DC cell-based bifunctional nanobody and its construction method and application
By constructing bifunctional nanoantibodies on pig DC cells, and using phage display technology to screen and recombinantly express pig DC-specific and virus-specific nanoantibodies, the problem of low antigen presentation efficiency in pig DC targeting research was solved, and an efficient and simple antigen targeting method was achieved, which was suitable for a variety of pig vaccines.
Patent Information
- Application Number
- CN202210477668.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-10-26
- Filing Date
- 2022-04-29
- Publication Date
- 2025-07-22
- Estimated Expiration
- 2042-04-29
AI Technical Summary
In the prior art, there is a lack of effective targeted antigen design in pig DC targeting research, resulting in poor immune effect. The existing assembly methods are complicated and easy to affect the antigen structure, making it difficult to achieve efficient antigen presentation on pig DC cells.
Bifunctional nanoantibodies were used to screen pig DC-specific and virus-specific nanoantibodies through phage display technology, and recombinantly expressed using linker elements to achieve DC targeting of antigens, avoid the impact of chemical coupling and gene fusion on antigen structure, and directly incubate and assemble with intact pathogen particles.
It realizes efficient antigen presentation on pig DC cells, improves the effectiveness of immune response, simplifies the operation process, reduces production costs, and is suitable for a variety of vaccine antigens for pigs, with good stability and versatility.
Smart Images

Figure CN115304678B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to a bifunctional nanobody based on dendritic cells and a construction method and application thereof. Background Art
[0002] Dendritic cells (DCs) are the most powerful professional antigen-presenting cells in the body. Active targeted delivery of antigens to DCs is of great significance for improving antigen presentation efficiency and antigen immunopotency, and is a frontier hotspot in the field of research and application of new vaccine preparations. DC targeting of antigens is mainly achieved by targeting receptors on the surface of DC cells. After exogenous antigens are targeted to DC cells by antibodies or natural ligands, the DC cells take them up, process them, and present them to corresponding effector cells respectively to activate the immune response. Compared with non-targeted antigens, targeted antigens have significant improvements in both improving antigen presentation efficiency and reducing antigen dosage, and have good application values in anti-viral infection and tumor treatment. Currently, multiple DC-targeted human vaccines have entered the clinical trial stage. However, there are few studies on porcine DC targeting, the types, structures, and functions of porcine DC cell surface receptors.
[0003] As a DC-specific antigen-presenting receptor, CD205 belongs to the macrophage mannose receptor family of C-type lectin receptors (CLRs), also known as DEC-205 or Ly75. It is the only receptor that is most widely expressed in DC cells in the T cell region of the body's lymphoid organs and plays an important role in the antigen presentation process. Studies have shown that compared with non-targeted antigens, CD205 targeting can increase the OVA antigen presentation efficiency by at least 100 times and reduce the antigen dosage by nearly 1000 times; by targeting the hepatitis B virus preS antigen to CD205, a highly efficient IgG1 and IgG2a antibody response can be generated in mice, providing preventive and therapeutic effects against hepatitis B virus infection; in human melanoma clinical trials, it was found that by targeting the NY-ESO-1 antigen to CD205, a highly efficient humoral and cellular immune response can be generated, and the conditions of some patients were stable, with tumor regression and lesion shrinkage. CD205 has become an important target in the research and application of new vaccine preparations, and CD205-targeted human vaccines have also entered the clinical trial stage. In veterinary research, CD205 targeting has attracted increasing attention. Studies have shown that by targeting the Rickettsia MSP1a antigen to bovine CD205, the IFN-γ level and antibody level can be significantly increased; by targeting the avian influenza virus HA antigen to chicken CD205, a highly efficient antibody level can be generated 14 days after immunization; by targeting the Rift Valley fever virus eGn antigen to ovine CD205, although the IFN-γ level can be increased, the antibody level and the protective effect against virus challenge are reduced; by targeting the GP345M fusion antigen of PRRSV to porcine CD205, although relatively good IFN-γ and antibody levels can be generated, no protective effect against virus challenge can be produced, and there is no significant difference in porcine lung lesions; there are no reports on CD205 targeting of FMDV, PEDV, and CSFV. In summary, in the existing research reports, due to differences in species and targeted antigens, the immune effects are also different; moreover, the mechanism of targeted presentation is still unclear, and there are also deficiencies in the design of targeted antigens. In the existing research reports, protein antigens are mostly used as targeted antigens. Due to limited antigen epitopes, protein antigens often cannot produce ideal immune effects. Therefore, how to design more effective targeted antigens will play an important role in improving DC-targeted immune efficacy. The DC targeting of antigens mainly uses specific monoclonal antibodies or single-chain antibodies corresponding to DC surface receptors to assemble with antigens through chemical conjugation or gene fusion expression methods. This process is relatively cumbersome and easily affects the antigen structure. Therefore, exploring new antigen assembly strategies is of great significance for improving DC-targeted immune efficacy.
[0004] As the smallest antigen-binding fragment with complete functions known so far, nanobodies have the characteristics of small relative molecular mass (about 15KDa), low immunogenicity, high stability, and easy to be efficiently produced by microbial genetic engineering systems compared with monoclonal antibodies and single-chain antibodies. The research on nanobodies in DC targeting also shows good application prospects. Research shows that by preparing specific nanobodies against MHCII, CD11b, and CD36, and using GFP, yeast ubiquitin, OVA, and influenza virus HA for DC targeting research respectively, good immune responses can be generated, and virus challenge protection against influenza virus can be produced in mice; by preparing specific nanobodies against mouse CD206, targeted presentation of nanogels and reporter genes can be achieved. So far, in the research on porcine DC or CD205 targeting, monoclonal antibodies and single-chain antibodies are still mainly used, and no porcine DC or CD205-specific nanobodies have been reported, nor have porcine DC cell-targeted bifunctional nanobodies and porcine CD205-targeted bifunctional nanobodies been reported. Summary of the Invention
[0005] Object of the Invention: The technical problem to be solved by the present invention is to provide a bifunctional nanobody that can be used for antigen targeting of porcine DC cells. The present invention adopts a new technical idea, and realizes DC targeting of antigens by using the specific binding between antigens and nanobodies and the bridging effect of bifunctional nanobodies. This method can not only avoid the influence of chemical coupling and gene fusion expression methods on the antigen structure, but also use intact pathogen particles to replace conventional protein antigens, make full use of the natural antigen epitopes of intact pathogen particles, and is easy to be applied in clinical practice.
[0006] Another technical problem to be solved by the present invention is to provide a construction method of the bifunctional nanobody.
[0007] Finally, the technical problem to be solved by the present invention is to provide the application of the bifunctional nanobody.
[0008] Technical Solution: To solve the technical problems existing in the prior art, the present invention provides a bifunctional nanobody based on DC cells. The bifunctional nanobody is a target protein obtained by connecting the gene of a DC cell-based target protein-specific nanobody and the gene encoding a virus antigen-specific nanobody with a particle size of less than 150 nm through a linker element to obtain a target gene fragment and then performing recombinant expression.
[0009] Among them, the DC cell-based target protein-specific nanobody includes a nanobody encoding DC cell specificity or a nanobody encoding DC cell antigen presentation receptor specificity.
[0010] Among them, the target protein-specific nanobody of the porcine DC cells and the porcine virus antigen-specific nanobody with a particle size within 150 nm are respectively screened and obtained by using phage display technology.
[0011] Furthermore, the particle size of the porcine virus antigen is 17 nm to 130 nm. Furthermore, the particle size of the porcine virus antigen is 20 nm to 60 nm. Furthermore, the particle size of the porcine virus antigen is 20 nm to 50 nm. Furthermore, the particle size of the porcine virus antigen is one or several of 17 nm, 20 nm, 25 nm, 50 nm, 60 nm or 130 nm.
[0012] Among them, the porcine virus antigen includes one or several of porcine circovirus antigen (Porcine Circovirus, PCV, virus particle diameter is about 17 nm), porcine parvovirus antigen (Porcine Parvovirus, PPV, virus particle diameter is about 20 nm), foot-and-mouth disease virus antigen (Foot and Mouth Disease Virus, FMDV, virus particle diameter is about 25 nm), classical swine fever virus antigen (Classical Swine Fever Virus, CSFV, virus particle diameter is about 50 nm), porcine reproductive and respiratory syndrome virus antigen (Porcine Reproductive and Respiratory Syndrome Virus, PRRSV, virus particle diameter is about 60 nm) or porcine epidemic diarrhea virus antigen (Porcine Epidemic Diarrhea Virus, PEDV, virus particle diameter is about 130 nm).
[0013] The content of the present invention also includes a preparation method of the bifunctional nanobody based on DC cells, comprising the following steps:
[0014] 1) Immunize camels or alpacas with freshly induced and differentiated DC cells. After multiple immunizations, extract the cDNA of their peripheral blood lymphocytes using molecular biology principles, amplify the antibody heavy chain variable region gene library, and construct a phage display nanobody gene library;
[0015] 2) Coat the freshly induced and differentiated DC cells as antigens, and perform 3 - 5 rounds of affinity screening using phage display technology to obtain 1 porcine DC-specific nanobody;
[0016] 3) Immunize camels or alpacas with the said virus. After multiple immunizations, extract the cDNA of their peripheral blood lymphocytes using molecular biology principles, amplify the antibody heavy chain variable region gene library, and construct a phage display nanobody gene library;
[0017] 4) Coat the virus as an antigen and perform 3 - 5 rounds of affinity screening using phage display technology to obtain one virus - specific nanobody;
[0018] 5) Connect the gene sequence of the porcine DC - specific nanobody and the gene sequence of the virus - specific nanobody to obtain a target gene fragment and recombinantly express the obtained target protein: Construct a bifunctional nanobody expression system using the gene sequences of the porcine DC - specific nanobody and the pathogen - specific nanobody by overlap extension PCR method. After purification of the expression product, incubate it with the pathogen antigen, immunize pigs, collect samples such as post - immunization serum and lymph nodes, and detect antibodies and cytokines for immunopotency evaluation.
[0019] The present invention also includes a bifunctional nanobody of porcine foot - and - mouth disease virus (FMDV) type O targeting porcine dendritic cells (DCs). The bifunctional nanobody of porcine FMDV type O targeting porcine DCs is a target protein obtained by further recombinantly expressing a target gene fragment obtained by connecting the gene encoding the DC - specific nanobody and the gene encoding the porcine FMDV type O - specific nanobody with a linker element.
[0020] Among them, the amino acid sequence of the porcine DC - specific nanobody Nb131 is shown as SEQ ID NO.: 5, and the amino acid sequence of the porcine FMDV type O - specific nanobody Nb104 is shown as SEQ ID NO.: 6.
[0021] Among them, the nucleotide sequence of the gene encoding the porcine DC - specific nanobody Nb131 is shown as SEQ ID NO.: 1, and the nucleotide sequence of the gene encoding the porcine FMDV type O - specific nanobody Nb104 is shown as SEQ ID NO.: 2.
[0022] Among them, the linker element includes but is not limited to the linker element (G4S)4, and may also include common (G4S) n , n = 1 - 6, as well as the hinge region of camel - derived antibody IgG2c, the hinge region of human antibody IgA, etc. The linker element is the linker element (G4S)4. The nucleotide sequence of the linker element (G4S)4 is shown as SEQ ID NO.: 3, and the amino acid sequence of the linker element (G4S)4 is shown as SEQ ID NO.: 7.
[0023] Among them, the amino acid sequence of the bifunctional nanobody Nbl31 - 104 of porcine FMDV type O targeting porcine DCs is shown as SEQ ID NO.: 8.
[0024] Among them, the equilibrium dissociation constant (K) of the porcine DC - specific nanobody Nb131 and porcine DC cells D) is 3.43×10 -9 , the equilibrium dissociation constant (KD) of the porcine O-type FMDV antigen-specific nanobody Nb104 and the porcine O-type FMDV antigen is 6.82×10 -10 , the equilibrium dissociation constants (KD) of the porcine DC / FMDV bifunctional nanobody Nb131-104 and porcine DC cells are 6.02×10 -8 , the equilibrium dissociation constant (KD) of the porcine DC / FMDV bifunctional nanobody Nb131-104 and the porcine O-type FMDV antigen is 2.41×10 -9 .
[0025] The present invention also includes nucleic acids or genes encoding the porcine O-type FMDV bifunctional nanobody Nb131-104 targeting porcine DC cells, and the nucleotide sequence thereof is as shown in SEQ ID NO.: 4.
[0026] The present invention also includes a method for constructing the porcine O-type FMDV bifunctional nanobody targeting porcine DC cells, and the construction method includes the following steps: inserting the gene encoding the bifunctional nanobody Nb131-104 of porcine O-type FMDV targeting porcine DC cells into the pMECS vector, and then introducing it into Escherichia coli WK6 competent cells to obtain recombinant bacteria; inducing the recombinant bacteria to express the target protein, and purifying the bifunctional nanobody Nb131-104 after lysing the recombinant bacteria.
[0027] The present invention also includes a bifunctional nanobody of porcine CSFV targeting porcine DC cells, and the bifunctional nanobody of porcine CSFV targeting porcine DC cells is a target protein obtained by ligating the gene encoding the DC-specific nanobody and the gene encoding the porcine CSFV-specific nanobody with a linker element and then further recombinantly expressing the obtained target gene fragment.
[0028] Among them, the amino acid sequence of the porcine DC-specific nanobody Nb131 is as shown in SEQ ID NO.: 5, and the amino acid sequence of the porcine CSFV-specific nanobody Nb62 is as shown in SEQ ID NO.: 20.
[0029] Among them, the nucleotide sequence of the gene encoding the porcine DC-specific nanobody Nb131 is as shown in SEQ ID NO.: 1, and the nucleotide sequence of the gene encoding the porcine CSFV-specific nanobody Nb62 is as shown in SEQ ID NO.: 18.
[0030] Among them, the linker element includes but is not limited to the linker element (G4S)4, and may also include common (G4S) n, where n = 1 - 6, and there are also the hinge region of camel-derived antibody IgG2c, the hinge region of human antibody IgA, etc. The linker element is the linker element (G4S)4, and the nucleotide sequence of the linker element (G4S)4 is as shown in SEQ ID NO.: 3, and the amino acid sequence of the linker element (G4S)4 is as shown in SEQ ID NO.: 7.
[0031] Among them, the amino acid sequence of the porcine CSFV bifunctional nanobody Nb131 - 62 targeting porcine DC cells is as shown in SEQ ID NO.: 21.
[0032] Among them, the equilibrium dissociation constant (K D ) of the porcine DC - specific nanobody Nb131 and porcine DC cells is 3.43×10 -9 , the equilibrium dissociation constant (K D ) of the porcine CSFV - antigen - specific nanobody Nb62 and porcine CSFV antigen is 1.55×10 -10 , the equilibrium dissociation constants (K D ) of the porcine DC / CSFV bifunctional nanobody Nb131 - 62 and porcine DC cells are 0.77×10 -9 respectively, and the equilibrium dissociation constant (K D ) of the porcine DC / CSFV bifunctional nanobody Nb131 - 62 and porcine CSFV antigen is 3.49×10 -9 .
[0033] The content of the present invention also includes nucleic acid or gene encoding the porcine CSFV bifunctional nanobody Nb131 - 62 targeting porcine DC cells, and its nucleotide sequence is as shown in SEQ ID NO.: 19.
[0034] The content of the present invention also includes a construction method of the porcine CSFV bifunctional nanobody targeting porcine DC cells. The construction method includes the following steps: inserting the gene encoding the bifunctional nanobody Nb131 - 62 of porcine CSFV targeting porcine DC cells into the pMECS vector, then introducing it into the competent cells of Escherichia coli WK6 to obtain recombinant bacteria; inducing the recombinant bacteria to express the target protein, and purifying the bifunctional nanobody Nb131 - 62 after lysing the recombinant bacteria.
[0035] In order to improve the immune efficacy of the antigen through the targeted presentation of the antigen by porcine CD205, the present invention takes the porcine CD205 target protein as the target, screens porcine CD205 - specific nanobodies, and conducts the evaluation of the targeted presentation and immune efficacy of the antigen.
[0036] The present invention also includes a porcine PEDV bifunctional nanobody targeting porcine CD205. The bifunctional nanobody is obtained by ligating the gene encoding the nanobody Nb193 specific for the porcine CD205 target protein and the gene encoding the nanobody Nb2 specific for the porcine PEDV antigen with a linker element to obtain a target gene fragment, and further recombinantly expressing to obtain the target protein.
[0037] Among them, the nucleotide sequence of the nanobody Nb193 specific for the porcine CD205 target protein is as shown in SEQ ID NO.: 9, and the nucleotide sequence of the nanobody Nb2 specific for the porcine PEDV antigen is as shown in SEQ ID NO.: 13.
[0038] Among them, the amino acid sequence of the nanobody Nb193 specific for the porcine CD205 target protein is as shown in SEQ ID NO.: 11, and the amino acid sequence of the nanobody Nb2 specific for the porcine PEDV antigen is as shown in SEQ ID NO.: 14.
[0039] Among them, the linker element includes but is not limited to the linker element (G4S)4, and may also include common (G4S) n , n = 1 - 6, as well as the hinge region of camel-derived antibody IgG2c, the hinge region of human antibody IgA, etc. The linker element is the linker element (G4S)4. The nucleotide sequence of the linker element (G4S)4 is as shown in SEQ ID NO.: 3, and the amino acid sequence of the linker element (G4S)4 is as shown in SEQ ID NO.: 7.
[0040] Among them, the amino acid sequence of the porcine PEDV bifunctional nanobody Nb193 - 2 targeting porcine CD205 is as shown in SEQ ID NO.: 16. Among them, the equilibrium dissociation constant (K D ) of the porcine CD205 - specific nanobody Nb193 and the porcine CD205 target protein is 1.04×10 -9 , the equilibrium dissociation constant (K D ) of the porcine PEDV - specific nanobody Nb2 and the porcine PEDV antigen is 1.03×10 -s , the equilibrium dissociation constant (K D ) of the porcine CD205 / PEDV bifunctional nanobody Nb193 - 2 and the porcine CD205 target protein is 1.52×10 -8 , and the equilibrium dissociation constant (K D ) of the porcine CD205 / PEDV bifunctional nanobody Nb193 - 2 and the porcine PEDV antigen is 1.01×10 -8 .
[0041] The present invention also includes nucleic acids or genes encoding the porcine PEDV bifunctional nanobody Nb193-2 targeting porcine CD205, and the nucleotide sequence thereof is as shown in SEQ ID NO.: 15.
[0042] The present invention also includes a method for preparing the porcine PEDV bifunctional nanobody targeting porcine CD205, comprising the following steps: inserting the encoding gene of the bifunctional nanobody Nb193-2 into the pMECS vector, and then introducing it into competent Escherichia coli WK6 cells to obtain a recombinant bacterium; inducing the recombinant bacterium to express the target protein, and purifying the bifunctional nanobody Nb193-2 after lysing the recombinant bacterium.
[0043] The present invention also includes a porcine foot-and-mouth disease virus (FMDV) type O bifunctional nanobody targeting porcine CD205, which is a target protein obtained by further recombinant expression of a target gene fragment obtained by ligating the gene encoding the nanobody Nb193 specific for the porcine CD205 target protein and the gene encoding the nanobody Nb104 specific for the FMDV type O antigen with a linker element.
[0044] Among them, the nucleotide sequence of the nanobody Nb193 specific for the porcine CD205 target protein is as shown in SEQ ID NO.: 9, and the nucleotide sequence of the nanobody Nb104 specific for the FMDV type O antigen is as shown in SEQ ID NO.: 2.
[0045] Among them, the amino acid sequence of the nanobody Nb193 specific for the porcine CD205 target protein is as shown in SEQ ID NO.: 11, and the amino acid sequence of the nanobody Nb104 specific for the FMDV type O antigen is as shown in SEQ ID NO.: 6.
[0046] Among them, the linker element includes but is not limited to the linker element (G4S)4, and may also include common (G4S) n , where n = 1-6, and the hinge region of camel-derived antibody IgG2c, the hinge region of human antibody IgA, etc. The nucleotide sequence of the linker element (G4S)4 is as shown in SEQ ID NO.: 3, and the amino acid sequence of the linker element (G4S)4 is as shown in SEQ ID NO.: 7.
[0047] Among them, the amino acid sequence of the porcine FMDV type O bifunctional nanobody Nb193-104 targeting porcine CD205 is as shown in SEQ ID NO.: 12. Among them, the equilibrium dissociation constant (K D ) of the porcine CD205-specific nanobody Nb193 and the porcine CD205 target protein is 1.04×10 -9, the equilibrium dissociation constant (K D ) of the porcine O-type FMDV-specific nanobody Nb104 and the porcine O-type FMDV antigen is 6.82×10 -10 . The equilibrium dissociation constant (K D ) of the porcine CD205 / FMDV bifunctional nanobody Nb193-104 and the porcine CD205 target protein is 0.75×10 -8 . The equilibrium dissociation constant (K D ) of the porcine CD205 / FMDV bifunctional nanobody Nb193-104 and the porcine O-type FMDV antigen is 1.44×10 -8 .
[0048] The present invention also includes nucleic acids or genes encoding the porcine O-type FMDV bifunctional nanobody Nb193-104 targeting porcine CD205, and its nucleotide sequence is as shown in SEQ ID NO.: 10.
[0049] The present invention also includes a method for preparing the porcine O-type FMDV bifunctional nanobody targeting porcine CD205, comprising the following steps: inserting the coding gene of the bifunctional nanobody Nb193-104 into the pMECS vector, then introducing it into Escherichia coli WK6 competent cells to obtain a recombinant bacterium; inducing the recombinant bacterium to express the target protein, and purifying the bifunctional nanobody Nb193-104 after lysing the recombinant bacterium.
[0050] The present invention also includes the application of the bifunctional nanobody of porcine O-type FMDV targeting porcine DC cells, the bifunctional nanobody of porcine CSFV targeting porcine DC cells, the bifunctional nanobody of porcine PEDV targeting porcine CD205, the bifunctional nanobody of porcine O-type FMDV targeting porcine CD205, the nucleic acid or gene in the preparation of swine vaccines.
[0051] The vectors of the present invention include but are not limited to the pMECS vector, other vectors such as pHEN1, pHEN4, pComb3XSS, pCANTAB5e, pPIC9K, pYES2, etc., and virus vectors such as baculovirus, lentiviral vector, adenoviral vector, AAV virus vector, retrovirus, etc., as well as transposons and other gene transfer systems. According to subsequent expression and action modes, many vector forms can be selected.
[0052] The cells of the present invention include, but are not limited to, Escherichia coli WK6 competent cells, other host cells such as Escherichia coli TOP10, BL21, XL1-blue, etc. in prokaryotic cells, as well as eukaryotic cells such as CHO, 293, etc., and other hosts such as Saccharomyces cerevisiae BY4743 cells and Pichia pastoris GS115 cells, and SF9 insect cells, etc.
[0053] The bifunctional nanobody targeting porcine DC cells provided by the present invention is specifically achieved through the following technical solutions:
[0054] 1) Freshly induced and differentiated porcine BMDC cells were used to immunize Xinjiang Bactrian camels. After 6 immunizations, the cDNA of their peripheral blood lymphocytes was extracted using molecular biology principles, and the heavy chain variable region gene library of antibodies was amplified to construct a phage display nanobody gene library;
[0055] 2) Freshly induced and differentiated porcine BMDC cells were used as antigens for coating, and 3 - 5 rounds of affinity screening were carried out using phage display technology to obtain 1 porcine DC-specific nanobody that mediates efficient antigen endocytosis, named Nb131;
[0056] 3) Inactivated virus of type O FMDV was used to immunize Xinjiang Bactrian camels. After 6 immunizations, the cDNA of their peripheral blood lymphocytes was extracted using molecular biology principles, and the heavy chain variable region gene library of antibodies was amplified to construct a phage display nanobody gene library;
[0057] 4) Type O FMDV was used as an antigen for coating, and 3 - 5 rounds of affinity screening were carried out using phage display technology to obtain 1 type O FMDV-specific nanobody, named Nb104;
[0058] 5) The gene sequences of the porcine DC-specific nanobody Nb131 and the type O FMDV-specific nanobody Nb104 were used to construct a bifunctional nanobody expression system (Nb131-104) using the overlap extension PCR method. After the expression product was purified, it was incubated with the type O FMDV antigen of pigs, and pigs were immunized. Samples such as post-immune sera and lymph nodes were collected, and antibodies and cytokines were detected for evaluating the immune efficacy.
[0059] The bifunctional nanobody targeting porcine DC cells and specific to classical swine fever virus (CSFV) provided by the present invention is achieved through the following technical solutions:
[0060] 1) Freshly induced and differentiated porcine BMDC cells were used to immunize Xinjiang Bactrian camels. After 6 immunizations, the cDNA of their peripheral blood lymphocytes was extracted using molecular biology principles, and the heavy chain variable region gene library of antibodies was amplified to construct a phage display nanobody gene library;
[0061] 2) Coat the freshly induced and differentiated porcine BMDC cells as antigens, and perform 3 - 5 rounds of affinity screening using phage display technology to obtain a porcine DC - specific nanobody that mediates efficient antigen endocytosis, named Nb131;
[0062] 3) Immunize Xinjiang Bactrian camels with a live classical swine fever heat - resistant protective vaccine. After 6 immunizations, extract the cDNA of their peripheral blood lymphocytes using molecular biology principles, amplify the gene library of the antibody heavy - chain variable region, and construct a phage - displayed nanobody gene library;
[0063] 4) Coat the inactivated classical swine fever virus antigen as an antigen, and perform 3 - 5 rounds of affinity screening using phage display technology to obtain a CSFV - specific nanobody, named Nb62;
[0064] 5) Use the gene sequences of the porcine DC - specific nanobody Nb131 and the CSFV - specific nanobody Nb62 to construct a bifunctional nanobody expression system (Nb131 - 62) using the overlap - extension PCR method. After purifying the expression product, incubate it with the porcine CSFV antigen, immunize pigs, collect samples such as post - immunization serum and lymph nodes, and detect antibodies and cytokines for evaluating the immune efficacy.
[0065] The porcine PEDV bifunctional nanobody targeting porcine CD205 provided by the present invention is realized according to the following technical scheme:
[0066] S1) Use PCR technology to amplify the CysR - FN II truncated gene sequence of the porcine CD205 molecule, construct a recombinant expression vector of the porcine CD205 molecule using the pET - 32a expression vector, and perform prokaryotic system soluble expression and protein purification.
[0067] S2) Immunize Xinjiang Bactrian camels with the purified porcine CD205 target protein. After 5 - 7 immunizations, extract the cDNA of their peripheral blood lymphocytes, amplify the gene library of the antibody heavy - chain variable region, and construct a phage - displayed nanobody gene library.
[0068] S3) Coat the purified porcine CD205 target protein as an antigen, and perform 3 - 5 rounds of affinity screening using phage display technology to obtain a high - affinity porcine CD205 - specific nanobody, named Nb193.
[0069] S4) Immunize Xinjiang Bactrian camels with the porcine PEDV antigen. After 5 - 7 immunizations, extract the cDNA of their peripheral blood lymphocytes, amplify the gene library of the antibody heavy - chain variable region, and construct a phage - displayed nanobody gene library.
[0070] S5) Coat the porcine PEDV antigen and perform 3 - 5 rounds of affinity screening using phage display technology to obtain 1 highly - affinity porcine PEDV - specific nanobody, named Nb2.
[0071] S6) Use the gene sequences of the porcine CD205 - specific nanobody Nb193 and the porcine PEDV - specific nanobody Nb2 to construct a bifunctional nanobody expression system (Nb193 - 2) by overlap - extension PCR. After purifying the expression product, incubate it with the porcine PEDV antigen, immunize pigs, collect samples such as post - immunization serum and lymph nodes, and detect antibodies and cytokines for evaluating the immune efficacy.
[0072] A bifunctional nanobody targeting porcine CD205 against porcine O - type FMDV provided by the present invention is achieved through the following technical solutions:
[0073] 1) Use PCR technology to amplify the truncated gene sequence of CysR - FN II of the porcine CD205 molecule, construct a recombinant expression vector of the porcine CD205 molecule using the pET - 32a expression vector, and perform prokaryotic system soluble expression and protein purification.
[0074] 2) Immunize Xinjiang Bactrian camels with the purified porcine CD205 target protein. After 5 - 7 immunizations, extract the cDNA of its peripheral blood lymphocytes, amplify the gene library of the antibody heavy - chain variable region, and construct a phage - displayed nanobody gene library.
[0075] 3) Coat the purified porcine CD205 target protein as an antigen and perform 3 - 5 rounds of affinity screening using phage display technology to obtain 1 highly - affinity porcine CD205 - specific nanobody, named Nb193.
[0076] 4) Immunize Xinjiang Bactrian camels with porcine O - type FMDV antigen. After 5 - 7 immunizations, extract the cDNA of its peripheral blood lymphocytes, amplify the gene library of the antibody heavy - chain variable region, and construct a phage - displayed nanobody gene library.
[0077] 5) Coat the porcine O - type FMDV antigen and perform 3 - 5 rounds of affinity screening using phage display technology to obtain 1 highly - affinity porcine O - type FMDV - specific nanobody, named Nb104.
[0078] 6) Use the gene sequences of the porcine CD205 - specific nanobody Nb193 and the porcine O - type FMDV - specific nanobody Nb104 to construct a bifunctional nanobody expression system (Nb193 - 104) by overlap - extension PCR. After purifying the expression product, incubate it with the porcine O - type FMDV antigen, immunize pigs, collect samples such as post - immunization serum and lymph nodes, and detect antibodies and cytokines for evaluating the immune efficacy.
[0079] The dual-functional nanobody targeting porcine DC cells of the present invention is a dual-functional nanobody that can specifically bind to porcine DC cells and porcine foot-and-mouth disease virus (FMDV) type O antigen. Its application in improving the immunogenicity of porcine FMDV type O antigen can increase the titers of IgG and IgG1 antibodies after immunization with porcine FMDV type O antigen, prolong the persistence period of IgG antibodies after immunization, and increase the proportions of CD4 + T cells and CD8 + T cells, and promote the secretion of IFN-γ, IL-2, and IL-4.
[0080] The dual-functional nanobody targeting porcine DC cells of the present invention is a dual-functional nanobody that can specifically bind to porcine DC cells and classical swine fever virus (CSFV) antigen. Its application in improving the immunogenicity of porcine CSFV antigen can increase the antibody blocking rate after immunization with porcine CSFV antigen, promote lymphocyte proliferation, and the secretion of IFN-γ, IL-2, IL-4, and IL-10, and induce a highly efficient cellular immune response.
[0081] The dual-functional nanobody targeting porcine CD205 of the present invention is a dual-functional nanobody that can specifically bind to the target protein of porcine CD205 and porcine porcine epidemic diarrhea virus (PEDV) antigen. Its application in improving the immunogenicity of porcine PEDV antigen can increase the titers of IgG, IgG1, IgG2a, and mucosal IgA antibodies after immunization with porcine PEDV antigen, promote lymphocyte proliferation, and the secretion of IFN-γ, IL-4, and IL-6, and induce a highly efficient cellular immune response.
[0082] The dual-functional nanobody targeting porcine CD205 of the present invention is a dual-functional nanobody that can specifically bind to the target protein of porcine CD205 and porcine FMDV type O antigen. Its application in improving the immunogenicity of porcine FMDV type O antigen can increase the titers of IgG, IgG1, and IgG2a antibodies after immunization with porcine FMDV type O antigen, promote lymphocyte proliferation, and the secretion of IFN-γ, IL-2, and IL-4, and induce a highly efficient cellular immune response.
[0083] The bifunctional nanobody of the present invention can be directly incubated and assembled with an antigen. This method can use the whole virus to replace the protein antigen, making full use of the natural antigen epitopes of the whole virus, and can also avoid the influence of chemical coupling and gene fusion expression methods on the antigen structure. As one of the most basic properties of pathogenic microorganisms, particle size can affect the immune effect by influencing the interaction between antigens and immune cells and the migration efficiency of antigens to lymph nodes. The uptake pathways of antigens by cells can be divided into receptor-mediated endocytosis, phagocytosis, macropinocytosis and other pathways. Antigens of different particle sizes will be taken up by different antigen-presenting cells through different pathways. Generally, antigens of 20-200 nm are mainly taken up by cells through receptor-mediated endocytosis, while antigens larger than 500 nm are mainly taken up by cells through macropinocytosis and phagocytosis. The present invention has also verified through multiple examples that DC targeting can be achieved for viruses with a particle size of less than 150 nm. For other viruses with a particle size of less than 150 nm, only the corresponding nanobody needs to be replaced to construct the corresponding porcine DC-targeted or CD205-targeted bifunctional nanobody, which can be widely applied to other porcine vaccine antigens and has strong versatility.
[0084] Existing studies usually use chemical coupling or gene fusion expression methods to assemble DC-specific monoclonal antibodies or single-chain antibodies with antigens. However, this process is relatively cumbersome, easily affects the antigen structure, and protein antigens often cannot produce ideal immune effects due to limited antigen epitopes. The present invention adopts a new technical idea to achieve DC targeting of antigens by using the specific binding between antigens and nanobodies and the bridging effect of bifunctional nanobodies. This method can not only avoid the influence on the antigen structure, but also use the whole virus to replace the protein antigen, making full use of the natural antigen epitopes of the whole virus, and is easy to be applied in clinical practice.
[0085] Advantages: Compared with the prior art, the present invention has the following advantages: The bifunctional nanobody provided by the present invention that can be used to target porcine DC cells or porcine CD205 is the first to propose a new approach to significantly improve the antigen immunization efficacy of porcine vaccines by using bifunctional nanobodies as a technical means and targeting porcine DC cells or porcine CD205 molecules. The present invention helps to design a new, efficient, and actively targeted antigen delivery system for porcine DC cells. The present invention uses bifunctional nanobodies as a technical link and directly incubates and assembles them with antigens to achieve DC or CD205 targeting of antigens. This method can use intact pathogen particles to replace traditional protein antigens, make full use of the natural antigen epitopes of intact pathogen particles, and avoid the influence of conventional chemical coupling and gene fusion expression methods on the antigen structure. In addition, the present invention has generality. Specific nanobodies can be screened for different pathogens within the specific particle size range of the present invention, and the corresponding porcine DC-targeted bifunctional nanobodies can be constructed, which can be extended to other porcine vaccine antigens. The operation is simple, efficient, and time-consuming, and the bifunctional nanobodies are relatively clear in design and structure, easy to produce efficiently using microbial genetic engineering systems, with low manufacturing costs and good stability. The bifunctional nanobodies can be used immediately after incubation with antigens, which is simple and easy to implement, closer to the actual veterinary clinic, and convenient for popularization and application. Brief Description of the Drawings
[0086] Figure 1 It is an immunofluorescence image of porcine BMDC cells observed by a laser confocal microscope. The cells were stained with PE anti-porcine CD11c, FITC anti-porcine CD11b, and DAPI respectively to observe the cell morphology.
[0087] Figure 2 It is the PCR amplification result of the VHH gene. Among them, M: DL2000bp DNA marker, and lanes 1 and 2 are the amplification products of the VHH gene fragment.
[0088] Figure 3 It is the identification electrophoresis diagram of monoclonal phage gene libraries. Among them, lanes 1-24 respectively represent randomly selected monoclonal phage gene libraries constructed, and M: DL2000bp DNA marker.
[0089] Figure 4 It is to detect the binding activity of nanobodies by the indirect ELISA method. The abscissa represents different nanobody numbers, the ordinate represents the OD450 value, the lysate of porcine DC represents the sample well, the lysate of porcine bone marrow progenitor cells represents the negative well, and Control represents the blank well.
[0090] Figure 5SDS-PAGE electrophoresis pattern and Western Blot identification results of the purified nanobody. In the left figure, lanes 1-6 are the SDS-PAGE identification results of randomly selected purified nanobodies; M: protein standards; in the right figure, lanes 1-6 are the Western Blot identification results of randomly selected purified nanobodies; M: protein standards.
[0091] Figure 6 PCR amplification results of the VHH gene. Among them, M: DL2000bp DNA marker, and lanes 1-5 are the amplification products of the VHH gene fragment.
[0092] Figure 7 Identification electrophoresis pattern of monoclonal phage gene library. Among them, lanes 1-24 respectively represent randomly selected monoclonal phage gene libraries constructed, M: DL2000bp DNA marker.
[0093] Figure 8 Detection of the binding activity of nanobodies by the indirect ELISA method. The abscissa represents different nanobody numbers, the ordinate represents the OD450 value, O-type FMDV represents the sample well, BHK-21 represents the negative well, and Control represents the blank well.
[0094] Figure 9 Detection of the specificity of nanobodies by the indirect ELISA method. The abscissa represents different nanobody numbers, the ordinate represents the OD450 value, A-type FMDV and Asia1-type FMDV represent the sample wells, and Control represents the blank well.
[0095] Figure 10 SDS-PAGE electrophoresis pattern and Western Blot identification results of the purified nanobody. In the left figure, lanes 1-5 are the SDS-PAGE identification results of randomly selected purified nanobodies; M: protein standards; in the right figure, lanes 1-5 are the Western Blot identification results of randomly selected purified nanobodies; M: protein standards.
[0096] Figure 11 SOE-PCR amplification results of the bifunctional nanobody gene fragment. Among them, M: DL2000bp DNA marker, and the other lane is the amplification product of the bifunctional nanobody gene fragment.
[0097] Figure 12SDS-PAGE electrophoresis pattern and Western Blot identification results of the purified bifunctional nanobody Nb131-104. In the upper figure, lanes 1 and 2 show the SDS-PAGE identification results of the purified bifunctional nanobody Nb131-104; in the lower figure, lanes 1 and 2 show the Western Blot identification results of the purified bifunctional nanobody Nb131-104; M: protein standards.
[0098] Figure 13 To observe the binding ability of the bifunctional nanobody Nb131-104 to porcine BMDC by laser confocal microscopy. The 4 groups of figures above show the observation results of the experimental group added with the bifunctional nanobody by laser confocal microscopy, and the 4 groups of figures below show the observation results of the blank control group by laser confocal microscopy. The cells were stained with AF647 anti-porcine CD1, FITC Nb131-104 and DAPI respectively to observe the cell morphology.
[0099] Figure 14 To observe the FMDV antigen delivery ability of the bifunctional nanobody Nb131-104 by laser confocal microscopy. The 4 groups of figures above show the observation results of the experimental group added with the bifunctional nanobody by laser confocal microscopy, and the 4 groups of figures below show the observation results of the blank control group by laser confocal microscopy. The cells were stained with AF647 anti-porcine CD1, FITC Nb131-104 and DAPI respectively to observe the cell morphology.
[0100] Figure 15 To detect the specific antibody levels in the sera after immunization by ELISA. Blood samples were collected at 14 days, 28 days, 42 days and 56 days after immunization for antibody detection.
[0101] Figure 16 To detect the IgG1 antibody levels in the sera after immunization by ELISA. Blood samples were collected at 14 days, 28 days, 42 days and 56 days after immunization for antibody detection.
[0102] Figure 17 To detect the IgG2a antibody levels in the sera after immunization by ELISA. Blood samples were collected at 14 days, 28 days, 42 days and 56 days after immunization for antibody detection.
[0103] Figure 18 To detect the antibody persistence period after immunization by ELISA. Blood samples were collected at 14 days, 28 days, 42 days and 56 days after immunization for antibody detection.
[0104] Figure 19 To detect the secretion levels of IFN-γ, IL-2 and IL-4 in the cell culture supernatant by ELISA;
[0105] Figure 20 The PCR amplification results of the VHH gene. Among them, M is the DL2000 DNA marker, and lane 1 is the amplification product of the VHH gene fragment.
[0106] Figure 21 The electrophoresis diagram for the identification of monoclonal phage gene libraries. Among them, lanes 1-24 respectively represent randomly selected monoclonal phage gene libraries constructed, and M is the DL2000 DNA marker.
[0107] Figure 22 The binding activity of nanobodies detected by the indirect ELISA method. The abscissa represents different nanobody numbers, the ordinate represents the OD450 value, the classical swine fever virus antigen represents the sample well, PK-15 represents the negative well, and Control represents the blank well.
[0108] Figure 23 The specificity of nanobodies detected by the indirect ELISA method. The abscissa represents different nanobody numbers, the ordinate represents the OD450 value, O-FMDV, PCV2, PRRSV, PRV, PEDV represent the sample wells, and Control represents the blank well;
[0109] Figure 24 The SDS-PAGE electrophoresis diagram and Western Blot identification results of the purified nanobodies. Lanes 1-3 are randomly selected purified nanobodies, and M is the protein standards;
[0110] Figure 25 The SOE-PCR amplification results of the bifunctional nanobody gene fragment. Among them, M is the DL10000 DNA marker, and lane 1 is the amplification product of the bifunctional nanobody gene fragment;
[0111] Figure 26 The SDS-PAGE electrophoresis diagram and Western Blot identification results of the purified bifunctional nanobody Nb131-62. Lane 1 is the purified bifunctional nanobody Nb131-62, and M is the protein standards;
[0112] Figure 27 The binding ability of the bifunctional nanobody Nb131-62 to porcine BMDC observed by a laser confocal microscope. The 4 groups of figures above are the observation results of the laser confocal microscope for the experimental group with the addition of the bifunctional nanobody, and the 4 groups of figures below are the observation results of the laser confocal microscope for the blank control group. The cells were stained with AF647 anti-porcine CD1, FITC Nb131-62 and DAPI respectively to observe the cell morphology;
[0113] Figure 28 To observe the FMDV antigen delivery ability of the bifunctional nanobody Nb131-62 by laser confocal microscopy. The upper 4 groups of pictures are the observation results of the experimental group added with the bifunctional nanobody by laser confocal microscopy, and the lower 4 groups of pictures are the observation results of the blank control group by laser confocal microscopy. The cells were stained with AF647 anti-porcine CD1, FITC Nb131-62 and DAPI respectively and the cell morphology was observed;
[0114] Figure 29 To detect the level of specific antibodies in the immune serum by ELISA, blood samples were collected and detected on the 14th, 28th, 42nd and 56th days after immunization respectively;
[0115] Figure 30 To detect the secretion level of IFN-γ in the immune serum by ELISA, blood samples were collected and detected on the 14th, 28th, 42nd and 56th days after immunization respectively;
[0116] Figure 31 To detect the secretion level of IL-2 in the immune serum by ELISA, blood samples were collected and detected on the 14th, 28th, 42nd and 56th days after immunization respectively
[0117] Figure 32 To detect the secretion level of IL-4 in the immune serum by ELISA, blood samples were collected and detected on the 14th, 28th, 42nd and 56th days after immunization respectively
[0118] Figure 33 To detect the secretion level of IL-10 in the immune serum by ELISA, blood samples were collected and detected on the 14th, 28th, 42nd and 56th days after immunization respectively.
[0119] Figure 34 To detect the lymphocyte proliferation level by MTT method.
[0120] Figure 35 PCR amplification results of the truncated gene of porcine CD205 molecule CysR-FN II. Among them, M is DL2000 DNA marker, and lane 1 is the amplification product of the truncated gene fragment of porcine CD205 molecule CysR-FN II.
[0121] Figure 36 SDS-PAGE electrophoresis map and Western Blot identification results of the purified porcine CD205 target protein. Among them, lane 1 is the purified porcine CD205 target protein, and M is protein standards.
[0122] Figure 37The results of PCR amplification of the VHH gene. Among them, M is the DL2000 DNA marker, and lanes 1 and 2 are the amplification products of the VHH gene fragment.
[0123] Figure 38 The electrophoresis diagram for the identification of monoclonal phage gene libraries. Among them, lanes 1-24 respectively represent randomly selected monoclonal phage gene libraries constructed, and M is the DL2000 DNA marker.
[0124] Figure 39 The binding activity of nanobodies was detected by the indirect ELISA method. The abscissa represents different nanobody numbers, the ordinate represents the OD450 value, the porcine CD205 target protein represents the sample well, any other irrelevant protein prepared under the same conditions represents the negative well, and Control represents the blank well.
[0125] Figure 40 The SDS-PAGE electrophoresis diagram and Western Blot identification results of the purified nanobodies. Lanes 1 and 2 are randomly selected purified nanobodies, and M is the protein standards.
[0126] Figure 41 The results of PCR amplification of the VHH gene. Among them, M is the DL2000 DNA marker, and lanes 1-3 are the amplification products of the VHH gene fragment.
[0127] Figure 42 The electrophoresis diagram for the identification of monoclonal phage gene libraries. Among them, lanes 1-24 respectively represent randomly selected monoclonal phage gene libraries constructed, and M is the DL2000 DNA marker.
[0128] Figure 43 The binding activity of nanobodies was detected by the indirect ELISA method. The abscissa represents different nanobody numbers, the ordinate represents the OD450 value, PEDV represents the sample well, ST represents the negative well, and Control represents the blank well.
[0129] Figure 44 The specificity of nanobodies was detected by the indirect ELISA method. The abscissa represents different nanobody numbers, the ordinate represents the OD450 value, O-FMDV, PCV2, PRRSV, and PRV represent the sample wells, and Control represents the blank well.
[0130] Figure 45 The SDS-PAGE electrophoresis diagram and Western Blot identification results of the purified nanobodies. Lanes 1 and 2 are randomly selected purified nanobodies, and M is the protein standards.
[0131] Figure 46 The result of SOE-PCR amplification of the bifunctional nanobody gene fragment. Among them, M is DL10000 DNA marker, and lane 1 is the amplification product of the bifunctional nanobody gene fragment.
[0132] Figure 47 The SDS-PAGE electrophoresis pattern and Western Blot identification result of the purified bifunctional nanobody Nb193-2. Lane 1 is the purified bifunctional nanobody Nb193-2, and M is protein standards.
[0133] Figure 48 The binding ability of the bifunctional nanobody Nb193-2 to porcine BMDC observed by laser confocal microscopy. The 4 groups of pictures above are the results observed by laser confocal microscopy of the experimental group added with the bifunctional nanobody, and the 4 groups of pictures below are the results observed by laser confocal microscopy of the blank control group. The cells were stained with AF647 anti-porcine CD1, FITC Nb193-2 and DAPI respectively and the cell morphology was observed.
[0134] Figure 49 ELISA was used to detect the level of specific antibodies in the serum 28 days after immunization.
[0135] Figure 50 ELISA was used to detect the level of IgG1 antibodies in the serum 28 days after immunization.
[0136] Figure 51 ELISA was used to detect the level of IgG2a antibodies in the serum 28 days after immunization.
[0137] Figure 52 ELISA was used to detect the level of mucosal IgA antibodies 28 days after immunization.
[0138] Figure 53 MTT method was used to detect the lymphocyte proliferation level.
[0139] Figure 54 ELISA was used to detect the secretion levels of IFN-γ, IL-4 and IL-6 in the cell culture supernatant.
[0140] Figure 55 The result of SOE-PCR amplification of the bifunctional nanobody gene fragment. Among them, M is DL10000 DNA marker, and lane 1 is the amplification product of the bifunctional nanobody gene fragment;
[0141] Figure 56SDS-PAGE electrophoresis pattern and Western Blot identification results of the purified bifunctional nanobody Nb193-104. Lane 1 is the purified bifunctional nanobody Nb193-104, and M is protein standards;
[0142] Figure 57 To observe the binding ability of the bifunctional nanobody Nb193-104 to porcine BMDC by laser confocal microscopy. The upper 4 groups of pictures are the observation results of the experimental group added with the bifunctional nanobody by laser confocal microscopy, and the lower 4 groups of pictures are the observation results of the blank control group by laser confocal microscopy. The cells were stained with AF647 anti-porcine CD1, FITC Nb193-104 and DAPI respectively and the cell morphology was observed;
[0143] Figure 58 To observe the FMDV antigen delivery ability of the bifunctional nanobody Nb193-104 by laser confocal microscopy. The upper 4 groups of pictures are the observation results of the experimental group added with the bifunctional nanobody by laser confocal microscopy, and the lower 4 groups of pictures are the observation results of the blank control group by laser confocal microscopy. The cells were stained with AF647 anti-porcine CD1, FITC Nb193-104 and DAPI respectively and the cell morphology was observed.
[0144] Figure 59 To detect the specific antibody level in the immunized serum by ELISA. Blood samples were collected on day 14, 28, 42 and 56 after immunization for antibody detection;
[0145] Figure 60 To detect the IgG1 antibody level in the immunized serum by ELISA. Blood samples were collected on day 14, 28, 42 and 56 after immunization for antibody detection;
[0146] Figure 61 To detect the IgG2a antibody level in the immunized serum by ELISA. Blood samples were collected on day 14, 28, 42 and 56 after immunization for antibody detection;
[0147] Figure 62 To detect the persistence period of the immunized antibody by ELISA. Blood samples were collected on day 14, 28, 42 and 56 after immunization for antibody detection;
[0148] Figure 63 To detect the lymphocyte proliferation level by MTT method;
[0149] Figure 64 To detect the secretion levels of IFN-γ, IL-2 and IL-4 in the cell culture supernatant by ELISA. Specific embodiments
[0150] The present invention will be further described in conjunction with the accompanying drawings and specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the present invention.
[0151] Example 1 Construction of a Nanobody Library for Porcine BMDC Cells
[0152] 1. Induction and Differentiation of Porcine BMDC Cells
[0153] Collect fresh porcine bone marrow progenitor cells (4×10 6 cells / mL), and induce their differentiation using porcine recombinant GM-CSF (20 ng / mL, purchased from Shanghai Youningwei Co., Ltd.) and porcine recombinant IL-4 (10 ng / mL, purchased from Shanghai Youningwei Co., Ltd.). After continuous culture for 7 days, collect porcine bone marrow-derived dendritic cells (BMDC) and seed them in cell culture dishes (2×10 6 cells / mL). Fix them with 4% paraformaldehyde at room temperature for 10 min, wash them 3 times with PBS, then place them in PBS containing 0.1% Triton and treat at 37°C for 5 min. Wash them 3 times with PBS and then block them in the blocking solution at 37°C for 1 h. Incubate with PE-labeled anti-porcine CD11c fluorescent antibody (diluted 1:1000, purchased from Shanghai Youningwei Co., Ltd.) at 4°C for 30 min, wash the cells three times with PBS, incubate with FITC-labeled anti-porcine CD11b fluorescent antibody (diluted 1:1000, purchased from Shanghai Youningwei Co., Ltd.) at 4°C for 30 min, wash the cells three times with PBS, stain with DAPI (working solution, purchased from Shanghai Beyotime Co., Ltd.) for 10 min, wash the cells three times with PBS and then observe them under a laser confocal microscope. As Figure 1 shown, a relatively abundant number of porcine BMDC cells were obtained.
[0154] 2. RNA Extraction and cDNA Synthesis
[0155] After repeated induction and differentiation, a sufficient amount of porcine BMDC cells (about 1×10 10The cells were ultrasonically disrupted, and the supernatant was discarded after centrifugation at 12,000 g for 10 min. The precipitate was resuspended with physiological saline to obtain the disrupted product of porcine BMDC cells. 1 mg of the disrupted product of porcine BMDC cells was mixed with an equal volume of Freund's complete adjuvant and used to immunize a Xinjiang Bactrian camel. One week later, 1 mg of the disrupted product of porcine BMDC cells was mixed with an equal volume of Freund's incomplete adjuvant and used to immunize the Bactrian camel once a week for a total of 6 times to stimulate the body to produce specific antibodies against porcine BMDC cells. After the immunization, 100 mL of camel peripheral blood lymphocytes were drawn, and the total RNA of the lymphocytes was extracted. According to the instructions of the reverse transcription kit (purchased from TAKARA), cDNA was synthesized.
[0156] 3. Primer Design and Synthesis
[0157] According to the reference (Beta-lactamase inhibitors derived from single-domain antibody fragments elicited in the camelidae, Conrath Katja et.al, Antimicrobial Agents and Chemotherapy, 2001, 45, 2807-2812.), PCR primers C1F, C1R, V HH F and V HH R were designed for amplifying the VHH fragment (350 bp) of the camel heavy-chain antibody variable region gene. The specific sequences of each primer are shown in Table 1.
[0158] Table 1. PCR Amplification Primers
[0159] Primer Sequence (5’-3’) C1F GTCCTGGCTGCTCTTCTACAAGG C1R GGTACGTGCTGTTGAACTGTTCC <![CDATA[V HH F]]> <![CDATA[GATGTGCAG CTGCAG GAGTCTGGRGGAGG (The underlined part is the Pst I restriction site)]]> <![CDATA[V HH R]]> <![CDATA[CTAGT GCGGCCGC TGAGGAGACGGTGACCTGGGT (The underlined part is the Not I restriction site)]]>
[0160] Note: The degenerate base R in Table 1 = A or G.
[0161] 4. Amplification of VHH Fragment
[0162] Using the previously synthesized camel cDNA as a template, the VHH fragment was amplified by PCR. First, using cDNA as a template and C1F and C1R as upstream and downstream primers, a gene fragment of approximately 750 bp was amplified. The reaction conditions were: 95°C for 3 min; 95°C for 30 s, 59°C for 1 min, 72°C for 1 min, for a total of 30 cycles; 72°C for 10 min. After the reaction, the gene fragment of approximately 750 bp was recovered. Then, using this gene fragment of approximately 750 bp as a template, V HH F and V HHR are the upstream and downstream primers for amplifying the VHH fragment. The reaction conditions are as follows: 95°C for 3 min; 95°C for 30 s, 58°C for 1 min, 72°C for 30 s, for a total of 30 cycles; 72°C for 10 min. After the reaction, the PCR amplification product was identified by 1% agarose gel electrophoresis, and the target band was observed under ultraviolet light. As Figure 2 shown, a VHH gene fragment of approximately 350 bp was visible, which was consistent with the expected size. The target band was purified and recovered using a gel extraction kit (purchased from TAKARA).
[0163] 5. Construction of the phage display gene library
[0164] After digestion of the purified and recovered VHH gene fragment with Pst I and Not I, it was ligated into the pMECS vector (purchased from Novagen). The ligation product was transformed into E. coli TG1 competent cells (purchased from Novagen), cultured at 37°C for 1 h, the bacterial solution was centrifuged and concentrated, and then spread on an LB plate medium containing ampicillin resistance. After overnight growth at 37°C, 24 monoclonal colonies were randomly selected, and V HH F and V HH R were used as the upstream and downstream primers for colony PCR identification. The results were as Figure 3 shown. After colony PCR identification of the 24 monoclonal colonies, all monoclonal colonies contained a target fragment of approximately 350 bp in size, indicating that the insertion rate of this library reached 100%. The colonies on the above plate were scraped into an LB liquid medium, then glycerol with a final concentration of 30% was added, and it was aliquoted and stored at -80°C for later use. This is the phage display library of nanobodies against porcine BMDC cells.
[0165] Example 2 Screening process for nanobodies against porcine BMDC cells
[0166] 1. Amplification of the phage display library
[0167] Take 200 μL of the phage display library prepared in Example 1 stored at -80°C, inoculate it into 500 mL of 2×TY medium, culture it at 37°C with a shaker speed of 200 rpm for 3 - 5 h, then add 50 μL of helper phage VCSM13 (purchased from Novagen), incubate at 37°C for 1 h, and then culture it overnight at 37°C with a shaker speed of 200 rpm. The next day, 80 g of PEG6000 (purchased from Shanghai Sangon) was added to precipitate the phage, and this precipitate was the amplified phage display library. The amplified phage display library was resuspended in 5 mL of 0.1 M PBS buffer to obtain its suspension.
[0168] 2. Affinity screening
[0169] Add 10 μg of the porcine BMDC cell lysate prepared in Example 1 to 10 mL of 100 mM NaHCO3 solution (pH 8.2), mix well, take 100 μL and add it to each well of a 96-well ELISA plate, and coat overnight at 4 °C. Set the porcine bone marrow progenitor cell lysate as a control; the next day, add 100 μL of 1% skim milk solution to each well and block at room temperature for 2 h; then, add 100 μL of the amplified phage display library suspension to each well, incubate at room temperature for 1 h, wash 5 times with PBS buffer containing 0.05% Tween-20 to wash away unbound phages, and then wash down the phages specifically bound to the porcine BMDC cell lysate with 100 μL of a 100 mM triethylamine (purchased from Shanghai Sangon Biotech Co., Ltd.) solution and infect 5-fold volume (about 500 μL) of Escherichia coli TG1 cells in the logarithmic growth phase (OD 600 is 0.8), culture at 37 °C for 1 h, add 50 μL of helper phage VCSM13 (purchased from Novagen) to infect TG1 cells, centrifuge and take the supernatant to obtain the phages screened in the first round for the next round of screening. The same screening process was carried out for 3 rounds. Take 10 μL of the phages obtained in each round of screening and spread them on LB solid medium, and culture overnight at 37 °C to observe the enrichment process of affinity screening. As shown in Table 2, after three rounds of affinity screening of the library, the phages enriched in each round of screening are more than the previous round.
[0170] Table 2. Enrichment process of three rounds of affinity screening of phage library
[0171] Affinity screening round Input phage library amount (pfu / mL) Recovered phage library amount (pfu / mL) The first round of affinity screening <![CDATA[1.12×10 7 > <![CDATA[8.71×10 3 > The second round of affinity screening <![CDATA[1.04×10 7 > <![CDATA[6.25×10 4 > The third round of affinity screening <![CDATA[1.16×10 7 > <![CDATA[3.04×10 5 >
[0172] Example 3 Screening of specific positive clones by enzyme-linked immunosorbent assay (ELISA)
[0173] 1. Expression of nanobodies
[0174] Pick 200 single colonies from the colonies enriched on the LB plate after the third round of screening in Example 2 and inoculate them into the wells of a 96-well plate (added with TB medium containing 100 μg / mL ampicillin), and set a blank control with only TB medium added. Culture at 37 °C and a shaking speed of 200 rpm until the logarithmic growth phase, add IPTG with a final concentration of 1 mM to each well, and culture overnight at 28 °C and a shaking speed of 200 rpm. The next day, lyse each bacterium by ultrasonic disruption method, centrifuge and take the lysate to obtain the nanobodies against the porcine BMDC cell lysate expressed by each recombinant bacterium, and the numbers of the nanobodies are sequentially numbered from 1 to 200.
[0175] 2. Detection of the binding activity of nanobodies by indirect ELISA method
[0176] The binding activity of each nanobody numbered 1-200 to the porcine BMDC cell lysate was identified by indirect ELISA reaction. 10 μg of the porcine BMDC cell lysate prepared in Example 1 was added to 10 mL of a 100 mM NaHCO3 solution (pH 8.2), mixed well, and 100 μL was taken and added to each sample well of a 96-well ELISA plate, and coated overnight at 4 °C. In the control wells, the porcine bone marrow progenitor cell lysate was used to replace the porcine BMDC cell lysate for coating; the next day, the liquid in the plate was discarded, and it was washed 5 times with PBS buffer containing 0.05% Tween-20, patted dry, and 100 μL of 5% skim milk solution was added to each well and blocked at room temperature for 2 h; it was washed 5 times with PBS buffer containing 0.05% Tween-20, 100 μL of each nanobody was added to each well of the ELISA plate in turn, incubated at room temperature for 1 h, the unbound nanobody was washed away with PBS buffer containing 0.05% Tween-20, 100 μL of Mouse anti-HAtag antibody (mouse anti-HA antibody, purchased from Beijing ComWin Biotech Co., Ltd.) diluted 1:2000 was added, and placed at room temperature for 1 h, the unbound antibody was washed away with PBS buffer containing 0.05% Tween-20, 100 μL of HRP labeled goat anti-mouse IgG (horseradish peroxidase-labeled goat anti-mouse antibody, purchased from AAT Bioquest) diluted 1:2000 was added, and placed at room temperature for 1 h, the unbound antibody was washed away with PBS buffer containing 0.05% Tween-20, horseradish peroxidase chromogenic solution (purchased from Shanghai Sangon Biotech Co., Ltd.) was added, incubated at 37 °C for 15 min, 50 μL of 2 M sulfuric acid solution was added to each well to terminate the reaction, and the absorbance OD at 450 nm wavelength of each well was measured using an ELISA reader 450 . When the OD 450 value of the sample well is more than 2.5 times that of the control well OD 450 value, it is judged as a positive clone well. The results are as Figure 4 shown. A total of 17 nanobodies can specifically bind to the porcine BMDC cell lysate (to screen for high-affinity nanobodies, only nanobodies with an OD 450 value greater than 2.0 were selected).
[0177] Example 4 Screening of high-affinity nanobodies against porcine BMDC by surface plasmon resonance (SPR)
[0178] 1. Expression and purification of nanobodies against porcine BMDC
[0179] The recombinant bacterial plasmids expressing positive nanobodies against porcine BMDC obtained in Example 3 were extracted separately and transformed into Escherichia coli WK6 competent cells (purchased from Novagen) at 42°C. The cells were cultured for 1 h at 37°C with a shaking speed of 200 rpm, and the bacterial solution was concentrated by centrifugation and then spread on an LB plate containing 100 μg / mL ampicillin and cultured at 37°C for 12 - 16 h. Single colonies were selected to obtain recombinant bacteria A1 - A17 expressing nanobodies against porcine BMDC respectively.
[0180] The recombinant bacteria A1 - A17 were separately inoculated into 5 mL of LB culture medium containing ampicillin and cultured in a shaker at 37°C until the OD 600 reached 0.6 - 0.9. Then 1 mL of the bacterial solution was transferred to 500 mL of TB culture medium and cultured in a shaker at 37°C. When the OD 600 value reached 0.6 - 0.9, IPTG with a final concentration of 1 mM was added, and the recombinant bacteria were cultured in a shaker at 28°C for 12 - 16 h to induce the expression of the target protein. The bacterial cell precipitate was collected by centrifugation, and the crude nanobody extract was obtained by ultrasonic disruption. The nanobodies were purified by nickel column (purchased from GE Healthcare) affinity chromatography. Purified nanobodies (numbered 18, 29, 37, 47, 60, 64 respectively) were randomly selected for SDS - PAGE electrophoresis and Western blot identification. It can be seen that there are obvious bands at about 16 kD for the nanobodies, which is consistent with the expected size of the target fragment, and the purity is over 90%. Figure 5 It can be seen that there are obvious bands at about 16 kD for the nanobodies, which is consistent with the expected size of the target fragment, and the purity is over 90%.
[0181] 2. Identification of the affinity of nanobodies against porcine BMDC by SPR
[0182] Biacore was used respectively TMThe affinity of the 17 obtained nanobodies against porcine BMDCs and the cell lysate of porcine BMDCs was identified using an X100 Protein Interaction Analyzer (purchased from GE Healthcare). First, 1 mg of the cell lysate of porcine BMDCs prepared in Example 1 was conjugated to a CM5 chip using the coupling reagent N-ethyl-N’-(dimethylaminopropyl)-carbodiimide / N-hydroxy succinimide (purchased from Sigma). The purified nanobodies (the numbers are shown in Table 3) were serially diluted from 100 nM (100 nM, 50 nM, 25 nM, 12.5 nM, 6.25 nM, 3.125 nM) with normal saline and then allowed to bind to the cell lysate conjugated to the CM5 chip for 180 s. Ethanolamine was used for blocking. Unbound substances were removed by washing with HBS-EP buffer (10 mM N-(2-hydroxyethyl)piperazine-N’-2-ethanesulfonic acid (HEPES), pH 7.5, 150 mM NaCl, 3.5 mM EDTA, and 0.005% (v / v) Surfactant P20) at a flow rate of 30 μL / min, and regeneration was performed using 10 mM glycine / HCl (pH 2.5). The detection results were analyzed with Biacore 2.0.1 software, and the association rate constant (ka), dissociation rate constant (kd), and equilibrium dissociation constant (K D ) are shown in Table 3. The K D value of the nanobody numbered 131 reached 3.43×10 -9 , which is the nanobody with the highest affinity against porcine BMDCs screened in the present invention, and subsequent studies were all carried out around this nanobody Nb131.
[0183] Table 3. Kinetic parameters of the binding of each nanobody to the cell lysate of porcine BMDCs
[0184] Nanobody number <![CDATA[k a (M -1 s -1 )]]> <![CDATA[k d (s -1 )]]> <![CDATA[K D (M)]]> 18 <![CDATA[3.16×10 4 > <![CDATA[4.10×10 -4 > <![CDATA[1.29×10 -8 > 29 <![CDATA[1.17×10 4 > <![CDATA[3.97×10 -4 > <![CDATA[3.39×10 -8 > 37 <![CDATA[4.11×10 4 > <![CDATA[3.03×10 -4 > <![CDATA[0.73×10 -8 > 39 <![CDATA[8.85×10 4 > <![CDATA[1.52×10 -4 > <![CDATA[0.17×10 -8 > 47 <![CDATA[2.15×10 5 > <![CDATA[9.65×10 -4 > <![CDATA[4.48×10 -9 > 60 <![CDATA[1.91×10 4 > <![CDATA[5.05×10 -4 > <![CDATA[2.64×10 -8 > 64 <![CDATA[5.18×10 4 > <![CDATA[1.79×10 -4 > <![CDATA[0.35×10 -8 > 96 <![CDATA[8.09×10 4 > <![CDATA[4.93×10 -4 > <![CDATA[0.61×10 -8 > 108 <![CDATA[7.17×10 4 > <![CDATA[3.18×1 0 - 4 > <![CDATA[0.44×10 -8 > 128 <![CDATA[2.10×10 4 > <![CDATA[4.76×10 -4 > <![CDATA[2.26×10 -8 <!-- 15 -->]]> 131 <![CDATA[0.89×10 5 > <![CDATA[3.05×10 -4 > <![CDATA[3.43×10 -9 > 147 <![CDATA[6.71×10 4 > <![CDATA[7.32×10 -4 > <![CDATA[1.09×10 -8 > 162 <![CDATA[5.45×10 4 > <![CDATA[8.23×10 -4 > <![CDATA[1.51×10 -8 > 169 <![CDATA[3.10×10 4 > <![CDATA[2.98×10 -4 > <![CDATA[0.96×10 -8 > 173 <![CDATA[9.12×10 4 > <![CDATA[1.76×10 -4 > <![CDATA[0.19×10 -8 > 181 <![CDATA[4.46×10 4 > <![CDATA[8.81×10 -4 > <![CDATA[1.97×10 -8 > 194 <![CDATA[2.01×10 4 > <![CDATA[5.24×10 -4 > <![CDATA[2.61×10 -8 >
[0185] Note: In Table 3, ka represents the association rate constant, kd represents the dissociation rate constant, and K D represents the equilibrium dissociation constant.
[0186] The recombinant plasmid of nanobody Nb131 was extracted and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing to obtain its nucleotide sequence and amino acid sequence, which are shown as SEQ ID NO.: 1 and SEQ ID NO.: 5, respectively.
[0187] Example 5 Construction of a Nanobody Library Against Foot-and-Mouth Disease Virus Serotype O
[0188] 1. RNA extraction and cDNA synthesis
[0189] 1 mg of inactivated foot-and-mouth disease virus type O (kindly donated by Sino-Agri Biotech Co., Ltd.) was mixed with equal volumes of Freund's complete adjuvant to immunize a Xinjiang Bactrian camel; one week later, the Bactrian camel was immunized and cDNA was synthesized according to the method described in Title 2 of Example 1.
[0190] 2. Primer design and synthesis
[0191] According to Example 1, title 3, PCR primers C1F, C1R, V1R, and V2R were designed for amplifying the camel heavy chain antibody variable region gene VHH fragment (350 bp). HH F and V HH R. The specific sequences of each primer are shown in Table 1 above.
[0192] 3. Amplification of VHH fragments
[0193] Using the camel cDNA synthesized in Title 1 of this Example as a template, the VHH fragment was amplified and identified according to the method described in Title 4 of Example 1. The results are as follows Figure 6 As shown, a VHH gene fragment of about 350 bp was observed, which was consistent with the expected size. The target band was purified and recovered using the instructions of the gel recovery kit (purchased from TAKARA).
[0194] 4. Construction of phage display gene library
[0195] The purified and recovered VHH gene fragments were used to construct a phage display gene library and identify the results according to the method described in Title 5 of Example 1. Figure 7 , 24 monoclonal colonies were identified by colony PCR, and all monoclonal colonies contained the target fragment of about 350 bp in size, indicating that the insertion rate of the library reached 100%. The colonies on the above plate were scraped into LB liquid culture medium, and then glycerol with a final concentration of 30% was added, and the aliquots were stored at -80°C for later use. This is the O-type foot-and-mouth disease virus phage display library.
[0196] Example 6 Screening process for nanoantibodies against type O foot-and-mouth disease virus
[0197] 1. Amplification of phage display library
[0198] Take 200 μL of the O-type foot-and-mouth disease virus phage display library prepared in Example 5 and stored at -80°C, amplify it according to the method described in Title 1 of Example 2, and resuspend the amplified phage library in 5 mL 0.1 M PBS to obtain a suspension thereof.
[0199] 2. Affinity screening
[0200] 10 μg of inactivated foot-and-mouth disease virus type O was added to 10 mL of 100 mM NaHCO3 solution (pH 8.2), and affinity screening and identification were carried out according to the method described in Title 2 of Example 2. The BHK-21 cell lysate (preserved in our laboratory) was set as a control. The results are shown in Table 4. After three rounds of affinity screening of the library, the phages enriched in each round were more than those in the previous round.
[0201] Table 4. Enrichment process of phage library in 3 rounds of affinity screening
[0202] Affinity screening round Input phage library amount (pfu / mL) Recovered phage library amount (pfu / mL) The first round of affinity screening <![CDATA[1.01×10 7 > <![CDATA[3.96×10 3 > The second round of affinity screening <![CDATA[1.12×10 7 > <![CDATA[2.58×10 4 > The third round of affinity screening <![CDATA[1.07×10 7 > <![CDATA[1.49×10 5 >
[0203] Example 7 Screening of specific positive clones by enzyme-linked immunosorbent assay (ELISA)
[0204] 1. Expression of nanobodies against foot-and-mouth disease virus type O
[0205] From the colonies enriched on the LB plate after the third round of screening in Example 6, 200 single colonies were selected and the nanobodies against foot-and-mouth disease virus type O expressed by each recombinant bacterium were prepared respectively according to the method described in Title 1 of Example 3. The numbers of the nanobodies were 1 - 200 in sequence.
[0206] 2. Detection of the binding activity of nanobodies by indirect ELISA method
[0207] The binding activity of each nanobody to foot-and-mouth disease virus type O was identified by indirect ELISA reaction. 10 μg of inactivated foot-and-mouth disease virus type O was added to 10 mL of 100 mM NaHCO3 solution (pH 8.2), and identification was carried out according to the method described in Title 2 of Example 3. The BHK-21 cell lysate was set as a control. The results are as Figure 8 shown. A total of 29 nanobodies could specifically bind to foot-and-mouth disease virus type O (to screen for nanobodies with high affinity, only the nanobodies with OD 450 value greater than 2.0 were selected).
[0208] 3. Specific identification
[0209] According to the indirect ELISA detection method described in Title 2 of this example, the cross-reactivity between each nanobody and foot-and-mouth disease virus type A and Asia1 was detected respectively, and the corresponding OD 450 was measured by an enzyme-labeled instrument. The difference was that the coating antigen on the ELISA plate was replaced by foot-and-mouth disease virus type A and Asia1 instead of foot-and-mouth disease virus type O. The results are as Figure 9As shown in the figure, among the nanobodies obtained in the present invention, 8 nanobodies have cross-reactivity with foot-and-mouth disease virus serotype A, 9 nanobodies have cross-reactivity with foot-and-mouth disease virus serotype Asia1, 3 nanobodies have cross-reactivity with both foot-and-mouth disease virus serotype A and Asia1, and the remaining 15 nanobodies have extremely low cross-reactivity with foot-and-mouth disease virus serotype A and Asia1. This indicates that the present invention has obtained specific nanobodies against foot-and-mouth disease virus serotype O. At the same time, some nanobodies have cross-reactivity with foot-and-mouth disease virus serotype A and Asia1.
[0210] Example 8 Screening of high-affinity nanobodies against foot-and-mouth disease virus serotype O by surface plasmon resonance (SPR)
[0211] 1. Expression and purification of nanobodies
[0212] Recombinant plasmids of specific nanobodies against foot-and-mouth disease virus serotype O obtained in Example 7 were extracted separately. According to the method described in item 1 of the title of Example 4, 15 recombinant bacteria B1 - B15 expressing nanobodies against foot-and-mouth disease virus serotype O were prepared, and induced expression and protein purification were carried out. Randomly selected purified nanobodies (numbered 26, 43, 45, 82, 88) were identified by SDS-PAGE electrophoresis and Western blot. It can be seen that obvious bands of nanobodies appeared at about 16 kD, which was consistent with the expected size of the target fragment, and the purity reached more than 90%. Figure 10 It can be seen that obvious bands of nanobodies appeared at about 16 kD, which was consistent with the expected size of the target fragment, and the purity reached more than 90%.
[0213] 2. Identification of the affinity of nanobodies by SPR method
[0214] According to the method described in item 2 of the title of Example 4, the affinities of the 15 obtained nanobodies with inactivated foot-and-mouth disease virus serotype O were identified respectively. The results are shown in Table 5. The K value of the nanobody numbered 104 reached 6.82×10, which was the nanobody Nb104 with the highest affinity screened in the present invention, and subsequent studies were all carried out around this nanobody. D value reached 6.82×10 -10 and it was the nanobody Nb104 with the highest affinity screened in the present invention, and subsequent studies were all carried out around this nanobody.
[0215] Table 5. Kinetic parameters of the binding of each nanobody to foot-and-mouth disease virus serotype O
[0216] Nanobody number <![CDATA[k a (M -1 s -1 )]]> <![CDATA[k d (s -1 )]]> <![CDATA[K D (M)]]> 26 <![CDATA[5.16×10 5 > <![CDATA[9.10×10 -4 > <![CDATA[1.76×10 -9 > 43 <![CDATA[2.57×10 5 > <![CDATA[2.03×10 -4 > <![CDATA[7.89×10 -8 <!-- 17 -->]]> 45 <![CDATA[6.31×10 5 > <![CDATA[3.93×10 -4 > <![CDATA[6.22×10 -8 > 82 <![CDATA[4.47×10 5 > <![CDATA[8.25×10 -4 > <![CDATA[1.84×10 -9 > 88 <![CDATA[1.52×10 5 > <![CDATA[6.59×10 -4 > <![CDATA[4.33×10 -9 > 104 <![CDATA[1.41×10 5 > <![CDATA[9.61×10 -5 > <![CDATA[6.82×10 -10 > 109 <![CDATA[8.15×10 5 > <![CDATA[7.91×10 -4 > <![CDATA[9.71×10 -8 > 119 <![CDATA[3.09×10 5 > <![CDATA[3.90×10 -4 > <![CDATA[1.26×10 -9 > 131 <![CDATA[9.14×10 5 > <![CDATA[6.82×10 -4 > <![CDATA[7.46×10 -8 > 146 <![CDATA[7.02×10 5 > <![CDATA[6.47×10 -4 > <![CDATA[9.21×10 -8 > 163 <![CDATA[5.89×10 5 > <![CDATA[3.31×10 -4 > <![CDATA[5.62×10 -8 > 168 <![CDATA[6.16×10 5 > <![CDATA[2.92×10 -4 > <![CDATA[4.74×10 -8 > 184 <![CDATA[1.63×10 5 > <![CDATA[2.31×10 -4 > <![CDATA[1.41×10 -9 > 186 <![CDATA[2.14×10 5 > <![CDATA[1.85×10 -4 > <![CDATA[8.64×10 -8 > 197 <![CDATA[1.92×10 5 > <![CDATA[1.17×10 -4 > <![CDATA[6.09×10 -8 >
[0217] Note: In Table 5, ka represents the binding rate constant, kd represents the dissociation rate constant, and K D represents the equilibrium dissociation constant.
[0218] The recombinant bacterial plasmid expressing nanobody Nb104 was extracted and sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing to obtain its gene sequence and amino acid sequence, which are shown in SEQ ID NO.: 2 and SEQ ID NO.: 6 respectively.
[0219] Example 9 Tandem Expression and Purification of Bifunctional Nanobody Nb131-104
[0220] 1. Construction of Bifunctional Nanobody Gene Fragments
[0221] The recombinant plasmids expressing porcine DC-specific nanobody Nb131 and porcine foot-and-mouth disease virus serotype O-specific nanobody Nb104 were extracted respectively, and amplified using the primers NbF, NbLR and NbLF, NbR shown in Table 6 respectively to obtain the gene fragments of porcine DC-specific nanobody Nb131 and porcine foot-and-mouth disease virus serotype O-specific nanobody Nb104, which were then purified and recovered. Using the purified and recovered nanobody gene fragments as templates and (G4S)4 sequence as the linker element linker, a bifunctional nanobody fragment Nb131-104 was constructed by splicing by overlap extension (SOE) PCR. The reaction was carried out in two steps:
[0222] The first step of the reaction was carried out without adding primers. The reaction conditions were: 95°C for 3 min; 95°C for 30 s, 62°C for 30 s, 72°C for 2 min, for a total of 8 cycles; 72°C for 10 min;
[0223] For the second step of the reaction, only primers NbF and NbR need to be added to the original PCR tube. The reaction conditions were: 95°C for 3 min; 95°C for 30 s, 55°C for 30 s, 72°C for 2 min, for a total of 25 cycles; 72°C for 10 min;
[0224] After the reaction, the PCR amplification products were identified by 1% agarose gel electrophoresis, and the target bands were observed under ultraviolet light. As Figure 11 shown, a gene fragment of about 900 bp was visible, which was consistent with the expected fragment size. Subsequently, it was inserted between the Pst I and Xba I restriction sites of the pMECS vector (purchased from Novagen), and transformed into Escherichia coli WK6 competent cells (purchased from Novagen) at 42°C. The cells were cultured at 37°C with a shaking speed of 200 rpm for 1 h, the bacterial liquid was centrifuged and concentrated, and then spread on an LB plate containing 100 μg / mL ampicillin and cultured at 37°C for 12 - 16 hours; single colonies were selected to obtain recombinant bacteria expressing bifunctional nanobody. The specific sequences of each primer are shown in Table 6:
[0225] Table 6. Primers for SOE-PCR Amplification
[0226]
[0227] 2. Identification of the gene sequence of bifunctional nanobody
[0228] Extract the plasmid of the recombinant bacterium expressing the bifunctional nanobody Nb131-104, and send it to Shanghai Sangon Biotech Co., Ltd. for sequence determination to obtain the nucleotide sequences and amino acid sequences of the linker element (G4S)4 and the bifunctional nanobody Nb131-104. The nucleotide sequences of the linker element (G4S)4 and the bifunctional nanobody Nb131-104 are shown in SEQ ID NO.: 3 and SEQ ID NO.: 4 respectively, and the amino acid sequences of the linker element (G4S)4 and the bifunctional nanobody Nb131-104 are shown in SEQ ID NO.: 7 and SEQ ID NO.: 8 respectively.
[0229] 3. Expression, purification and identification of bifunctional nanobody
[0230] According to the method described in Title 1 of Example 4, use the recombinant bacterium to induce expression to prepare the bifunctional nanobody Nb131-104, and carry out protein purification and identification. From Figure 12 It can be seen that there are obvious bands at about 35 kD for the bifunctional nanobody Nb131-104, which is consistent with the expected size of the target fragment, and the purity reaches more than 90%.
[0231] Example 10 Identification of the affinity of bifunctional nanobody Nb131-104 by surface plasmon resonance (SPR)
[0232] 1. Identification of the affinity of nanobody by SPR
[0233] According to the method described in Title 2 of Example 4, identify the affinities of the bifunctional nanobody Nb131-104 with the lysate of porcine BMDC cells and foot-and-mouth disease virus type O respectively. The results are shown in Table 7. The equilibrium dissociation constants (K D ) of the bifunctional nanobody Nb131-104 with the lysate of porcine BMDC cells and foot-and-mouth disease virus type O are 6.02×10 -8 and 2.41×10 -9 respectively.
[0234] Table 7. Kinetic parameters of the binding of bifunctional nanobody Nb131-104 to antigens
[0235] Antigen <![CDATA[k a (M -1 s -1 )]]> <![CDATA[k d (s -1 )]]> <![CDATA[K D (M)]]> Porcine BMDC cell lysate <![CDATA[2.37×10 4 > <![CDATA[1.42×10 -3 > <![CDATA[6.02×10 -8 > Foot-and-mouth disease virus, type O <![CDATA[1.93×10 5 > <![CDATA[4.65×10 -4 > <![CDATA[2.41×10 -9 >
[0236] Note: In Table 7, ka represents the binding rate constant, kd represents the dissociation rate constant, and K D represents the equilibrium dissociation constant.
[0237] Example 11 Identification of the antigen presentation function of bifunctional nanobody Nb131-104 by laser confocal microscopy
[0238] 1. Identification of the binding ability of bifunctional nanobody Nb131-104 to porcine BMDCs by laser confocal microscopy
[0239] The bifunctional nanobody Nb131-104 prepared in Example 9 was subjected to column chromatography to remove endotoxin, and its endotoxin content was detected using an endotoxin detection kit (purchased from Pyrosate Company, 0.25 EU / mL) to ensure that the endotoxin level was less than 0.05 EU. It was labeled with FITC fluorescent dye (purchased from Shanghai Youningwei Company), and the unlabeled excess dye was removed by ultrafiltration (4000 g, 20 min). Fresh porcine BMDC cells were induced to differentiate according to the method described in Example 1. The bifunctional nanobody Nb131-104 (5 μg / mL) pre-labeled with FITC fluorescent dye was incubated with porcine BMDC cells (1×10 6 cells / mL) at 4°C for 30 min. The cells were collected and fixed with 4% paraformaldehyde at room temperature for 10 min. After washing three times with PBS, they were placed in PBS containing 0.1% Triton and treated at 37°C for 5 min. After washing three times with PBS, they were placed in the blocking solution and blocked at 37°C for 1 h. The cells were washed three times with PBS, and incubated with AF647-labeled anti-pig CD1 antibody (1:1000 dilution, purchased from Shanghai Youningwei Company) at 4°C for 30 min. The cells were washed three times with PBS, stained with DAPI (working solution, purchased from Beyotime Institute of Biotechnology) for 10 min, and after washing three times with PBS, they were observed under a laser confocal microscope. The results were as Figure 13 shown. The green fluorescence intensity of the experimental group of porcine BMDC cells added with bifunctional nanobody Nb131-104 was higher than that of the control group, indicating that bifunctional nanobody Nb131-104 could specifically bind to porcine BMDC cells.
[0240] 2. Identification of the FMDV antigen delivery ability of bifunctional nanobody Nb131-104 by laser confocal microscopy
[0241] The inactivated antigen of type O FMDV was purified by sucrose density gradient centrifugation technology, and the purified product was identified by SDS-PAGE and Western Blotting methods. Fresh porcine BMDC cells were induced to differentiate according to the method described in Example 1. After incubating the bifunctional nanobody Nb131-104 (5 μg / mL) labeled with FITC fluorescent dye (purchased from Shanghai Youningwei Company) with the purified inactivated FMDV antigen (5 μg / mL) at 4°C for 30 min, it was then incubated with porcine BMDC cells (1×10 6Incubate at 4°C for 30 min at 4 °C, collect the cells, and identify them according to the method described in Title 1 of this example. The results are as Figure 14 shown. The green fluorescence intensity of the porcine BMDC cell test group with the addition of the bifunctional nanobody Nb131-104 was higher than that of the control group, indicating that the FMDV antigen was delivered to porcine BMDC cells through the bifunctional nanobody Nb131-104.
[0242] Example 12 Evaluation of the Immunopotency of the Bifunctional Nanobody Nb131-104 in Presenting FMDV Antigen
[0243] 1. Immune assay
[0244] Incubate the bifunctional nanobody Nb131-104 (5 μg / mL) prepared in Example 9 with the purified inactivated FMDV antigen (5 μg / mL) at 4 °C for 60 min, supplemented with 206 adjuvant, and conduct an immunization experiment on pigs. Each pig was immunized with 2 mL intramuscularly in the neck and blood samples were taken at different time points (14 d, 28 d, 42 d, 56 d). At the same time, a control group of the bifunctional nanobody Nb131-104 formulated with PBS, a control group of non-DC-targeted nanobody formulated with FMDV, a control group of non-DC-targeted nanobody formulated with PBS, an FMDV control group, and a PBS blank control group were set up, with 5 pigs in each group.
[0245] The FMD liquid-phase blocking ELISA antibody detection technology has good sensitivity, rapid diagnostic ability, and repeatability, and has a good correlation with the protection against challenge. It has now been widely used in the detection of FMD immune antibody levels. The FAO and OIE recommend using the liquid-phase blocking ELISA method to evaluate the FMD immunization effect. Therefore, this study used the liquid-phase blocking ELISA method to evaluate the FMD immunization effect.
[0246] 2. Evaluation of immunopotency
[0247] Use the FMD liquid-phase blocking ELISA antibody detection kit to detect the specific antibody level, antibody subtypes (IgG1 and IgG2a), and immune persistence period in the post-immunization serum. The detection steps were all carried out according to the kit instructions. The detection results are as Figure 15 shown. The post-immunization antibody titers of the test group of the bifunctional nanobody Nb131-104 formulated with FMDV were significantly higher than those of other test groups and control groups, indicating that the bifunctional nanobody promotes the production of post-immunization antibodies against the FMDV antigen; the detection results of antibody subtypes showed (as Figure 16 , Figure 17(as shown in the figure), the post-immunization IgG1 antibody titers of the test group with the bifunctional nanobody Nb131-104 combined with FMDV were significantly higher than those of other test groups and the control group. There was no significant difference in the IgG2a antibody titer compared with other FMDV test groups, indicating that the bifunctional nanobody Nb131-104 could significantly increase the post-immunization IgG1 antibody level of FMDV antigen, and there was no significant difference in the promotion effect on the IgG2a antibody level compared with other test groups. The results of the immune persistence period detection showed (as Figure 18 (as shown in the figure), the antibody level of the test group with the bifunctional nanobody Nb131-104 combined with FMDV could last until 56 days after immunization, and the antibody titers were significantly higher than those of other test groups and the control group, indicating that the bifunctional nanobody Nb131-104 could not only significantly increase the post-immunization antibody level of FMDV antigen, but also the antibodies in the serum 56 days after immunization could still be maintained at a relatively high level, indicating that the bifunctional nanobody had a significant promoting effect on the humoral immune response caused by FMDV antigen after immunization.
[0248] Fresh lymph nodes of immunized pigs were collected in vivo near the injection site, and single-cell suspensions of lymph nodes were prepared. Lymphocyte separation solution was added to the cell suspension, and density gradient centrifugation was performed (3000g, 20 min). Lymphocytes were aspirated (a total of four layers were divided from top to bottom after centrifugation, and the second layer was aspirated), washed 3 times with cell culture medium containing serum, and then inoculated into 96-well plates (1×10 6 cells / mL); the separated lymphocytes were stained with fluorescent antibodies against CD4 and CD8 respectively, and the proliferation results were detected using a FACSAria flow cytometer, and data were obtained using CellQuest software. In the two-dimensional scatter plot of forward scatter light (FSC) and side scatter light (SSC), the lymphocyte region P1 was delineated, and 10,000 cells were counted in the P1 region. The types of lymphocytes were analyzed using multi-parameter flow cytometry. CellQuest software was used to analyze the percentage of CD4 + T cells and CD8 + T cells in the total number of cells in the selected P1 cell region. The number of cells and percentages of each group are shown in Table 8. As can be seen from Table 8, the numbers of CD4 + T cells and CD8 + T cells in the Nb131-104 + O-FMDV test group increased significantly, and there were very significant differences compared with the other test groups and the control group, indicating that the bifunctional nanobody had a promoting effect on the cellular immune response caused by FMDV antigen after immunization.
[0249] Table 8. Numbers and percentages of CD4 + T cells and CD8 + T cells in the spleens of each test group
[0250]
[0251]
[0252] The freshly isolated lymphocytes above (2×10 6 cells / mL) were inoculated into a 24-well plate, and the lymphocytes were stimulated in vitro with the purified inactivated FMDV antigen (5 μg / mL), and co-incubated in a cell culture incubator (37 °C, containing 5% CO2) for 120 min. Part of the cell samples were collected and centrifuged to obtain the supernatant. According to the instructions of the ELISA kit (purchased from Shanghai Univ-Bio Co., Ltd.), the concentrations of IFN-γ, IL-2, and IL-4 in the supernatant were detected. The results are as Figure 19 shown. The secretion levels of IFN-γ, IL-2, and IL-4 in the Nb131-104 + O-FMDV test group were significantly higher than those in the other test groups and the control group, further indicating that the bifunctional nanobody Nb131-104 can significantly enhance the cellular immune response induced by FMDV antigen immunization.
[0253] Example 13 Construction of a Nanobody Library Against Classical Swine Fever Virus
[0254] 1. RNA Extraction and cDNA Synthesis
[0255] A Xinjiang Bactrian camel was immunized with one dose of a live classical swine fever vaccine with heat protection agent (kindly provided by Nanjing Tianbang Biological Products Co., Ltd.); one week later, the Bactrian camel was immunized and cDNA was synthesized according to the method described in Title 2 of Example 1.
[0256] 2. Primer Design and Synthesis
[0257] According to Title 3 of Example 1, PCR primers C1F, C1R, V HH F, and V HH R were designed for amplifying the variable region gene VHH fragment (350 bp) of the camel heavy chain antibody. The specific sequences of each primer are shown in Table 1 above.
[0258] 3. Amplification of VHH Fragment
[0259] Using the camel cDNA synthesized in Title 1 of this example as a template, the VHH fragment was amplified and identified according to the method described in Title 4 of Example 1. The results are as Figure 20 shown. A VHH gene fragment of approximately 350 bp was visible, which was consistent with the expected size. The gel recovery kit (purchased from TAKARA) was used according to the instructions to purify and recover the target band.
[0260] 4. Construction of a Phage Display Gene Library
[0261] The purified and recovered VHH gene fragments were used to construct a phage display gene library and identified according to the method described in Title 5 of Example 1, and the results were as follows Figure 21 , 24 monoclonal colonies were identified by colony PCR, and all monoclonal colonies contained a target fragment of approximately 350 bp in size, indicating that the insertion rate of this library reached 100%. The colonies on the above plate were scraped into LB liquid medium, then glycerol with a final concentration of 30% was added, and they were aliquoted and stored at -80 °C for later use. This is the phage display library of classical swine fever virus.
[0262] Example 14 Screening process of nanobody against classical swine fever virus
[0263] 1. Amplification of phage display library
[0264] Take 200 μL of the phage display library of classical swine fever virus prepared in Example 13 stored at -80 °C, and amplify it according to the method described in Title 1 of Example 2. The amplified phage library was resuspended in 5 mL of 0.1 M PBS to obtain its suspension.
[0265] 2. Affinity screening
[0266] Add 10 μg of inactivated antigen of classical swine fever virus (preserved in this laboratory) to 10 mL of 100 mM NaHCO3 solution (pH 8.2), and perform affinity screening and identification according to the method described in Title 2 of Example 2. Set the cell lysate of PK-15 cells (preserved in this laboratory) as a control. The results are shown in Table 9. After three rounds of affinity screening of the library, the phages enriched in each round of screening were more than those in the previous round.
[0267] Table 9. Enrichment process of phage library in 3 rounds of affinity screening
[0268] Affinity screening round Input phage library amount (pfu / mL) Recovered phage library amount (pfu / mL) The first round of affinity screening <![CDATA[1.38×10 7 > <![CDATA[3.41×10 3 > The second round of affinity screening <![CDATA[1.21×10 7 > <![CDATA[1.51×10 4 > The third round of affinity screening <![CDATA[1.25×10 7 > <![CDATA[1.67×10 5 >
[0269] Example 15 Screening of specific positive clones by enzyme-linked immunosorbent assay (ELISA)
[0270] 1. Expression of nanobody against classical swine fever virus
[0271] From the colonies enriched on the LB plate after the third round of screening in Example 14, 200 single colonies were selected and used to prepare the nanobodies against classical swine fever virus expressed by each recombinant bacterium according to the method described in Title 1 of Example 3. The numbers of each nanobody were sequentially numbered from 1 to 200.
[0272] 2. Detection of binding activity of nanobody by indirect ELISA method
[0273] The binding activity of each nanobody to classical swine fever virus (CSFV) was identified by indirect ELISA. 10 μg of CSFV was added to 10 mL of 100 mM NaHCO3 solution (pH 8.2), and the identification was carried out according to the method described in Title 2 of Example 3, with the cell lysate of PK-15 cells set as a control. The results are as Figure 22 shown. A total of 19 nanobodies could specifically bind to CSFV (to screen for high-affinity nanobodies, only the nanobodies with an OD 450 value greater than 2.0 were selected).
[0274] 3. Identification of specificity
[0275] According to the indirect ELISA detection method described in Title 2 of this example, the cross-reactivity of each nanobody with O-FMDV, PCV2, PRRSV, PRV, and PEDV was detected respectively. The corresponding OD 450 was measured using an enzyme-linked immunosorbent assay (ELISA) reader, with the difference that the coating antigen on the ELISA plate was O-FMDV, PCV2, PRRSV, PRV, or PEDV instead of CSFV. The results are as Figure 23 shown. The nanobodies obtained in the present invention had extremely low cross-reactivity with O-FMDV, PCV2, PRRSV, PRV, and PEDV, indicating that the present invention obtained specific nanobodies against porcine epidemic diarrhea virus (PEDV).
[0276] Example 16 Screening for high-affinity nanobodies against classical swine fever virus by surface plasmon resonance (SPR)
[0277] 1. Expression and purification of nanobodies
[0278] The plasmids of the recombinant bacteria expressing specific nanobodies against CSFV obtained in Example 15 were extracted respectively. Nineteen recombinant bacteria B1 - B19 expressing nanobodies against CSFV were prepared according to the method described in Title 1 of Example 4, and induced expression and protein purification were carried out. Randomly selected purified nanobodies (numbered 26, 43, 45, 82, 88) were identified by SDS-PAGE electrophoresis and Western blot. It can be seen from Figure 24 that there were obvious bands at approximately 16 kD for the nanobodies, which was consistent with the expected size of the target fragment, and the purity was over 90%.
[0279] 2. Identification of the affinity of nanobodies by SPR
[0280] According to the method described in Title 2 of Example 4, the affinity of the 19 obtained nanobodies with CSFV was identified respectively. The results are shown in Table 10. The K D value of the nanobody numbered 62 reached 6.82×10 -10, Nb62, the nanobody with the highest affinity screened for the present invention, and subsequent studies were all carried out around this nanobody.
[0281] Table 10. Kinetic parameters of the binding of each nanobody to classical swine fever virus
[0282]
[0283]
[0284] Note: In Table 10, ka represents the binding rate constant, kd represents the dissociation rate constant, and K D represents the equilibrium dissociation constant.
[0285] Extract the recombinant plasmid of the nanobody Nb62, send it to Sangon Biotech (Shanghai) Co., Ltd. for sequence determination, and obtain its gene sequence and amino acid sequence. The gene sequence and amino acid sequence are shown in SEQ ID NO.: 13 and SEQ ID NO.: 14 respectively.
[0286] Example 17 Tandem Expression and Purification of Bifunctional Nanobody Nb131-62
[0287] 1. Construction of the bifunctional nanobody gene fragment
[0288] Extract the recombinant plasmids expressing the porcine DC cell-specific nanobody Nb131 and the classical swine fever virus-specific nanobody Nb62 respectively, and construct the bifunctional nanobody fragment Nb131-62 according to the method described in item 1 of Example 9. As Figure 25 shown, a gene fragment of about 900 bp can be seen, which is consistent with the expected fragment size. Subsequently, it is inserted between the Pst I and Xba I restriction sites of the pMECS vector (purchased from Novagen) to obtain a recombinant bacterium expressing the bifunctional nanobody.
[0289] 2. Identification of the bifunctional nanobody gene sequence
[0290] Extract the plasmid of the recombinant bacterium expressing the bifunctional nanobody Nb131-62, send it to Sangon Biotech (Shanghai) Co., Ltd. for sequence determination, and obtain the gene sequence and amino acid sequence of the linker element (G4S)4 and the bifunctional nanobody Nb131-62. The gene sequences of the linker element (G4S)4 and the bifunctional nanobody Nb131-62 are shown in SEQ ID NO.: 3 and SEQ ID NO.: 19 respectively, and the amino acid sequences of the linker element (G4S)4 and the bifunctional nanobody Nb131-62 are shown in SEQ ID NO.: 7 and SEQ ID NO.: 21 respectively.
[0291] 3. Expression and Purification Identification of the Bifunctional Nanobody
[0292] According to the method described in Title 1 of Example 4, the bifunctional nanobody Nb131-62 was induced and expressed using recombinant bacteria, and protein purification and identification were carried out. From Figure 26 it can be seen that there are obvious bands of the bifunctional nanobody Nb131-62 at about 35 kD, which is consistent with the expected size of the target fragment, and the purity reaches more than 90%.
[0293] Example 18 Identification of the affinity of the bifunctional nanobody Nb131-62 by surface plasmon resonance (SPR)
[0294] 1. Identification of the affinity of the nanobody by SPR
[0295] According to the method described in Title 2 of Example 4, the affinities of the bifunctional nanobody Nb131-62 with the lysate of porcine BMDC cells and classical swine fever virus were identified respectively. The results are shown in Table 11. The equilibrium dissociation constants (K D ) of the bifunctional nanobody Nb131-62 with the lysate of porcine BMDC cells and classical swine fever virus are 0.77×10 -9 and 3.49×10 -9 , respectively.
[0296] Table 11. Kinetic parameters of the binding of the bifunctional nanobody Nb131-62 to antigens
[0297] Antigen <![CDATA[k a (M -1 s -1 )]]> <![CDATA[k d (s -1 )]]> <![CDATA[K D (M)]]> Porcine BMDC cell lysate <![CDATA[3.85×10 4 > <![CDATA[2.97×10 -4 > <![CDATA[0.77×10 -9 > Classical swine fever virus <![CDATA[1.61×10 5 > <![CDATA[5.63×10 -4 > <![CDATA[3.49×10 -9 >
[0298] Note: In Table 11, ka represents the association rate constant, kd represents the dissociation rate constant, and K D represents the equilibrium dissociation constant.
[0299] Example 19 Identification of the antigen presentation function of the bifunctional nanobody Nb131-62 by laser confocal microscopy
[0300] 1. Identification of the binding ability of the bifunctional nanobody Nb131-62 to porcine BMDC by laser confocal microscopy
[0301] The bifunctional nanobody Nb131-62 prepared in Example 17 was subjected to column chromatography to remove endotoxin, ensuring that the endotoxin level was less than 0.05 EU, and it was labeled with FITC fluorescent dye (purchased from Shanghai Univ Biotechnology Co., Ltd.). Fresh porcine BMDC cells were induced and differentiated according to the method described in Example 1. The FITC fluorescent dye-labeled bifunctional nanobody Nb131-62 (5 μg / mL) was incubated with porcine BMDC cells (1×10 6 cells / mL) at 4 °C for 30 min, the cells were collected, and identification was carried out according to the method described in Title 1 of Example 11. The results are as Figure 27As shown, the green fluorescence intensity of the experimental group of porcine BMDC cells with the addition of the bifunctional nanobody Nb131-62 was higher than that of the control group, indicating that the bifunctional nanobody Nb131-62 could specifically bind to porcine BMDC cells.
[0302] 2. Identification of the ability of the bifunctional nanobody Nb131-62 to deliver classical swine fever virus antigens by laser confocal microscopy
[0303] The classical swine fever virus antigens were purified by sucrose density gradient centrifugation, and the purified products were identified by SDS-PAGE and Western Blotting. Fresh porcine BMDC cells were induced and differentiated according to the method described in Example 1. After incubating the purified classical swine fever virus antigens (5 μg / mL) with the FITC-fluorescent dye-labeled bifunctional nanobody (5 μg / mL) at 4°C for 30 min, the mixture was then incubated with porcine BMDC cells (1×10 6 cells / mL) at 4°C for 30 min. The cells were collected and identified according to the method described in Title 1 of Example 11. The results were as Figure 28 shown. The green fluorescence intensity of the experimental group of porcine BMDC cells with the addition of the bifunctional nanobody Nb131-62 was higher than that of the control group, indicating that the classical swine fever virus antigens were delivered to porcine BMDC cells through the bifunctional nanobody Nb131-62.
[0304] Example 20 Evaluation of the immune efficacy of the bifunctional nanobody Nb131-62 in presenting classical swine fever virus antigens
[0305] 1. Immune experiment
[0306] After incubating the bifunctional nanobody Nb131-62 (5 μg / mL) prepared in Example 17 with the purified classical swine fever virus antigens (5 μg / mL) at 4°C for 60 min, 206 adjuvant was added, and an immune experiment was conducted on pigs. Each pig was immunized intramuscularly with 2 mL behind the ear root, and blood samples were taken at different time points (14 d, 28 d, 42 d, 56 d). At the same time, a control group of the bifunctional nanobody combined with PBS, a control group of non-DC-targeted nanobody combined with classical swine fever virus, a control group of non-DC-targeted nanobody combined with PBS, a control group of classical swine fever virus, and a PBS blank control group were set up, with 5 pigs in each group.
[0307] 2. Evaluation of immune efficacy
[0308] The specific antibody levels in the post-immune sera were detected using a CSFV-ELISA antibody detection kit (purchased from IDEXX, USA). The detection steps were carried out according to the kit instructions, and the antibody blocking rate was calculated according to the formula provided by the kit. The detection results were as Figure 29As shown, the antibody titers after immunization in the experimental group of bifunctional nanobody Nb131-62 combined with classical swine fever virus were significantly higher than those in other experimental groups and the control group, indicating that the bifunctional nanobody can promote the production of antibodies after immunization with classical swine fever virus antigen.
[0309] The ELISA kit (purchased from Suzhou Calvin Company) was used to detect the secretion levels of IFN-γ, IL-2, IL-4, and IL-10 in the above-mentioned sera after immunization. The detection steps were carried out according to the kit instructions, and the detection results are as Figures 30 - 33 shown. The secretion levels of IFN-γ, IL-2, IL-4, and IL-10 in the experimental group of bifunctional nanobody Nb131-62 + classical swine fever virus were significantly higher than those in the remaining experimental groups and the control group, further indicating that the bifunctional nanobody can significantly enhance the cellular immune response induced by classical swine fever virus antigen immunization.
[0310] The anticoagulated blood from the anterior vena cava of immunized pigs was aseptically collected, and lymphocytes were separated according to the instructions of lymphocyte separation medium. Lymphocyte separation medium was added to the anticoagulated blood from the anterior vena cava, and density gradient centrifugation was performed (3000g, 20 min). Lymphocytes were aspirated (after centrifugation, there were four layers from top to bottom, and the second layer was aspirated), washed 3 times with serum-containing cell culture medium, and then inoculated into 96-well plates (1×10 6 cells / mL); the cells were stimulated with purified classical swine fever virus antigen (5 μg / mL) and LPS respectively, and then continued to be cultured in a cell incubator (37 °C, containing 5% CO2) for 48 h; MTT (5 mg / mL) was added to each well and then continued to be cultured for 4 h. The cell samples were centrifuged and collected, DMSO was added and mixed until the crystals dissolved, and the cell plate was placed in an enzyme-linked immunosorbent assay reader to read the results. The results are as Figure 34 shown. Compared with the control group, the experimental group of Nb131-62 + classical swine fever virus can significantly increase the proliferation level of lymphocytes and induce a better cellular immune level.
[0311] Example 21 Preparation of Porcine CD205 Molecular Target Protein
[0312] 1. Primer Design and Synthesis
[0313] According to the gene sequence of porcine CD205 molecule published by NCBI (accession number: GQ420669.1), PCR primers F1 and R1 were designed for amplifying the truncated gene of CysR-FNII of porcine CD205 molecule (see SEQ ID NO.: 17, 600 bp). The specific sequences of each primer are shown in Table 12.
[0314] Table 12. PCR Amplification Primers
[0315] Primer Sequence (5’-3’) F1 <![CDATA GGATCC GAGCTCTAAATGATCACACCACTGAACGAC (The underlined part is the BamH I restriction site)]]> R1 <![CDATA TTCGAA CTCGAGTGAAATATAAGCTTCTTTCCAAGAA (The underlined part is the HindIII restriction site)]]>
[0316] 2. Amplification of the truncated gene of porcine CD205 molecule CysR-FN II
[0317] Under sterile conditions, porcine spleen tissue was obtained, and total RNA was extracted from the spleen tissue. According to the instructions of the reverse transcription kit (purchased from TAKARA), cDNA was synthesized. Using the primers F1 and R1 designed in Title 1 of this example, PCR amplification was carried out to obtain a gene fragment of approximately 600 bp. The PCR reaction conditions were: 95°C for 3 min; 95°C for 30 s, 59°C for 1 min, 72°C for 1 min, for a total of 30 cycles; 72°C for 10 min. After the reaction, the PCR amplification product was identified by 1% agarose gel electrophoresis, and the target band was observed under ultraviolet light. As Figure 35 shown, a porcine CD205 molecule CysR-FN II truncated gene fragment of approximately 600 bp was visible, which was consistent with the expected size. The target band was purified and recovered using a gel recovery kit (purchased from TAKARA).
[0318] 3. Induced expression, purification and identification of the target protein of porcine CD205 molecule
[0319] The purified and recovered porcine CD205 molecule CysR-FN II gene fragment was digested with BamH I and Hind III and then ligated into the pET-32a vector (purchased from Novagen). The ligation product was transformed into E. coli BL21 competent cells (purchased from Novagen), cultured at 37°C for 1 h, and the bacterial solution was centrifuged and concentrated and then spread on an LB plate medium containing ampicillin resistance, and cultured at 37°C for 12 - 16 hours; a single colony was selected to obtain recombinant bacterium 1 expressing the porcine CD205 target protein.
[0320] According to the method described in Title 1 of Example 4, the recombinant bacterium 1 was used to induce the expression of the porcine CD205 target protein, and protein purification and identification were carried out. From Figure 36 it can be seen that there was an obvious band at approximately 23 kD for the porcine CD205 target protein, which was consistent with the expected size of the target fragment, and the purity reached more than 90%.
[0321] Example 22 Construction of a nanobody library against porcine CD205 molecule
[0322] 1. RNA extraction and cDNA synthesis
[0323] 1 mg of the porcine CD205 target protein prepared in Example 13 was mixed with an equal volume of Freund's complete adjuvant and used to immunize a Xinjiang Bactrian camel; one week later, the Bactrian camel was immunized and cDNA was synthesized according to the method described in Title 2 of Example 1.
[0324] 2. Primer design and synthesis
[0325] According to Example 1, Title 3, PCR primers C1F, C1R, V HH F and V HH R for amplifying the VHH fragment (350bp) of the variable region gene of camel heavy chain antibody were designed. The specific sequences of each primer are as shown in Table 1 above.
[0326] 3. Amplification of VHH fragment
[0327] Using the camel cDNA synthesized in Title 1 of this example as a template, the VHH fragment was amplified and identified according to the method described in Title 4 of Example 1. The results are as Figure 37 shown. A VHH gene fragment of approximately 350bp was visible, which was consistent with the expected size. The target band was purified and recovered using a gel recovery kit (purchased from TAKARA).
[0328] 4. Construction of phage display gene library
[0329] The purified and recovered VHH gene fragment was used to construct a phage display gene library and identified according to the method described in Title 5 of Example 1. The results are as Figure 38 , 24 monoclonal colonies were identified by colony PCR. All monoclonal colonies contained a target fragment of approximately 350bp in size, indicating that the insertion rate of this library reached 100%. The colonies on the above plate were scraped into LB liquid medium, then glycerol with a final concentration of 30% was added, and they were aliquoted and stored at -80°C for later use. This is the phage display library of nanobodies against porcine CD205 molecule.
[0330] Example 23 Screening process of nanobodies against porcine CD205 molecule
[0331] 1. Amplification of phage display library
[0332] Take 200 μL of the phage display library prepared in Example 22 stored at -80°C and amplify it according to the method described in Title 1 of Example 2. The amplified phage display library was resuspended in 5 mL of 0.1 M PBS buffer to obtain its suspension.
[0333] 2. Affinity screening
[0334] Add 10 μg of the porcine CD205 target protein prepared in Example 21 to 10 mL of 100 mM NaHCO3 solution (pH 8.2), and perform affinity screening and identification according to the method described in Title 2 of Example 2. Another unrelated protein antigen prepared under the same conditions was set as a control. The results are shown in Table 13. After three rounds of affinity screening of the library, the phages enriched in each round of screening were more than those in the previous round.
[0335] Table 13. Enrichment process of 3 rounds of affinity screening of phage library
[0336] Affinity screening round Input phage library amount (pfu / mL) Recovered phage library amount (pfu / mL) The first round of affinity screening <![CDATA[1.1×10 7 > <![CDATA[5.3×10 3 > The second round of affinity screening <![CDATA[1.4×10 7 > <![CDATA[2.2×10 4 > The third round of affinity screening <![CDATA[1.2×10 7 > <![CDATA[1.6×10 5 >
[0337] Example 24 Screening of Specific Positive Clones by Enzyme-Linked Immunosorbent Assay (ELISA)
[0338] 1. Expression of Nanobody
[0339] From the colonies enriched on the LB plate after the third round of screening in Example 23, 200 single colonies were selected, and the nanobodies against the target protein CD205 expressed by each recombinant bacterium were prepared respectively according to the method described in Title 1 of Example 3. The numbers of the nanobodies were sequentially numbered from 1 to 200.
[0340] 2. Detection of the Binding Activity of Nanobody by Indirect ELISA
[0341] The binding activities of the nanobodies numbered from 1 to 200 with the porcine CD205 target protein were identified by indirect ELISA reaction. 10 μg of the porcine CD205 target protein prepared in Example 21 was added to 10 mL of a NaHCO3 solution with a concentration of 100 mM (pH 8.2), and the identification was carried out according to the method described in Title 2 of Example 3. In the control wells, any other irrelevant protein prepared under the same conditions was used to replace the porcine CD205 target protein for coating. The results are as Figure 39 shown. A total of 14 nanobodies could specifically bind to the porcine CD205 target protein (to screen for high-affinity nanobodies, only the nanobodies with an OD 450 value greater than 2.0 were selected).
[0342] Example 25 Screening of High-Affinity Nanobodies by Surface Plasmon Resonance (SPR)
[0343] 1. Expression and Purification of Nanobody
[0344] The plasmids of the recombinant bacteria expressing nanobodies obtained in Example 24 were extracted respectively, and the recombinant bacteria A1 - A14 expressing nanobodies were prepared according to the method described in Title 1 of Example 4, and induced expression and protein purification were carried out. Randomly selected purified nanobodies were identified by SDS-PAGE electrophoresis and Western blot. From Figure 40 it can be seen that obvious bands of nanobody appeared at about 16 kD, which was consistent with the expected size of the target fragment, and the purity reached more than 90%.
[0345] 2. Identification of the Affinity of Nanobody by SPR
[0346] The affinities of the nanobodies with the porcine CD205 target protein were identified respectively according to the method described in Title 2 of Example 4. The results are shown in Table 14. The nanobody numbered 193 had a K DReaching 1.04×10 -9 , which is the nanobody with the highest affinity screened for the present invention, and subsequent studies were all carried out around this nanobody.
[0347] Table 14. Kinetic parameters of the binding of each nanobody to the porcine CD205 target protein
[0348] Nanobody number <![CDATA[k a (M -1 s -1 )]]> <![CDATA[k d (s -1 )]]> <![CDATA[K D (M)]]> 3 <![CDATA[2.18×10 4 > <![CDATA[1.71×10 -4 > <![CDATA[0.78×10 -8 > 21 <![CDATA[1.29×10 4 > <![CDATA[2.39×10 -4 > <![CDATA[1.85×10 -8 > 25 <![CDATA[3.14×10 4 > <![CDATA[1.38×10 -4 > <![CDATA[0.43×10 -8 > 46 <![CDATA[2.16×10 4 > <![CDATA[1.26×10 -4 > <![CDATA[0.58×10 -8 > 68 <![CDATA[6.91×10 5 > <![CDATA[3.45×10 -4 > <![CDATA[0.49×10 -9 > 87 <![CDATA[1.17×10 4 > <![CDATA[3.12×10 -4 > <![CDATA[2.66×10 -8 > 89 <![CDATA[4.16×10 4 > <![CDATA[5.10×10 -4 > <![CDATA[1.23×10 -8 > 131 <![CDATA[1.47×10 5 > <![CDATA[1.97×10 -4 > <![CDATA[1.34×10 -9 > 153 <![CDATA[4.31×10 4 > <![CDATA[3.83×10 -4 > <![CDATA[8.89×10 -9 > 169 <![CDATA[2.85×10 4 > <![CDATA[9.52×10 -4 > <![CDATA[3.34×10 -8 > 170 <![CDATA[4.25×10 4 > <![CDATA[2.23×10 -4 > <![CDATA[0.52×10 -8 > 174 <![CDATA[2.02×10 4 > <![CDATA[1.98×10 -4 > <![CDATA[0.98×10 -8 > 181 <![CDATA[2.52×10 4 > <![CDATA[8.65×10 -4 > <![CDATA[3.43×10 -9 > 193 <![CDATA[1.99×10 5 > <![CDATA[2.07×10 -4 > <![CDATA[1.04×10 -9 >
[0349] Note: In Table 14, ka represents the binding rate constant, kd represents the dissociation rate constant, and K D represents the equilibrium dissociation constant.
[0350] Extract the recombinant plasmid of nanobody 193, send it to Sangon Biotech (Shanghai) Co., Ltd. for sequence determination, and obtain its gene sequence and amino acid sequence. The gene sequence and amino acid sequence are shown in SEQ ID NO.: 9 and SEQ ID NO.: 11 respectively.
[0351] Example 26 Construction of a phage display library of nanobodies against porcine PEDV antigen
[0352] 1. Extraction of RNA and synthesis of cDNA
[0353] Mix 1 mg of porcine PEDV antigen (propagated and preserved in our laboratory) with an equal volume of Freund's complete adjuvant, and immunize a Xinjiang Bactrian camel; one week later, immunize the Bactrian camel and synthesize cDNA according to the method described in Title 2 of Example 1.
[0354] 2. Design and synthesis of primers
[0355] According to Title 3 of Example 1, design PCR primers C1F, C1R, V HH F and V HH R for amplifying the variable region gene VHH fragment (350 bp) of camel heavy chain antibody. The specific sequences of each primer are shown in Table 1 above.
[0356] 3. Amplification of VHH fragment
[0357] Using the camel cDNA synthesized in Title 1 of this example as a template, amplify and identify the VHH fragment according to the method described in Title 4 of Example 1. The results are as Figure 41 shown. It can be seen that a VHH gene fragment of about 350 bp is consistent with the expected size. Operate according to the instructions of the gel recovery kit (purchased from TAKARA Company) to purify and recover the target band.
[0358] 4. Construction of a phage display gene library
[0359] The purified and recovered VHH gene fragments were used to construct a phage display gene library and identified according to the method described in Title 5 of Example 1. The results are as follows Figure 42 , 24 monoclonal colonies were identified by colony PCR. All monoclonal colonies contained a target fragment of approximately 350 bp in size, indicating that the insertion rate of this library reached 100%. The colonies on the above plate were scraped into LB liquid medium, then glycerol with a final concentration of 30% was added, and they were aliquoted and stored at -80 °C for later use. This is the phage display library of porcine PEDV antigen.
[0360] Example 27 Screening process of nanobodies against porcine PEDV antigen
[0361] 1. Amplification of the phage display library
[0362] Take 200 μL of the phage library prepared in Example 26 stored at -80 °C and amplify it according to the method described in Title 1 of Example 2. The amplified phage library was resuspended in 5 mL of 0.1 M PBS to obtain its suspension.
[0363] 2. Affinity screening
[0364] Add 10 μg of porcine PEDV antigen preserved in our laboratory to 10 mL of 100 mM NaHCO3 solution (pH 8.2), and perform affinity screening according to the method described in Title 2 of Example 2. Set the ST cell lysate (proliferated and preserved in our laboratory) as a control. The results are shown in Table 15. After three rounds of affinity screening of the library, the phages enriched in each round of screening were more than those in the previous round.
[0365] Table 15. Enrichment process of 3 rounds of affinity screening of the phage library
[0366] Affinity screening round Input phage library amount (pfu / mL) Recovered phage library amount (pfu / mL) The first round of affinity screening <![CDATA[1.2×10 7 > <![CDATA[4.1×10 3 > The second round of affinity screening <![CDATA[1.1×10 7 > <![CDATA[1.8×10 4 > The third round of affinity screening <![CDATA[1.1×10 7 > <![CDATA[2.4×10 5 >
[0367] Example 28 Screening of specific positive clones by enzyme-linked immunosorbent assay (ELISA)
[0368] 1. Expression of nanobodies
[0369] From the colonies enriched on the LB plate after the third round of screening in Example 27, 200 single colonies were selected and the nanobodies expressed by each recombinant bacterium were prepared respectively according to the method described in Title 1 of Example 3. The nanobodies were numbered 1 - 200 in sequence.
[0370] 2. Detection of the binding activity of nanobodies by indirect ELISA method
[0371] The binding activities of each nanobody to porcine PEDV antigen were identified by indirect ELISA reaction. 10 μg of porcine PEDV antigen was added to 10 mL of 100 mM NaHCO3 solution (pH 8.2), and the identification was carried out according to the method described in Title 2 of Example 3. The ST cell lysate was set as a control. The results are as Figure 43 shown. A total of 11 nanobodies could specifically bind to porcine PEDV antigen (to screen for high-affinity nanobodies, only nanobodies with an OD 450 value greater than 2.0 were selected).
[0372] 3. Specificity identification
[0373] According to the indirect ELISA detection method described in Title 2 of this example, the cross-reactivities of each nanobody with O-type FMDV, PCV2, PRRSV, and PRV were detected respectively. The corresponding OD 450 was measured using an enzyme-linked immunosorbent assay reader. The difference was that the coating antigen on the ELISA plate was replaced with O-type FMDV, PCV2, PRRSV, and PRV instead of PEDV. The results are as Figure 44 shown. The nanobodies obtained in the present invention had extremely low cross-reactivities with O-type FMDV, PCV2, PRRSV, and PRV, indicating that the specific nanobodies against porcine PEDV were obtained in the present invention.
[0374] Example 29 Screening of high-affinity nanobodies by surface plasmon resonance (SPR)
[0375] 1. Expression and purification of nanobodies
[0376] The plasmids of the recombinant bacteria of the specific nanobodies against porcine PEDV antigen obtained in Example 28 were extracted respectively. Recombinant bacteria B1-B11 expressing nanobodies were prepared according to the method described in Title 1 of Example 4, and induced expression and protein purification were carried out. Randomly selected purified nanobodies were identified by SDS-PAGE electrophoresis and Western blot. It can be seen from Figure 45 that obvious bands of nanobodies appeared at about 16 kD, which was consistent with the expected size of the target fragment, and the purity reached more than 90%.
[0377] 2. Identification of the affinity of nanobodies by SPR method
[0378] According to the method described in Title 2 of Example 4, the affinities of each nanobody with porcine PEDV antigen were identified respectively. The results are shown in Table 16. The K D value of nanobody No. 2 reached 1.03×10 -8 , and it was the nanobody 2 with the highest affinity screened in the present invention. Subsequent studies were all carried out around this nanobody.
[0379] Table 16. Kinetic parameters of the binding of each nanobody to porcine PEDV antigen
[0380] Nanobody number <![CDATA[k a (M -1 s -1 )]]> <![CDATA[k d (s -1 )]]> <![CDATA[K D (M)]]> 2 <![CDATA[1.15×10 4 > <![CDATA[1.19×10 -4 > <![CDATA[1.03×10 -8 > 16 <![CDATA[1.25×10 4 > <![CDATA[2.31×10 -4 > <![CDATA[1.84×10 -8 > 25 <![CDATA[2.36×10 4 > <![CDATA[4.79×10 -4 > <![CDATA[2.02×10 -8 > 37 <![CDATA[3.73×10 4 > <![CDATA[2.85×10 -4 > <![CDATA[0.76×10 -8 > 61 <![CDATA[1.82×10 4 > <![CDATA[2.19×10 -4 > <![CDATA[1.2×10 -8 > 67 <![CDATA[3.42×10 4 > <![CDATA[1.69×10 -4 > <![CDATA[0.49×10 -8 > 88 <![CDATA[1.85×10 4 > <![CDATA[5.79×10 -4 > <![CDATA[3.12×10 -8 > 122 <![CDATA[4.39×10 4 > <![CDATA[3.29×10 -4 > <![CDATA[0.74×10 -8 > 149 <![CDATA[5.46×10 4 > <![CDATA[1.72×10 -4 > <![CDATA[0.31×10 -8 > 170 <![CDATA[3.71×10 4 > <![CDATA[4.99×10 -4 > <![CDATA[1.34×10 -8 > 191 <![CDATA[5.28×10 4 > <![CDATA[7.11×10 -4 > <![CDATA[1.35×10 -8 >
[0381] Note: In Table 16, ka represents the binding rate constant, kd represents the dissociation rate constant, and K D represents the equilibrium dissociation constant.
[0382] Extract the recombinant plasmid of nanobody 2, send it to Shanghai Sangon Biotech Co., Ltd. for sequence determination, and obtain its gene sequence and amino acid sequence. The gene sequence and amino acid sequence are shown in SEQ ID NO.: 13 and SEQ ID NO.: 14 respectively.
[0383] Example 30 Tandem Expression and Purification of Bifunctional Nanobody Nb193-2
[0384] 1. Construction of the gene fragment of bifunctional nanobody Nb193-2
[0385] Extract the recombinant plasmids of the bacteria expressing porcine CD205-specific nanobody 193 and porcine PEDV antigen-specific nanobody 2 respectively, and construct the bifunctional nanobody fragment Nb193-2 according to the method described in Title 1 of Example 9. As Figure 46 shown, a gene fragment of about 900 bp can be seen, which is consistent with the expected fragment size. Subsequently, it is inserted between the Pst I and Xba I restriction sites of the pMECS vector (purchased from Novagen), and a recombinant bacterium expressing the bifunctional nanobody is obtained.
[0386] 2. Identification of the gene sequence of the bifunctional nanobody
[0387] Extract the plasmid of the recombinant bacterium expressing the bifunctional nanobody Nb193-2, send it to Shanghai Sangon Biotech Co., Ltd. for sequence determination, and obtain the linker element (G4S)4, and the gene sequence and amino acid sequence of the bifunctional nanobody Nb193-2. The gene sequences of the linker element (G4S)4 and the bifunctional nanobody Nb193-2 are shown in SEQ ID NO.: 3 and SEQ ID NO.: 15 respectively, and the amino acid sequences of the linker element (G4S)4 and the bifunctional nanobody Nb193-2 are shown in SEQ ID NO.: 7 and SEQ ID NO.: 16 respectively.
[0388] 3. Expression, purification and identification of bifunctional nanobody Nb193-2
[0389] According to the method described in Title 1 of Example 4, use the recombinant bacterium to induce the expression to prepare the bifunctional nanobody Nb193-2, and perform protein purification and identification. From Figure 47It can be seen that there are obvious bands of the bifunctional nanobody Nb193-2 at approximately 35 kD, which is consistent with the expected size of the target fragment, and the purity is over 90%.
[0390] Example 31 Identification of the Affinity of Bifunctional Nanobody Nb193-2 by Surface Plasmon Resonance (SPR)
[0391] 1. Identification of the Affinity of Nanobodies by SPR
[0392] The affinities of the bifunctional nanobody Nb193-2 with the porcine CD205 target protein and the porcine PEDV antigen were identified respectively according to the method described in Title 2 of Example 4. The results are shown in Table 17. The equilibrium dissociation constants (K D ) of the bifunctional nanobody Nb193-2 with the porcine CD205 target protein and the porcine PEDV antigen are 1.52×10 -8 and 1.01×10 -8 , respectively.
[0393] Table 17. Kinetic Parameters of the Binding of Bifunctional Nanobody Nb193-2 to Antigens
[0394]
[0395]
[0396] Note: In Table 17, ka represents the association rate constant, kd represents the dissociation rate constant, and K D represents the equilibrium dissociation constant.
[0397] Example 32 Identification of the Antigen Presentation Function of Bifunctional Nanobody Nb193-2 by Laser Confocal Microscopy
[0398] 1. Identification of the PEDV Antigen Delivery Ability of Bifunctional Nanobody Nb193-2 by Laser Confocal Microscopy
[0399] The bifunctional nanobody Nb193-2 prepared in Example 30 was subjected to column chromatography to remove endotoxin to ensure that the endotoxin level was less than 0.05 EU, and it was labeled with FITC fluorescent dye (purchased from Shanghai Univ Biotechnology Co., Ltd.). The porcine PEDV antigen was purified by sucrose density gradient centrifugation technology, and the purified product was identified by SDS-PAGE and Western Blotting methods. Fresh porcine BMDC cells were induced to differentiate according to the method described in Example 1. After incubating the FITC fluorescent dye-labeled bifunctional nanobody (5 μg / mL) with the purified PEDV antigen (5 μg / mL) at 4°C for 30 min, it was then incubated with porcine BMDC cells (1×10 6Cells / mL) Incubate at 4°C for 30 min, collect the cells, and identify them according to the method described in Title 1 of Example 11. The results are as Figure 48 shown. The green fluorescence intensity of the experimental group of porcine BMDC cells with the addition of the bifunctional nanobody Nb193-2 was higher than that of the control group, indicating that the PEDV antigen was delivered to porcine BMDC cells through the bifunctional nanobody Nb193-2.
[0400] Example 33 Evaluation of the Immunopotency of the Bifunctional Nanobody Nb193-2 in Presenting the PEDV Antigen
[0401] 1. Immunization Experiment
[0402] Incubate the bifunctional nanobody Nb193-2 (5 μg / mL) prepared in Example 30 and the purified PEDV antigen (5 μg / mL) at 4°C for 60 min, then supplement with 206 adjuvant, and conduct an immunization experiment on pigs. Each pig was immunized with 2 mL of the vaccine by intramuscular injection in the neck, and blood samples were collected on day 28. At the same time, set up a control group of the bifunctional nanobody combined with PBS, a control group of a non-CD205-targeted nanobody combined with PEDV, a control group of a non-CD205-targeted nanobody combined with PBS, a PEDV control group, and a PBS blank control group, with 5 pigs in each group.
[0403] 2. Evaluation of Immunopotency
[0404] Use a PEDV antibody detection kit (purchased from Wuhan Keqian Company) to detect the levels of specific antibodies, antibody subtypes (IgG1 and IgG2a), and IgA antibodies in the post-immunization serum. The detection steps were all carried out according to the kit instructions. The antibody detection results are as Figure 49 shown. The antibody titer of the experimental group of the bifunctional nanobody combined with PEDV on day 28 after immunization was significantly higher than that of other experimental groups and control groups, indicating that the bifunctional nanobody has a promoting effect on the production of antibodies after immunization with the PEDV antigen; the antibody subtype detection results show (as Figure 50 , Figure 51) that the IgG1 and IgG2a antibody titers of the experimental group of the bifunctional nanobody combined with PEDV on day 28 after immunization were significantly higher than those of other experimental groups and control groups, indicating that the bifunctional nanobody can significantly increase the levels of IgG1 and IgG2a antibodies after immunization with the PEDV antigen; the IgA detection results show (as Figure 52 shown) that although the antibody levels of each experimental group and control group were low, the mucosal IgA antibody titer of the experimental group of the bifunctional nanobody combined with PEDV on day 28 after immunization was significantly higher than that of other experimental groups and control groups, indicating that the bifunctional nanobody can significantly increase the mucosal IgA antibody level after immunization with the PEDV antigen.
[0405] Fresh lymph nodes of immunized pigs were collected in vivo near the injection site, and single-cell suspensions of lymph nodes were prepared. Lymphocyte separation medium was added to the cell suspension, and density gradient centrifugation was performed (3000 g, 20 min). Lymphocytes were aspirated (after centrifugation, there were a total of four layers from top to bottom, and the second layer was aspirated), washed 3 times with serum-containing cell culture medium, and then inoculated into a 96-well plate (1×10 6 cells / mL); The cells were stimulated with purified PEDV antigen (5 μg / mL) and LPS respectively, and then continued to be cultured in a cell incubator (37 °C, containing 5% CO2) for 48 h; MTT (5 mg / mL) was added to each well and then continued to be cultured for 4 h. The cell samples were collected by centrifugation, DMSO was added and mixed until the crystals dissolved, and the cell plate was placed in an enzyme-linked immunosorbent assay (ELISA) reader to read the results. The results are as Figure 53 shown. Compared with the control group, the Nb193-2 + PEDV test group could significantly increase the proliferation level of lymphocytes and induce a better cellular immune level.
[0406] The freshly prepared lymphocytes (2×10 6 cells / mL) were inoculated into a 24-well plate, and the lymphocytes were stimulated in vitro with purified PEDV antigen (5 μg / mL), and co-incubated in a cell incubator (37 °C, containing 5% CO2) for 120 min. Part of the cell samples were collected and centrifuged to obtain the supernatant. According to the instructions of the ELISA kit (purchased from Shanghai Univ-Bio Co., Ltd.), the concentrations of IFN-γ, IL-6, and IL-4 in the supernatant were detected. The results are as Figure 54 shown. The secretion levels of IFN-γ, IL-6, and IL-4 in the Nb193-2 + PEDV test group were significantly higher than those of the other test groups and the control group, further indicating that the bifunctional nanobody could significantly enhance the cellular immune response induced by PEDV antigen immunization.
[0407] Example 34 Tandem Expression and Purification of Bifunctional Nanobody Nb193-104
[0408] 1. Construction of Bifunctional Nanobody Gene Fragment
[0409] The recombinant plasmid of the bacterium expressing the porcine CD205-specific nanobody Nb193 and the recombinant plasmid of the bacterium expressing the porcine foot-and-mouth disease virus type O-specific nanobody Nb104 were extracted respectively. The bifunctional nanobody fragment Nb193-104 was constructed according to the method described in Title 1 of Example 9. As Figure 55 shown, a gene fragment of approximately 900 bp was visible, which was consistent with the expected fragment size. Subsequently, it was inserted between the Pst I and Xba I restriction sites of the pMECS vector (purchased from Novagen), and a recombinant bacterium expressing the bifunctional nanobody was obtained.
[0410] 2. Identification of the gene sequence of bifunctional nanobody
[0411] Extract the plasmid of the recombinant bacterium expressing the bifunctional nanobody Nb193-104, and send it to Shanghai Sangon Biotech Co., Ltd. for sequence determination to obtain the linker element (G4S)4, and the gene sequences and amino acid sequences of the bifunctional nanobody Nb193-104. The gene sequences of the linker element (G4S)4 and the bifunctional nanobody Nb193-104 are shown in SEQ ID NO.: 3 and SEQ ID NO.: 10 respectively, and the amino acid sequences of the linker element (G4S)4 and the bifunctional nanobody Nb193-104 are shown in SEQ ID NO.: 7 and SEQ ID NO.: 12 respectively.
[0412] 3. Expression, purification and identification of bifunctional nanobody
[0413] According to the method described in Title 1 of Example 4, use the recombinant bacterium to induce the expression of the bifunctional nanobody Nb193-104, and perform protein purification and identification. From Figure 56 It can be seen that there are obvious bands of the bifunctional nanobody Nb193-104 at about 35 kD, which is consistent with the expected size of the target fragment, and the purity is over 90%.
[0414] Example 35 Identification of the affinity of the bifunctional nanobody Nb193-104 by surface plasmon resonance (SPR)
[0415] 1. Identification of the affinity of nanobody by SPR
[0416] According to the method described in Title 2 of Example 4, identify the affinities of the bifunctional nanobody Nb193-104 with the porcine CD205 target protein and foot-and-mouth disease virus type O respectively. The results are shown in Table 18. The equilibrium dissociation constants (K D ) of the bifunctional nanobody Nb193-104 with the porcine CD205 target protein and foot-and-mouth disease virus type O are 0.75×10 -8 and 1.44×10 -8 respectively.
[0417] Table 18. Kinetic parameters of the binding of the bifunctional nanobody Nb193-104 to antigens
[0418] Antigen <![CDATA[k a (M -1 s -1 )]]> <![CDATA[k d (s -1 )]]> <![CDATA[K D (M)]]> Porcine CD205 target protein <![CDATA[2.13×10 4 > <![CDATA[1.59×10 -4 > <![CDATA[0.75×10 -8 > Foot-and-mouth disease virus, type O <![CDATA[1.36×10 4 > <![CDATA[1.96×10 -4 > <![CDATA[1.44×10 -8 >
[0419] Note: In Table 18, ka represents the binding rate constant, kd represents the dissociation rate constant, and K D represents the equilibrium dissociation constant.
[0420] Example 36 Identification of the antigen presentation function of the bifunctional nanobody Nb193-104 by laser confocal microscopy technology
[0421] 1. Identification of the binding ability of bifunctional nanobody Nb193-104 to porcine BMDCs by laser confocal microscopy technology
[0422] The bifunctional nanobody Nb193-104 prepared in Example 34 was subjected to column chromatography to remove endotoxin, ensuring that the endotoxin level was less than 0.05 EU, and it was labeled with FITC fluorescent dye (purchased from Shanghai Youningwei Co., Ltd.). Fresh porcine BMDC cells were induced to differentiate according to the method of Example 1. The bifunctional nanobody Nb193-104 labeled with FITC fluorescent dye (5 μg / mL) was incubated with porcine BMDC cells (1×10 6 cells / mL) at 4 °C for 30 min. The cells were collected and identified according to the method described in Title 1 of Example 11. The results were as Figure 57 shown. The green fluorescence intensity of the experimental group of porcine BMDC cells added with bifunctional nanobody Nb193-104 was higher than that of the control group, indicating that bifunctional nanobody Nb193-104 could specifically bind to porcine BMDC cells.
[0423] 2. Identification of the FMDV antigen delivery ability of bifunctional nanobody Nb193-104 by laser confocal microscopy technology
[0424] The inactivated antigen of type O FMDV was purified by sucrose density gradient centrifugation technology, and the purified product was identified by SDS-PAGE and Western Blotting methods. Fresh porcine BMDC cells were induced to differentiate according to the method described in Title 1 of this example. After the bifunctional nanobody labeled with FITC fluorescent dye (5 μg / mL) was incubated with the purified inactivated antigen of type O FMDV (5 μg / mL) at 4 °C for 30 min, it was then incubated with porcine BMDC cells (1×10 6 cells / mL) at 4 °C for 30 min. The cells were collected and identified according to the method described in Title 1 of Example 11. The results were as Figure 58 shown. The green fluorescence intensity of the experimental group of porcine BMDC cells added with bifunctional nanobody Nb193-104 was higher than that of the control group, indicating that the inactivated antigen of type O FMDV was delivered to porcine BMDC cells through bifunctional nanobody Nb193-104.
[0425] Example 37 Evaluation of the immune efficacy of bifunctional nanobody Nb193-104 in presenting FMDV antigen
[0426] 1. Immune test
[0427] The bifunctional nanobody Nb193-104 (5 μg / mL) prepared in Example 34 was incubated with the purified FMDV antigen (5 μg / mL) at 4°C for 60 min, supplemented with 206 adjuvant, and an immunization experiment was carried out on pigs. Each pig was immunized with 2 mL of neck muscle, and blood samples were taken at different time points (14 d, 28 d, 42 d, 56 d). At the same time, a control group of bifunctional nanobody combined with PBS, a control group of non-CD205-targeted nanobody combined with FMDV, a control group of non-CD205-targeted nanobody combined with PBS, an FMDV control group, and a PBS blank control group were set up, with 5 pigs in each group.
[0428] The FMD liquid-phase blocking ELISA antibody detection technology has good sensitivity, rapid diagnostic ability and repeatability, and has a good correlation with challenge protection. It has now been widely used in the detection of FMD immune antibody levels. The FAO and OIE recommend using the liquid-phase blocking ELISA method to evaluate the FMD immunization effect. Therefore, this study used the liquid-phase blocking ELISA method to evaluate the FMD immunization effect.
[0429] 2. Evaluation of immune efficacy
[0430] The specific antibody level, antibody subtypes (IgG1 and IgG2a) and immune persistence period in the post-immunization serum were detected using the FMD liquid-phase blocking ELISA antibody detection kit, and the detection steps were all carried out according to the kit instructions. The detection results are as Figure 59 shown. The post-immunization antibody titers of the experimental group of bifunctional nanobody Nb193-104 combined with FMDV were significantly higher than those of other experimental groups and control groups, indicating that the bifunctional nanobody has a promoting effect on the production of post-immunization antibodies against FMDV antigen; the detection results of antibody subtypes showed (as Figure 60 , shown in 61) that the post-immunization IgG1 antibody titers of the experimental group of bifunctional nanobody Nb193-104 combined with FMDV were significantly higher than those of other experimental groups and control groups, and the IgG2a antibody titers were not significantly different from those of other FMDV experimental groups, indicating that the bifunctional nanobody Nb193-104 can significantly increase the post-immunization IgG1 antibody level against FMDV antigen, and the promoting effect on the IgG2a antibody level is not significantly different from that of other experimental groups; the detection results of the immune persistence period showed (as Figure 62 shown) that the antibody level of the experimental group of bifunctional nanobody Nb193-104 combined with FMDV could last until 56 days after immunization, and the antibody titers were significantly higher than those of other experimental groups and control groups, indicating that the bifunctional nanobody Nb193-104 can not only significantly increase the post-immunization antibody level against FMDV antigen, but also the antibodies in the serum 56 days after immunization can still be maintained at a relatively high level, indicating that the bifunctional nanobody has a significant promoting effect on the humoral immune response induced by FMDV antigen after immunization.
[0431] Fresh lymph nodes of immunized pigs were collected in vivo near the injection site, and single-cell suspensions of lymph nodes were prepared. Lymphocyte separation medium was added to the cell suspension, and density gradient centrifugation was performed (3000 g, 20 min). Lymphocytes were aspirated (after centrifugation, there were a total of four layers from top to bottom, and the second layer was aspirated), washed 3 times with cell culture medium containing serum, and then inoculated into 96-well plates (1×10 6 cells / mL); The cells were stimulated with purified FMDV antigen (5 μg / mL) and LPS respectively, and then placed in a cell culture incubator (37 °C, containing 5% CO2) and cultured for another 48 h; MTT (5 mg / mL) was added to each well and cultured for another 4 h. The cell samples were collected by centrifugation, DMSO was added and mixed until the crystals dissolved, and the cell plate was placed in an enzyme-linked immunosorbent assay (ELISA) reader to read the results. The results were as Figure 63 shown. Compared with the control group, the Nb193-104 + FMDV experimental group could significantly increase the proliferation level of lymphocytes and induce a better cellular immune level.
[0432] The freshly prepared lymphocytes (2×10 6 cells / mL) were inoculated into 24-well plates, and the lymphocytes were stimulated in vitro with purified FMDV antigen (5 μg / mL), and then placed in a cell culture incubator (37 °C, containing 5% CO2) and co-incubated for 120 min. Part of the cell samples were collected and centrifuged to obtain the supernatant. According to the instructions of the ELISA kit (purchased from Shanghai Univ-Bio Co., Ltd.), the concentrations of IFN-γ, IL-2, and IL-4 in the supernatant were detected. The results were as Figure 64 shown. The secretion levels of IFN-γ, IL-2, and IL-4 in the Nb193-104 + FMDV experimental group were significantly higher than those of the other experimental groups and the control group, further indicating that the bifunctional nanobody could significantly enhance the cellular immune response induced by FMDV antigen immunization.
[0433] The present invention is described in connection with the best embodiments. However, after reading the above content of the present invention, those skilled in the art will easily realize that the present invention can be easily modified to obtain the purposes and advantages described herein and those purposes and advantages implicit herein. The methods, variants, and compositions described herein in the form of representatives of the currently preferred embodiments are exemplary and are not intended to limit the scope of the present invention. For those skilled in the art, changes can be made to them or they can be used for other purposes, but all of these are included in the scope of the present invention defined by the appended claims of this application. Sequence Listing <110> Jiangsu Academy of Agricultural Sciences <120> Bifunctional Nanobody Based on DC Cells, Its Construction Method and Application <160> 21 <170> SIPOSequenceListing 1.0 <210> 1 <211> 402 <212> DNA <213> Porcine DC-specific nanobody (Nb131) <400> 1 caggtgcagc tgcaggagtc tgggggaggc tcggtgcagg ctggagggtc tctgagactc 60 tcctgtacag cctctgaaag gacttataat agcatgtact gcatggcctg gttccgccag 120 gctccaggga aggagcgcga ggcggtcgca gttattgata gcgctggtag cacaacttac 180 gcagactccg tgaagggccg attcaccatc tcccaagaca acgccaagaa cgctctgtat 240 ctccaaatga acagcctgaa acctgaggac actgccatgt actactgtgc gcagggaaaa 300 attgtagtgg cggttacggg tatcccgccc cccctaattc cttcggccta taactacgtt 360 ggcctgggga cccaggtcac cgtctcctca gcggccgcat ac 402 <210> 2 <211> 375 <212> DNA <213> Porcine DC-specific nanobody (Nb104) <400> 2 caggtgcagc tgcaggagtc tggaggaggc tcggtgcagg ctggagggtc tctgagactc 60 tcctgtgtag cctctggata cacctactgt aggtacgaca tgagctggta ccgccaggct 120 ccagggaagg agcgcgagtt cgtctcagtt attgatagtg atggtagcac aagctacgca 180 gactccgtga agggccgatt caccatctcc caagacaaca ccaagaacac ggtgtatctg 240 caaatgaaca gcctgaaacc tgaggacact gccatgtact actgtgcaac agatcagtgc 300 cccctggtgg tagctggtgc cccaggttac tggggccagg ggacccaggt caccgtctcc 360 tcagcggccg catac 375 <210> 3 <211> 60 <212> DNA <213> Linker element ((G4S)4) <400> 3 ggcggcggcg gctcaggtgg tggtggatcc ggaggaggag gctccggcgg cggcggctca 60 <210> 4 <211> 837 <212> DNA <213> Nanobody (Nb131-104) <400> 4 caggtgcagc tgcaggagtc tgggggaggc tcggtgcagg ctggagggtc tctgagactc 60 tcctgtacag cctctgaaag gacttataat agcatgtact gcatggcctg gttccgccag 120 gctccaggga aggagcgcga ggcggtcgca gttattgata gcgctggtag cacaacttac 180 gcagactccg tgaagggccg attcaccatc tcccaagaca acgccaagaa cgctctgtat 240 ctccaaatga acagcctgaa acctgaggac actgccatgt actactgtgc gcagggaaaa 300 attgtagtgg cggttacggg tatcccgccc cccctaattc cttcggccta taactacgtt 360 ggcctgggga cccaggtcac cgtctcctca gcggccgcat acggcggcgg cggctcaggt 420 ggtggtggat ccggaggagg aggctccggc ggcggcggct cacaggtgca gctgcaggag 480 tctggaggag gctcggtgca ggctggaggg tctctgagac tctcctgtgt agcctctgga 540 tacacctact gtaggtacga catgagctgg taccgccagg ctccagggaa ggagcgcgag 600 ttcgtctcag ttattgatag tgatggtagc acaagctacg cagactccgt gaagggccga 660 ttcaccatct cccaagacaa caccaagaac acggtgtatc tgcaaatgaa cagcctgaaa 720 cctgaggaca ctgccatgta ctactgtgca acagatcagt gccccctggt ggtagctggt 780 gccccaggtt actggggcca ggggacccag gtcaccgtct cctcagcggc cgcatac 837 <210> 5 <211> 134 <212> PRT <213> Porcine DC-specific nanobody (Nb131) <400> 5 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Glu Arg Thr Tyr Asn Ser Met 20 25 30 Tyr Cys Met Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Ala 35 40 45 Val Ala Val Ile Asp Ser Ala Gly Ser Thr Thr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys Asn Ala Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Gln Gly Lys Ile Val Val Ala Val Thr Gly Ile Pro Pro Pro Leu 100 105 110 Ile Pro Ser Ala Tyr Asn Tyr Val Gly Leu Gly Thr Gln Val Thr Val 115 120 125 Ser Ser Ala Ala Ala Tyr 130 <210> 6 <211> 125 <212> PRT <213> Porcine DC-specific nanobody (Nb131) <400> 6 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Val Ala Ser Gly Tyr Thr Tyr Cys Arg Tyr 20 25 30 Asp Met Ser Trp Tyr Arg Gln Ala Pro Gly Lys Glu Arg Glu Phe Val 35 40 45 Ser Val Ile Asp Ser Asp Gly Ser Thr Ser Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Gln Asp Asn Thr Lys Asn Thr Val Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ala 85 90 95 Thr Asp Gln Cys Pro Leu Val Val Ala Gly Ala Pro Gly Tyr Trp Gly 100 105 110 Gln Gly Thr Gln Val Thr Val Ser Ser Ala Ala Ala Tyr 115 120 125 <210> 7 <211> 20 <212> PRT <213> Linker element ((G4S)4) <400> 7 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gly 1 5 10 15 Gly Gly Gly Ser 20 <210> 8 <211> 279 <212> PRT <213> Nanobody (Nb131-104) <400> 8 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Glu Arg Thr Tyr Asn Ser Met 20 25 30 Tyr Cys Met Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Ala 35 40 45 Val Ala Val Ile Asp Ser Ala Gly Ser Thr Thr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys Asn Ala Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Gln Gly Lys Ile Val Val Ala Val Thr Gly Ile Pro Pro Pro Leu 100 105 110 Ile Pro Ser Ala Tyr Asn Tyr Val Gly Leu Gly Thr Gln Val Thr Val 115 120 125 Ser Ser Ala Ala Ala Tyr Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 130 135 140 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Glu 145 150 155 160 Ser Gly Gly Gly Ser Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys 165 170 175 Val Ala Ser Gly Tyr Thr Tyr Cys Arg Tyr Asp Met Ser Trp Tyr Arg 180 185 190 Gln Ala Pro Gly Lys Glu Arg Glu Phe Val Ser Val Ile Asp Ser Asp 195 200 205 Gly Ser Thr Ser Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser 210 215 220 Gln Asp Asn Thr Lys Asn Thr Val Tyr Leu Gln Met Asn Ser Leu Lys 225 230 235 240 Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ala Thr Asp Gln Cys Pro Leu 245 250 255 Val Val Ala Gly Ala Pro Gly Tyr Trp Gly Gln Gly Thr Gln Val Thr 260 265 270 Val Ser Ser Ala Ala Ala Tyr 275 <210> 9 <211> 402 <212> DNA <213> Porcine CD205-specific nanobody (Nb193) <400> 9 caggtgcagc tgcaggagtc tgggggaggc tcggtgcaga ctggagggtc tctgagactc 60 tcctgtacat cctctggatt cacctacagt ggcaagtgca tgtcctggtt ccgccaggct 120 ccagggaagg agcgcgcggc ggtcgcaact atttccacga ctagtactac aacatactat 180 gccgacgacg tcaagggccg attcactatc tcccaagacg tcgccaagcg cacggtatat 240 ctgcaaatga acgccctgaa acctgacgac actgccatgt atttctgtgc ggcagccggt 300 cccacgagtc cgcacggggg tatgtggtgc gtaaattatt tggctgactt tggttactgg 360 ggccagggga cccaggtcac cgtctcctca gcggccgcat ac 402 <210> 10 <211> 837 <212> DNA <213> Nanobody (Nb193 - 104) <400> 10 caggtgcagc tgcaggagtc tgggggaggc tcggtgcaga ctggagggtc tctgagactc 60 tcctgtacat cctctggatt cacctacagt ggcaagtgca tgtcctggtt ccgccaggct 120 ccagggaagg agcgcgcggc ggtcgcaact atttccacga ctagtactac aacatactat 180 gccgacgacg tcaagggccg attcactatc tcccaagacg tcgccaagcg cacggtatat 240 ctgcaaatga acgccctgaa acctgacgac actgccatgt atttctgtgc ggcagccggt 300 cccacgagtc cgcacggggg tatgtggtgc gtaaattatt tggctgactt tggttactgg 360 ggccagggga cccaggtcac cgtctcctca gcggccgcat acggcggcgg cggctcaggt 420 ggtggtggat ccggaggagg aggctccggc ggcggcggct cacaggtgca gctgcaggag 480 tctggaggag gctcggtgca ggctggaggg tctctgagac tctcctgtgt agcctctgga 540 tacacctact gtaggtacga catgagctgg taccgccagg ctccagggaa ggagcgcgag 600 ttcgtctcag ttattgatag tgatggtagc acaagctacg cagactccgt gaagggccga 660 ttcaccatct cccaagacaa caccaagaac acggtgtatc tgcaaatgaa cagcctgaaa 720 cctgaggaca ctgccatgta ctactgtgca acagatcagt gccccctggt ggtagctggt 780 gccccaggtt actggggcca ggggacccag gtcaccgtct cctcagcggc cgcatac 837 <210> 11 <211> 134 <212> PRT <213> Porcine CD205-specific nanobody (Nb193) <400> 11 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Thr Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ser Ser Gly Phe Thr Tyr Ser Gly Lys 20 25 30 Cys Met Ser Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Ala Ala Val 35 40 45 Ala Thr Ile Ser Thr Thr Ser Thr Thr Thr Tyr Tyr Ala Asp Asp Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Gln Asp Val Ala Lys Arg Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ala Leu Lys Pro Asp Asp Thr Ala Met Tyr Phe Cys 85 90 95 Ala Ala Ala Gly Pro Thr Ser Pro His Gly Gly Met Trp Cys Val Asn 100 105 110 Tyr Leu Ala Asp Phe Gly Tyr Trp Gly Gln Gly Thr Gln Val Thr Val 115 120 125 Ser Ser Ala Ala Ala Tyr 130 <210> 12 <211> 279 <212> PRT <213> Nanobody (Nb193-104) <400> 12 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Thr Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ser Ser Gly Phe Thr Tyr Ser Gly Lys 20 25 30 Cys Met Ser Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Ala Ala Val 35 40 45 Ala Thr Ile Ser Thr Thr Ser Thr Thr Thr Tyr Tyr Ala Asp Asp Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Gln Asp Val Ala Lys Arg Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ala Leu Lys Pro Asp Asp Thr Ala Met Tyr Phe Cys 85 90 95 Ala Ala Ala Gly Pro Thr Ser Pro His Gly Gly Met Trp Cys Val Asn 100 105 110 Tyr Leu Ala Asp Phe Gly Tyr Trp Gly Gln Gly Thr Gln Val Thr Val 115 120 125 Ser Ser Ala Ala Ala Tyr Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 130 135 140 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Glu 145 150 155 160 Ser Gly Gly Gly Ser Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys 165 170 175 Val Ala Ser Gly Tyr Thr Tyr Cys Arg Tyr Asp Met Ser Trp Tyr Arg 180 185 190 Gln Ala Pro Gly Lys Glu Arg Glu Phe Val Ser Val Ile Asp Ser Asp 195 200 205 Gly Ser Thr Ser Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser 210 215 220 Gln Asp Asn Thr Lys Asn Thr Val Tyr Leu Gln Met Asn Ser Leu Lys 225 230 235 240 Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ala Thr Asp Gln Cys Pro Leu 245 250 255 Val Val Ala Gly Ala Pro Gly Tyr Trp Gly Gln Gly Thr Gln Val Thr 260 265 270 Val Ser Ser Ala Ala Ala Tyr 275 <210> 13 <211> 384 <212> DNA <213> Porcine PEDV antigen-specific nanobody (Nb2) <400> 13 caggtgcagc tgcaggagtc tggaggaggc tcggtgcagg ctggaggctc tctgagactc 60 tcctgtgcag cctctggata cagcgatagt agctactgca taggttggtt ccgccagcgt 120 ccagggaagc cgcgcgaggg ggttgcggtc atcgatagtg atggtagcac aatctacgca 180 gactccgtga agggccgatt caccatctcc caagacaaca ccaagaatac tctgtatctg 240 caaatgaaca gcctgactcc tgaggacact gccatgtact actgtgcggc agattctcgc 300 attgtttgta gttggctgtc aacgggggac tttggttcct ggggccaggg gacccaggtc 360 accgtctcct cagcggccgc atac 384 <210> 14 <211> 128 <212> PRT <213> Porcine PEDV antigen-specific nanobody (Nb2) <400> 14 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Tyr Ser Asp Ser Ser Tyr 20 25 30 Cys Ile Gly Trp Phe Arg Gln Arg Pro Gly Lys Pro Arg Glu Gly Val 35 40 45 Ala Val Ile Asp Ser Asp Gly Ser Thr Ile Tyr Ala Asp Ser Val Lys 50 55 60 Gly Arg Phe Thr Ile Ser Gln Asp Asn Thr Lys Asn Thr Leu Tyr Leu 65 70 75 80 Gln Met Asn Ser Leu Thr Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ala 85 90 95 Ala Asp Ser Arg Ile Val Cys Ser Trp Leu Ser Thr Gly Asp Phe Gly 100 105 110 Ser Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser Ala Ala Ala Tyr 115 120 125 <210> 15 <211> 846 <212> DNA <213> Nanobody (Nb193-2) <400> 15 caggtgcagc tgcaggagtc tgggggaggc tcggtgcaga ctggagggtc tctgagactc 60 tcctgtacat cctctggatt cacctacagt ggcaagtgca tgtcctggtt ccgccaggct 120 ccagggaagg agcgcgcggc ggtcgcaact atttccacga ctagtactac aacatactat 180 gccgacgacg tcaagggccg attcactatc tcccaagacg tcgccaagcg cacggtatat 240 ctgcaaatga acgccctgaa acctgacgac actgccatgt atttctgtgc ggcagccggt 300 cccacgagtc cgcacggggg tatgtggtgc gtaaattatt tggctgactt tggttactgg 360 ggccagggga cccaggtcac cgtctcctca gcggccgcat acggcggcgg cggctcaggt 420 ggtggtggat ccggaggagg aggctccggc ggcggcggct cacaggtgca gctgcaggag 480 tctggaggag gctcggtgca ggctggaggc tctctgagac tctcctgtgc agcctctgga 540 tacagcgata gtagctactg cataggttgg ttccgccagc gtccagggaa gccgcgcgag 600 ggggttgcgg tcatcgatag tgatggtagc acaatctacg cagactccgt gaagggccga 660 ttcaccatct cccaagacaa caccaagaat actctgtatc tgcaaatgaa cagcctgact 720 cctgaggaca ctgccatgta ctactgtgcg gcagattctc gcattgtttg tagttggctg 780 tcaacggggg actttggttc ctggggccag gggacccagg tcaccgtctc ctcagcggcc 840 gcatac 846 <210> 16 <211> 282 <212> PRT <213> Nanobody (Nb193-2) <400> 16 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Thr Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ser Ser Gly Phe Thr Tyr Ser Gly Lys 20 25 30 Cys Met Ser Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Ala Ala Val 35 40 45 Ala Thr Ile Ser Thr Thr Ser Thr Thr Thr Tyr Tyr Ala Asp Asp Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Gln Asp Val Ala Lys Arg Thr Val Tyr 65 70 75 80 Leu Gln Met Asn Ala Leu Lys Pro Asp Asp Thr Ala Met Tyr Phe Cys 85 90 95 Ala Ala Ala Gly Pro Thr Ser Pro His Gly Gly Met Trp Cys Val Asn 100 105 110 Tyr Leu Ala Asp Phe Gly Tyr Trp Gly Gln Gly Thr Gln Val Thr Val 115 120 125 Ser Ser Ala Ala Ala Tyr Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 130 135 140 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Glu 145 150 155 160 Ser Gly Gly Gly Ser Val Gln Ala Gly Gly Ser Leu Arg Leu Ser Cys 165 170 175 Ala Ala Ser Gly Tyr Ser Asp Ser Ser Tyr Cys Ile Gly Trp Phe Arg 180 185 190 Gln Arg Pro Gly Lys Pro Arg Glu Gly Val Ala Val Ile Asp Ser Asp 195 200 205 Gly Ser Thr Ile Tyr Ala Asp Ser Val Lys Gly Arg Phe Thr Ile Ser 210 215 220 Gln Asp Asn Thr Lys Asn Thr Leu Tyr Leu Gln Met Asn Ser Leu Thr 225 230 235 240 Pro Glu Asp Thr Ala Met Tyr Tyr Cys Ala Ala Asp Ser Arg Ile Val 245 250 255 Cys Ser Trp Leu Ser Thr Gly Asp Phe Gly Ser Trp Gly Gln Gly Thr 260 265 270 Gln Val Thr Val Ser Ser Ala Ala Ala Tyr 275 280 <210> 17 <211> 600 <212> DNA <213> Porcine CD205 molecule (CysR-FNⅡ) <400> 17 atcacaccac tgaacgactg gatagtggca aaggactgtg acaaaaccaa ggacatgttt 60 tggaagtggg tatctcagca tcgactcttt catttgcaat cccagaagtg ccttggccta 120 gacataacca aacccacgga ttccttaaga atgttcagct gtgactccga tgccatgctg 180 tggtggaaat gtgaggacca ctctctgtat ggagctgccc agtacaggtt ggctctgaag 240 ggtggacacg ccatagcaag taccaattca tctgacgtct ggaagaaagg aggctcagag 300 gaaagcctct gtgcccagcc ctaccatgag atctatacca gagatgggaa ttccaatggg 360 agaccttgtg aatttccatt cttagttaac ggaacttggc atcacgagtg tatgcgtgat 420 ggagatcaca atgggctgtg gtgtgcaacc accttcaact atgaatatga gggaaagtgg 480 ggcatctgct tacaaccaga aaatggctgt gaagataatt gggaaaagaa tgagcagact 540 ggaggttgct accaatttaa tagtcaggca gctctttctt ggaaagaagc ttatatttca 600 <210> 18 <211> 444 <212> DNA <213> Porcine CSFV antigen-specific nanobody (Nb62) <400> 18 caggtgcagc tgcaggagtc tgggggaggc tcggtgcaga ctggagggtc tctgagactc 60 ccgaaccctg tacatttcct ccggacggct ggattcacct acagtggcaa gtgcatgtcc 120 tggttcaggg cccgccaggc tccagggaag gagcgcgcgc cgaagcggtc gcaactattt 180 ccacgactag tactacaaca tactatgggc cgacgacggg caatcaaggg ccgattcact 240 atctcccaag acgtcgccgg accaagcgca cggtatatct gcaaatgcgc cctgaaaccc 300 gacactgcca tgtattccgg gaagcgctct gtgcggcagc cggtcccacg agtccgcacg 360 ggggtatgtg gtgcgcggaa attatttggc tttggttact ggggccaggg gacccaggtc 420 accgtctcct cagcggccgc atac 444 <210> 19 <211> 906 <212> DNA <213> Nanobody (Nb131-62) <400> 19 caggtgcagc tgcaggagtc tgggggaggc tcggtgcagg ctggagggtc tctgagactc 60 tcctgtacag cctctgaaag gacttataat agcatgtact gcatggcctg gttccgccag 120 gctccaggga aggagcgcga ggcggtcgca gttattgata gcgctggtag cacaacttac 180 gcagactccg tgaagggccg attcaccatc tcccaagaca acgccaagaa cgctctgtat 240 ctccaaatga acagcctgaa acctgaggac actgccatgt actactgtgc gcagggaaaa 300 attgtagtgg cggttacggg tatcccgccc cccctaattc cttcggccta taactacgtt 360 ggcctgggga cccaggtcac cgtctcctca gcggccgcat acggcggcgg cggctcaggt 420 ggtggtggat ccggaggagg aggctccggc ggcggcggct cacaggtgca gctgcaggag 480 tctgggggag gctcggtgca gactggaggg tctctgagac tcccgaaccc tgtacatttc 540 ctccggacgg ctggattcac ctacagtggc aagtgcatgt cctggttcag ggcccgccag 600 gctccaggga aggagcgcgc gccgaagcgg tcgcaactat ttccacgact agtactacaa 660 catactatgg gccgacgacg ggcaatcaag ggccgattca ctatctccca agacgtcgcc 720 ggaccaagcg cacggtatat ctgcaaatgc gccctgaaac ccgacactgc catgtattcc 780 gggaagcgct ctgtgcggca gccggtccca cgagtccgca cgggggtatg tggtgcgcgg 840 aaattatttg gctttggtta ctggggccag gggacccagg tcaccgtctc ctcagcggcc 900 gcatac 906 <210> 20 <211> 148 <212> PRT <213> Porcine CSFV antigen-specific nanobody (Nb62) <400> 20 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Thr Gly Gly 1 5 10 15 Ser Leu Arg Leu Pro Asn Pro Val His Phe Leu Arg Thr Ala Gly Phe 20 25 30 Thr Tyr Ser Gly Lys Cys Met Ser Trp Phe Arg Ala Arg Gln Ala Pro 35 40 45 Gly Lys Glu Arg Ala Pro Lys Arg Ser Gln Leu Phe Pro Arg Leu Val 50 55 60 Leu Gln His Thr Met Gly Arg Arg Arg Ala Ile Lys Gly Arg Phe Thr 65 70 75 80 Ile Ser Gln Asp Val Ala Gly Pro Ser Ala Arg Tyr Ile Cys Lys Cys 85 90 95 Ala Leu Lys Pro Asp Thr Ala Met Tyr Ser Gly Lys Arg Ser Val Arg 100 105 110 Gln Pro Val Pro Arg Val Arg Thr Gly Val Cys Gly Ala Arg Lys Leu 115 120 125 Phe Gly Phe Gly Tyr Trp Gly Gln Gly Thr Gln Val Thr Val Ser Ser 130 135 140 Ala Ala Ala Tyr 145 <210> 21 <211> 302 <212> PRT <213> Nanobody (Nb131-62) <400> 21 Gln Val Gln Leu Gln Glu Ser Gly Gly Gly Ser Val Gln Ala Gly Gly 1 5 10 15 Ser Leu Arg Leu Ser Cys Thr Ala Ser Glu Arg Thr Tyr Asn Ser Met 20 25 30 Tyr Cys Met Ala Trp Phe Arg Gln Ala Pro Gly Lys Glu Arg Glu Ala 35 40 45 Val Ala Val Ile Asp Ser Ala Gly Ser Thr Thr Tyr Ala Asp Ser Val 50 55 60 Lys Gly Arg Phe Thr Ile Ser Gln Asp Asn Ala Lys Asn Ala Leu Tyr 65 70 75 80 Leu Gln Met Asn Ser Leu Lys Pro Glu Asp Thr Ala Met Tyr Tyr Cys 85 90 95 Ala Gln Gly Lys Ile Val Val Ala Val Thr Gly Ile Pro Pro Pro Leu 100 105 110 Ile Pro Ser Ala Tyr Asn Tyr Val Gly Leu Gly Thr Gln Val Thr Val 115 120 125 Ser Ser Ala Ala Ala Tyr Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser 130 135 140 Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Gln Val Gln Leu Gln Glu 145 150 155 160 Ser Gly Gly Gly Ser Val Gln Thr Gly Gly Ser Leu Arg Leu Pro Asn 165 170 175 Pro Val His Phe Leu Arg Thr Ala Gly Phe Thr Tyr Ser Gly Lys Cys 180 185 190 Met Ser Trp Phe Arg Ala Arg Gln Ala Pro Gly Lys Glu Arg Ala Pro 195 200 205 Lys Arg Ser Gln Leu Phe Pro Arg Leu Val Leu Gln His Thr Met Gly 210 215 220 Arg Arg Arg Ala Ile Lys Gly Arg Phe Thr Ile Ser Gln Asp Val Ala 225 230 235 240 Gly Pro Ser Ala Arg Tyr Ile Cys Lys Cys Ala Leu Lys Pro Asp Thr 245 250 255 Ala Met Tyr Ser Gly Lys Arg Ser Val Arg Gln Pro Val Pro Arg Val 260 265 270 Arg Thr Gly Val Cys Gly Ala Arg Lys Leu Phe Gly Phe Gly Tyr Trp 275 280 285 Gly Gln Gly Thr Gln Val Thr Val Ser Ser Ala Ala Ala Tyr 290 295 300
Claims
1. A bifunctional nanobody against porcine O type FMDV targeting porcine DC cells, characterized in that, The bifunctional nanobody targeting porcine DC cells and porcine O-type FMDV is a target protein obtained by connecting the gene encoding the nanobody Nb131 specific to porcine DCs and the gene encoding the nanobody Nb104 specific to porcine O-type FMDV with a linker element to obtain a target gene fragment and then further recombinant expression. The amino acid sequence of the nanobody Nb131 specific to porcine DCs is shown in SEQ ID NO.:5, and the amino acid sequence of the nanobody Nb104 specific to porcine O-type FMDV is shown in SEQ ID NO.:
6.
2. A bifunctional nanobody targeting porcine DC cells and porcine foot-and-mouth disease virus serotype O, characterized in that, The bifunctional nanobody targeting porcine DC cells and porcine O-type FMDV is a target protein obtained by connecting the gene encoding the nanobody Nb131 specific to porcine DCs and the gene encoding the nanobody Nb104 specific to porcine O-type FMDV with a linker element to obtain a target gene fragment and then further recombinant expression. The nucleotide sequence of the gene encoding the nanobody Nb131 specific to porcine DCs is shown in SEQ ID NO.:1, and the nucleotide sequence of the gene encoding the nanobody Nb104 specific to porcine O-type FMDV is shown in SEQ ID NO.:
2.
3. The porcine O-type FMDV bifunctional nanobody targeting porcine DC cells according to claim 1, characterized in that, The linker element is the linker element (G4S)4. The nucleotide sequence of the linker element (G4S)4 is shown in SEQ ID NO.:3, and the amino acid sequence of the linker element (G4S)4 is shown in SEQ ID NO.:
7.
4. The porcine O-type FMDV bifunctional nanobody targeting porcine DC cells according to claim 1, wherein The amino acid sequence of the bifunctional nanobody targeting porcine DC cells and porcine O-type FMDV is shown in SEQ ID NO.:
8.
5. A nucleic acid or gene encoding the bifunctional nanobody targeting porcine DC cells and porcine O-type FMDV according to claim 1, and its nucleotide sequence is shown in SEQ ID NO.:
4.
6. The construction method of the porcine type O FMDV bifunctional nanobody targeting porcine DC cells according to any one of claims 1 to 4, characterized in that, The construction method includes the following steps: inserting the gene encoding the bifunctional nanobody targeting porcine DC cells and porcine O-type FMDV into the pMECS vector, and then introducing it into the competent cells of Escherichia coli WK6 to obtain a recombinant bacterium; inducing the recombinant bacterium to express the target protein, and purifying the bifunctional nanobody after lysing the recombinant bacterium.
7. A porcine O-type FMDV bifunctional nanobody targeting porcine CD205, characterized in that The bifunctional nanobody targeting porcine CD205 and porcine O-type FMDV is a target protein obtained by connecting the gene encoding the nanobody Nb193 specific to the CD205 target protein and the gene encoding the nanobody Nb104 specific to the O-type FMDV antigen with a linker element to obtain a target gene fragment and then further recombinant expression. The nucleotide sequence of the nanobody Nb193 specific to the porcine CD205 target protein is shown in SEQ ID NO.:9, and the nucleotide sequence of the nanobody Nb104 specific to the porcine O-type FMDV antigen is shown in SEQ ID NO.:
2.
8. Porcine O-type FMDV bifunctional nanobody targeting porcine CD205, characterized in that, The porcine O-type FMDV bifunctional nanobody targeting porcine CD205 is a target protein obtained by connecting the gene encoding the nanobody Nb193 specific to the CD205 target protein and the gene encoding the nanobody Nb104 specific to the O-type FMDV antigen with a linker element to obtain a target gene fragment and then recombinantly expressing it. The amino acid sequence of the porcine CD205 target protein-specific nanobody Nb193 is as shown in SEQ ID NO.:11, and the amino acid sequence of the porcine O-type FMDV antigen-specific nanobody Nb104 is as shown in SEQ ID NO.:
6.
9. The porcine O-type FMDV bifunctional nanobody targeting porcine CD205 according to claim 7, characterized in that, The linker element is the linker element (G4S)4. The nucleotide sequence of the linker element (G4S)4 is as shown in SEQ ID NO.:3, and the amino acid sequence of the linker element (G4S)4 is as shown in SEQ ID NO.:
7.
10. The porcine O-type FMDV bifunctional nanobody targeting porcine CD205 according to claim 7, wherein The amino acid sequence of the porcine O-type FMDV bifunctional nanobody targeting porcine CD205 is as shown in SEQ ID NO.:
12.
11. A nucleic acid or gene encoding the porcine O-type FMDV bifunctional nanobody targeting porcine CD205 as claimed in claim 10, and its nucleotide sequence is as shown in SEQ ID NO.:
10.
12. A method for preparing a porcine O-type FMDV bifunctional nanobody targeting porcine CD205, characterized in that, Comprising the following steps: Insert the encoding gene of the bifunctional nanobody into the pMECS vector, and then introduce it into competent Escherichia coli WK6 cells to obtain a recombinant bacterium; induce the recombinant bacterium to express the target protein, and purify the bifunctional nanobody after lysing the recombinant bacterium.
13. Porcine PEDV bifunctional nanobody targeting porcine CD205, characterized in that, The porcine PEDV bifunctional nanobody targeting porcine CD205 is a target protein obtained by connecting the gene encoding the nanobody Nb193 specific to the CD205 target protein and the gene encoding the porcine PEDV antigen-specific nanobody Nb2 with a linker element to obtain a target gene fragment and then recombinantly expressing it. The nucleotide sequence of the porcine CD205 target protein-specific nanobody Nb193 is as shown in SEQ ID NO.:9, and the nucleotide sequence of the porcine PEDV antigen-specific nanobody Nb2 is as shown in SEQ ID NO.:
13.
14. Porcine PEDV bifunctional nanobody targeting porcine CD205, characterized in that, The porcine PEDV bifunctional nanobody targeting porcine CD205 is a target protein obtained by connecting the gene encoding the nanobody Nb193 specific to the CD205 target protein and the gene encoding the porcine PEDV antigen-specific nanobody Nb2 with a linker element to obtain a target gene fragment and then recombinantly expressing it. The amino acid sequence of the porcine CD205 target protein-specific nanobody Nb193 is as shown in SEQ ID NO.:11, and the amino acid sequence of the porcine PEDV antigen-specific nanobody Nb2 is as shown in SEQ ID NO.:
14.
15. The porcine PEDV bifunctional nanobody targeting porcine CD205 according to claim 13, characterized in that, The linker element is the linker element (G4S)4. The nucleotide sequence of the linker element (G4S)4 is as shown in SEQ ID NO.:3, and the amino acid sequence of the linker element (G4S)4 is as shown in SEQ ID NO.:
7.
16. The porcine PEDV bifunctional nanobody targeting porcine CD205 according to claim 13, characterized in that, The amino acid sequence of the porcine PEDV bifunctional nanobody targeting porcine CD205 is as shown in SEQ ID NO.:
16.
17. A nucleic acid or gene encoding the porcine PEDV bifunctional nanobody targeting porcine CD205 as claimed in claim 13, the nucleotide sequence of which is as shown in SEQ ID NO.:
15.
18. The preparation method of the porcine PEDV bifunctional nanobody targeting porcine CD205 according to any one of claims 13 to 16, characterized in that, Comprising the following steps: Insert the encoding gene of the bifunctional nanobody into the pMECS vector, and then introduce it into competent Escherichia coli WK6 cells to obtain recombinant bacteria; induce the recombinant bacteria to express the target protein, and purify the bifunctional nanobody after lysing the recombinant bacteria.
19. A bifunctional nanobody targeting porcine DC cells against porcine CSFV, characterized in that, The porcine CSFV bifunctional nanobody targeting porcine DC cells is a target protein obtained by further recombinant expression of a target gene fragment obtained by linking the gene encoding the porcine DC cell-specific nanobody Nb131 and the gene encoding the porcine CSFV antigen-specific nanobody Nb62 with a linker element, the nucleotide sequence of the porcine DC cell-specific nanobody Nb131 is as shown in SEQ ID NO.: 1, and the nucleotide sequence of the porcine CSFV antigen-specific nanobody Nb62 is as shown in SEQ ID NO.:
18.
20. Porcine CSFV bifunctional nanobody targeting porcine DC cells, characterized in that, The porcine CSFV bifunctional nanobody targeting porcine DC cells is a target protein obtained by further recombinant expression of a target gene fragment obtained by linking the gene encoding the porcine DC cell-specific nanobody Nb131 and the gene encoding the porcine CSFV antigen-specific nanobody Nb62 with a linker element, the amino acid sequence of the porcine DC cell-specific nanobody Nb131 is as shown in SEQ ID NO.: 5, and the amino acid sequence of the porcine CSFV antigen-specific nanobody Nb62 is as shown in SEQ ID NO.:
20.
21. The dual-functional nanobody against porcine CSFV targeting porcine DC cells according to claim 19, wherein The linker element is the linker element (G4S)4, the nucleotide sequence of the linker element (G4S)4 is as shown in SEQ ID NO.: 3, and the amino acid sequence of the linker element (G4S)4 is as shown in SEQ ID NO.:
7.
22. The porcine CSFV bifunctional nanobody targeting porcine DC cells according to claim 19, characterized in that, The amino acid sequence of the porcine CSFV bifunctional nanobody targeting porcine DC cells is as shown in SEQ ID NO.:
21.
23. A nucleic acid or gene encoding the porcine CSFV bifunctional nanobody targeting porcine DC cells as claimed in claim 19, the nucleotide sequence of which is as shown in SEQ ID NO.:
19.
24. A method for preparing a porcine CSFV bifunctional nanobody targeting porcine DC cells according to any one of claims 19 to 22, characterized in that, Comprising the following steps: Insert the encoding gene of the bifunctional nanobody into the pMECS vector, and then introduce it into competent Escherichia coli WK6 cells to obtain recombinant bacteria; induce the recombinant bacteria to express the target protein, and purify the bifunctional nanobody after lysing the recombinant bacteria.
25. Use of the bifunctional nanobody of porcine O-type FMDV targeting porcine DC cells as claimed in any one of claims 1 to 4, the bifunctional nanobody of porcine O-type FMDV targeting porcine CD205 as claimed in any one of claims 7 to 10, the bifunctional nanobody of porcine PEDV targeting porcine CD205 as claimed in any one of claims 13 to 16, the bifunctional nanobody of porcine CSFV targeting porcine DC cells as claimed in any one of claims 19 to 22, and the nucleic acid or gene as claimed in any one of claims 5, 11, 17 or 23 in the preparation of swine vaccines.
Citation Information
Patent Citations
Vaccibodies targeted to cross-presenting dendritic cells
CN104136039A
Double-functional nanobody for detecting PCV2 viruses by blood coagulation method, coding gene and application thereof
CN109503711A
Nano antibody molecule targeting dendritic cells and application
CN113429481A