Anti-novel coronavirus rabbit recombinant monoclonal antibody with neutralizing activity and application

By immunizing New Zealand white rabbits, a high-affinity and broad-coverage rabbit recombinant monoclonal antibody against SARS-CoV-2-S-RBD was obtained, which solved the problem of limited antibody blocking effect in existing technologies, achieved efficient neutralizing activity and low-cost therapeutic effect, and laid the foundation for subsequent humanization.

CN115433273BActive Publication Date: 2026-05-19SUZHOU DIMA BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202110627997.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-06-05
Publication Date
2026-05-19
Estimated Expiration
2041-06-05

AI Technical Summary

Technical Problem

Currently, there are no effective neutralizing antibodies for the treatment of the novel coronavirus (SARS-CoV-2). Existing antibodies have limited blocking effects and pose ethical issues and infection risks. There are also no approved products on the market.

Method used

By immunizing New Zealand white rabbits with the SARS-CoV-2-S-RBD protein expressed in eukaryotes, a rabbit recombinant monoclonal antibody with neutralizing activity against SARS-CoV-2-S-RBD was obtained using B-cell cloning technology. This antibody was then combined with multiple neutralizing antibodies from other sources using a cocktail approach to prepare a rabbit-derived monoclonal antibody with high affinity and broad coverage.

Benefits of technology

The obtained rabbit recombinant monoclonal antibody has high affinity and good specificity, and can effectively block the action of ACE2 protein and RBD protein, reducing the production cost. It can be used for diagnosis and treatment, and can be further humanized.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN115433273B_ABST
    Figure CN115433273B_ABST
Patent Text Reader

Abstract

The application relates to an anti-novel coronavirus SARS-CoV2-S-RBD protein rabbit recombinant monoclonal antibody with neutralizing activity and application, the obtained antibody has good specificity, and most importantly, the antibody can block the interaction between the novel coronavirus RBD protein and the receptor ACE2 protein, and has potential therapeutic value of neutralizing viruses.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of antibody preparation in biotechnology, and in particular relates to a neutralizing rabbit recombinant monoclonal antibody against SARS-CoV2-S-RBD, its preparation method, and its application. Background Technology

[0002] The novel coronavirus 2019-nCoV, also known as SARS-CoV-2, primarily causes respiratory symptoms such as fever, cough, and difficulty breathing in humans. Severe cases can lead to pneumonia, severe acute respiratory syndrome, kidney failure, and even death. While vaccination is the most effective way to prevent the novel coronavirus, there are currently no approved vaccines available, and no specific treatments are available for infected patients. However, substantial evidence suggests that convalescent plasma can effectively treat COVID-19 patients, with the effective component being high concentrations of neutralizing antibodies in the plasma. Therefore, developing neutralizing antibodies may be an effective candidate for treating the novel coronavirus.

[0003] The novel coronavirus is a single-stranded positive-sense RNA virus. The viral particle is encased in a fatty membrane, which contains three main glycoproteins. The spike protein has two subunits, S1 and S2. The S1 subunit has a receptor ACE2 protein binding site (RBD), mediating host cell fusion. Currently, there is a large body of literature on the development of neutralizing antibodies targeting this site. Some studies utilize the isolation of specific B cells from convalescent viral blood to obtain fully human monoclonal antibodies, while others use phage display technology to obtain humanized monoclonal antibodies. However, no commercially available products have yet been developed. For example, Chinese patent application CN2020101393840 relates to SARS-CoV-2 inhibitors and their applications, which uses phage display technology to prepare antibodies with strong neutralizing activity against SARS-CoV-2 virus from PBMCs in the peripheral blood of convalescent patients. Patent applications such as CN2020108392266 also involve the preparation of monoclonal antibodies from PBMCs in the peripheral blood of convalescent patients.

[0004] Since the blocking effect of a single neutralizing antibody is limited, studies have found that combining multiple neutralizing antibodies in a cocktail manner can achieve better antiviral effects. Because rabbit antibodies have higher affinity and broader epitope coverage than antibodies from other sources, developing rabbit-derived monoclonal antibodies with neutralizing activity against the SARS-CoV-2 RBD protein could provide more options for the development of therapeutic neutralizing antibodies. Summary of the Invention

[0005] The purpose of this invention is to provide a rabbit recombinant monoclonal antibody with neutralizing activity against SARS-CoV2-S-RBD to block the action of ACE2 protein and RBD protein, selected from one or more of the following rabbit recombinant monoclonal antibodies:

[0006] The rabbit recombinant monoclonal antibody named 2B6 has the following amino acid sequences: CDR1, CDR2, and CDR3 of its heavy chain complementarity-determining regions are shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively; and the amino acid sequences of CDR1, CDR2, and CDR3 of its light chain complementarity-determining regions are shown in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively.

[0007] The rabbit recombinant monoclonal antibody named 2H5 has the following amino acid sequences: CDR1, CDR2, and CDR3 of its heavy chain complementarity-determining regions are shown in SEQ ID NO:10, SEQ ID NO:11, and SEQ ID NO:12, respectively; and the amino acid sequences of CDR1, CDR2, and CDR3 of its light chain complementarity-determining regions are shown in SEQ ID NO:13, SEQ ID NO:14, and SEQ ID NO:15, respectively.

[0008] The rabbit recombinant monoclonal antibody named 4B1 has the following amino acid sequences: CDR1, CDR2, and CDR3 of the heavy chain complementarity-determining region (CDR1, CDR2, and CDR3) as shown in SEQ ID NO:19, SEQ ID NO:20, and SEQ ID NO:21, respectively; and the amino acid sequences of CDR1, CDR2, and CDR3 of the light chain complementarity-determining region (CDR1, CDR2, and CDR3) as shown in SEQ ID NO:22, SEQ ID NO:23, and SEQ ID NO:24, respectively.

[0009] The rabbit recombinant monoclonal antibody named 6B10 has the following amino acid sequences: CDR1, CDR2, and CDR3 of the heavy chain complementarity-determining region (CDR1), CDR2, and CDR3, as shown in SEQ ID NO:28, SEQ ID NO:29, and SEQ ID NO:30, respectively; and the amino acid sequences of CDR1, CDR2, and CDR3 of the light chain complementarity-determining region (CDR1), CDR2, and CDR3, as shown in SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33, respectively.

[0010] The rabbit recombinant monoclonal antibody named 9D5 has the following amino acid sequences: CDR1, CDR2, and CDR3 of the heavy chain complementarity-determining region (CDR1, CDR2, and CDR3) as shown in SEQ ID NO:37, SEQ ID NO:38, and SEQ ID NO:39, respectively; and the amino acid sequences of CDR1, CDR2, and CDR3 of the light chain complementarity-determining region (CDR1, CDR2, and CDR3) as shown in SEQ ID NO:40, SEQ ID NO:41, and SEQ ID NO:42, respectively.

[0011] Based on the above technical solution, a rabbit recombinant monoclonal antibody named 2B6 is produced, the heavy chain variable region sequence of which is the amino acid sequence shown in SEQ ID NO:7, and the light chain variable region sequence of which is the amino acid sequence shown in SEQ ID NO:8.

[0012] The rabbit recombinant monoclonal antibody named 2H5 has the heavy chain variable region sequence shown in SEQ ID NO:16 and the light chain variable region sequence shown in SEQ ID NO:17.

[0013] The rabbit recombinant monoclonal antibody named 4B1 has the following amino acid sequence: heavy chain variable region sequence as shown in SEQ ID NO:25 and light chain variable region sequence as shown in SEQ ID NO:26.

[0014] The rabbit recombinant monoclonal antibody named 6B10 has the following amino acid sequence: heavy chain variable region sequence as shown in SEQ ID NO: 34 and light chain variable region sequence as shown in SEQ ID NO: 35.

[0015] The rabbit recombinant monoclonal antibody named 9D5 has the heavy chain variable region sequence shown in SEQ ID NO:43 and the light chain variable region sequence shown in SEQ ID NO:44.

[0016] Based on the above technical solution, a rabbit recombinant monoclonal antibody named 2B6 was developed, and its SCFV sequence is the amino acid sequence shown in SEQ ID NO:9.

[0017] The rabbit recombinant monoclonal antibody named 2H5 has the SCFV sequence shown in SEQ ID NO:18.

[0018] A rabbit recombinant monoclonal antibody named 4B1 has an SCFV sequence as shown in SEQ ID NO:27.

[0019] The rabbit recombinant monoclonal antibody named 6B10 has the SCFV sequence shown in SEQ ID NO:36.

[0020] A rabbit recombinant monoclonal antibody named 9D5 has an SCFV sequence as shown in SEQ ID NO:45.

[0021] Based on the above technical solution, the light chain constant region of the rabbit recombinant monoclonal antibody is the κ chain, and the heavy chain constant region is of the IgG type.

[0022] The present invention also provides a nucleic acid molecule comprising a nucleic acid sequence of a heavy chain complementarity-determining region or a light chain complementarity-determining region capable of encoding a neutralizing rabbit recombinant monoclonal antibody against SARS-CoV2-S-RBD.

[0023] The present invention also provides a carrier containing the above-mentioned nucleic acid molecules.

[0024] The present invention also provides a host cell containing the above-mentioned neutralizing anti-SARS-CoV2-S-RBD rabbit recombinant monoclonal antibody, the above-mentioned nucleic acid molecule, or the above-mentioned vector.

[0025] The present invention also provides a conjugate containing the above-mentioned antibody.

[0026] The present invention also provides a pharmaceutical composition comprising a main component and an excipient, wherein: the main component is one or more of the above-mentioned neutralizing rabbit recombinant monoclonal antibody against SARS-CoV2-S-RBD, the above-mentioned nucleic acid molecule, the above-mentioned carrier, the above-mentioned host cell, and the above-mentioned conjugate; and the excipient is selected from pharmaceutically acceptable carriers or excipients, and optionally other bioactive substances.

[0027] The present invention also provides the use of the above-mentioned neutralizing anti-SARS-CoV2-S-RBD rabbit recombinant monoclonal antibody, the above-mentioned acid molecule, the above-mentioned carrier, the above-mentioned host cell, and the above-mentioned conjugate in the preparation of drugs for treating diseases or diagnostic reagents.

[0028] The present invention also provides a kit comprising the above-mentioned rabbit recombinant monoclonal antibody against SARS-CoV2-S-RBD with neutralizing activity.

[0029] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0030] This invention utilizes eukaryotically expressed SARS-CoV-2 RBD protein to immunize New Zealand white rabbits, and employs B-cell cloning technology to obtain a neutralizing rabbit recombinant monoclonal antibody against SARS-CoV-2-S-RBD. Importantly, this rabbit recombinant monoclonal antibody exhibits high affinity and good specificity, while simultaneously blocking the effects of ACE2 and RBD proteins. Furthermore, using immunized rabbit B cells to prepare neutralizing antibodies avoids ethical issues, infection risks, and viral leakage, and has low production costs. The rabbit monoclonal antibody of this application can fill gaps in the market for diagnostic and therapeutic applications of neutralizing anti-SARS-CoV-2 antibodies. Since the blocking effect of a single neutralizing antibody is limited, this invention prepares a SARS-CoV-2-S-RBD rabbit recombinant monoclonal antibody, which can be combined with multiple neutralizing antibodies from other sources using a cocktail approach to achieve better antiviral effects. The rabbit antibody prepared in this application has higher affinity than antibodies from other sources and a broader antibody epitope coverage. Furthermore, the rabbit monoclonal antibody can be subsequently humanized for use in the development of neutralizing antibodies or reagents for treating SARS-CoV-2 infection. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0032] Figure 1 The image shows an SDS-PAGE diagram of the RBD protein.

[0033] Figure 2 The results of antibody variable region PCR amplification are shown.

[0034] Figure 3 The SDS-PAGE identification diagram of antibody expression purification is shown.

[0035] Figure 4 The results of antibody ELISA titer assay are displayed.

[0036] Figure 5 The IC50 of the competing FACs for detecting the neutralizing titer of the recombinant monoclonal antibody against RBD rabbits was demonstrated. Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0038] The present invention will be further described below: Unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are all widely used terms and routine procedures in their respective fields. Additionally, to better understand the present invention, definitions and explanations of relevant terms are provided below.

[0039] The term "antibody" as used herein includes complete antibodies and any antigen-binding fragments (i.e., "antigen-binding moieties") or single chains thereof. An "antibody" is a glycoprotein, or its antigen-binding moieties, comprising at least two heavy (H) chains and two light (L) chains linked together by disulfide bonds. Each heavy chain consists of a heavy chain variable region and a heavy chain constant region. The proteins or fragments thereof involved in this invention may be naturally purified products, chemically synthesized products, or products generated from a eukaryotic host (e.g., mammalian cells) using recombinant technology. All raw materials and reagents used in this invention are commercially available.

[0040] The technical solution of the present invention will be further described below with reference to the embodiments.

[0041] Example:

[0042] (1) Preparation of RBD protein: To facilitate purification, this invention constructed a eukaryotic expression plasmid (PTT5-RBD-FC) for the SARS-CoV-2 RBD-FC fusion tag protein. Five days after transfection into 293F cells, the cell culture supernatant was collected, purified using Protein A resin, and the protein concentration was identified. The obtained RBD protein was analyzed by SDS-PAGE, and the results are as follows: Figure 1 As shown, the protein obtained is approximately 51.3 kDa, which is the RBD protein.

[0043] (2) Obtaining peripheral blood mononuclear cells (PBMCs) from immunized animals: New Zealand white rabbits were selected as immunized animals. For the first immunization, 250 μg of RBD protein was emulsified with an equal volume of complete Freund's adjuvant and injected subcutaneously at multiple points on the back of the New Zealand white rabbits. A second immunization was performed 21 days later, with 120 μg of RBD protein emulsified with an equal volume of incomplete Freund's adjuvant and injected subcutaneously into the back of the New Zealand white rabbits. A third immunization was performed 21 days later, with 120 μg of RBD protein emulsified with an equal volume of incomplete Freund's adjuvant and injected subcutaneously into the back of the New Zealand white rabbits. Peripheral blood was aseptically collected one week after the third immunization.

[0044] (3) Obtaining RBD-specific B lymphocytes: PBMC cells were separated from the collected peripheral blood using lymphocyte separation solution; RBD protein was coupled to the magnetic beads according to the instructions for immunomagnetic bead operation; the mixture of RBD protein-coupled magnetic beads and separated PBMC cells was incubated together at room temperature for 50 min and then placed in a magnetic rack. After 5 min, all the magnetic beads sank to the bottom. The supernatant was discarded, and sterile PBS was added to wash the cells. The washing of cells was repeated 3 times. The cells finally separated were RBD-specific B lymphocytes.

[0045] (4) Identification of B lymphocytes: The isolated B lymphocytes were diluted several times and placed in 96-well cell culture plates. 1640 medium containing 10% fetal bovine serum (FBS) and 2 μg / ml human IL2 was added, and the plates were cultured at 37℃ and 5% CO2 for 6 days. The supernatant of the medium was collected for antibody identification.

[0046] a) Indirect ELISA identification

[0047] RBD protein at a concentration of 1 μg / ml was coated at 100 μl / well and incubated at 4℃ for 16 h. The next day, after discarding the coating solution, the wells were blocked with PBS containing 1% bovine serum albumin (BSA) at 150 μl / well and incubated at 37℃ for 1 h. The blocking solution was discarded, and B cell supernatant was added at 50 μl / well and incubated at 37℃ for 1 h. The B cell supernatant was discarded, and the plates were washed 5 times with PBS containing 0.5 wt.% Tween-20 for 2 min each time. Finally, goat anti-rabbit IgG-HRP secondary antibody diluted 5000 times was added and the plates were incubated at 37℃ for 1 h. The secondary antibody was discarded, and the plates were washed 5 times with phosphate-Tween buffer (PBST) for 2 min each time. The washing solution was discarded, the plates were patted dry, and substrate was added for color development. The results are shown in Table 1. The B lymphocytes corresponding to the wells labeled 2B6, 2H5, 4B1, 6B10, and 9D5 were positive.

[0048] Table 1. ELISA Test Results

[0049]

[0050] (5) Cloning of antibody genes

[0051] B cells that tested positive were collected, and RNA was extracted using standard RNA extraction methods. The RNA was then reverse transcribed into cDNA. The antibody heavy chain gene primers were used for amplification: upstream primer 5'-CAGTCGCTGGAGGAGTCCGG-3' and downstream primer 5'-CCATTGGTGAGGGTGCCCGAG-3'. The antibody light chain gene primers were used for amplification: upstream primer 5'-GACATTGTGATGACCCAGAC-3' and downstream primer 5'-CCACCTCGGTCCCTTCGCCG-3'. The amplification conditions were: denaturation at 94℃ for 3 min, followed by 30 cycles of (95℃ for 1 min, 56℃ for 30 s, and 72℃ for 1 min), and a final extension at 72℃ for 10 min. (PCR amplification results are shown in [link to PCR results]). Figure 2 The PCR products were recovered using a DNA gel purification and recovery kit. The heavy and light chain genes of the rabbit recombinant monoclonal antibody were cloned into an expression vector and transformed. Single colonies were verified using colony PCR, and the gene sequences of positive colonies were obtained through gene sequencing. The gene sequences and amino acid sequences of the specific antibodies finally obtained from B lymphocytes labeled 2B6, 2H5, 4B1, 6B10, and 9D5 are shown in Table 2.

[0052] Table 2. Gene sequences and amino acid sequences of specific antibodies

[0053]

[0054] (6) Production and identification of RBD rabbit recombinant monoclonal antibody

[0055] The expression plasmids of the heavy and light chain genes of the antibody were co-transfected into 293 cells and cultured at 37℃ with 5% CO2 for 72 h. Cell supernatant was collected, and the antibody was purified using Protein A resin. The purified antibody was then stained with SDS-PAGE. The results are shown in the figure. Figure 3 .

[0056] The purified antibody underwent functional identification, as detailed below:

[0057] a) ELISA reaction

[0058] RBD protein at a concentration of 1 μg / ml was coated at 100 μl / well and incubated at 4℃ for 16 h. The next day, after discarding the coating solution, the plate was blocked with PBS containing 1% BSA at 150 μl / well and incubated at 37℃ for 1 h. The blocking solution was discarded, and antibody diluted at different fractions was added at 50 μl / well and incubated at 37℃ for 1 h. The antibody was discarded, and the plate was washed 5 times with PBS containing 0.5% Tween-20 for 2 min each time. Finally, goat anti-rabbit IgG-HRP secondary antibody diluted 5000 times was added and incubated at 37℃ for 1 h. The secondary antibody was discarded, and the plate was washed 5 times with PBST for 2 min each time. The washing solution was discarded, the plate was patted dry, and substrate was added for color development. The experimental results are shown in the figure. Figure 4 This demonstrates that the five antibodies 2B6, 2H5, 4B1, 6B10, and 9D5 can all react with RBD protein.

[0059] b) Flow cytometry-based neutralization activity assay

[0060] Identification was performed using 293 cells transfected with ACE2 protein plasmids. Different concentrations of antibody were reacted with RBD-mfc protein at 37°C for 1 h. The supernatant mixture was then reacted with the ACE2-transfected 293 cells and incubated at 4°C for 30 min. (Cell processing involved collecting cells in centrifuge tubes, washing twice with sterile PBS, blocking Fc receptors on the cell surface with Fc receptor blocking solution, and incubating at 4°C for 30 min. Cells were then collected by centrifugation, washed twice with PBS containing 0.5 wt.% BSA, and B cell supernatant was added, followed by incubation at 4°C for 30 min). Cells were then washed twice again with PBS containing 0.5 wt.% BSA, and finally, goat anti-mouse IgG-488 fluorescent secondary antibody was added, followed by incubation at 4°C for 30 min. After washing twice with PBS containing 0.5 wt.% BSA, cells were resuspended in 200 μl of PBS containing 0.5 wt.% BSA and analyzed by flow cytometry. Experimental results are shown below. Figure 5 This demonstrates that the five antibodies 2B6, 2H5, 4B1, 6B10, and 9D5 can all block the binding of RBD protein to ACE2 protein.

[0061] The above experiments demonstrate that the five rabbit recombinant monoclonal antibodies against RBD protein obtained can specifically recognize RBD protein and block the binding of RBD protein to ACE2 protein.

[0062] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention. sequence list <110> Suzhou Dima Biotechnology Co., Ltd. <120> Recombinant rabbit monoclonal antibody with neutralizing activity against SARS-CoV-2 and its application <160> 90 <170> SIPOSequenceListing 1.0 <210> 1 <211> 8 <212> PRT <213> Artificial Sequence <400> 1 Gly Val Thr Ile Asn Asn Tyr His 1 5 <210> 2 <211> 8 <212> PRT <213> Artificial Sequence <400> 2 Ile Tyr Ala Asp Ile Gly Val Thr 1 5 <210> 3 <211> 12 <212> PRT <213> Artificial Sequence <400> 3 Thr Arg Tyr Asn Glu Asp Trp Gly Val Phe Asn Leu 1 5 10 <210> 4 <211> 8 <212> PRT <213> Artificial Sequence <400> 4 Gln Ser Val Ala Ser Asn Asn Tyr 1 5 <210> 5 <211> 3 <212> PRT <213> Artificial Sequence <400> 5 Gly Ala Ser 1 <210> 6 <211> 11 <212> PRT <213> Artificial Sequence <400> 6 Gln Gly Gly Phe Ser Ser Gly Asp Gly Ala Ala 1 5 10 <210> 7 <211> 116 <212> PRT <213> Artificial Sequence <400> 7 Gln Ser Leu Glu Glu Ser Gly Gly Arg Leu Val Thr Pro Gly Thr Pro 1 5 10 15 Leu Thr Leu Thr Cys Thr Ala Ser Gly Val Thr Ile Asn Asn Tyr His 20 25 30 Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly 35 40 45 Thr Ile Tyr Ala Asp Ile Gly Val Thr Trp Tyr Ala Ser Trp Ala Lys 50 55 60 Gly Arg Phe Thr Ile Ser Glu Thr Ser Thr Thr Val Asp Leu Lys Ile 65 70 75 80 Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Thr Arg Tyr 85 90 95 Asn Glu Asp Trp Gly Val Phe Asn Leu Trp Gly Pro Gly Thr Leu Val 100 105 110 Thr Val Ser Ser 115 <210> 8 <211> 111 <212> PRT <213> Artificial Sequence <400> 8 Ala Gln Val Leu Thr Gln Thr Pro Ser Ser Thr Ser Ala Ala Val Gly 1 5 10 15 Gly Thr Val Thr Ile Asn Cys Gln Ala Ser Gln Ser Val Ala Ser Asn 20 25 30 Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Ile Leu 35 40 45 Leu Ile Tyr Gly Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe 50 55 60 Ser Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Val 65 70 75 80 Gln Cys Asp Asp Gly Ala Thr Tyr Tyr Cys Gln Gly Gly Phe Ser Ser 85 90 95 Gly Asp Gly Ala Ala Phe Gly Gly Gly Thr Glu Val Val Val Glu 100 105 110 <210> 9 <211> 227 <212> PRT <213> Artificial Sequence <400> 9 Gln Ser Leu Glu Glu Ser Gly Gly Arg Leu Val Thr Pro Gly Thr Pro 1 5 10 15 Leu Thr Leu Thr Cys Thr Ala Ser Gly Val Thr Ile Asn Asn Tyr His 20 25 30 Met Thr Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly 35 40 45 Thr Ile Tyr Ala Asp Ile Gly Val Thr Trp Tyr Ala Ser Trp Ala Lys 50 55 60 Gly Arg Phe Thr Ile Ser Glu Thr Ser Thr Thr Val Asp Leu Lys Ile 65 70 75 80 Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Thr Arg Tyr 85 90 95 Asn Glu Asp Trp Gly Val Phe Asn Leu Trp Gly Pro Gly Thr Leu Val 100 105 110 Thr Val Ser Ser Ala Gln Val Leu Thr Gln Thr Pro Ser Ser Thr Ser 115 120 125 Ala Ala Val Gly Gly Thr Val Thr Ile Asn Cys Gln Ala Ser Gln Ser 130 135 140 Val Ala Ser Asn Asn Tyr Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln 145 150 155 160 Pro Pro Ile Leu Leu Ile Tyr Gly Ala Ser Thr Leu Ala Ser Gly Val 165 170 175 Pro Ser Arg Phe Ser Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr 180 185 190 Ile Ser Asp Val Gln Cys Asp Asp Gly Ala Thr Tyr Tyr Cys Gln Gly 195 200 205 Gly Phe Ser Ser Gly Asp Gly Ala Ala Phe Gly Gly Gly Thr Glu Val 210 215 220 Val Val Glu 225 <210> 10 <211> 8 <212> PRT​​​​​​​​​​​​​​​​​​​​​​​​​​​​​<213> Artificial Sequence <400> 12 Ala Arg Glu Ala Asp Tyr Ala Asp Val Asn Thr Phe Asn Leu 1 5 10 <210> 13 <211> 6 <212> PRT <213> Artificial Sequence <400> 13 Glu Asn Ile Tyr Arg Phe 1 5 <210> 14 <211> 3 <212> PRT <213> Artificial Sequence <400> 14 Phe Val Asp 1 <210> 15 <211> 12 <212> PRT <213> Artificial Sequence <400> 15 Gln Gln Thr Phe Asn Val Asp Asp Val Asp Asn Thr 1 5 10 <210> 16 <211> 117 <212> PRT <213> Artificial Sequence <400> 16 Gln Ser Val Glu Glu Ser Gly Gly Arg Leu Val Thr Pro Gly Thr Pro 1 5 10 15 Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Ser Tyr Ala 20 25 30 Met Gly Trp Phe Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Ile Gly 35 40 45 Ile Ile Ser Asn Ser Gly Ser Ala Tyr Tyr Ala Ser Trp Val Asn Gly 50 55 60 Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu Lys Met Thr 65 70 75 80 Ser Leu Thr Ala Ser Asp Thr Ala Thr Tyr Phe Cys Ala Arg Glu Ala 85 90 95 Asp Tyr Ala Asp Val Asn Thr Phe Asn Leu Trp Gly Pro Gly Thr Leu 100 105 110 Val Thr Val Ser Ser 115 <210> 17 <211> 110 <212> PRT <213> Artificial Sequence <四百> 17 Ala Thr Asp Met Thr Gln Thr Pro Ser Pro Val Ser Ala Ala Val Gly 1 5 10 15 Gly Ser Val Thr Ile Asn Cys Gln Ala Ser Glu Asn Ile Tyr Arg Phe 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly His Ser Pro Lys Leu Leu Ile 35 40 45 Tyr Phe Val Asp Lys Leu Ala Ser Gly Val Pro Thr Arg Phe Lys Gly 50 55 60 Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Asp Val Gln Cys 65 70 75 80 Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Thr Phe Asn Val Asp Asp 85 90 95 Val Asp Asn Thr Phe Gly Gly Gly Thr Glu Val Val Val Lys 100 105 110 <210> 18 <211> 227 <212> PRT <213> Artificial Sequence <400> 18 Gln Ser Val Glu Glu Ser Gly Gly Arg Leu Val Thr Pro Gly Thr Pro 1 5 10 15 Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Ser Tyr Ala 20 25 30​​​​​​​​​​​​ Ser Leu Thr Ala Ser Asp Thr Ala Thr Tyr Phe Cys Ala Arg Glu Ala 85 90 95 Asp Tyr Ala Asp Val Asn Thr Phe Asn Leu Trp Gly Pro Gly Thr Leu 100 105 110 Val Thr Val Ser Ser Ala Thr Asp Met Thr Gln Thr Pro Ser Pro Val 115 120 125 Ser Ala Ala Val Gly Gly Ser Val Thr Ile Asn Cys Gln Ala Ser Glu 130 135 140 Asn Ile Tyr Arg Phe Leu Ala Trp Tyr Gln Gln Lys Pro Gly His Ser 145 150 155 160 Pro Lys Leu Leu Ile Tyr Phe Val Asp Lys Leu Ala Ser Gly Val Pro 165 170 175 Thr Arg Phe Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile 180 185 190 Ser Asp Val Gln Cys Glu Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Thr 195 200 205 Phe Asn Val Asp Asp Val Asp Asn Thr Phe Gly Gly Gly Thr Glu Val 210 215 220 Val Val Lys 225 <210> 19 <211> 8 <212> PRT <213> Artificial Sequence <400> 19 Gly Phe Ser Leu Ser Arg Tyr Ala 1 5 <210> 20 <211> 7 <212> PRT <213> Artificial Sequence <400> 20 Ile Ser Ser Ser Gly Ser Thr 1 5 <210> twenty one <211> 19 <212> PRT <213> Artificial Sequence <400> twenty one Ala Arg Asp Leu Tyr Asp Arg Tyr Gly Val Asp Tyr Ala Thr Gly Tyr 1 5 10 15 Phe Asn Leu <210> twenty two <211> 6 <212> PRT <213> Artificial Sequence <400> twenty two Gln Asn Ile Tyr Ser Asn 1 5 <210> twenty three <211> 3 <212> PRT <213> Artificial Sequence <400> twenty three Gly Ala Ser 1 <210> twenty four <211> 13 <212> PRT <213> Artificial Sequence <400> 24 Gln Ser Ser Tyr Tyr Ser Tyr Ser Thr Asp Thr Tyr Ser 1 5 10 <210> 25 <211> 119 <212> PRT <213> Artificial Sequence <400> 25 Gln Ser Val Glu Glu Ser Gly Gly Arg Leu Val Thr Pro Gly Thr Pro 1 5 10 15 Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Arg Tyr Ala 20 25 30 Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly 35 40 45<00​​​​​​​​​​​​​​​​​ 115 <210> 26 <211> 141 <212> PRT <213> Artificial Sequence <400> 26 Arg Ile Ser Ser Glu Phe Phe Thr Met Asp Thr Arg Ala Pro Thr Gln 1 5 10 15 Leu Leu Gly Leu Leu Leu Leu Trp Leu Pro Gly Ala Arg Cys Ala Leu 20 25 30 Val Met Thr Gln Thr Pro Ser Ser Val Ser Ala Ala Val Gly Gly Thr 35 40 45 Val Thr Ile Asn Cys Gln Ala Ser Gln Asn Ile Tyr Ser Asn Leu Ala 50 55 60 Trp Tyr Gln Gln Lys Pro Gly Gln Arg Pro Lys Leu Leu Ile Tyr Gly 65 70 75 80 Ala Ser Thr Leu Glu Ser Gly Val Pro Ser Arg Phe Lys Gly Ser Gly 85 90 95 Ser Gly Thr Glu Phe Thr Leu Thr Ile Ser Asp Leu Glu Cys Asp Asp 100 105 110 Ala Ala Thr Tyr Ala Cys Gln Ser Ser Tyr Tyr Ser Tyr Ser Thr Asp 115 120 125 Thr Tyr Ser Phe Gly Gly Gly Thr Glu Val Val Val Lys 130 135 140 <210> 27 <211> 260 <212> PRT <213> Artificial Sequence <400> 27 Gln Ser Val Glu Glu Ser Gly Gly Arg Leu Val Thr Pro Gly Thr Pro 1 5 10 15 Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Arg Tyr Ala 20 25 30 Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly 35 40 45 Ile Ile Ser Ser Ser Gly Ser Thr Tyr Tyr Ala Ser Trp Ala Lys Gly 50 55 60 Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu Lys Ile Thr 65 70 75 80 Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Ala Arg Asp Leu 85 90 95 Tyr Asp Arg Tyr Gly Val Asp Tyr Ala Thr Gly Tyr Phe Asn Leu Trp 100 105 110 Gly Pro Gly Thr Leu Val Thr Arg Ile Ser Ser Glu Phe Phe Thr Met 115 120 125 Asp Thr Arg Ala Pro Thr Gln Leu Leu Gly Leu Leu Leu Leu Trp Leu 130 135 140 Pro Gly Ala Arg Cys Ala Leu Val Met Thr Gln Thr Pro Ser Ser Val 145 150 155 160 Ser Ala Ala Val Gly Gly Thr Val Thr Ile Asn Cys Gln Ala Ser Gln 165 170 175 Asn Ile Tyr Ser Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Arg 180 185 190 Pro Lys Leu Leu Ile Tyr Gly Ala Ser Thr Leu Glu Ser Gly Val Pro 195 200 205 Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Glu Phe Thr Leu Thr Ile 210 215 220 Ser Asp Leu Glu Cys Asp Asp Ala Ala Thr Tyr Ala Cys Gln Ser Ser 225 230 235 240 Tyr Tyr Ser Tyr Ser Thr Asp Thr Tyr Ser Phe Gly Gly Gly Thr Glu 245 250 255 Val Val Val Lys 260 <210> 28 <211> 8 <212> PRT <213> Artificial Sequence <400> 28 Gly Phe Ser Leu Ser Phe Tyr Tyr 1 5 <210> 29 <211> 7 <212> PRT <213> Artificial Sequence <400> 29 Ile Gly Ser Gly Gly Thr Thr 1 5 <210> 30 <211> 10 <212> PRT <213> Artificial Sequence <400> 30 Val Arg Glu Ala Gly Tyr Ser Thr Thr Leu 1 5 10 <210> 31 <211> 6 <212> PRT <213> Artificial Sequence <400> 31 Gln Ile Ile Gly Ser Asn 1 5 <210> 32 <211> 3 <212> PRT <213> Artificial Sequence <400> 32 Ser Ala Ser 1 <210> 33 <211> 12 <212> PRT <213> Artificial Sequence <400> 33 Gln Cys Thr Asp Tyr Ile Gly Asp Tyr Val Asn Ala 1 5 10 <210> 34 <211> 113 <212> PRT <213> Artificial Sequence <400> 34 Gln Ser Val Glu Glu Ser Gly Gly Arg Leu Val Thr Pro Gly Thr Pro 1 5 10 15 Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Phe Tyr Tyr 20 25 30 Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Ile Gly 35 40 45 Ile Ile Gly Ser Gly Gly Thr Thr Tyr Tyr Ala Ser Trp Ala Lys Gly 50 55 60 Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu Lys Ile Thr 65 70 75 80 Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Val Arg Glu Ala 85 90 95 Gly Tyr Ser Thr Thr Leu Trp Gly Gln Gly Thr Leu Val Thr Val Ser 100 105 110 Ser <210> 35 <211> 110 <212> PRT <213> Artificial Sequence <400> 35 Asp Val Val Met Thr Gln Thr Pro Ala Ser Val Ser Glu Pro Val Gly 1 5 10 15 Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ile Ile Gly Ser Asn 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40 45 Tyr Ser Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys Gly 50 55 60 Ser Gly Ser Gly Thr Glu Tyr Thr Leu Thr Ile Ser Gly Val Gln Cys 65 70 75 80 Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Cys Thr Asp Tyr Ile Gly Asp 85 90 95 Tyr Val Asn Ala Phe Gly Gly Gly Thr Glu Val Val Val Lys 100 105 110 <210> 36 <211> 223 <212> PRT <213> Artificial Sequence[[ID=3,5]] <400> 36 Gln Ser Val Glu Glu Ser Gly Gly Arg Leu Val Thr Pro Gly Thr Pro 1 5 10 15 Leu Thr Leu Thr Cys Thr Val Ser Gly Phe Ser Leu Ser Phe Tyr Tyr 20 25 30 Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Ile Gly 35 40 45 Ile Ile Gly Ser Gly Gly Thr Thr Tyr Tyr Ala Ser Trp Ala Lys Gly 50 55 60 Arg Phe Thr Ile Ser Lys Thr Ser Thr Thr Val Asp Leu Lys Ile Thr 65 70 75 80 Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Val Arg Glu Ala 85 90 95 Gly Tyr Ser Thr Thr Leu Trp Gly Gln Gly Thr Leu Val Thr Val Ser 100 105 110 Ser Asp Val Val Met Thr Gln Thr Pro Ala Ser Val Ser Glu Pro Val 115 120 125 Gly Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ile Ile Gly Ser 130 135 140 Asn Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu 145 150 155 160 Ile Tyr Ser Ala Ser Thr Leu Ala Ser Gly Val Pro Ser Arg Phe Lys 165 170 175 Gly Ser Gly Ser Gly Thr Glu Tyr Thr Leu Thr Ile Ser Gly Val Gln 180 185 190 Cys Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Cys Thr Asp Tyr Ile Gly 195 200 205 Asp Tyr Val Asn Ala Phe Gly Gly Gly Thr Glu Val Val Val Lys 210 215 220 <210> 37 <211> 8 <212> PRT <213> Artificial Sequence <400> 37 Gly Phe Ser Arg Ser Gly Tyr Tyr 1 5 <210> 38 <211> 7 <212> PRT <213> Artificial Sequence <400> 38 Ile Tyr Thr Asn Gly Asp Thr 1 5 <210> 39 <211> 15 <212> PRT <213> Artificial Sequence <400> 39 Val Ser Asp Thr Tyr Gly Tyr Asp Phe Pro Thr Tyr Phe Asn Leu 1 5 10 15 <210> 40 <211> 6 <212> PRT <213> Artificial Sequence <400> 40 Gln Ser Ile Asn Asn Ile 1 5 <210> 41 <211> 3 <212> PRT <213> Artificial Sequence <400> 41 Asp Ala Ser 1 <210> 42 <211> 12 <212> PRT <213> Artificial Sequence <400> 42 Gln Gln Gly Asn Ile Asn Ser Asn Leu Asp Asn Val 1 5 10 <210> 43 <211> 117 <212> PRT <213> Artificial Sequence <400> 43 Gln Ser Val Glu Glu Ser Gly Gly Arg Leu Val Thr Pro Gly Thr Pro 1 5 10 15 Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Arg Ser Gly Tyr Tyr 20 25 30 Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly 35 40 45 Ile Ile Tyr Thr Asn Gly Asp Thr Tyr Tyr Ala Ser Trp Ala Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Thr Ser Ser Thr Thr Val Asp Leu Lys Met 65 70 75 80 Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Val Ser Asp 85 90 95 Thr Tyr Gly Tyr Asp Phe Pro Thr Tyr Phe Asn Leu Trp Gly Pro Gly 100 105 110 Thr Leu Val Thr Val 115 <210> 44 <211> 110 <212> PRT <213> Artificial Sequence <400> 44 Ala Tyr Asp Met Thr Gln Thr Pro Ala Ser Val Glu Val Ala Val Gly 1 5 10 15 Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln Ser Ile Asn Asn Ile 20 25 30 Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro Pro Lys Leu Leu Ile 35 40 45 Tyr Asp Ala Ser Thr Leu Ser Phe Gly Val Ser Ser Arg Phe Lys Gly 50 55 60 Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile Ser Gly Val Glu Cys 65 70 75 80 Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Gly Asn Ile Asn Ser Asn 85 90 95 Leu Asp Asn Val Phe Gly Gly Gly Thr Glu Val Val Val Lys 100 105 110 <210> 45 <211> 227 <212> PRT <213> Artificial Sequence <400> 45 Gln Ser Val Glu Glu Ser Gly Gly Arg Leu Val Thr Pro Gly Thr Pro 1 5 10 15 Leu Thr Leu Thr Cys Thr Ala Ser Gly Phe Ser Arg Ser Gly Tyr Tyr 20 25 30 Ile Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Ile Gly 35 40 45 Ile Ile Tyr Thr Asn Gly Asp Thr Tyr Tyr Ala Ser Trp Ala Lys Gly 50 55 60 Arg Phe Thr Ile Ser Arg Thr Ser Ser Thr Thr Val Asp Leu Lys Met 65 70 75 80 Thr Ser Pro Thr Thr Glu Asp Thr Ala Thr Tyr Phe Cys Val Ser Asp 85 90 95 Thr Tyr Gly Tyr Asp Phe Pro Thr Tyr Phe Asn Leu Trp Gly Pro Gly 100 105 110 Thr Leu Val Thr Val Ala Tyr Asp Met Thr Gln Thr Pro Ala Ser Val 115 120 125 Glu Val Ala Val Gly Gly Thr Val Thr Ile Lys Cys Gln Ala Ser Gln 130 135 140 Ser Ile Asn Asn Ile Leu Ala Trp Tyr Gln Gln Lys Pro Gly Gln Pro 145 150 155 160 Pro Lys Leu Leu Ile Tyr Asp Ala Ser Thr Leu Ser Phe Gly Val Ser 165 170 175 Ser Arg Phe Lys Gly Ser Gly Ser Gly Thr Gln Phe Thr Leu Thr Ile 180 185 190 Ser Gly Val Glu Cys Ala Asp Ala Ala Thr Tyr Tyr Cys Gln Gln Gly 195 200 205 Asn Ile Asn Ser Asn Leu Asp Asn Val Phe Gly Gly Gly Thr Glu Val 210 215 220 Val Val Lys 225 <210> 46 <211> 24 <212> DNA <213> Artificial Sequence <400> 46 ggagtcacca tcaataacta ccac 24 <210> 47 <211> 24 <212> DNA <213> Artificial Sequence <400> 47 atttatgctg atattggtgt caca 24 <210> 48 <211> 36 <212> DNA <213> Artificial Sequence <400> 48 accagatata atgaggactg gggtgttttc aacttg 36 <210> 49 <211> twenty four <212> DNA <213> Artificial Sequence <400> 49 cagagtgttg ctagtaacaa ctac 24 <210> 50 <211> 9 <212> DNA <213> Artificial Sequence <400> 50 ggtgcatcc 9 <210> 51 <211> 33 <212> DNA <213> Artificial Sequence <400> 51 caaggcggttttagtagtgg tgatggtgct gct 33 <210> 52 <211> 349 <212> DNA <213> Artificial Sequence <400> 52 cagtcgctgg aggagtccgg gggtcgcctg gtcacgcctg ggacacccct aacactcacc 60 tgcacagcct ctggagtcac catcaataac taccacatga cctgggtccg ccaggctcca 120 gggaaggggc tggagtggat tggaaccatt tatgctgata ttggtgtcac atggtacgcg 180 agctgggcga aaggccgatt caccatctcc gaaacctcga ccacggtgga tctgaagatc 240 accagtccga caaccgagga cacggccacc tatttctgta ccagatataa tgaggactgg 300 ggtgttttca acttgtgggg cccaggcacc ctggtcaccg tctcctcag 349 <210> 53 <211> 334 <212> DNA <213> Artificial Sequence <400> 53 gcccaagtgc tgacccagac tccttcttcc acgtctgcag ctgtgggagg cacagtcacc 60 atcaattgcc aggccagtca gagtgttgct agtaacaact acttagcctg gtatcagcag 120 aaaccagggc agcctcccat acttctgatc tatggtgcat ccactctggc atctggggtc 180 ccatcgcggt tcagtggcag tggatctggg acacagttca ctctcaccat cagcgacgtg 240 cagtgtgacg atggcgccac ttactactgt caaggcggtt ttagtagtgg tgatggtgct 300 gctttcggcg gagggaccga ggtggtggtc gaag 334 <210> 54 <211> 683 <212> DNA <213> Artificial Sequence <400> 54 cagtcgctgg aggagtccgg gggtcgcctg gtcacgcctg ggacaccct aacactcacc 120. tgcacagcct ctggagtcac catcaatac taccacatga cctgggtccg ccaggctcca gggaaggggc tggagtggat tggaaccatt tatgctgata ttggtgtcac atggtacgcg agctgggcga aaggccgatt caccatctcc gaaacctcga ccacggtgga tctgaagatc accagtccga caccgagga cacggccacc tatttctgta ccagatata tgaggactgg ggtgttttca acttgtgggg cccaggcacc ctggtcaccg tctcctcagg cccaagtgct 360 420. gacccagact ccttcttcca cgtctgcagc tgtgggaggc acagtcacca tcaattgcca ggccagtcag agtgttgcta gtaacaacta cttagcctgg tatcagcaga aaccagggca gcctcccata cttctgatct atggtgcatc cactctggca tctggggtcc catcgcggtt 540 cagtggcagt ggatctggga cacagttcac tctcaccatc agcgacgtgc agtgtgacga tggcgccact tactactgtc aaggcggttt tagtagtggt gatggtgctg ctttcggcgg 660 agggaccgag gtggtggtcg aag <210> 55 <211> twenty four <212> DNA <213> Artificial Sequence <400> 55 ggattctccc tcagtagcta tgca 24 <210> 56 <211> twenty one <212> DNA <213> Artificial Sequence <400> 56 attagtaata gtggtagcgc a 21 <210> 57 <211> 42 <212> DNA <213> Artificial Sequence <400> 57 gccagagaag cagattatgc tgatgtaaat acttttaatt tg 42 <210> 58 <211> 18 <212> DNA <213> Artificial Sequence <400> 58 gagaacattt acaggttt 18 <210> 59 <211> 9 <212> DNA <213> Artificial Sequence <400> 59 tttgtagac 9 <210> 60 <211> 36 <212> DNA <213> Artificial Sequence <400> 60 cagcagactt ttaatgttga tgatgttgat aatact 36 <210> 61 <211> 352 <212> DNA <213> Artificial Sequence <400> 61 cagtcggtgg aggagtctgg gggtcgcctg gtcacgcctg ggacacccct gacactcacc 60 tgcacagtct ctggattctc cctcagtagc tatgcaatgg gctggttccg ccaggctcca 120 gggaaggggc tggaatacat cggaatcatt agtaatagtg gtagcgcata ctacgcgagc 180 tgggtgaatg gccgattcac catctccaaa acctcgacca cggtggatct gaaaatgacc 240 agtctgacag cttcagacac ggccacttat ttctgtgcca gagaagcaga ttatgctgat 300 gtaaatactt ttaatttgtg gggcccaggc actctggtca ccgtctcctc ag 352 <210> 62 <211> 331 <212> DNA <213> Artificial Sequence <400> 62 gccactgaca tgacccagac tccatcacct gtgtctgcag ctgtgggagg ctcagtcacc 60 atcaattgcc aggccagtga gaacatttac aggtttttgg cctggtatca gcagaaacca 120 gggcactctc cgaagctcct gatctatttt gtagacaaat tggcctctgg agtcccaaca 180 cggttcaaag gcagtggatc tgggacacag ttcactctca ccatcagcga cgtgcagtgt 240 gaggatgctg ccacttacta ctgtcagcag acttttaatg ttgatgatgt tgataatact 300 ttcggcggag ggaccgaggt ggtggtcaaa g 331 <210> 63 <211> 683 <212> DNA <213> Artificial Sequence <400> 63 cagtcggtgg aggagtctgg gggtcgcctg gtcacgcctg ggacacccct gacactcacc 60 tgcacagtct ctggattctc cctcagtagc tatgcaatgg gctggttccg ccaggctcca 120 gggaaggggc tggaatacat cggaatcatt agtaatagtg gtagcgcata ctacgcgagc 180 tgggtgaatg gccgattcac catctccaaa acctcgacca cggtggatct gaaaatgacc 240 agtctgacag cttcagacac ggccacttat ttctgtgcca gagaagcaga ttatgctgat 300 gtaaatactt ttaatttgtg gggcccaggc actctggtca ccgtctcctc aggccactga 360 catgacccag actccatcac ctgtgtctgc agctgtggga ggctcagtca ccatcaattg 420 ccaggccagt gagaacattt acaggttttt ggcctggtat cagcagaaac cagggcactc 480 tccgaagctc ctgatctatt ttgtagacaa attggcctct ggagtcccaa cacggttcaa 540 aggcagtgga tctgggacac agttcactct caccatcagc gacgtgcagt gtgaggatgc 600 tgccacttac tactgtcagc agacttttaa tgttgatgat gttgataata ctttcggcgg 660 agggaccgag gtggtggtca aag 683 <210> 64 <211> 24 <212> DNA <213> Artificial Sequence <400> 64 ggattctccc tcagtaggta tgca 24 <210> 65 <211> 21 <212> DNA <213> Artificial Sequence <400> 65 attagtagta gtggtagcac a 21 <210> 66 <211> 57 <212> DNA <213> Artificial Sequence <400> 66 gccagagacc tttacgatcg ttatggtgtt gattatgcta cgggctactt taacttg 57 <210> 67 <211> 18 <212> DNA <213> Artificial Sequence <400> 67 cagaacattt acagcaat <210> 68 <211> 9 <212> DNA <213> Artificial Sequence <400> 68 9. ggtgcatcc <210> 69 <211> 39 <212> DNA <213> Artificial Sequence <400> 69 caaagttctt attatagtta tagtactgat acgtattct <210> 70 <211> 357 <212> DNA <213> Artificial Sequence <400> 70 cagtcggtgg aggagtccgg gggtcgcctg gtcacgcctg ggacacccct gacactcacc 120. tgcacagtct ctggattctc cctcagtagg tatgcaatga gctgggtccg ccaggctcca gggaaggggc tggaatggat cggaattatt agtagtagtg gtagcacata ctacgcgagc 240. tgggcgaaag gccgattcac catctccaaa acctcgacca cggtggatct gaaaatcacc agtccgacaa ccgaggacac ggccacctat ttctgtgcca gagaccttta cgatcgttat ggtgttgatt atgctacggg ctactttaac ttgtggggcc caggcaccct ggtcacc 357 <210> 71 <211> 330 <212> DNA <213> Artificial Sequence <400> 71 ttgtgatgac ccagactcca tcctccgtgt ctgcagctgt gggaggcaca gtcaccatca 60 attgccaggc cagtcagaac atttacagca atttagcctg gtatcagcag aaaccagggc 120 agcgtcccaa gctcctgatc tatggtgcat ccactctgga atctggggtc ccatcgcggt 180 tcaaaggcag tggatctggg acagagttca ctctcaccat cagcgacctg gagtgtgacg 240 atgctgccac ttacgcgtgt caaagttctt attatagtta tagtactgat acgtattctt 300 tcggcggagg gaccgaggtg gtggtcaaag 330 <210> 72 <211> 687 <212> DNA <213> Artificial Sequence <400> 72 cagtcggtgg aggagtccgg gggtcgcctg gtcacgcctg ggacacccct gacactcacc 60 tgcacagtct ctggattctc cctcagtagg tatgcaatga gctgggtccg ccaggctcca 120 gggaaggggc tggaatggat cggaattatt agtagtagtg gtagcacata ctacgcgagc 240. tgggcgaaag gccgattcac catctccaaa acctcgacca cggtggatct gaaaatcacc agtccgacaa ccgaggacac ggccacctat ttctgtgcca gagaccttta cgatcgttat 360. ggtgttgatt atgctacggg ctactttaac ttgtggggcc caggcaccct ggtcaccttg tgatgaccca gactccatcc tccgtgtctg cagctgtggg aggcacagtc accatcaatt 420 gccaggccag tcagaacatt tacagcaatt tagcctggta tcagcagaaa ccagggcagc gtcccaagct cctgatctat ggtgcatcca ctctggaatc tggggtccca tcgcggttca 540 aaggcagtgg atctgggaca gagttcactc tcaccatcag cgacctggag tgtgacgatg ctgccactta cgcgtgtcaa agttcttatt atagttatag tactgatacg tattctttcg 660 gcggagggac cgaggtggtg gtcaaag 687 <210> 73 <211> 24 <212> DNA <213> Artificial Sequence <400> 73 ggattctccc tcagtttcta ctat <210> 74 <211> 21 <212> DNA <213> Artificial Sequence <400> 74 attggtagtg gtggtaccac a 21 <210> 75 <211> 30 <212> DNA <213> Artificial Sequence <400> 75 gtcagagaag ctggttatag tacaactttg 30 <210> 76 <211> 18 <212> DNA <213> Artificial Sequence <400> 76 cagatcattg gtagtaat 18 <210> 77 <211> 9 <212> DNA <213> Artificial Sequence <400> 77 tctgcatcc 9 <210> 78 <211> 36 <212> DNA <213> Artificial Sequence <400> 78 caatgtactg attatattgg tgattatgtt aatgct 36 <210> 79 <211> 340 <212> DNA <213> Artificial Sequence <400> 79 cagtcggtgg aggagtccgg gggtcgcctg gtcacgcctg ggacacccct gacactcacc 60 tgcacagtct ctggattctc cctcagtttc tactatatga gctgggtccg ccaggctcca 120 gggaaggggc tggaatacat tggaatcatt ggtagtggtg gtaccacata ctacgcgagc 180 tgggcgaaag gccgattcac catctccaaa acctcgacca cggtggatct gaaaatcacc 240 agtccgacaa ccgaggacac ggccacctat ttctgtgtca gagaagctgg ttatagtaca 300 actttgtggg gccaaggcac cctggtcacc gtctcctcag 340 <210> 80 <211> 331 <212> DNA <213> Artificial Sequence <400> 80 gatgttgtga tgacccagac tccagcctcc gtgtctgaac ctgtgggagg cacagtcacc 60 atcaagtgcc aggccagtca gatcattggt agtaatttag cctggtatca gcagaaacca 120 gggcagcctc ccaagctcct gatctattct gcatccactc tggcatctgg ggtcccatca 180 cggttcaaag gcagtggatc tgggacagag tacactctca ccatcagcgg cgtgcagtgt 240 gccgatgcag ccacttacta ctgtcaatgt actgattata ttggtgatta tgttaatgct 300 ttcggcggag ggaccgaggt ggtggtcaaa g 331 <210> 81 <211> 671 <212> DNA <213> Artificial Sequence <400> 81 cagtcggtgg aggagtccgg gggtcgcctg gtcacgcctg ggacacccct gacactcacc 60 tgcacagtct ctggattctc cctcagtttc tactatatga gctgggtccg ccaggctcca 120 gggaaggggc tggaatacat tggaatcatt ggtagtggtg gtaccacata ctacgcgagc 180 tgggcgaaag gccgattcac catctccaaa acctcgacca cggtggatct gaaaatcacc 240 agtccgacaa ccgaggacac ggccacctat ttctgtgtca gagaagctgg ttatagtaca 300 actttgtggg gccaaggcac cctggtcacc gtctcctcag gatgttgtga tgacccagac 360 tccagcctcc gtgtctgaac ctgtgggagg cacagtcacc atcaagtgcc aggccagtca 420 gatcattggt agtaatttag cctggtatca gcagaaacca gggcagcctc ccaagctcct 480 gatctattct gcatccactc tggcatctgg ggtcccatca cggttcaaag gcagtggatc 540 tgggacagag tacactctca ccatcagcgg cgtgcagtgt gccgatgcag ccacttacta 600 ctgtcaatgt actgattata ttggtgatta tgttaatgct ttcggcggag ggaccgaggt 660 ggtggtcaaa g 671 <210> 82 <211> twenty four <212> DNA <213> Artificial Sequence <400> 82 ggattctccc gcagtggcta ctac 24 <210> 83 <211> twenty one <212> DNA <213> Artificial Sequence <400> 83 atttatacta atggtgacac g 21 <210> 84 <211> 45 <212> DNA <213> Artificial Sequence <400> 84 gtcagtgata cttatggtta tgattttcct acctacttta acttg 45 <210> 85 <211> 18 <212> DNA <213> Artificial Sequence <400> 85 cagagtatta ataatatt 18 <210> 86 <211> 9 <212> DNA <213> Artificial Sequence <400> 86 gatgcatcc 9 <210> 87 <211> 36 <212> DNA <213> Artificial Sequence <400> 87 caacagggta atatcaatag taatcttgat aatgtt <210> 88 <211> 351 <212> DNA <213> Artificial Sequence <400> 88 cagtcggtgg aggagtccgg gggtcgcctg gtcacgcctg ggacacccct gacactcacc 120. tgcacagcct ctggattctc ccgcagtggc tactcataa gttgggtccg ccaggctcca gggaaggggc tggaatggat cggaatcatt tatactaatg gtgacacgta ctacgcgagc 240. tgggcgaaag gccgattcac catctccagg acctcgtcga ccacggtgga tctgaaaatg accagtccga caaccgagga cacggccacc tatttctgtg tcagtgatac ttatggttat gattttccta cctactttaa cttgtggggc ccaggcaccc tggtcaccgt c 351 <210> 89 <211> 331 <212> DNA <213> Artificial Sequence <400> 89 gcctatgata tgacccagac tccagcctct gtggaggtag ctgtgggagg cacagtcacc atcaagtgcc aggccagtca gagtattaat aatatttag cctggtatca gcagaaacca gggcagcctc ccaagctcct gatctatgat gcatccactc tgtcatttgg ggtctcatcg 240. cggttcaaag gcagtggatc tgggacacag ttcactctca ccatcagcgg cgtggagtgt gccgacgctg ccacttatta ctgtcaacag ggtaatatca atagtaatct tgataatgtt ttcggcggag ggaccgaggt ggtggtcaaa g 331 <210> 90 <211> 682 <212> DNA <213> Artificial Sequence <400> 90 cagtcggtgg aggagtccgg gggtcgcctg gtcacgcctg ggacacccct gacactcacc 120. tgcacagcct ctggattctc ccgcagtggc tactcataa gttgggtccg ccaggctcca gggaaggggc tggaatggat cggaatcatt tatactaatg gtgacacgta ctacgcgagc 240. tgggcgaaag gccgattcac catctccagg acctcgtcga ccacggtgga tctgaaaatg accagtccga caaccgagga cacggccacc tatttctgtg tcagtgatac ttatggttat gattttccta cctactttaa cttgtggggc ccaggcaccc tggtcaccgt cgcctatgat 360 atgacccaga ctccagcctc tgtggaggta gctgtgggag gcacagtcac catcaagtgc 420 caggccagtc agagtattaa tatatttta gcctggtatc agcagaaacc agggcagcct 480 cccaagctcc tgatctatga tgcatccact ctgtcatttg gggtctcatc gcggttcaaa 540 ggcagtggat ctgggacaca gttcactctc accatcagcg gcgtggagtg tgccgacgct 600 gccacttatt actgtcaaca gggtataatc aatagtaatc ttgataatgt ttcggcgga 660 gggaccgagg tggtggtcaa ag 682

Claims

1. A rabbit recombinant monoclonal antibody with neutralizing activity against SARS-CoV-2-S-RBD, characterized in that: The neutralizing rabbit recombinant monoclonal antibody against SARS-CoV-2-S-RBD is named 2B6. The amino acid sequences of its heavy chain complementarity-determining regions CDR1, CDR2, and CDR3 are shown in SEQ ID NO:1, SEQ ID NO:2, and SEQ ID NO:3, respectively; and the amino acid sequences of its light chain complementarity-determining regions CDR1, CDR2, and CDR3 are shown in SEQ ID NO:4, SEQ ID NO:5, and SEQ ID NO:6, respectively.

2. The neutralizing rabbit recombinant monoclonal antibody against SARS-CoV-2-S-RBD according to claim 1, characterized in that: The rabbit recombinant monoclonal antibody named 2B6 has a heavy chain variable region sequence as shown in SEQ ID NO:7 and a light chain variable region sequence as shown in SEQ ID NO:

8.

3. The neutralizing rabbit recombinant monoclonal antibody against SARS-CoV-2-S-RBD according to claim 1 or 2, characterized in that: The rabbit recombinant monoclonal antibody named 2B6 has an SCFV sequence that is the amino acid sequence shown in SEQ ID NO:

9.

4. The neutralizing rabbit recombinant monoclonal antibody against SARS-CoV-2-S-RBD according to claim 1, characterized in that: The rabbit recombinant monoclonal antibody has a light chain constant region of κ chain and a heavy chain constant region of IgG type.

5. A nucleic acid molecule, characterized in that: It encodes the rabbit recombinant monoclonal antibody against SARS-CoV2-S-RBD with neutralizing activity as described in any one of claims 1-4.

6. A carrier, characterized in that: It contains the nucleic acid molecule as described in claim 5.

7. A host cell, characterized in that: The host cell contains the neutralizing rabbit recombinant monoclonal antibody against SARS-CoV2-S-RBD as described in any one of claims 1 to 4, the nucleic acid molecule as described in claim 5, or the vector as described in claim 6.

8. The use of the neutralizing rabbit recombinant monoclonal antibody against SARS-CoV2-S-RBD as described in any one of claims 1 to 4, the nucleic acid molecule as described in claim 5, the vector as described in claim 6, and the host cell as described in claim 7 in the preparation of a reagent for detecting SARS-CoV2-S-RBD.