequence 2 was 23, the number of nucleic acids of the junction C forming the first sequence 2 was 4, the number of nucleic acids of the sequence A was 19, and (2) the number of nucleic acids of the second sequence 3 was 40 (including the poly A sequence), the number of nucleic acids of the junction C forming the second sequence 3 was 4, and the number of nucleic acids of the sequence B was 21.

[0183] Figure 8 The figures are graphs in which the translation template mRNAs prepared in Examples 20, 21, and 29 were analyzed using the secondary structure prediction software MXfold (http: / / www.dna.bio.keio.ac.jp / mxfold / ), and the secondary structure was visualized using forna (http: / / rna.tbi.univie.ac.at / forna / ). In Examples 20, 21, and 29, it was confirmed that the number of the sequence A and the sequence B was consistent with the design. Although not shown in the figures, it was confirmed that the translation template mRNAs prepared in Examples 22 to 28 were also consistent with the design.

[0184] The forward primer (FW-1-4-A) of Examples 20 to 28 was all the same. The reverse primer (RV-0) of Example 20 and the reverse primer (RV-1) of Example 21 are shown in Table 9. In addition, the reverse primer of Examples 22 to 28 can be changed only by changing the length of "T" of "GGGCCTC" (underlined portion of SEQ. ID. 33 of Table 9) of RV-1. Therefore, the description of the reverse primer of Examples 22 to 28 is omitted. The forward primer (FW-GFP-1+PlyA) and the reverse primer (RV-GFP-1+PlyA) of Example 29 are shown in Table 9.

[0185] Table 9

[0186]

[0187] Figure 9 The results of the fluorescence measurement of the synthesized GFP are shown in Table 6. Figure 9 The graph in which the measured value of the comparative example (Example 29, GFP-1 + PlyA) is taken as 100 and the measured values of Examples 20 to 28 are shown as relative values to Example 29 is shown in FIG. 1. Figure 9 It was confirmed that the translation efficiency was improved if the number of the sequence A and the sequence B was small, in other words, if the initiation codon and the termination codon were arranged adjacently.

[0188] <Example 30, Comparative Example 2>

[0189] Next, an experiment in which the polyA sequence on the 3' end side of the second sequence 3 of Example 29 was removed was performed. Example 30 was the same as Example 29 except that the polyA sequence of Example 29 was removed. In Comparative Example 2, the translation promoter described in Japanese Patent Application Publication No. 2003-556626 was used as the 5'UTR, and the polyA sequence described in International Publication No. 2016 / 143799 was used as the 3'UTR. In addition, the 3'UTR of Comparative Example 2 had a polyA sequence linked after the termination codon, and thus a joint was not formed. The primers are shown in Table 10. The FW of Example 30 was the same as that of Example 29. The fluorescence of GFP was measured in the same steps as in the above examples except that the primers were different.

[0190] Table 10

[0191]

[0192] Figure 10 The results of the fluorescence measurement of the synthesized GFP are shown in Table 6. In addition, the measured results of Example 29 are also shown for comparison. Figure 10 The graph in which the measured value of Comparative Example 2 is taken as 100 and the measured values of Examples 20 to 28 are shown as relative values to Comparative Example 2 is shown in FIG. 2. Figure 10 It was confirmed that more protein could be synthesized by forming a joint by the 5'UTR and the 3'UTR compared to the known translation template mRNA in which the 5' translation promoter and the 3' translation promoter were combined. In addition, it was confirmed that the translation efficiency was further improved if the translation promoter disclosed in the present application was added with a polyA sequence on the 3' side of the second sequence 3.

[0193] Industrial applicability

[0194] By the translation promoter disclosed in the present application, the 5'UTR can be shortened. Therefore, it is useful in industries such as the pharmaceutical industry, research institutions, and the like in which cell-free protein synthesis is required.

[0195] Explanation of reference signs

[0196] 1…translation promoter, 2…first sequence, 3…second sequence, 3a…polyA sequence, 4…coding region, 5…promoter region, 10…translation template mRNA, 100…transcription template DNA

[0197] C… junction, CS… complementary sequence, L… loop, SL… stem loop

Claims

1. A translation template mRNA, comprising: Translation facilitators; as well as The coding region that encodes the amino acid sequence of the target protein. The translation promoter is a combination of the first and second sequences. The first sequence is a nucleic acid serving as a 5' untranslated region, which is adjacent to the 5' end of the coding region encoding the amino acid sequence of the target protein. The second sequence is a nucleic acid serving as the 3' untranslated region, which is adjacent to the 3' end of the coding region encoding the amino acid sequence of the target protein. When analyzing translation template mRNA using MXfold, the first and second sequences form a junction. The sum of the number of nucleic acids on the 3' side of the junction of the first sequence and the number of nucleic acids on the 5' side of the junction of the second sequence is less than 25.

2. The translation template mRNA according to claim 1, wherein, The length of the first sequence of nucleic acids is 3 or more.

3. The translation template mRNA according to claim 1, wherein, The length of the second sequence of nucleic acid is more than 20.

4. The translation template mRNA according to claim 2, wherein, The length of the second sequence of nucleic acid is more than 20.

5. The translation template mRNA according to any one of claims 1 to 4, wherein, The second sequence also includes a continuous poly-A sequence of A (adenine) on the 3' side of the junction.

6. The translation template mRNA according to any one of claims 1 to 4, wherein, The first sequence and / or the second sequence includes more than one stem or stem ring.

7. The translation template mRNA according to claim 5, wherein, The first sequence and / or the second sequence includes more than one stem or stem ring.

8. A transcription template DNA for cell-free protein synthesis systems. The transcription template DNA includes: The region encoding the translation template mRNA according to any one of claims 1 to 7; as well as The starter subregion is configured at the 5' end of the first sequence.

9. A method for producing translation template mRNA for a cell-free protein synthesis system, comprising the following steps: In the absence of cells and in the presence of elements for transcribing the template DNA into mRNA, the template DNA of claim 8 is used to synthesize the template mRNA for translation.

10. A method for producing a protein, comprising the following steps: In the absence of cells and in the presence of elements for translating translation template mRNA into protein, protein is synthesized using the translation template mRNA as described in any one of claims 1 to 7 or the translation template mRNA produced by the method for producing translation template mRNA as described in claim 9.

Citation Information

Patent Citations

  • Template molecule having generality and high efficiency function and cell-free protein-synthesizing means using the same

    JP2005247857A

  • Method for synthesizing cell-free protein

    JP2007097438A

  • Method for detecting antibody by using cell-free method for synthesizing protein, and method for screening specific protein

    JP2008035701A

  • TRANSLATION REACTION-PROMOTING DNA FRAGMENT AND TEMPLATE DNA USING THE SAME, mRNA, AND REACTION LIQUID FOR CELL-FREE PROTEIN SYNTHESIS

    JP2009072207A

  • Translation promoting sequence and method for synthesizing cell-free protein using the same

    JP2013158342A