Escherichia coli recombinant strain for producing 2-pyrone-4,6-dicarboxylic acid and construction method and application thereof

Abstract

The application provides an Escherichia coli (E. coli) recombinant strain for producing 2-pyrone-4,6-dicarboxylic acid. Escherichia coli The recombinant strain is obtained by overexpressing an exogenous 3-dehydroshikimic acid dehydrase gene on the genome of a 3-dehydroshikimic acid-producing recombinant strain, or further overexpressing a protocatechuate-4,5-dioxygenase gene, or further overexpressing a 4-carboxy-2-hydroxymuconate-6-semialdehyde dehydrogenase gene, so as to realize high-efficiency de novo synthesis of 2-pyrone-4,6-dicarboxylic acid. The strain utilizes an inorganic salt culture medium, takes glucose as a carbon source, and produces 2-pyrone-4,6-dicarboxylic acid through batch feeding fermentation, so that the production cost is low, and the above-mentioned recombinant strain does not contain a plasmid and has high genetic stability.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method for producing recombinant Escherichia coli with 2-pyranone-4,6-dicarboxylic acid and its application. Background Technology

[0002] 2-Pyrone-4,6-dicarboxylic acid (or alpha-pyrone-4,6-dicarboxylicacid, CAS: 72698-24-9) is a pseudo-aromatic dicarboxylic acid compound containing a pyran ring. It has a dicarboxylic acid molecular structure similar to terephthalic acid (TPA) and can undergo dehydration condensation polymerization with various diols or hydroxy acids to produce polyester polymers. Compared to polyethylene terephthalate (PET), 2-pyrone-4,6-dicarboxylic acid-derived polymers exhibit good thermal stability and are more readily degraded by microorganisms in the environment, thus serving as an excellent monomer for biodegradable polymers. Given these properties, 2-pyrone-4,6-dicarboxylic acid is considered a potential alternative chemical to terephthalic acid in aromatic polyester raw materials. Furthermore, 2-pyrone-4,6-dicarboxylic acid can also be used as an additive in lithium-ion battery electrolytes and a complexing agent for treating wastewater containing the radioactive element cesium.

[0003] 2-Pyranone-4,6-dicarboxylic acid is difficult to synthesize via petrochemical methods. Currently, reported synthetic methods mainly include microbial decomposition of lignin, catalytic synthesis using protocatechuic acid as a substrate, and de novo synthesis using glucose as a starting material. In nature, certain microorganisms (such as Rhodococcus) can synthesize lignin. Rhodococcus jostii , Pseudomonas putida Pseudomonas putida During the degradation of lignin, 2-pyranone-4,6-dicarboxylic acid can be generated, but the yield is very low (Mycroft Z, Gomis M, Mines P, et al. Biocatalytic Conversion of Lignin to AromaticDicarboxylic Acids in Rhodococcus jostii RHA1 by Re-Routing Aromatic Degradation Pathways.Green Chem. 2015,17: 4974-4979.Notonier S, WernerAZ, Kuatsjah E, et al.Metabolism of syringyl lignin-derived compounds in Pseudomonas putidaEnables efficient production of 2-pyrone-4,6-dicarboxylic acid. Metab Eng. 2021, 65:111–122.). Otsuka et al. utilized co-expression of Sphingosomalidone. Sphingomonas paucimobilis Using *Pseudomonas putida*, a protocatechuic acid-4,5-dioxidase complex LigAB and 4-carboxy-2-hydroxymucosamide-6-hemialdehyde dehydrogenase LigC, as whole-cell catalysts, protocatechuic acid can be catalyzed to 2-pyrone-4,6-dicarboxylic acid, but the yield is only 10 g / L, and the cost of the substrate protocatechuic acid is relatively high (Otsuka Y, Nakamura M, Shigehara K, et al. Efficient production of 2-pyrone 4,6-dicarboxylic acid as anovel polymer-based material from protocatechuate by microbial function. ApplMicrobiolBiot. 2006, 71(5):608-614.). Korean researchers used metabolic engineering to regulate key genes in the endogenous shikimic acid pathway of *E. coli* and integrated the encoding genes for exogenous 3-dehydroshikimic acid dehydratase, protocatechuic acid-4,5-dioxidase, and 4-carboxy-2-hydroxymucosanol-6-semialdehyde dehydrogenase, achieving de novo synthesis of 2-pyranone-4,6-dicarboxylic acid using glucose as a carbon source. However, the yield was only 16.7 g / L (Luo ZW, Kim WJ, Lee SY. Metabolic Engineering of...). Escherichia coli (For Efficient Production of 2-Pyrone-4,6-dicarboxylic Acid from Glucose. ACS Synth Biol. 2018, 7: 2296−2307.). This demonstrates that the efficiency and yield of microbial synthesis of 2-pyrone-4,6-dicarboxylic acid remain low, making it difficult to meet the requirements of large-scale industrial fermentation production. Summary of the Invention

[0004] In view of this, the present invention provides *Escherichia coli* that produces 2-pyranone-4,6-dicarboxylic acid (… Escherichia coli Recombinant strains produced by genetic engineering or by their passage have high yield, low cost and strong genetic stability in the production of 2-pyranone-4,6-dicarboxylic acid.

[0005] This invention provides a method for constructing a recombinant strain of *Escherichia coli* producing 2-pyranone-4,6-dicarboxylic acid. The method utilizes, for example, CRISPR-Cas9 gene editing technology to integrate exogenous genes encoding 3-dehydroshikimate dehydratase, protocatechuic acid-4,5-dioxidase, and 4-carboxy-2-hydroxymucosinate-6-semialdehyde dehydrogenase into the *Escherichia coli* genome, and uses artificially synthesized regulatory elements to upregulate the expression of the above genes.

[0006] In one embodiment, the starting strain used to construct the genetically engineered recombinant strain that produces 2-pyranone-4,6-dicarboxylic acid can be either a recombinant Escherichia coli strain that produces 3-dehydrogenase shikimic acid, a recombinant Escherichia coli strain regulated by the shikimic acid pathway, or a wild-type Escherichia coli.

[0007] Preferably, the recombinant Escherichia coli strain WJ060 is used as the starting strain for construction, and the preservation number of WJ060 is CGMCC No.14602.

[0008] In one embodiment, the recombinant strain is constructed using an exogenous 3-dehydroshikimate dehydratase gene. quiC Replace, for example, the pyruvate formate lyase gene on the genome of the recombinant Escherichia coli strain WJ060 pflB And obtained, the aforementioned quiC The sequence is shown as the nucleotide sequence on the pET30a-quiC plasmid (CN202111135396.7).

[0009] Preferably, the control element P2 is used to increase the adjustment. quiC The expression, whose sequence is shown in SEQ ID NO:10. More preferably, the regulating element P2 is located at... quiC Upstream of the start codon ATG. Most preferably, gene editing technologies such as CRISPR-Cas9 gene editing are used to insert the gene upstream of the start codon ATG in the genome of the recombinant strain. pflB Replace with quiC .

[0010] In one embodiment, the recombinant strain enhances its enzyme activity by overexpressing protocatechuic acid-4,5-dioxidase in its genome. Exemplarily, the gene encoding protocatechuic acid-4,5-dioxidase comprises the nucleotide sequence shown in any of SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8, encoding a protein with an amino acid sequence shown in any of the NCBI accession numbers BAB88742.1 / BAB88743.1, AAK73572.1 / AAK73573.1, MBO9517659.1 / MBO9517658.1, NHO66815.1 / NHO66816.1, and EZP27614.1.

[0011] Preferably, the gene encoding protocatechuic acid-4,5-dioxidase is integrated into the genome of the recombinant strain. ykgH - betA The expression of the protocatechuic acid-4,5-dioxidase-encoding gene is upregulated using the regulatory element P4, the sequence of which is shown in SEQ ID NO:11. More preferably, the regulatory element P4 is located upstream of the start codon ATG of the protocatechuic acid-4,5-dioxidase-encoding gene. Most preferably, the protocatechuic acid-4,5-dioxidase-encoding gene is integrated into the genome of the recombinant strain using gene editing technology such as CRISPR-Cas9 gene editing technology. ykgH - betA Between two genes.

[0012] In one embodiment, the recombinant strain enhances its enzyme activity by overexpressing 4-carboxy-2-hydroxymuconic acid-6-semialdehyde dehydrogenase in its genome. Exemplarily, the 4-carboxy-2-hydroxymuconic acid-6-semialdehyde dehydrogenase gene comprises the nucleotide sequence shown in any of SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:9, encoding a protein with the amino acid sequence shown in any of the NCBI accession numbers BAB88744.1, MBO9517657.1, NHO66817.1, and EZP27613.1.

[0013] Preferably, the D-lactate dehydrogenase gene on the genome of the recombinant strain is replaced with the 4-carboxy-2-hydroxymuconic acid-6-semialdehyde dehydrogenase gene. ldhAMore preferably, the expression of the 4-carboxy-2-hydroxymucoconic acid-6-semialdehyde dehydrogenase gene is upregulated using the regulatory element P4, the sequence of which is shown in SEQ ID NO:11. Further preferably, the regulatory element P4 is located upstream of the start codon ATG of the 4-carboxy-2-hydroxymucoconic acid-6-semialdehyde dehydrogenase gene. Most preferably, gene editing technology, such as CRISPR-Cas9 gene editing technology, is used to upregulate the expression of the 4-carboxy-2-hydroxymucoconic acid-6-semialdehyde dehydrogenase gene. ldhA Replace it with the 4-carboxy-2-hydroxymucosanoic acid-6-semialdehyde dehydrogenase gene.

[0014] In one embodiment, the recombinant strain further enhances its enzyme activity by integrating a second copy of the 4-carboxy-2-hydroxymucoconic acid-6-semialdehyde dehydrogenase gene into its genome.

[0015] Preferably, the 4-carboxy-2-hydroxymuconic acid-6-semialdehyde dehydrogenase gene is Porphyrobacter sp.-derived 4-carboxy-2-hydroxymucoconic acid-6-semialdehyde dehydrogenase gene PsligC Its sequence is shown in SEQ ID NO:5. Preferably, the second copy... PsligC Integrated into recombinant strains ypjC-ileY Between the two genes. More preferably, upregulation is achieved using the regulatory element P4. PsligC The expression, whose sequence is shown in SEQ ID NO:11. More preferably, the regulating element P4 is located at... PsligC Upstream of the ATG start codon. Most preferably, gene editing technologies such as CRISPR-Cas9 gene editing technology are used to... PsligC Integrated into the genome of the recombinant strain ypjC-ileY Between two genes.

[0016] The most preferred recombinant strain provided by this invention has the accession number CGMCC No. 24557.

[0017] The present invention also provides the use of the above-mentioned recombinant strain or recombinant bacteria derived therefrom in the production of 2-pyranone-4,6-dicarboxylic acid.

[0018] The present invention also provides a method for producing 2-pyranone-4,6-dicarboxylic acid by fermentation of the above-mentioned recombinant strain or recombinant strain produced by its passage.

[0019] For example, strain WJ060 and one or more combinations of the above-mentioned recombinant strains are fermented.

[0020] In a specific embodiment of the present invention, the method for producing 2-pyranone-4,6-dicarboxylic acid by shake-flask fermentation using recombinant bacterial strains specifically includes:

[0021] (1) Seed culture: single colonies of recombinant strains were picked and inoculated into 5 mL LB medium and cultured at 37℃ and 250 r / min for 10 h to obtain seed culture;

[0022] (2) Shake flask fermentation culture: The seed liquid was transferred to a 100 mL Erlenmeyer flask containing 15 mL of shake flask fermentation medium at a 1% inoculation rate and cultured at 37℃ and 250 r / min for 60 h. Samples were taken at regular intervals during the fermentation process.

[0023] (3) Product concentration analysis: The concentrations of 3-dehydroshikimic acid, protocatechuic acid, 2-pyranone-4,6-dicarboxylic acid and other substances in the fermentation broth were detected by HPLC.

[0024] In a specific embodiment of the present invention, the method for producing 2-pyranone-4,6-dicarboxylic acid by fed-batch fermentation using recombinant strains specifically includes:

[0025] (1) Primary seed culture: Select a single colony of the recombinant strain and inoculate it into 5 mL of LB medium. Culture at 37℃ and 250 r / min for 10 h as primary seed culture.

[0026] (2) Secondary seed culture: The primary seed culture was transferred to 200 mL LB medium at an inoculation rate of 0.1% and cultured at 37℃ and 250 r / min for 10 h to obtain the secondary seed culture.

[0027] (3) Fed-batch fermentation culture: The secondary seed culture was transferred at a 10% inoculum to a 5 L fermenter containing 1.8 L of fed-batch fermentation medium. The fermentation temperature was 37℃, the aeration rate was 1 vvm, the dissolved oxygen was 30%, the pH was 6.5, and the initial glucose concentration was about 40 g / L. As fermentation progressed, when the glucose concentration in the fermentation broth dropped below 1 g / L, feeding was started. The feeding rate was controlled to keep the glucose concentration in the fermentation broth below 5 g / L. Samples were taken at regular intervals during the fermentation process.

[0028] (4) Sample detection: The concentrations of glucose, protocatechuic acid, 2-pyranone-4,6-dicarboxylic acid, and other substances in the fermentation broth were detected by HPLC, and the cell concentration OD was detected by visible spectrophotometer. 600 .

[0029] The present invention also provides cultures of the above-mentioned recombinant strains or strains produced by their passage, or their processed products, such as fermentation broth, culture medium, lyophilized powder, and fermentation broth, culture medium, lyophilized powder, etc., of recombinant strain PDC14 mixed with other strains.

[0030] This invention provides a recombinant *Escherichia coli* strain for producing 2-pyranone-4,6-dicarboxylic acid. The recombinant strain produces 2-pyranone-4,6-dicarboxylic acid via fed-batch fermentation under aerobic conditions using an inorganic salt medium and glucose as the carbon source. This process results in low production costs and virtually no accumulation of other metabolic byproducts. Furthermore, none of the recombinant strains contain plasmids, demonstrating strong genetic stability. Attached Figure Description

[0031] Figure 1 Schematic diagram of the biosynthetic pathway of 2-pyranone-4,6-dicarboxylic acid (Glucose; EMP, glycolysis; PPP, pentose phosphate pathway; PEP, phosphoenolpyruvate; E4P, erythrose-4-phosphate; DAHP, 3-deoxy-D-arabinohepeptulose-7-phosphate; DHS, 3-dehydroshikimic acid; PCA, protocatechuic acid; CHMS, 4-carboxy-2-hydroxymucinonic acid-6-hemialdehyde; PDC, 2-pyranone-4,6-dicarboxylic acid; O2, oxygen; NADPH, reduced nicotinamide adenine dinucleotide phosphate / reduced coenzyme II; NADP) + Oxidized nicotinamide adenine dinucleotide phosphate / oxidized coenzyme II; QuiC, 3-dehydroshikimate dehydratase; LigAB, protocatechuic acid-4,5-dioxidase; LigC, 4-carboxy-2-hydroxymuconic acid-6-semialdehyde dehydrogenase).

[0032] Figure 2 This is a batch-fed fermentation process diagram of recombinant Escherichia coli strains PDC09 and PDC14 (PDC, 2-pyranone-4,6-dicarboxylic acid; PCA, protocatechuic acid; Glucose) from Example 5 of the present invention. In the diagram, A shows the fermentation process of recombinant strain PDC09; B shows the fermentation process of recombinant strain PDC14.

[0033] Preservation information:

[0034] The recombinant strain of *Escherichia coli*, WJ060, has the accession number CGMCC No. 14602 and is classified as *Escherichia coli*. Escherichia coli It was deposited on September 11, 2017 at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, 100101, China.

[0035] The recombinant strain PDC14 provided by this invention was deposited on March 21, 2022, at the China General Microbiological Culture Collection Center (CGMCC), located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, 100101, China, with accession number CGMCC No. 24557, and classified as *Escherichia coli*.Escherichia coli . Detailed Implementation

[0036] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0037] Unless otherwise specified, the experimental methods in the following embodiments are conventional methods, performed in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions.

[0038] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0039] In this application, the abbreviations for various enzymes, such as quiC, can represent either the 3-dehydroshikimate dehydratase gene or 3-dehydroshikimate dehydratase, and the specific meaning can be understood from the context.

[0040] The method for constructing a recombinant *Escherichia coli* strain for producing 2-pyranone-4,6-dicarboxylic acid provided by this invention integrates and optimizes the endogenous shikimic acid pathway and the exogenous 2-pyranone-4,6-dicarboxylic acid synthesis pathway of *E. coli* through metabolic engineering, achieving efficient de novo synthesis of 2-pyranone-4,6-dicarboxylic acid using glucose as a carbon source. The catalytic enzymes in the exogenous 2-pyranone-4,6-dicarboxylic acid synthesis pathway include 3-dehydroshikimic acid dehydratase (QuiC), protocatechuic acid-4,5-dioxidase (LigAB), and 4-carboxy-2-hydroxymuconic acid-6-hemisaldehyde dehydrogenase (LigC). Figure 1 ).

[0041] The conventional experimental methods used in this invention are as follows:

[0042] 1. Preparation of competent cells by chemical transformation of Escherichia coli

[0043] A single colony of *Escherichia coli* DH5α (Beijing Qingke Biotechnology Co., Ltd.) was picked and inoculated into 3 mL of liquid LB medium and cultured at 37℃ and 250 rpm for 8–12 h to obtain a seed culture. 100 μL of the seed culture was then inoculated into 50 mL of liquid LB medium and cultured at 37℃ and 250 rpm until OD (Organic Depth) reached. 600Approximately 0.3-0.4; incubate on ice for 15 min, then transfer the bacterial culture to a pre-chilled 50 mL centrifuge tube; centrifuge at 2000 g for 5 min, discard the supernatant, and resuspend the bacterial cells in 15 mL of pre-chilled 100 mM CaCl2 solution. Repeat this step once; centrifuge at 2000 g for 5 min, discard the supernatant, and resuspend the bacterial cells in 2 mL of pre-chilled 10% (v / v) glycerol-100 mM CaCl2 solution to obtain chemically transformed competent cells.

[0044] The LB medium contains 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl.

[0045] 2. PCR amplification reaction system and conditions

[0046] (1) When amplifying the pTargetF fragment, the high-fidelity DNA polymerase PrimeSTAR HSDNA Polymerase from TaKaRa was used. The universal amplification system was: 5× PrimeSTAR Buffer (Mg... 2+ The amplification mixture consisted of 10 μl of the following: 4 μl of dNTP Mixture (2.5 mM each), 1 μl of upstream primer (10 μM), 1 μl of downstream primer (10 μM), 1 μl of template, 0.5 μl of PrimeSTAR HS DNA Polymerase (2.5 U / μl), and 32.5 μl of sterile water, for a total volume of 50 μl. The general amplification program was as follows: ① 95℃ for 3 min; ② 98℃ for 10 sec, 55℃ for 15 sec, 72℃ for 1 kb / min, repeating step ② 30 times; ③ 72℃ for 5 min.

[0047] (2) When preparing homologous recombination fragments by ligating two homologous arms, promoters, and target genes using fusion PCR, the high-fidelity DNA polymerase PrimeSTAR HS DNA Polymerase from TaKaRa was used for PCR amplification. The general preparation steps are as follows: First, amplify the two homologous arms, promoters, and target gene fragments separately using their respective specific primers. Second, using the left homologous arm and promoter as templates, amplify using the F-terminal primer of the left homologous arm and the R-terminal primer of the promoter, and ligate the two fragments to form the left homologous arm-promoter fragment; using the target gene and right homologous arm as templates, amplify using the F-terminal primer of the target gene and the R-terminal primer of the right homologous arm, and ligate the two fragments to form the target gene-right homologous arm fragment. Third, using the left homologous arm-promoter fragment and the target gene-right homologous arm fragment as templates, amplify using the F-terminal primer of the left homologous arm and the R-terminal primer of the right homologous arm, and ligate the two fragments to form the full-length fragment. Its universal amplification system is: 5×PrimeSTAR Buffer (Mg 2+ The amplification mixture consisted of: 10 μl of (Plus) dNTP Mixture (2.5 mM each), 4 μl of F-terminal primer (10 μM), 1 μl of R-terminal primer (10 μM), 1 μl of template 1, 1 μl of template 2, 0.5 μl of PrimeSTAR HS DNA Polymerase (2.5 U / μl), and 31.5 μl of sterile water, for a total volume of 50 μl. The general amplification program was as follows: ① 95℃ for 3 min; ② 98℃ for 10 sec, 55℃ for 15 sec, 72℃ at 1 kb / min, repeating step ② 30 times; ③ 72℃ for 5 min.

[0048] (3) When performing colony PCR verification, 2×Es TaqMasterMix (Dye) from Kangwei Century Biotechnology Co., Ltd. was used for amplification. The universal amplification system is as follows: 12.5 μl of 2×Es Taq MasterMix (Dye), 1 μl of upstream primer (10 μM), 1 μl of downstream primer (10 μM), 0.5 μl of template, 10 μl of sterile water, and a total volume of 25 μl. The universal amplification program is as follows: ① 94℃ for 3 min; ② 94℃ for 30 sec, (Tm-5)℃ for 30 sec, 72℃ for 2 kb / min, repeat step ② 30 times; ③ 72℃ for 5 min.

[0049] 3. Construction of N20-sgRNA expression vector

[0050] (1) Enzyme digestion: The pTargetF fragment was amplified using PrimeSTAR HS DNA Polymerase, a high-fidelity DNA polymerase from TaKaRa, under the conditions shown in Experimental Method 2; restriction endonucleases from New England Biolabs (NEB) were used. Spe I. Single digestion of the pTargetF fragment; digestion reaction system and conditions: 3 μL of 10×CutSmartBuffer, 500-1000 ng of pTargetF fragment. Spe Add 0.5 μL of I (20 U / μL) to a final volume of sterile water to a final volume of 30 μL, and digest at 37°C for 1 h.

[0051] (2) Enzyme ligation: Using Thermo Scientific's T4 DNA ligase to ligate DNA... Spe The pTargetF fragment digested by enzyme I was circularized and self-ligated; the enzyme ligation reaction system and conditions were as follows: 10× T4 DNA Ligase Buffer 2 μL, pTargetF fragment 20-100 ng, T4 DNA Ligase (5 U / μL) 0.5 μL, and sterile water was added to bring the total volume to 20 μL. The enzyme ligation was carried out at 22℃ for 0.5 h.

[0052] (3) Transformation: Add 5-10 μL of the enzyme ligation product to 50 μL of Escherichia coli DH5α competent cells, mix gently, and incubate on ice for 30 min; heat shock at 42℃ for 45 s, incubate on ice for 2 min, add 500 μL of LB liquid medium, and incubate at 37℃ and 250 rpm for 40-60 min; centrifuge at 8000 rpm for 2 min, remove most of the supernatant, spread the remaining bacterial culture on solid LB medium containing 50 μg / mL spectinomycin, and incubate at 37℃ overnight until single colonies grow.

[0053] (4) Verification: Select 2-5 single clones and use 2×Es TaqMasterMix (Dye) of Kangwei Century Biotechnology Co., Ltd. to perform colony PCR verification. The PCR amplification conditions are as shown in Experimental Method 2. After the PCR products are detected by 1% agarose gel electrophoresis, the samples with the correct band size are sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The clones with the correct sequencing are selected and the pTargetF plasmid is extracted using the high purity plasmid small-volume rapid extraction kit of Beijing Bomed Gene Technology Co., Ltd.

[0054] 4. Preparation and transformation of competent cells by electroporation transformation of Escherichia coli

[0055] (1) Preparation of competent cells: A single colony of Escherichia coli carrying the pCas plasmid was picked and inoculated into 3 mL of liquid LB medium containing 50 μg / mL kanamycin, and cultured at 30℃ and 250 rpm for 12-16 h as seed culture; 200 μL of seed culture was inoculated into 30 mL of liquid LB medium containing 3% L-arabinose (w / v) and 50 μg / mL kanamycin, and cultured at 30℃ and 250 rpm until OD. 600 Approximately 0.5-0.7; incubate on ice for 15 min, transfer the bacterial culture to a pre-chilled 50 mL centrifuge tube, centrifuge at 2000 g for 5 min, and discard the supernatant; resuspend the bacterial pellet in 10 mL of pre-chilled 10% glycerol (v / v), centrifuge at 5000 g for 5 min, discard the supernatant, and repeat this step twice; resuspend the bacterial pellet in 300 μL of pre-chilled 10% glycerol (v / v) to obtain electrotransformation competent cells.

[0056] (2) Electroporation transformation: Mix 100 ng pTargetF plasmid and 400 ng homologous recombination fragment with 50 μL competent cells and add to a 2 mm electroporation cuvette. Incubate on ice for 5 min. After drying the cuvette, place it in an electroporator for transformation at 2.5 kV. Immediately add 1 mL of pre-cooled liquid LB medium to the cuvette and incubate on ice for 5 min. Transfer the bacterial culture to a 2 mL sterile centrifuge tube and incubate at 30℃ and 250 rpm for 2 h. Centrifuge at 8000 rpm for 1 min, discard most of the supernatant, and spread the remaining bacterial culture on solid LB medium containing 50 μg / mL kanamycin and 50 μg / mL spectinomycin. Incubate at 30℃ until colonies grow, then perform colony PCR verification and sequencing.

[0057] 5. Plasmid elimination

[0058] To eliminate the pTargetF plasmid, pick a single E. coli colony and inoculate it into liquid LB medium containing 50 μg / mL kanamycin and 0.4 mM IPTG. Incubate at 30°C and 250 rpm for 8-16 h. Then, streak the culture onto solid LB medium containing 50 μg / mL kanamycin and incubate at 30°C until colonies grow. Select colonies that are sensitive to spectinomycin to identify strains that have successfully eliminated the pTargetF plasmid.

[0059] 6. Sample detection and analysis

[0060] (1) When detecting the concentrations of 3-dehydroshikimic acid, protocatechuic acid, 2-pyranone-4,6-dicarboxylic acid, and glucose in the fermentation broth, the fermentation broth sample was diluted with distilled water to an appropriate ratio, centrifuged at 12,000 rpm for 10 min, and the supernatant was filtered through a 0.22 μm aqueous microporous membrane. The analysis was performed using an Agilent 1200 high-performance liquid chromatograph equipped with a VWD ultraviolet detector and a RID differential refractive index detector. The chromatographic column was a Phenomenex Rezex RFQ-Fast Acid H+ (8%) (LC Column 100 × 7.8 mm). The chromatographic conditions were: mobile phase 5 mM H2SO4 aqueous solution, sample loading volume 5 μL, flow rate 0.6 mL / min, column temperature 55℃, and detection wavelength 210 nm. 3-Dehydroshikimic acid, protocatechuic acid, and glucose standards were purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd., and 2-pyranone-4,6-dicarboxylic acid standard was purchased from Shanghai Bid Pharmaceutical Technology Co., Ltd.

[0061] (2) When detecting the cell concentration (OD) in the fermentation broth 600 When diluting the fermentation broth sample with distilled water to an appropriate ratio, the absorbance value of the sample at a wavelength of 600 nm is measured using a 723 visible spectrophotometer from Shanghai Spectrum Instruments Co., Ltd., which is the cell concentration OD. 600 .

[0062] To make the technical problems, technical solutions, and beneficial effects of this invention clearer, the invention will be described in detail below with reference to embodiments. It should be noted that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0063] Example 1: Construction of recombinant Escherichia coli strain PDC01

[0064] The method for constructing a recombinant *E. coli* strain that produces 2-pyranone-4,6-dicarboxylic acid provided by this invention integrates and optimizes the endogenous shikimic acid pathway and the exogenous 2-pyranone-4,6-dicarboxylic acid synthesis pathway of *E. coli* through metabolic engineering, achieving efficient de novo synthesis of 2-pyranone-4,6-dicarboxylic acid using glucose as a carbon source. The starting strain used in its construction can be a recombinant *E. coli* strain that produces 3-dehydrogenase shikimic acid, a recombinant *E. coli* strain with shikimic acid pathway regulated, or a wild-type *E. coli* strain.

[0065] The following example demonstrates the construction of a recombinant Escherichia coli strain WJ060 (CGMCC No. 14602, CN201711002831.2) that produces the 3-dehydrogenase shikimic acid. The specific steps are as follows:

[0066] Using recombinant Escherichia coli strain WJ060 as the starting strain, this study utilized the CRISPR-Cas9 gene editing technology reported in the literature (Jiang Y, Chen B, Duan C, et al. Multigene Editing in the Escherichiacoli Genome via the CRISPR-Cas9System. Appl Environ Microbiol. 2015, 81:2506-2514.) to employ an exogenous 3-dehydroshikimate dehydratase gene. quiC (Derived from pET30a-quiC plasmid, CN202111135396.7) Replace the pyruvate formate lyase gene on the genome of strain WJ060. pflB And insert the P2 promoter (nucleotide sequence as shown in SEQ ID NO:10) into quiC The primers used before the start codon ATG are shown in Table 1, and the specific construction method is as follows:

[0067] (1) Constructing the pTargetF-pflB plasmid

[0068] Using pTargetF-cadA plasmid as a template, the pTargetF-pflB fragment was amplified using pflB-N20-F / pTargetF-R primers and TaKaRa's high-fidelity DNA polymerase PrimeSTAR HS DNA Polymerase. The PCR amplification system and procedure are shown in Experimental Method 2.

[0069] Using restriction endonucleases from New England Biolabs (NEB) Spe I. The pTargetF-pflB fragment was digested with enzymes, and the enzyme digestion reaction system and conditions are shown in Experimental Method 3.

[0070] The pTargetF-pflB fragment digested by the enzyme was self-ligated using T4 DNA ligase from Thermo Scientific. The enzyme ligation reaction system and conditions are shown in Experimental Method 3.

[0071] Escherichia coli DH5α competent cells were prepared according to Experimental Method 1. Then, 5 μL of enzyme-linked product was used to transform 50 μL of competent cells. The transformation method is as shown in Experimental Method 3.

[0072] Three single clones were selected and colony PCR was performed using pTargetF-seq-F / pTargetF-seq-R primers via 2×Es Taq MasterMix (Dye) from Kangwei Century Biotechnology Co., Ltd. PCR amplification conditions were as shown in Experimental Method 2. After the PCR products were detected by 1% agarose gel electrophoresis, samples with the correct band size were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The selected clones with correct sequencing were used to extract the pTargetF-pflB plasmid using a high-purity plasmid small-scale rapid extraction kit from Beijing Bomed Gene Technology Co., Ltd.

[0073] Primer Name Primer Sequence 5´→3´ pflB-N20-F CTGACTAGTAACCGAACATGACCATTCTGGTTTTAGAGCTAGAAATAGC pTargetF-R ATGACTAGTATTATACCTAGGACTGAGC pTargetF-seq-F AGCGAGGAAGCGGAAGAGCG pTargetF-seq-R TAGCACGATCAACGGCACTG pflB-1F GTATGTCTGGCAGTATGGATG pflB-1R CAACACCGCCAGAGATAAGTAACACCTACCTTCTTAAGTG P-F TTATCTCTGGCGGTGTTG P-R AGCTGTTTCCTGGTTTAAAC quiC-F GTTTAAACCAGGAAACAGCTATGAAACTGACCAGCCTG quiC-R TTAACGCATTTTAACTGCGC pflB-2F GCGCAGTTAAAATGCGTTAATTAGATTTGACTGAAATCGTACAG pflB-2R TTCATAAAGTGGCGATAGGTC

[0074] (2) Preparation pflB Homologous recombination fragments at loci

[0075] Amplification was performed using PrimeSTAR HS DNA Polymerase, a high-fidelity DNA polymerase from TaKaRa. pflB The homologous recombination fragments at specific sites, the PCR amplification system and procedure are as shown in Experimental Method 2, and the preparation steps for the homologous recombination fragments are as follows:

[0076] The first step involved using Escherichia coli DSM1576 bacterial culture as a template and amplifying the culture using two primer pairs, pflB-1F / pflB-1R and pflB-2F / pflB-2R. pflB The two homologous arms, pflB-1 on the left and pflB-2 on the right, were obtained from the site. The promoter P2 was amplified using PF / PR primers with DNA of the artificially synthesized regulatory element P2 (nucleotide sequence shown in SEQ ID NO:10) as a template. The quiC fragment was amplified using quiC-F / quiC-R primers with pET30a-quiC plasmid (CN202111135396.7) as a template.

[0077] The second step involves using pflB-1 and P2 as templates and amplifying the pflB-1-P2 fragment using pflB-1F / PR primers; and using quiC and pflB-2 as templates and amplifying the quiC-pflB-2 fragment using quiC-F / pflB-2R primers.

[0078] The third step involves using pflB-1-P2 and quiC-pflB-2 as templates and amplifying the full-length fragment of pflB-P2-quiC using pflB-1F / pflB-2R primers.

[0079] (3) Construction of PDC01 strain

[0080] Using the recombinant Escherichia coli strain WJ060 (CGMCC No. 14602, CN201711002831.2) as the starting strain, electrocompetent cells were prepared according to the method shown in Experimental Method 4.

[0081] 100 ng pTargetF-pflB plasmid and 400 ng pflB-P2-quiC homologous recombination fragment were added to 50 μL of WJ060 competent cells, and single colonies were obtained by electroporation transformation according to the method shown in Experimental Method 4.

[0082] Five single clones were selected and colony PCR was performed using pflB-1F / pflB-2R primers via 2×Es Taq MasterMix (Dye) from Kangwei Century Biotechnology Co., Ltd. The PCR amplification conditions were as shown in Experimental Method 2. After the PCR products were detected by 1% agarose gel electrophoresis, samples with the correct band size were selected and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing, and finally the recombinant strain PDC01-T was obtained.

[0083] To proceed with the next round of genome editing, the pTargetF-pflB plasmid needs to be eliminated from the recombinant strain PDC01-T cells. Single colonies of PDC01-T were picked, and the pTargetF-pflB plasmid was eliminated according to the method described in Experimental Method 5 to obtain the recombinant strain PDC01.

[0084] Example 2: Construction of recombinant Escherichia coli strains PDC07, PDC08, PDC09, PDC10, and PDC11

[0085] (1) Genome overexpression of procatechuic acid-4,5-dioxidase gene

[0086] Sequence alignment yielded protocatechuic acid-4,5-dioxidase (EC1.13.11.8) from different species in NCBI, including... Sphingomonas paucimobilis SpLigAB from the source Comamonas testosteroni Source CtPmdAB, Porphyrobacter sp. source PsLigAB, Aestuariicella hydrocarbonica Source: AhLigAB Microbacterium oleivoransThe MoLigAB gene, derived from NCBI accessions AB073227.1, AF305325.1, JAGIBN010000003.1, JAAONZ010000012.1, and JFYO01000005.1, encodes nucleotide sequences from these genomes. These sequences were then codon-optimized according to E. coli codon preference. The optimized sequences are shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8. The encoded proteins are shown in NCBI accessions BAB88742.1 / BAB88743.1, AAK73572.1 / AAK73573.1, and MBO9517659.1 / . The amino acid sequence shown is MBO9517658.1, NHO66815.1 / NHO66816.1, or EZP27614.1.

[0087] Using recombinant strain PDC01 as the starting strain, CRISPR-Cas9 technology was used to transfer protocatechuic acid-4,5-dioxidase genes from different species ( SpligAB , CtpmdAB , PsligAB , AhligAB , MoligAB Integrated into the genome of strain PDC01 ykgH - betA The non-coding region between the two genes was extracted, and the P4 promoter was inserted before the start codon ATG of the protocatechuic acid-4,5-dioxidase gene to construct recombinant strains PDC02, PDC03, PDC04, PDC05, and PDC06. The primers used are shown in Table 2, and the specific construction method is as follows:

[0088] A1) Construct the pTargetF-ykgH plasmid

[0089] Using pTargetF-cadA plasmid as a template, the pTargetF-ykgH fragment was amplified using ykgH-N20-F / pTargetF-R primers and TaKaRa's high-fidelity DNA polymerase PrimeSTAR HS DNA Polymerase. The PCR amplification system and procedure are shown in Experimental Method 2.

[0090] Using restriction endonucleases from New England Biolabs (NEB) Spe I. The pTargetF-ykgH fragment was digested with enzymes, and the digestion reaction system and conditions are shown in Experimental Method 3.

[0091] The pTargetF-ykgH fragment digested by the enzyme was self-ligated using T4 DNA ligase from Thermo Scientific. The enzyme ligation reaction system and conditions are shown in Experimental Method 3.

[0092] Escherichia coli DH5α competent cells were prepared according to Experimental Method 1. Then, 5 μL of enzyme-linked product was used to transform 50 μL of competent cells. The transformation method is as shown in Experimental Method 3.

[0093] Three single clones were selected and colony PCR was performed using pTargetF-seq-F / pTargetF-seq-R primers via 2×Es Taq MasterMix (Dye) from Kangwei Century Biotechnology Co., Ltd. PCR amplification conditions were as shown in Experimental Method 2. After the PCR products were detected by 1% agarose gel electrophoresis, samples with the correct band size were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The selected clones with correct sequencing were used to extract the pTargetF-ykgH plasmid using a high-purity plasmid small-scale rapid extraction kit from Beijing Bomed Gene Technology Co., Ltd.

[0094] Primer Name Primer Sequence 5´→3´ pTargetF-R ATGACTAGTATTATACCTAGGACTGAGC pTargetF-seq-F AGCGAGGAAGCGGAAGAGCG pTargetF-seq-R TAGCACGATCAACGGCACTG P-F TTATCTCTGGCGGTGTTG P-R AGCTGTTTCCTGGTTTAAAC ykgH-N20-F CTGACTAGTCATATCCAGTATTCATGATGGTTTTAGAGCTAGAAATAGC ykgH-1F ATCACCGTTCGGATACAATG ykgH-1R CAACACCGCCAGAGATAACCAGTATTCATGATGCGG SpligAB-F GTTTAAACCAGGAAACAGCTATGACCGAAAAGAAAGAACGCATTG CtpmdAB-F GTTTAAACCAGGAAACAGCTATGGCACTGGAAAAGCCGTAT PsligAB-F GTTTAAACCAGGAAACAGCTATGAGCGACAAAAAAGAACG AhligAB-F GTTTAAACCAGGAAACAGCTATGAGCCTGGACAAACCGT MoligAB-F GTTTAAACCAGGAAACAGCTATGACCCTGGACAAACCGT AB-R GATTATGCGGCCGTGTACAA ykgH-2F TTGTACACGGCCGCATAATCATATGAAGCATGAGAGTTACCT ykgH-2R ATTTATTCGCAGCCGTGAG

[0095] A2) Preparation ykgH - betA Homologous recombination fragments at loci

[0096] Amplification was performed using PrimeSTAR HS DNA Polymerase, a high-fidelity DNA polymerase from TaKaRa. ykgH - betA The homologous recombination fragments at specific sites, the PCR amplification system and procedure are as shown in Experimental Method 2, and the preparation steps for the homologous recombination fragments are as follows:

[0097] The first step involved using Escherichia coli DSM1576 bacterial culture as a template and amplifying the culture using two primer pairs, ykgH-1F / ykgH-1R and ykgH-2F / ykgH-2R. [[ID=3,3]]ykgH - betA The two homologous arm fragments, ykgH-1 on the left and ykgH-2 on the right, were obtained from the site. Using the DNA of the artificially synthesized regulatory element P4 (nucleotide sequence shown in SEQ ID NO:11) as a template, the promoter P4 was amplified using PF / PR primers. The artificially synthesized protocatechuic acid-4,5-dioxidase gene (optimized according to E. coli codon preference) was used. SpligAB , CtpmdAB , PsligAB , AhligAB , MoligABUsing the sequences shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:6, and SEQ ID NO:8 as templates, the SpligAB fragment was amplified using SpligAB-F / AB-R primers, the CtpmdAB fragment was amplified using CtpmdAB-F / AB-R primers, the PsligAB fragment was amplified using PsligAB-F / AB-R primers, the AhligAB fragment was amplified using AhligAB-F / AB-R primers, and the MoligAB fragment was amplified using MoligAB-F / AB-R primers.

[0098] The second step involves amplifying the ykgH-1-P4 fragment using ykgH-1F / PR primers, using ykgH-1 and P4 as templates; amplifying the SpligAB-ykgH-2 fragment using SpligAB-F / ykgH-2R primers, using SpligAB and ykgH-2 as templates; amplifying the CtpmdAB-ykgH-2 fragment using CtpmdAB-F / ykgH-2R primers, using Pslig... Using AB and ykgH-2 as templates, the PsligAB-ykgH-2 fragment was amplified using the PsligAB-F / ykgH-2R primers; the AhligAB-ykgH-2 fragment was amplified using the AhligAB-F / ykgH-2R primers; and the MoligAB-ykgH-2 fragment was amplified using the MoligAB-F / ykgH-2R primers.

[0099] The third step involves amplifying the full-length fragment of ykgH-P4-SpligAB using ykgH-1-P4 and SpligAB-ykgH-2 as templates, and using ykgH-1F / ykgH-2R primers to obtain the full-length fragment of ykgH-P4-SpligAB; using ykgH-1-P4 and CtpmdAB-ykgH-2 as templates, and using ykgH-1F / ykgH-2R primers to obtain the full-length fragment of ykgH-P4-CtpmdAB; and using ykgH-1-P4 and PsligAB-ykgH-2 as templates, and using ykgH-1-P4-SpligAB-ykgH-2 to obtain the full-length fragment of ykgH-P4-CtpmdAB. The full-length fragment ykgH-P4-PsligAB was amplified using H-1F / ykgH-2R primers; the full-length fragment ykgH-P4-AhligAB was amplified using ykgH-1-P4 and AhligAB-ykgH-2 primers; and the full-length fragment ykgH-P4-MoligAB was amplified using ykgH-1F / ykgH-2R primers.

[0100] A3) Construct strains PDC02, PDC03, PDC04, PDC05, and PDC06.

[0101] Using recombinant strain PDC01 as the starting strain, electrotransformation competent cells were prepared according to the method shown in Experimental Method 4.

[0102] 100 ng pTargetF-ykgH plasmid and 400 ng ykgH-P4-SpligAB or 400 ng ykgH-P4-CtpmdAB or 400 ng ykgH-P4-PsligAB or 400 ng ykgH-P4-AhligAB or 400 ng ykgH-P4-MoligAB homologous recombination fragments were added to 50 μL LPDC01 competent cells, and single colonies were obtained by electroporation transformation according to the method shown in Experimental Method 4.

[0103] Five single clones were selected from each transformation group and colony PCR was performed using ykgH-1F / ykgH-2R primers via 2×Es Taq MasterMix (Dye) from Kangwei Century Biotechnology Co., Ltd. The PCR amplification conditions are as shown in Experimental Method 2. After the PCR products were detected by 1% agarose gel electrophoresis, samples with the correct band size were selected and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. Finally, recombinant strains PDC02-T, PDC03-T, PDC04-T, PDC05-T, and PDC06-T were obtained.

[0104] To proceed with the next round of genome editing, the pTargetF-ykgH plasmid needs to be eliminated from recombinant strains PDC02-T, PDC03-T, PDC04-T, PDC05-T, and PDC06-T cells. Single colonies of PDC02-T, PDC03-T, PDC04-T, PDC05-T, and PDC06-T were picked, and the pTargetF-ykgH plasmid was eliminated according to the method described in Experimental Method 5, resulting in recombinant strains PDC02, PDC03, PDC04, PDC05, and PDC06, respectively.

[0105] (2) Overexpression of the 4-carboxy-2-hydroxymuconic acid-6-semialdehyde dehydrogenase gene in the genome

[0106] Sequence alignment revealed 4-carboxy-2-hydroxymucoconic acid-6-hemisaldehyde dehydrogenase (EC 1.1.1.312) from different species in NCBI, including... Sphingomonaspaucimobilis SpLigC from the source Porphyrobacter sp. source PsLigC, [[ID=,2]]Aestuariicellahydrocarbonica AhLigC from the sourceMicrobacteriumoleivorans The MoLigC gene was derived from the nucleotide sequences of the genomes accessed by NCBI with accession numbers AB073227.1, JAGIBN010000003.1, JAAONZ010000012.1, and JFYO01000005.1. These gene sequences were codon-optimized according to the codon preference of E. coli, and the optimized sequences are shown in SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:9. The encoded proteins are shown in any of the amino acid sequences of NCBI accession numbers BAB88744.1, MBO9517657.1, NHO66817.1, and EZP27613.1.

[0107] Using recombinant strains PDC02, PDC03, PDC04, PDC05, and PDC06 as starting strains, 4-carboxy-2-hydroxymuconic acid-6-hemisaldehyde dehydrogenase genes from different species were utilized via CRISPR-Cas9 technology. SpligC , PsligC , AhligC , MoligC Replace the D-lactate dehydrogenase gene on the genomes of strains PDC02, PDC03, PDC04, PDC05, and PDC06. ldhA The P4 promoter was inserted before the ATG start codon of the 4-carboxy-2-hydroxymucoconic acid-6-hemisaldehyde dehydrogenase gene to construct recombinant strains PDC07, PDC08, PDC09, PDC10, and PDC11. The primers used are shown in Table 3, and the specific construction method is as follows:

[0108] A1) Construct the pTargetF-ldhA plasmid

[0109] Using pTargetF-cadA plasmid as a template, the pTargetF-ldhA fragment was amplified using ldhA-N20-F / pTargetF-R primers and TaKaRa's high-fidelity DNA polymerase PrimeSTAR HS DNA Polymerase. The PCR amplification system and procedure are shown in Experimental Method 2.

[0110] Using restriction endonucleases from New England Biolabs (NEB) Spe I. The pTargetF-ldhA fragment was digested with enzymes, and the digestion reaction system and conditions are shown in Experimental Method 3.

[0111] The pTargetF-ldhA fragment digested by the enzyme was self-ligated using T4 DNA ligase from Thermo Scientific. The enzyme ligation reaction system and conditions are shown in Experimental Method 3.

[0112] Escherichia coli DH5α competent cells were prepared according to Experimental Method 1. Then, 5 μL of enzyme-linked product was used to transform 50 μL of competent cells. The transformation method is as shown in Experimental Method 3.

[0113] Three single clones were selected and colony PCR was performed using pTargetF-seq-F / pTargetF-seq-R primers via 2×Es Taq MasterMix (Dye) from Kangwei Century Biotechnology Co., Ltd. PCR amplification conditions were as shown in Experimental Method 2. After the PCR products were detected by 1% agarose gel electrophoresis, samples with the correct band size were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The selected clones with correct sequencing were used to extract the pTargetF-ldhA plasmid using a high-purity plasmid small-scale rapid extraction kit from Beijing Bomed Gene Technology Co., Ltd.

[0114] Primer Name Primer Sequence 5´→3´ pTargetF-R ATGACTAGTATTATACCTAGGACTGAGC pTargetF-seq-F AGCGAGGAAGCGGAAGAGCG pTargetF-seq-R TAGCACGATCAACGGCACTG P-F TTATCTCTGGCGGTGTTG P-R AGCTGTTTCCTGGTTTAAAC ldhA-N20-F CTGACTAGTCCGTGACGCTAACTTCTCTCGTTTTAGAGCTAGAAATAGC ldhA-1F It should be noted that there seems to be an error in the original text where "Aestuariicellahydrocarbonica" is split into two parts in line 42. I have translated it as best as possible with the given text. Also, the "ykgH" appears multiple times in a way that might need further context clarification for a more accurate understanding in a biological or technical sense. GCGAGAGAGAGTTTTCCCTG ldhA-1R CAACACCGCCAGAGATAAAAGACTTTCTCCAGTGATGTT SpligC-F GTTTAAACCAGGAAACAGCTATGCGCATTGCACTGG PsligC-F GTTTAAACCAGGAAACAGCTATGCGCATTGCCCTGGC AhligC-F GTTTAAACCAGGAAACAGCTATGAAGGTTGCCCTGGC MoligC-F GTTTAAACCAGGAAACAGCTATGACCGCCGGTAAAGTTC C-R TGCTAGTTATTGCTCAGCGG ldhA-2F CCGCTGAGCAATAACTAGCATCTTGCCGCTCCCCTGCA ldhA-2R TCGCTTTCTGTTGCCCGT

[0115] A2) Preparation ldhA Homologous recombination fragments at loci

[0116] Amplification was performed using PrimeSTAR HS DNA Polymerase, a high-fidelity DNA polymerase from TaKaRa. ldhA The homologous recombination fragments at specific sites, the PCR amplification system and procedure are as shown in Experimental Method 2, and the preparation steps for the homologous recombination fragments are as follows:

[0117] The first step involved using Escherichia coli DSM1576 bacterial culture as a template and amplifying the culture using two primer pairs, ldhA-1F / ldhA-1R and ldhA-2F / ldhA-2R. ldhA The two homologous arm fragments, ldhA-1 on the left and ldhA-2 on the right, were obtained from the site; the promoter P4 was amplified using PF / PR primers with DNA of the artificially synthesized regulatory element P4 (as shown in SEQ ID NO:11) as a template; and the artificially synthesized 4-carboxy-2-hydroxymuconic acid-6-hemisaldehyde dehydrogenase gene (optimized according to E. coli codon preference) was used. SpligC , PsligC , AhligC , MoligCUsing sequences as shown in SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:7, and SEQ ID NO:9 as templates, the SpligC fragment was amplified using SpligC-F / CR primers, the PsligC fragment was amplified using PsligC-F / CR primers, the AhligC fragment was amplified using AhligC-F / CR primers, and the MoligC fragment was amplified using MoligC-F / CR primers.

[0118] The second step involves amplifying the ldhA-1-P4 fragment using ldhA-1F / PR primers, using ldhA-1 and P4 as templates; amplifying the SpligC-ldhA-2 fragment using SpligC-F / ldhA-2R primers, using SpligC and ldhA-2 as templates; amplifying the PsligC-ldhA-2 fragment using PsligC-F / ldhA-2R primers, using PsligC and ldhA-2 as templates; amplifying the AhligC-ldhA-2 fragment using AhligC-F / ldhA-2R primers, using AhligC and ldhA-2 as templates; and amplifying the MoligC-ldhA-2 fragment using MoligC-F / ldhA-2R primers, using MoligC and ldhA-2 as templates.

[0119] The third step involves amplifying the full-length fragment ldhA-P4-SpligC using ldhA-1-P4 and SpligC-ldhA-2 as templates with ldhA-1F / ldhA-2R primers; amplifying the full-length fragment ldhA-P4-PsligC using ldhA-1-P4 and PsligC-ldhA-2 as templates with ldhA-1F / ldhA-2R primers; amplifying the full-length fragment ldhA-P4-AhligC using ldhA-1-P4 and AhligC-ldhA-2 as templates with ldhA-1F / ldhA-2R primers; and amplifying the full-length fragment ldhA-P4-MoligC using ldhA-1-P4 and MoligC-ldhA-2 as templates with ldhA-1F / ldhA-2R primers.

[0120] A3) Construct strains PDC07, PDC08, PDC09, PDC10, and PDC11.

[0121] Recombinant strains PDC02, PDC03, PDC04, PDC05, and PDC06 were used as starting strains, and electrocompetent cells of the above strains were prepared according to the method shown in Experimental Method 4.

[0122] 100 ng of pTargetF-ldhA plasmid and 400 ng of ldhA-P4-SpligC homologous recombination fragment were transformed into 50 μL of PDC02 or 50 μL of PDC03 competent cells; 100 ng of pTargetF-ldhA plasmid and 400 ng of ldhA-P4-PsligC homologous recombination fragment were transformed into 50 μL of PDC04 competent cells; 100 ng of pTargetF-ldhA plasmid and 400 ng of ldhA-P4-AhligC homologous recombination fragment were transformed into 50 μL of PDC05 competent cells; and 100 ng of pTargetF-ldhA plasmid and 400 ng of ldhA-P4-MoligC homologous recombination fragment were transformed into 50 μL of PDC06 competent cells. Single colonies were then obtained by electroporation transformation according to the method described in Experimental Method 4.

[0123] Five single clones were selected from each transformation group. Colony PCR was performed using ldhA-1F / ldhA-2R primers via 2×Es Taq MasterMix (Dye) from Kangwei Century Biotechnology Co., Ltd. The PCR amplification conditions were as shown in Experimental Method 2. After the PCR products were detected by 1% agarose gel electrophoresis, samples with the correct band size were selected and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. Finally, recombinant strains PDC07-T, PDC08-T, PDC09-T, PDC10-T, and PDC11-T were obtained.

[0124] To proceed with the next round of genome editing, the pTargetF-ldhA plasmid needs to be eliminated from recombinant strains PDC07-T, PDC08-T, PDC09-T, PDC10-T, and PDC11-T cells. Single colonies of PDC07-T, PDC08-T, PDC09-T, PDC10-T, and PDC11-T were picked, and the pTargetF-ldhA plasmid was eliminated according to the method shown in Experimental Method 5, resulting in recombinant strains PDC07, PDC08, PDC09, PDC10, and PDC11, respectively.

[0125] Example 3: Production of PDC by shake-flask fermentation of recombinant Escherichia coli strains WJ060, PDC01, PDC07, PDC08, PDC09, PDC10, and PDC11

[0126] The components, their contents, inoculum size, fermentation temperature, and fermentation time in the seed culture medium and shake-flask fermentation medium mentioned in this invention can all be adjusted as needed, for example:

[0127] The yeast extract content is 1-5 g / L, specifically 1 g / L, 2 g / L, 3 g / L, 4 g / L, or 5 g / L, etc.

[0128] The content of tryptone is 2-10 g / L, specifically 2 g / L, 4 g / L, 6 g / L, 8 g / L, or 10 g / L, etc.

[0129] The NaCl content is 2-10 g / L, specifically 2 g / L, 4 g / L, 6 g / L, 8 g / L, or 10 g / L, etc.

[0130] The glucose content is 10-50 g / L, specifically 10 g / L, 20 g / L, 30 g / L, 40 g / L, or 50 g / L, etc.

[0131] The K2HPO4•3H2O content is 2.5-12.5 g / L, specifically 2.5 g / L, 5 g / L, 7.5 g / L, 10 g / L, or 12.5 g / L, etc.

[0132] The MgSO4•7H2O content is 1-5 g / L, specifically 1 g / L, 2 g / L, 3 g / L, 4 g / L, or 5 g / L, etc.

[0133] The (NH4)2SO4 content is 0.8-4.0 g / L, specifically 0.8 g / L, 1.6 g / L, 2.4 g / L, 3.2 g / L, or 4.0 g / L, etc.

[0134] The FeSO4•7H2O content is 0.025-0.125 g / L, specifically 0.025 g / L, 0.050 g / L, 0.075 g / L, 0.100 g / L, or 0.125 g / L, etc.

[0135] The content of citric acid monohydrate is 1-5 g / L, specifically 1 g / L, 2 g / L, 3 g / L, 4 g / L, or 5 g / L, etc.

[0136] The CaCO3 content is 1-5 g / L, specifically 1 g / L, 2 g / L, 3 g / L, 4 g / L, or 5 g / L.

[0137] The MnSO4•H2O content is 1.5-7.5 mg / L, specifically 1.5 mg / L, 3.0 mg / L, 4.5 mg / L, 6.0 mg / L, or 7.5 mg / L;

[0138] The Na2SO4 content is 10-50 mg / L, specifically 10 mg / L, 20 mg / L, 30 mg / L, 40 mg / L, or 50 mg / L;

[0139] The ZnSO4•7H2O content is 0.4-6.4 mg / L, specifically 0.4 mg / L, 1.6 mg / L, 3.2 mg / L, 4.8 mg / L, or 6.4 mg / L;

[0140] The CoCl2•6H2O content is 1-5 mg / L, specifically 1 mg / L, 2 mg / L, 3 mg / L, 4 mg / L, or 5 mg / L;

[0141] The CuSO4•5H2O content is 0.2-1.0 mg / L, specifically 0.2 mg / L, 0.4 mg / L, 0.6 mg / L, 0.8 mg / L, or 1.0 mg / L;

[0142] The inoculation volume percentage is 1%-5%, specifically 1%, 2%, 3%, 4%, or 5%, etc.

[0143] The fermentation temperature is 25-42℃, specifically 25℃, 30℃, 37℃, 40℃, or 42℃, etc.

[0144] The fermentation time is 24-72 hours, specifically 24 hours, 36 hours, 48 ​​hours, 60 hours, or 72 hours.

[0145] The shake-flask fermentation process is illustrated below.

[0146] The seed culture medium was LB medium, which included 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl.

[0147] The shake-flask fermentation medium was an inorganic salt medium, including 20 g / L glucose, 7.5 g / L K2HPO4•3H2O, 2 g / L MgSO4•7H2O, 1.6 g / L (NH4)2SO4, 0.075 g / L FeSO4•7H2O, 2 g / L citric acid monohydrate, 5 g / L CaCO3, 4.5 mg / L MnSO4•H2O, 20 mg / L Na2SO4, 6.4 mg / L ZnSO4•7H2O, 4 mg / L CoCl2•6H2O, and 0.6 mg / L CuSO4•5H2O.

[0148] The shake-flask fermentation steps are as follows:

[0149] Single colonies of recombinant strains WJ060, PDC01, PDC07, PDC08, PDC09, PDC10, and PDC11 were picked and inoculated into 5 mL of LB medium and cultured at 37℃ and 250 r / min for 10 h to obtain seed culture.

[0150] Transfer the seed culture at a 1% inoculum to a 100 mL Erlenmeyer flask containing 15 mL of shake-flask fermentation medium, and incubate at 37℃ and 250 r / min for 60 h. During the fermentation process, samples can be taken at the time points required by actual needs.

[0151] Take an appropriate amount of fermentation broth sample and determine the concentration of 3-dehydroshikimic acid, protocatechuic acid, 2-pyranone-4,6-dicarboxylic acid, and other substances in the fermentation broth according to the analytical method in Experiment 6.

[0152] Results: After 60 h of shake-flask fermentation, the 3-dehydroshikimic acid content in the fermentation broth of the starting strain WJ060 was 5.98 g / L, with a small amount of protocatechuic acid produced. 2-pyranone-4,6-dicarboxylic acid was not detected. quiC Subsequently, the protocatechuic acid content in the fermentation broth of strain PDC01 was 4.71 g / L, with no 3-dehydroshikimic acid residue and no 2-pyranone-4,6-dicarboxylic acid production detected. After integrating genes from different species on the 2-pyranone-4,6-dicarboxylic acid synthesis pathway, the 2-pyranone-4,6-dicarboxylic acid content in the fermentation broth of strain PDC09 was 8.67 g / L, with only trace amounts of protocatechuic acid residue and no 3-dehydroshikimic acid residue detected. Except for strains PDC07 and PDC08, which showed a small accumulation of 2-pyranone-4,6-dicarboxylic acid, no other strains produced 2-pyranone-4,6-dicarboxylic acid.

[0153] Strain 3-Dehydroshikimic acid (g / L) Protocatechuic acid (g / L) 2-Pyrone-4,6-dicarboxylic acid (g / L) WJ060 5.98 0.06 0.00 PDC01 0.00 4.71 0.00 PDC07 0.00 2.10 1.03 PDC08 0.00 4.11 0.47 PDC09 0.00 0.01 8.67 PDC10 0.00 4.24 0.00 PDC11 0.00 4.68 0.00

[0154] Example 4: Construction of recombinant Escherichia coli strain PDC14

[0155] Using recombinant strain PDC09 as the starting strain, the second copy was inserted using CRISPR-Cas9 technology. Porphyrobacter sp.-derived 4-carboxy-2-hydroxymucoconic acid-6-semialdehyde dehydrogenase gene PsligC Integration into the genome of strain PDC09 ypjC-ileY The non-coding region between the two genes, and the P4 promoter is inserted into PsligC The recombinant strain PDC14 was constructed by adding a start codon ATG. The primers used are shown in Table 5, and the specific construction method is as follows:

[0156] (1) Constructing the pTargetF-ypjC plasmid

[0157] Using pTargetF-cadA plasmid as a template, the pTargetF-ypjC fragment was amplified using ypjC-N20-F / pTargetF-R primers via TaKaRa's high-fidelity DNA polymerase PrimeSTAR HS DNA Polymerase. The PCR amplification system and procedure are shown in Experimental Method 2.

[0158] Using restriction endonucleases from New England Biolabs (NEB) Spe I. The pTargetF-ypjC fragment was digested with enzymes, and the enzyme digestion reaction system and conditions are shown in Experimental Method 3.

[0159] The pTargetF-ypjC fragment digested by the enzyme was self-ligated using T4 DNA ligase from Thermo Scientific. The enzyme ligation reaction system and conditions are shown in Experimental Method 3.

[0160] Escherichia coli DH5α competent cells were prepared according to Experimental Method 1. Then, 5 μL of enzyme-linked product was used to transform 50 μL of competent cells. The transformation method is as shown in Experimental Method 3.

[0161] Three single clones were selected and colony PCR was performed using pTargetF-seq-F / pTargetF-seq-R primers via 2×Es Taq MasterMix (Dye) from Kangwei Century Biotechnology Co., Ltd. PCR amplification conditions were as shown in Experimental Method 2. After the PCR products were detected by 1% agarose gel electrophoresis, samples with the correct band size were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The selected clones with correct sequencing were used to extract the pTargetF-ypjC plasmid using a high-purity plasmid small-scale rapid extraction kit from Beijing Bomed Gene Technology Co., Ltd.

[0162] Primer Name Primer Sequence 5´→3´ pTargetF-R ATGACTAGTATTATACCTAGGACTGAGC pTargetF-seq-F AGCGAGGAAGCGGAAGAGCG pTargetF-seq-R TAGCACGATCAACGGCACTG P-F TTATCTCTGGCGGTGTTG P-R AGCTGTTTCCTGGTTTAAAC PsligC-F GTTTAAACCAGGAAACAGCTATGCGCATTGCCCTGGC C-R TGCTAGTTATTGCTCAGCGG ... ypjC-N20-F CTGACTAGTGACATTTCATCCTTACTCTAGTTTTAGAGCTAGAAATAGC ypjC-1F GCTCCCATAATGACAAAGGC ypjC-1R CAACACCGCCAGAGATAAGTAAGGATGAAATGTCTCTGCC ypjC-2F CCGCTGAGCAATAACTAGCACATTGTTCTACATACATTGGTTG ypjC-2R

[0163] (2) Preparation CCAAGGTGAATGGGAACGC Homologous recombination fragments at loci

[0164] Amplification was performed using PrimeSTAR HS DNA Polymerase, a high-fidelity DNA polymerase from TaKaRa. ypjC-ileY ypjC- The homologous recombination fragments at specific sites, the PCR amplification system and procedure are as shown in Experimental Method 2, and the preparation steps for the homologous recombination fragments are as follows:

[0165] The first step involved using Escherichia coli DSM1576 bacterial culture as a template and amplifying the culture using two primer pairs, ypjC-1F / ypjC-1R and ypjC-2F / ypjC-2R.ileY The two homologous arms, ypjC-1 on the left and ypjC-2 on the right, were obtained from the site. Using the DNA of the artificially synthesized regulatory element P4 (as shown in SEQ ID NO:11) as a template, the promoter P4 was amplified using PF / PR primers. The artificially synthesized 4-carboxy-2-hydroxymuconic acid-6-hemisaldehyde dehydrogenase gene, optimized according to E. coli codon preference, was used. ypjC-ileY Using (as shown in SEQ ID NO:5) as a template, the PsligC fragment was amplified using PsligC-F / CR primers.

[0166] The second step involves using ypjC-1 and P4 as templates and amplifying the ypjC-1-P4 fragment using ypjC-1F / PR primers; and using PsligC and ypjC-2 as templates and amplifying the PsligC-ypjC-2 fragment using PsligC-F / ypjC-2R primers.

[0167] The third step involves using ypjC-1-P4 and PsligC-ypjC-2 as templates and amplifying the full-length fragment of ypjC-P4-PsligC using primers ypjC-1F / ypjC-2R.

[0168] (3) Construction of PDC014 strain

[0169] Using recombinant strain PDC09 as the starting strain, electrotransformation competent cells were prepared according to the method shown in Experimental Method 4.

[0170] 100 ng pTargetF-ypjC plasmid and 400 ng ypjC-P4-PsligC homologous recombination fragment were added to 50 μL LPDC09 competent cells, and single colonies were obtained by electroporation transformation according to the method shown in Experimental Method 4.

[0171] Five single clones were selected and colony PCR was performed using ypjC-1F / ypjC-2R primers via 2×Es Taq MasterMix (Dye) from Kangwei Century Biotechnology Co., Ltd. The PCR amplification conditions were as shown in Experimental Method 2. After the PCR products were detected by 1% agarose gel electrophoresis, samples with the correct band size were selected and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing, and finally the recombinant strain PDC14-T was obtained.

[0172] To eliminate the pTargetF-ypjC plasmid within recombinant strain PDC14-T cells, single colonies of PDC14-T were picked, and the pTargetF-ypjC plasmid was eliminated according to the method described in Experimental Method 5, thus obtaining recombinant strain PDC14. Recombinant strain PDC14 was deposited on March 21, 2022, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCC No. 24557.

[0173] Example 5: Production of PDC by fed-batch fermentation of recombinant Escherichia coli strains PDC09 and PDC14

[0174] The components and their contents, inoculum size, fermentation temperature, fermentation pH, aeration rate, dissolved oxygen level, and fermentation time in the seed culture medium and fed-batch fermentation medium mentioned in this invention can all be adjusted as needed, for example:

[0175] The yeast extract content is 1-5 g / L, specifically 1 g / L, 2 g / L, 3 g / L, 4 g / L, or 5 g / L, etc.

[0176] The content of tryptone is 2-10 g / L, specifically 2 g / L, 4 g / L, 6 g / L, 8 g / L, or 10 g / L, etc.

[0177] The NaCl content is 2-10 g / L, specifically 2 g / L, 4 g / L, 6 g / L, 8 g / L, or 10 g / L, etc.

[0178] The initial glucose content is 20-100 g / L, specifically 20 g / L, 40 g / L, 60 g / L, 80 g / L, or 100 g / L, etc.

[0179] The K2HPO4•3H2O content is 2.5-12.5 g / L, specifically 2.5 g / L, 5 g / L, 7.5 g / L, 10 g / L, or 12.5 g / L, etc.

[0180] The MgSO4•7H2O content is 1-5 g / L, specifically 1 g / L, 2 g / L, 3 g / L, 4 g / L, or 5 g / L, etc.

[0181] The (NH4)2SO4 content is 0.8-4.0 g / L, specifically 0.8 g / L, 1.6 g / L, 2.4 g / L, 3.2 g / L, or 4.0 g / L, etc.

[0182] The FeSO4•7H2O content is 0.025-0.125 g / L, specifically 0.025 g / L, 0.050 g / L, 0.075 g / L, 0.100 g / L, or 0.125 g / L, etc.

[0183] The content of citric acid monohydrate is 1-5 g / L, specifically 1 g / L, 2 g / L, 3 g / L, 4 g / L, or 5 g / L, etc.

[0184] The MnSO4•H2O content is 1.5-7.5 mg / L, specifically 1.5 mg / L, 3.0 mg / L, 4.5 mg / L, 6.0 mg / L, or 7.5 mg / L;

[0185] The Na2SO4 content is 10-50 mg / L, specifically 10 mg / L, 20 mg / L, 30 mg / L, 40 mg / L, or 50 mg / L;

[0186] The ZnSO4•7H2O content is 0.4-6.4 mg / L, specifically 0.4 mg / L, 1.6 mg / L, 3.2 mg / L, 4.8 mg / L, or 6.4 mg / L;

[0187] The CoCl2•6H2O content is 1-5 mg / L, specifically 1 mg / L, 2 mg / L, 3 mg / L, 4 mg / L, or 5 mg / L;

[0188] The CuSO4•5H2O content is 0.2-1.0 mg / L, specifically 0.2 mg / L, 0.4 mg / L, 0.6 mg / L, 0.8 mg / L, or 1.0 mg / L.

[0189] The fermentation pH is 5-8, specifically 5, 5.5, 6, 6.5, 7, 7.5, or 8, etc.

[0190] The fermentation temperature is 25-42℃, specifically 25℃, 30℃, 37℃, 40℃, or 42℃, etc.

[0191] The ventilation rate is 0.5-2.5 vvm, specifically 0.5 vvm, 1.0 vvm, 1.5 vvm, 2.0 vvm, or 2.5 vvm;

[0192] Dissolved oxygen is 10%-50%, specifically 10%, 20%, 30%, 40%, or 50%;

[0193] Fermentation time is 36-96 hours, specifically 36 hours, 48 ​​hours, 60 hours, 72 hours, 84 hours, or 96 hours, etc.

[0194] The inoculation volume percentage is 5%-30%, specifically 5%, 10%, 15%, 20%, 25%, or 25%, etc.

[0195] The following is an example of a batch-fed fermentation process.

[0196] The seed culture medium was LB medium, which included 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl.

[0197] The fed-batch fermentation medium was an inorganic salt medium, consisting of K2HPO4•3H2O 7.5 g / L, MgSO4•7H2O 2 g / L, (NH4)2SO4 1.6 g / L, FeSO4•7H2O 0.075 g / L, citric acid monohydrate 2 g / L, MnSO4•H2O 4.5 mg / L, Na2SO4 20 mg / L, ZnSO4•7H2O 6.4 mg / L, CoCl2•6H2O 4 mg / L, and CuSO4•5H2O 0.6 mg / L.

[0198] The feeding medium was a 600 g / L glucose solution.

[0199] The batch fermentation process is as follows:

[0200] Primary seed culture: Single colonies of recombinant strains PDC09 and PDC14 were picked and inoculated into 5 mL LB medium and cultured at 37℃ and 250 r / min for 10 h to obtain the primary seed culture.

[0201] Secondary seed culture: The primary seed culture was transferred to 200 mL LB medium at an inoculation rate of 0.1% and cultured at 37℃ and 250 r / min for 10 h to obtain the secondary seed culture.

[0202] Fed-batch fermentation: The secondary seed culture was transferred at a 10% inoculum to a 5 L fermenter (Shanghai Baoxing Bio-Equipment Engineering Co., Ltd., BIOTECH-5BG fermenter) containing 1.8 L of fed-batch fermentation medium. The fermentation temperature was 37℃, and the aeration rate was 1 vvm. During fermentation, the agitator speed was gradually increased to maintain dissolved oxygen at 30%, and the pH of the fermentation broth was maintained at 6.5 (adjusted with 25% concentrated ammonia). The initial glucose concentration was approximately 40 g / L. As fermentation progressed, when the glucose concentration in the fermentation broth decreased to below 1 g / L, feeding was initiated, and the feeding rate was controlled to ensure that the glucose concentration in the fermentation broth remained below 5 g / L. Samples were taken at appropriate time points during fermentation as needed.

[0203] Sample testing: Take an appropriate amount of fermentation broth sample and test the concentrations of 2-pyranone-4,6-dicarboxylic acid, protocatechuic acid, and glucose, as well as the cell concentration OD, in the fermentation broth according to the analytical method in Experimental Method 6. 600 .

[0204] Results: Through fed-batch fermentation analysis, the recombinant strain PDC09, after 76 h of fermentation, produced 55.9 g / L of 2-pyranone-4,6-dicarboxylic acid, with a synthesis rate of 0.74 g / L / h. The cell OD... 600 The concentration was 46.4, the glucose conversion rate was 0.34 g / g, and the residual amount of protocatechuic acid gradually increased as fermentation neared its end. PsligC (A). After 76 h of fermentation, the recombinant strain PDC14 increased the yield of 2-pyranone-4,6-dicarboxylic acid to 105.9 g / L, with a synthesis rate of 1.39 g / L / h. The cell OD... 600 The concentration was 33.4, the glucose conversion rate was 0.40 g / g, only a very small amount of protocatechuic acid residue was found in the fermentation broth, no 3-dehydroshikimic acid residue was detected, and there was virtually no accumulation of other metabolic byproducts such as acetic acid. [[ID= (B) Compared with the precursor strain PDC09, strain PDC14 showed significantly improved yield and synthesis rate of 2-pyranone-4,6-dicarboxylic acid, as well as glucose conversion.

[0205] The recombinant *E. coli* strain PDC14 provided in this embodiment is a novel microbial strain suitable for the production of 2-pyranone-4,6-dicarboxylic acid. This strain is plasmid-free, exhibits strong genetic stability, and utilizes a simple fermentation process with a short fermentation cycle. It achieves a high yield of 105.9 g / L of 2-pyranone-4,6-dicarboxylic acid, with high glucose conversion and virtually no accumulation of metabolic byproducts such as acetic acid. The yield of 2-pyranone-4,6-dicarboxylic acid is more than six times that of the highest reported yield (16.7 g / L) of 2-pyranone-4,6-dicarboxylic acid synthesized by microbial fermentation (Luo ZW, Kim WJ, Lee SY. Metabolic Engineering of ​ For Efficient Production of 2-Pyrone-4,6-dicarboxylic Acid from Glucose. ACS Synth Biol. 2018, 7: 2296−2307.). The recombinant Escherichia coli strain PDC14 provided in this example shows promising application prospects in the large-scale industrial fermentation production of 2-pyrone-4,6-dicarboxylic acid.

[0206] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications or equivalent substitutions made within the spirit and technical principles of the present invention are included within the protection scope of the present invention. <110> Tianjin Institute of Industrial Biotechnology, Chinese Academy of Sciences <120> Production of recombinant strains of 2-pyranone-4,6-dicarboxylic acid Escherichia coli, their construction methods and applications <130> <160> 11 <170> PatentIn version 3.5 <210> 1 <211> 1349 <212> DNA <213> Artificial sequences (SpligAB) <400> 1 <210> 2 <211> 948 <212> DNA <213> Artificial sequences (SpligC) <400> 2 ATGCGCATTGCACTGGCCGGCGCAGGCGCATTTGGTGAAAAGCATCTGGATGGTCTGAAGAATATTGATGGTGTTGAAATTGTTAGCATCATTAGCCGTAAAGCCGAACAGGCCGCAGAAGTTGCAGCCAAATATGGCGCCAAACATAGCGGTACCGATCTGAGTGAAGCCCTGGCCCGTGATGATGTGGATGCAGTGATTCTGTGTACCCCGACCCAGATGCATGCAGAACAGGCAATTGCATGCATGAATGCCGGTAAACATGTTCAGGTGGAAATTCCGCTGGCCGATAGTTGGGCCGATGCAGAAGCCGTGATGAAGAAAAGCCAGGAAACCGGCCTGGTGTGTATGGTTGGCCATACCCGCCGTTTTAATCCGAGCCATCAGTATATTCATAATAAGATTGTGGCCGGCGAACTGGCCATTCAGCAGATGGATGTGCAGACCTATTTCTTTCGCCGTAAGAATATGAATGCCAAAGGTGAACCGCGTAGTTGGACCGATCATCTGCTGTGGCATCATGCAGCACATACCGTGGATCTGTTTGCATATCAGGCCGGCAAAATTGTTCAGGCCAATGCCGTTCAGGGTCCGATTCATCCGGAACTGGGTATTGCAATGGATATGAGTATTCAGCTGAAAAGTGAAACCGGTGCAATTTGTACCCTGAGCCTGAGTTTTAATAATGATGGTCCGCTGGGCACCTTCTTTCGCTATATTTGTGATAATGGCACCTGGATTGCACGTTATGATGATCTGGTTACCGGTAAAGAAGAACCGGTGGATGTTAGTAAAGTTGATGTGAGCATGAATGGTATTGAACTGCAGGATCGCGAATTCATTGCCGCCATTCGTGAAGGCCGCGAACCGAATAGCAGCGTTGCACGCGTGCTGGATTGTTATCGTGTGCTGGGCGAACTGGAAGTTCAGCTGGAAAAGCAGGGTTAA 948 <210>3 <211>1340 <212> DNA <213> Artificial sequence (CtpmdAB) <400> 3 <210> 4 <211> 1334 <212> DNA <213> Artificial sequence (PsligAB) <400> 4 <210> 5 <211> 957 <212> DNA <213> Artificial sequence (PsligC) <400> 5 ATGCGCATTGCCCTGGCCGGTGCCGGTGCCTTTGGGGAAAAACACCTGGACGGGCTGAAAAACATTGACGGTGTGGAAATTACCAGCATTATTAGCCGCCGTGCCGAACAGGCCGCCGAAGTTGCAGCAAAATATGGGGCACGGCATAGCGGTACCGAATTAAGCGAAGCACTTGAAAGAGATGATGTGGATGCAGTTATTCTGTGTACCCCGACCCAAATGCATGCAGAACAGGCAATTGCATGTATGAATGCAGGTAAACACGTTCAAGTTGAAATTCCGCTGTCGGATAGCTGGGCAGATGCAGAAGCAGTTTTAAAAAAGCAACAAGAAACCGGCCTTGTATGTATGGTTGGGCATACCCGGCGCTTTAATCCGAGCCATCAGTATGTGCACAATAAAATTGTAGCAGGTGAACTGAGTATTCAGCAGATGGACGTGCAGACATATTTTTTTCGTCGTAAAAACATGAACGCAAAAGGTGAAGCCCGCAGCTGGACCGATCATCTGTTATGGCATCACGCAGCACATACCATAGATCTGTTTGCATACCAGGCAGGAAAAATTGTTACAGCAAATGCAATCCAAGGCCCGAAACATCCAGAATTAGGAATAGCAATGGACATGAGCATTCAATTAAAAAGCGAAAGCGGTGCAATTTGTACCCTGAGCCTGAGCTTCAACAATGACGGTCCGCTGGGCACCTTTTTTCGTTACATTGGTGACACCGCAACCTATATTGCACGTTATGATGATCTGGTTACCGGAAAGGAAGAACCGATTGATCTGACCGGAGTTACCGTGAGTAATAACGGCATTGAACTGCAGGATCGCGAATTTATAGCAGCAATTCGTGAGGGTCGTGAACCTAATAGCAGTGTGGCACAGGTGCTGGATTGTTATCGTGTTATTGGTGAACTGGCAGCATCATTAGAAGCACAAGATGGTTGGAGCTAA 957 <210>6 <211> 1259 <212> DNA <213> Artificial sequence (AhligAB) <400> 6 <210> 7 <211> 951 <212> DNA <213> Artificial sequence (AhligC) <400> 7 ATGAAGGTTGCCCTGGCCGGCCCGGGGGCATTTGGTATTAAACACCTGGACGCGATTGAAAAAATCGACGGCGTGGAAGTTGTTTCGCTGATTGGGCGCGACCTGGAAAAAACGAAAAAAGTGGCGGAAAAATATCATATTGGTCATACGAGTACCGAACTGGCAGACGCACTGGCACTGCCGGAAGTGGATGCAGTTATACTGTGTACCCCGACCCAAATGCATGCAGCACAGAGCATAGAATGTATGCGTGCAGGGAAGCACGTTGAAGTTGAAATTCCTCTGGCAGATAGTTGGGAAGAAGCAGAAGAAGTTCTGAAAGTTCAAAAAGAAACCGGCAAAGTGTGTATGGTTGGTCATACCCGGCGTTTTAATCCGAGCCATCAATATGTTAACAAAAAAATTCGCGCAGGTGAACTGAATATACAGCAGATGGATGTTCAGACATATTTTTTTCGCCGTACCAACACCAATGCACTGGGTGAAGCACGCTCATGGACCGATCACCTGCTGTGGCACCACGCAGCACATACCGTTGACCTGTTTCGTTACCAGGCAGGTGCAGAGATTGTTAGTGCAAATGCGCTGGAAGGTCCTAAACATCCGGAACTGGGTATAGCAATGGATATGAGCATTCAAATGAAAGCAGCAAATGGAGCAATTTGTACCTTAAGTCTGAGCTTTAACAATGATGGTCCGTTAGGTACATTTTTCCGTTATATTTGTGACAATGGTACCTACATTGCGAGATACGATGATCTGGTTAATGGTAAGGAAGAGCCGATTGATGTTAGCAAAGTTGATGTTAGCATGAATGGTATTGAACTGCAGGATCGTGAATTTTTTGCAGCAATAGCCGAAGGGCGGGAACCGAATAGCAGTGTTGCACAGGTGCTGCCTTGTTATAAAGTTCTGCATGATCTGGAACAGCAACTGAACGCAGCACAATAA 951 <210>8 <211>1317 <212> DNA <213> Artificial sequence (MoligAB) <400> 8 <210> 9 <211> 957 <212> DNA <213> Artificial sequence (MoligC) <400> 9 ATGACCGCCGGTAAAGTTCGCATTGCCGTTGTGGGGGCCGCCGGGGCATTTGGTATGAAACATCTGGATGGGCTGCGTAATATCGCAGAAGCCGAAGTGACCGTTGTGAGCGGGACCCGTCCAGAAAGCGTGCAGGCAGTTGCAGAACAGTATGGTATACCGAATGCCGTTGTGGGCTTAGATGCAGTTCTGGCAAGAGATGATGTTGATGCAGTTATTCTGGCGACCCCGACCCAACAGCATGCAGCACAGACCCAGGCAGTGTTAGCGGGTCGCAAACATGTTCAGGTGGAAATCCCGTTAGCAGATAGTCTGGCAGATGCAGAAGCAACCCTGGCCGCAGCAGAAGCAAGCGGTCGTATTGCAATGGTTGGTCATACCCGGAGATTTAATCCAAGCCATCAACTTATACATAACCGTATAGCAGCAGGTGAATTTGCAGTGCAGCAGATGGATGTTCAAACATATTTCTTTCGTCGTAGCAATACCAATGCAAAAGGTGAAGCCCGTAGCTGGACCGATCATCTGTTATGGCATCACGCAGCACATACCGTTGATTTATTCGCCTACCAGGCAGGTCGCATTGTGCAGGCAAACGCAATCCAAGGGCCGATCCATCCGGAACTGGGAATTGCCATGGACATGAGTATTCAATTAAAAGCAGAAAGCGGTGCGATCTGTACCCTGAGCTTAAGCTTTAACAATAATGGTCCGTTTGGCAGCTTTTTTCGCTATATTGGTGATAGTGAGACCTACATAGCACGGTACGATGATCTGGTTAATGGACGTGAAGAACCGATTGATGTTAGCGACGTTGCAGTCAGCACAAATGGTATTGAACTGCAGGATCGGGAGTTTGTTGCAGCAATCCTGGAAGGTCGTGAACCGAATAGCAGTATAAGACAGGTGATTGATTGTTATAGAGTATTAGGTGCACTGGAAGAGCAGCTGAGCTAA 957 <210>10 <211>88 <212> DNA <213> Artificial sequence (P2) <400>10 TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCTGAGGTGGCTTATTATTCGTTTAAACCAGGAAACAGCT 88 <210>11 <211>88 <212> DNA <213> Artificial sequence (P4) <400>11 TTATCTCTGGCGGTGTTGACAAGAGATAACAACGTTGATATAATTGAGCCCGTATTGTTAGCATGTACGTTTAAACCAGGAAACAGCT 88

Claims

1. Recombinant Escherichia coli for the production of 2-pyrone-4,6-dicarboxylic acid, characterized in that, The starting Escherichia coli is the Escherichia coli WJ060 strain with the preservation number of CGMCC No. 14602, and the recombinant Escherichia coli is obtained by the following genetic modification: In the starting Escherichia coli producing 3-dehydroshikimic acid, a foreign 3-dehydroshikimic acid dehydratase gene is overexpressed by integration, and the pyruvate formate lyase gene pflB on the genome of the WJ060 strain is replaced; wherein the 3-dehydroshikimic acid dehydratase is a protein encoded by the quiC gene on the pET30a-quiC plasmid; The protocatechuate-4,5-dioxygenase gene, which encodes a protein composed of two subunits of α and β, is overexpressed, the NCBI accession numbers of the amino acid sequences of the α and β subunits are MBO9517659.1 and MBO9517658.1 respectively, and the gene is integrated into the non-coding region between the ykgH-betA two genes on the genome of the WJ060 strain; The 4-carboxy-2-hydroxymuconate-6-semialdehyde dehydrogenase encoding gene, which encodes a protein with the NCBI accession number of MBO9517657.1, is overexpressed, and the D-lactate dehydrogenase gene ldhA on the genome of the WJ060 strain is replaced; The expression of the 3-dehydroshikimic acid dehydratase gene is up-regulated by using the regulatory element P2, which is located upstream of the start codon ATG of the 3-dehydroshikimic acid dehydratase gene, and the sequence is shown in SEQ ID NO: 10; The expression of the protocatechuate-4,5-dioxygenase gene is up-regulated by using the regulatory element P4, which is located upstream of the start codon ATG of the protocatechuate-4,5-dioxygenase gene, and the sequence is shown in SEQ ID NO: 11; The expression of the 4-carboxy-2-hydroxymuconate-6-semialdehyde dehydrogenase gene is up-regulated by using the regulatory element P4, which is located upstream of the start codon ATG of the 4-carboxy-2-hydroxymuconate-6-semialdehyde dehydrogenase gene, and the sequence is shown in SEQ ID NO: 11; A second copy of the 4-carboxy-2-hydroxymuconate-6-semialdehyde dehydrogenase gene PsligC is also integrated into the genome of the Escherichia coli; It is obtained by integrating a second copy of the 4-carboxy-2-hydroxymuconate-6-semialdehyde dehydrogenase gene PsligC between the ypjC-ileY two genes on the genome, and up-regulating the expression of PsligC by using the regulatory element P4, the sequence of PsligC is shown in SEQ ID NO: 5; and the sequence of P4 is shown in SEQ ID NO: 11, which is located upstream of the start codon ATG of PsligC.

2. The recombinant E. coli of claim 1, wherein, The nucleotide sequence of the 4-carboxy-2-hydroxymuconate-6-semialdehyde dehydrogenase gene is shown in SEQ ID NO:

5.

3. The recombinant E. coli of claim 1, wherein, The genetic modification is achieved by using gene editing technology to overexpress the foreign gene.

4. The recombinant E. coli of claim 1, wherein, The preservation number is CGMCC No. 24557.

5. The recombinant Escherichia coli of any one of claims 1-4 in the production of 2-pyrone-4,6-dicarboxylic acid.

6. A method for fermentatively producing 2-pyrone-4,6-dicarboxylic acid, comprising fermenting with the recombinant strain of any one of claims 1-4.

7. The production method according to claim 6, wherein The fermentation is carried out under aerobic conditions using inorganic salt medium with glucose as carbon source.

8. The production method according to claim 7, wherein The fermentation pH is 5-8, the fermentation temperature is 25-42 DEG C, the dissolved oxygen is 10%-50%, and 2-pyrone-4, 6-dicarboxylic acid is produced through fed-batch fermentation.

Images