Deuterated oxo-arsenical compounds and uses thereof
By introducing a deuterated group into the phenylarsine oxide compound, the problems of insufficient compound stability and half-life were solved, achieving long-term drug stability and reducing the frequency of dosing, enhancing the inhibitory activity against PI4KIIIα, and exhibiting broad therapeutic effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- NUO BETA PHARMA TECH (SHANGHAI) CO LTD
- Filing Date
- 2021-03-31
- Publication Date
- 2026-06-09
Smart Images

Figure CN115515964B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of chemical synthesis, specifically relating to a novel deuterated phenylarsine oxide compound, its preparation method, and its application. Background Technology
[0002] Phenylarsine oxide (PAO) is a known bioinhibitor, in which the arsenic atom has a high affinity for the sulfur atom of the thiol group in biomolecules. Recent studies have found that Phenylarsine oxide is a PI4KIIIα inhibitor and could be used to treat Alzheimer's disease.
[0003] Deuterium is a stable isotope of hydrogen. Compared to hydrogen, deuterium can form stronger chemical bonds, making drug molecules more stable. Human trials have shown that deuterium substitution can alter the half-life of drugs, reducing the frequency of dosing while maintaining their original activity and selectivity. Deuterated drugs have become a new direction and model for drug development. In 2017, the U.S. Food and Drug Administration approved the world's first deuterated drug, deuterated benzodiazepine (AUSTEDOTM, for the treatment of Huntington's disease and related motor dysfunction). Currently, several deuterated drugs have entered clinical trials. Summary of the Invention
[0004] In one aspect, the present invention provides a compound of formula I or a pharmaceutically acceptable salt thereof.
[0005]
[0006] Formula (I)
[0007] Among them, R 1 R 2 R 3 R 4 R 5 Independently selected from hydrogen, deuterium, halogen, methyl, monodeuterated methyl, dideuterated methyl, or trideuterated methyl, and R 1 R 2 R 3 R 4 R 5 At least one of them is deuterium or deuterated.
[0008] In one implementation, R 1 R 2 R 3 R 4 R 5 Independently selected from hydrogen or deuterium, and R 1 R 2 R 3 R 4 R 5At least one of them is deuterium, at least two are deuterium, and preferably at least three, four or five are deuterium.
[0009] In one specific embodiment, the compound is selected from the group consisting of:
[0010] , , , , , , , , , , , , , , , , , ,and .
[0011] On the other hand, the present invention discloses the use of the aforementioned compounds or pharmaceutically acceptable salts thereof in the preparation of medicaments for the prevention or treatment of diseases or pathological reactions in subjects.
[0012] In one implementation, the disease is selected from tumors, cachexia such as malignant tumors or cachexia caused by chemotherapy drugs for treating tumors, Alzheimer's disease, diseases related to intracellular protein misfolding, lysosomal storage diseases, inflammatory reactions, tissue and organ fibrosis, diseases caused by viral infections, and neurosis.
[0013] In one implementation, the subject is a human or a non-human mammal.
[0014] In one specific implementation, the tumor is selected from lymphoma, cervical cancer, liver cancer, breast cancer such as triple-negative breast cancer, lung cancer such as non-small cell lung cancer or small cell lung cancer, colorectal cancer, stomach cancer, skin cancer such as melanoma, bone cancer, osteosarcoma, myeloma, leukemia, or ovarian cancer.
[0015] In one specific implementation, the intracellular protein misfolding-related diseases are Parkinson's disease, Lewy body dementia, multiple system atrophy, inclusion body myoinflammatory disease, frontotemporal dementia, Huntington's disease, polyglutamine disease, amyotrophic lateral sclerosis, or prion disease.
[0016] In one specific implementation, the lysosomal storage disease is a sphingolipid metabolism disorder such as Gaucher disease, Niemann's disease type C, mucopolysaccharidosis, glycogen storage disease, glycoprotein storage disease, lipid storage disease, post-translational modification deficiency, intrinsic membrane protein deficiency disorder, neuronal cerebrolipofuscin deposition disease, or lysosomal-associated organelle disorder.
[0017] In one specific implementation, the inflammatory response is an increase in inflammatory factors such as TNFα or IL-6 in local tissues or systemic blood.
[0018] In one specific implementation, the organ fibrosis is selected from pulmonary fibrosis or liver fibrosis.
[0019] In one specific implementation, the virus includes coronaviruses and non-coronaviruses, preferably the coronaviruses are selected from chicken infectious bronchitis virus, porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine hemagglutinating encephalomyelitis virus, porcine delta coronavirus, canine respiratory coronavirus, mouse hepatitis virus, feline coronavirus, human coronavirus, severe acute respiratory syndrome virus, Middle East respiratory syndrome virus, or novel coronavirus; the non-coronaviruses are selected from hepatitis C virus or HIV.
[0020] In one specific implementation, the neurosis is selected from neurasthenia, anxiety disorder, depression, or mania.
[0021] In another aspect, this invention discloses the use of the aforementioned compound or a pharmaceutically acceptable salt thereof in the preparation of a medicament for the prevention or treatment of a subject's disease, further comprising administering a second agent to a subject in need of it. This invention also discloses the use of the aforementioned compound or a pharmaceutically acceptable salt thereof and a second agent in the preparation of a medicament for the prevention or treatment of a subject's disease in combination.
[0022] In one embodiment, the disease is selected from tumors, and the second reagent is a reagent for treating tumors.
[0023] In one specific implementation, the disease is selected from pulmonary fibrosis, and the second agent is an agent for treating pulmonary fibrosis, such as a vascular endothelial growth factor receptor tyrosine kinase inhibitor, preferably nintedanib.
[0024] In one specific embodiment, the second reagent is a reagent for treating tumors, wherein the reagent for treating tumors is selected from at least one of paclitaxel, gemcitabine, cyclophosphamide, and temozolomide.
[0025] In one embodiment, the aforementioned compound or its pharmaceutically acceptable salt is administered before, after, or simultaneously with the second reagent.
[0026] In another aspect, the present invention discloses a pharmaceutical composition comprising the aforementioned compound or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
[0027] In one embodiment, the pharmaceutical composition further comprises a drug for treating tumors.
[0028] In one specific implementation, the drug for treating tumors is selected from at least one of paclitaxel, gemcitabine, cyclophosphamide, and temozolomide.
[0029] In another aspect, the present invention discloses a method for preparing the compound as described above or a pharmaceutically acceptable salt thereof, comprising the following steps:
[0030]
[0031] 1) At 0℃~10℃, add concentrated hydrochloric acid and sodium nitrite aqueous solution sequentially to an aqueous solution of aniline or its salt with the structure corresponding to formula (I), and keep the temperature below 5℃;
[0032] 2) Heat the aqueous solution of sodium carbonate, arsenic trioxide and copper sulfate to 90~100℃ and then cool it down. Add the solution prepared in step 1) above to the aqueous solution, stir and filter. Add acid to the filtrate to adjust the pH value and separate the precipitated solid.
[0033] 3) The above-precipitated solid, potassium iodide, sodium bisulfite or hydrochloric acid and sulfur dioxide are stirred in methanol until the reaction is complete, and then post-processed to obtain the compound.
[0034] In one embodiment, the post-treatment in step 3) includes adjusting the pH to an appropriate value with acid or base, extracting with ethyl acetate, combining the organic phases, and evaporating to dryness.
[0035] In another aspect, the present invention discloses the use of phenylarsine oxide and its derivatives in the preparation of medicaments for the prevention or treatment of tissue and organ fibrosis, such as pulmonary fibrosis or liver fibrosis.
[0036] This invention discloses the use of phenylarsine oxide and its derivatives in the preparation of medicaments for the prevention or treatment of inflammatory responses, wherein the inflammatory response is an increase in inflammatory factors such as TNFα or IL-6 in local tissues or systemic blood.
[0037] This invention discloses the use of phenylarsine oxide and its derivatives in the preparation of medicaments for the prevention or treatment of cachexia, such as cachexia caused by malignant tumors or chemotherapy drugs for treating tumors.
[0038] This invention discloses the use of phenylarsine oxide and its derivatives in the preparation of drugs for the prevention or treatment of tumors.
[0039] In one embodiment, the phenylarsine oxide and its derivatives have the structure shown in formula (II) or a pharmaceutically acceptable salt thereof.
[0040]
[0041] Equation (II)
[0042] Among them, R 6 Each group is independently selected from (a) H, halogen, nitro, cyano, hydroxyl, amino, carbamoyl, C1-6 alkylsulfonyl, C1-6 alkyl, C1-6 cycloalkyl, C2-6 alkynyl, C2-6 alkenyl, C1-6 alkoxy, C1-6 haloalkyl, C1-6 alkylene-NH2, C1-6 alkylene-NH-C(O)H, -As(O), -N=NH, N-(C1-6 alkyl)amino, N,N-(C1-6 alkyl)2amino, -NH-C(O)H, -NH-S(O)2H, -C(O)OH, -OC(O)H, -SH, -S(O)2H, -S(O)2-NH2 or heterocyclic groups, and optionally R 7 Or R 8 Replace, where R 7 and R 8 Each group is independently selected from amino, C1-6 alkyl, C1-6 alkoxy, C1-6 haloalkyl, N-(C1-6 alkyl)amino, N-(6-12 aryl)amino, N,N-(C1-6 alkyl)2amino, C3-6 cycloalkyl, 6-12 aryl, or 3-12 heterocyclic groups, and optionally is radicalized by one or more halogens, nitro, cyano, hydroxyl, amino, carbamoyl, or -NH-C(O)-R. 10 -C(O)OR 9 6-12 membered aromatic groups, C1-6 alkyl groups, C2-6 alkynyl groups, C2-6 alkenyl groups, C1-6 alkoxy groups, C1-6 haloalkyl groups, 3-6 membered heterocyclic groups, C3-6 cycloalkyl groups, or Bn-O-substituted groups, and R 9 It is a C1-6 alkyl group, and optionally substituted with one or more halogens, nitro, cyano, hydroxyl, amino, carbamoyl, 6-12 membered aromatic group, C1-6 alkyl, C2-6 alkynyl, C2-6 alkenyl, C1-6 alkoxy, C1-6 haloalkyl, 3-6 membered heterocyclic group, C3-6 cycloalkyl, or Bn-O-, R 10 Selected from H, C1-6 alkyl, C2-6 alkynyl, C2-6 alkenyl, C1-6 alkoxy, or C1-6 haloalkyl, and / or
[0043] (b) R on two adjacent carbon atoms 6It forms a 5-12 membered cycloalkyl, aromatic, or heterocyclic group, and is optionally substituted with one or more halogens, nitro, cyano, hydroxyl, amino, carbamoyl, 6-12 membered aromatic group, C1-6 alkyl, C2-6 alkynyl, C2-6 alkenyl, C1-6 alkoxy, C1-6 haloalkyl, 3-6 membered heterocyclic group, C3-6 cycloalkyl, or Bn-O-.
[0044] Where n is an integer between 0 and 5.
[0045] In one implementation, where n is an integer from 0 to 2, the R 6 Each is independently selected from H, halogen, nitro, cyano, hydroxyl, amino, carbamoyl, C1-6 alkyl sulfone, C1-6 alkyl, C1-6 cycloalkyl, C1-6 alkoxy, C1-6 haloalkyl, -As(O), N-(C1-6 alkyl)amino, N,N-(C1-6 alkyl)2amino, -NH-C(O)H or -NH-S(O)2H, and optionally by said R 7 Or R 8 replace.
[0046] In one implementation, where n is an integer from 0 to 2, the R 6 Each is independently selected from H, halogen, nitro, cyano, hydroxyl, amino, C1-6 alkylsulfonyl, C1-6 alkyl, C1-6 cycloalkyl, C1-6 alkoxy, C1-6 haloalkyl, -As(O), -NH-C(O)H or -NH-S(O)2H, and optionally by said R 7 Or R 8 replace.
[0047] In one implementation, where n is 1 or 2, the R 6 Each element is independently selected from H, halogen, amino, C1-6 alkyl sulfone, C1-6 cycloalkyl, C1-6 alkoxy, C1-6 haloalkyl, -NH-C(O)R 7 or -NH-S(O)2R 8 , where R 7 It is a C1-6 alkyl group, optionally substituted with a 6-12 membered aromatic group, R 8 It is a 6-12-membered aromatic group, optionally substituted with a halogen, a C1-6 alkoxy group, or a C1-6 haloalkyl group.
[0048] In one implementation, the R 6 Located at the ortho and / or para positions of the -As(O) group.
[0049] In one implementation, n is 0.
[0050] In one embodiment, the compound is selected from the group consisting of:
[0051] , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , .
[0052] In one implementation, the object is a human or a mammal.
[0053] In one embodiment, the tumor is selected from lymphoma, cervical cancer, liver cancer, breast cancer such as triple-negative breast cancer, lung cancer such as non-small cell lung cancer or small cell lung cancer, colorectal cancer, stomach cancer, skin cancer such as melanoma, bone cancer, osteosarcoma, myeloma, leukemia, or ovarian cancer.
[0054] In one embodiment, it further includes administering a second reagent to the object in need, preferably the second reagent being a reagent for treating tumors.
[0055] In one embodiment, the second reagent is a reagent for treating tumors.
[0056] In one embodiment, the compound is applied before, after, or simultaneously with the second reagent.
[0057] In one embodiment, the agent for treating tumors is selected from at least one of paclitaxel, gemcitabine, cyclophosphamide, and temozolomide.
[0058] This method further discloses a method for screening drugs for the prevention or treatment of diseases, including contacting candidate drugs with PI4KIIIα protein or nucleic acid or PI4KIIIα, and detecting whether the candidate drugs can inhibit the formation or activity of PI4KIIIα, wherein the disease is selected from tissue or organ fibrosis, inflammatory response, cachexia, and tumor.
[0059] In one implementation, organ fibrosis is selected from pulmonary fibrosis or liver fibrosis.
[0060] In one embodiment, the inflammatory response is an increase in inflammatory factors such as TNFα or IL-6 in local tissues or systemic blood.
[0061] In one embodiment, the tumor is selected from lymphoma, cervical cancer, liver cancer, breast cancer such as triple-negative breast cancer, lung cancer such as non-small cell lung cancer or small cell lung cancer, colorectal cancer, stomach cancer, skin cancer such as melanoma, bone cancer, osteosarcoma, myeloma, leukemia, or ovarian cancer. Attached Figure Description
[0062] Figure 1 The pharmacokinetic time-p-time curves are shown for a single intravenous injection of 0.1 mg / Kg PAO or d5PAO in male SD rats.
[0063] Figure 2 The pharmacokinetic curves for a single oral gavage of 0.2 mg / kg PAO or d5PAO in male SD rats are shown.
[0064] Figure 3 The vector map of the α-synuclein overexpression plasmid is shown.
[0065] Figure 4 The standard preparation diagram for α-synuclein ELISA detection is shown.
[0066] Figure 5 The results showed that d5PAO and PAO inhibited apoptosis in SH-sy5y cells, among which... Figure 5 A shows the effect of MTT assay on the viability of SH-sy5y cells at certain concentrations of d5PAO and PAO, n=5, mean±SEM, one-way ANOVA, ***p<0.0001 vs. Ctrl+, ###p<0.0001 vs. ctrl; Figure 5 B shows that propidium iodide (PI) was added to the culture medium and incubated for 15 minutes before Ki67 immunofluorescence staining was performed.
[0067] Figure 6 The results showed that d5PAO and PAO enhanced the viability of stable APP (SW) HEK293 cells and promoted Aβ release, among which... Figure 6 A shows the effect of MTT assay on the viability of stable APP (SW) HEK293 cells at certain concentrations of d5PAO and PAO, n=5, mean±SEM, one-way ANOVA, **p<0.001, ***p<0.0001. vs. ctrl; Figure 6 B shows the Aβ content in the supernatant detected by the ELISA kit, and the Aβ value of each group is calculated by the standard curve. Figure 6 C shows the data normalization process, with Ctrl set to 1, calculating the multiples of change in Aβ content for each group, n=3, mean±SEM, One-way ANOVA, *p<0.03, **p<0.001, ***p<0.0001 vs. ctrl.
[0068] Figure 7 The structural formulas of PAO deuterated compounds and their effects on promoting Aβ release are shown. Figure 7 A shows the Aβ content in the supernatant detected by the ELISA kit, and the Aβ values of each group are calculated using a standard curve. Figure 7 B shows the data normalization process, with Ctrl set to 1, calculating the multiples of change in Aβ content for each group, n=3, mean±SEM, One-way ANOVA, *p<0.03, **p<0.001, ***p<0.0001 vs. ctrl. Compared with the 50 nM d5PAO treatment group, ##p<0.001, ###p<0.0001.
[0069] Figure 8 The results showed that d5PAO and PAO reduced the damaging effects of α-synuclein overexpression on SH-sy5y cells and promoted α-synuclein release. Figure 8 A shows the effect of MTT assay on cell viability of transiently transfected α-synuclein cells at certain concentrations of d5PAO and PAO, n=5, mean±SEM, one-way ANOVA, *p<0.03, **p<0.001, ***p<0.0001. vs. ctrl; Figure 8 B shows the α-synuclein content in the supernatant detected by the ELISA kit, and the α-synuclein values of each group were calculated using a standard curve. n=3, mean±SEM, One-way ANOVA, *p<0.03 vs. ctrl; Figure 8 C shows the normalized data, with the α-syn OE group as 1, and the multiples of change in α-synuclein content for each group calculated. n=3, mean±SEM, One-way ANOVA, *p<0.03 vs. ctrl.
[0070] Figure 9 This study demonstrates that d5PAO and PAO play a protective role in the SH-SY5Y cell model constructed by CBE. Figure 9 A shows that SH-SY5Y cells were treated with CBE for 48 hours, and cell viability was detected by MTT assay. Figure 9B shows that SH-SY5Y cells were treated with 100 μM CBE for 24 hours, starved (high glucose DMEM without FBS) and treated with 100 μM CBE for 24 hours, and then treated with different concentrations of PAO for 24 hours. Cell viability was detected by MTT assay. Figure 9 C shows SH-SY5Y cells treated with 100 μM CBE for 24 hours, followed by starvation (high glucose DMEM without FBS) and co-treatment with 100 μM CBE for 24 hours, and then treatment with different concentrations of d5PAO and PAO for 24 hours. Cell viability was assessed by MTT assay. n=5. Data are expressed as mean ± SEM. Compared with the control group, ###p<0.0001; compared with the 100 μM CBE treatment group, **p<0.001, ***p<0.0001 vs. 100 μM CBE.
[0071] Figure 10 This study showed that PAO inhibits CBE-induced lysosomal and GlcCer accumulation and promotes GlcCer efflux. Figure 10 A shows that SH-SY5Y cells were co-incubated with lysosome trackers for 30 minutes, then the supernatant was aspirated and replaced with PAO containing different concentrations and incubated for 10 minutes. Lyso-trackers were observed by immunofluorescence. Figure 10 B shows the statistical analysis of Lyso-tracker fluorescence intensity in each group; scale bar: 50 μm; n=5; One-way ANOVA analysis, compared with the control group, ##p<0.001, compared with the 100 μM CBE treatment group, **p<0.001, ***p<0.0001; Figure 10 C shows the statistical analysis of GlcCer concentration in cell lysates of each group as determined by LC / MS. Figure 10 D shows the statistical analysis of the GlcCer concentration in the cell culture supernatant of each group by LC / MS measurement.
[0072] Figure 11 Showing knockdown PI4Ka It promotes a reduction in lysosomal storage. Figure 11 A shows the Western blot detection of different shRNA-interfered lentiviral vectors (sh-ctrl, sh1-). PI4Ka, sh2- PI4Ka, sh3- PI4Ka Treatment of SH-SY5Y cells for 48 hours to determine PI4KⅢα protein levels; Figure 11 B. Statistical analysis of Western blot results; Figure 11C shows the immunofluorescence method for detecting the fluorescence intensity of the Lyso-tracker after treatment with shRNA-interfered lentiviral vector, and the statistical analysis. Figure 11 D). Scale bar: 50 μm; n=5; data are expressed as mean ± SEM, one-way ANOVA analysis, ***p<0.0001.
[0073] Figure 12 The pGMLV-SC5 RNAi vector map is shown.
[0074] Figure 13 The image shows a bright-field plot of MRC-5 cells after 24 hours of treatment. MRC-5 cells were cultured for 24 hours in MEM medium (FBS-free) containing 5 ng / mL TGF-β1, with different concentrations of PAO or d5PAO added simultaneously according to the cell group. Scale bar: 50 μm.
[0075] Figure 14 This study demonstrates that d5PAO and PAO inhibit the expression of α-SMA and Calponin1 in MRC-5 model cells. Figure 14 A shows the expression levels of α-SMA and Calponin1 detected by Western blotting. Figure 14 B shows the statistical analysis results of α-SMA expression levels in each group. Figure 14 C shows the statistical analysis results of Calponin1 expression levels in each group. ImageJ software was used to analyze protein signal intensity, with the signal intensity of the ctrl group as 1, n=3. One-way ANOVA was used, and data are expressed as mean ± SEM. Compared with the 5 ng / mL TGF-β1 treatment group, *p<0.03, **p<0.001, ***p<0.0001, and #p<0.03 compared with the ctrl group.
[0076] Figure 15 This study demonstrates that d5PAO and PAO inhibit the expression of α-SMA and Calponin1 in MRC-5 model cells. Figure 15 A shows the immunofluorescence images of α-SMA in each group. Red: α-SMA, Blue: DAPI (nucleus). Scale bar: 50 μm. Figure 15 B shows the immunofluorescence images of Calponin1 in each group. Red: Calponin1, Blue: DAPI (nucleus). Scale bar: 50 μm. Figure 15 C, Figure 15D shows the statistical analysis of α-SMA and Calponin1 immunofluorescence intensity. With the mean value of the ctrl group as 1 and n=5, one-way ANOVA was used. Data are expressed as mean ± SEM. Compared with the 5 ng / mL TGF-β1 treatment group, *p<0.03, **p<0.001, ***p<0.0001; compared with the ctrl group, ###p<0.0001.
[0077] Figure 16 This shows that d5PAO and PAO regulate Calponin1 expression in MSCs, where Figure 16 A shows the immunofluorescence images of Calponin1 in each group. Red: Calponin1, blue: DAPI (nucleus). Scale bar: 50 μm; Figure 16 B shows the statistical analysis of Calponin1 immunofluorescence intensity. One-way ANOVA was used for n=4, and data are expressed as mean ± SEM.
[0078] Figure 17 This demonstrates that d5PAO and PAO inhibit COL1 secretion during MRC-5 cell fibrosis. Figure 17 A shows the concentration of COL1 in the supernatant of each group detected by ELISA, n=6, and the data are expressed as mean±SEM. Figure 17 B shows the statistical analysis of COL1 concentration in the supernatant of each group with the mean of the ctrl group as 1. The data are expressed as mean ± SEM. Compared with the 5 ng / mL TGF-β1 treatment group, *p<0.03, **p<0.001, ***p<0.0001, and #p<0.0001 compared with the ctrl group.
[0079] Figure 18 The results showed that shRNA interference with lentiviral vectors reduced PI4KⅢα expression. The shRNA interference lentiviral vectors were co-incubated with MRC-5 cells for 48 hours, and the proteins were collected for Western blotting experiments. Figure 18 A shows the detection of PI4KⅢα protein; Figure 18 B shows the data analysis using ImageJ software, with the sh-ctrl group set to 1 for normalization, n=3, and the data expressed as mean ± SEM. The comparison with the sh-ctrl group shows p<0.0001.
[0080] Figure 19 Showing knockdown PI4KaCalponin1 and α-SMA expression was inhibited in TGF-β1-treated MRC-5 cells. MRC-5 cells were cultured for 24 hours after adhesion, with different sequences of lentiviral vectors added. Cells were then treated with 5 ng / mTGF-β1 or without adding the vector for 24 hours, and immunofluorescence staining was performed for observation. Figure 19 A shows the immunofluorescence staining of α-SMA in each group. Red: α-SMA, blue: DAPI (nucleus), green: green fluorescent protein GFP. Scale bar: 50 μm. Figure 19 B shows the Calponin1 immunofluorescence staining for each group. Red: Calponin1, blue: DAPI (nucleus), green: green fluorescent protein GFP. Scale bar: 50 μm. α-SMA ( Figure 19 C) Statistical analysis of the immunofluorescence intensity of Calponin1 was performed, with the mean value of the sh-ctrl group as 1 for normalization. n=5. Data are expressed as mean ± SEM. Compared with the sh-ctrl plus 5 ng / mL TGF-β1 co-treatment group, *p<0.03, ***p<0.0001. Compared with the sh-ctrl group, ##p<0.001, ###p<0.0001.
[0081] Figure 20 This study demonstrates that d5PAO and PAO inhibit the secretion of IL-6 and TNF-α in a BV2 cell inflammation model. Figure 20 A shows the TNF-α concentration in BV2 cell supernatant detected by ELISA, and the TNF-α content (pg / mL) was calculated based on the standard curve. Figure 20 B shows the calculation of the relative concentration changes of TNF-α in each group, with the average concentration of the Ctrl group set to 1. Figure 20 C shows the concentration of IL-6 in the supernatant of BV2 cells detected by ELISA, and the IL-6 content (pg / mL) was calculated according to the standard curve. Figure 20 D shows the relative concentration changes of IL-6 in each group, with the average concentration of the ctrl group as 1. n=3, one-way ANOVA was used, and the data are expressed as mean ± SEM. Compared with the 1 μg / mL LPS treatment group, *p<0.03, **p<0.001, ***p<0.0001, and compared with the ctrl group, #p<0.03, ##p<0.001.
[0082] Figure 21 This demonstrates the inhibitory effect of PAO on breast cancer.
[0083] Figure 22 This demonstrates the inhibitory effect of PAO on lymphoma.
[0084] Figure 23This demonstrates the inhibitory effect of d5PAO on melanoma.
[0085] Figure 24 This study demonstrates the inhibitory effect of d5PAO on melanoma on day 28 of treatment.
[0086] Figure 25 The effects of high-dose PAO and d5PAO gavage on mouse body weight and survival rate are shown.
[0087] Figure 26 The effect of PAO on body weight in a mouse model of breast cancer is shown.
[0088] Figure 27 The effect of PAO on body weight in a pancreatic cancer model is shown.
[0089] Figure 28 The effect of PAO on the body weight of lymphoma model animals is shown.
[0090] Figure 29 The effect of d5PAO combination therapy on body weight in melanoma mice is shown.
[0091] Figure 30 The inhibitory effects of PAO and d5PAO on HCoV 229E (influenza coronavirus) are shown.
[0092] Figure 31 The study showed the anxiolytic effects of PAO and d5PAO, with d5PAO exhibiting a more significant anxiolytic effect than PAO.
[0093] Figure 32 The results showed that both PAO and d5PAO have antidepressant effects, with d5PAO exhibiting a more significant and stable antidepressant effect than PAO.
[0094] Figure 33 This shows that d5PAO and PAO inhibit cholesterol accumulation induced by U18666A. Scale bar: 50 μm.
[0095] Figure 34 The study showed that PAO promotes LC3B and p62 expression, while Baf-A1 blocks the protective effect of PAO in cell models. Figure 34 A shows the detection of LC3B and p62 proteins using a Western blot assay. Figure 34 B, Figure 34 C shows the statistical analysis of LC3B and p62 protein signal intensity using ImageJ software; Figure 34 D shows the immunofluorescence detection of LC3B and p62, red: p62, green: LC3B, scale bar: 50 μm; Figure 34E shows the cell viability of each group as determined by MTT assay, and statistical analysis was performed. n=5, data are expressed as mean ± SEM, one-way ANOVA analysis, compared with the control group ###p<0.0001, compared with the 100 μM CBE treatment group **p<0.001.
[0096] Figure 35 Showing knockdown PI4Ka Activate ALP, in which Figure 35 A, Figure 35 B shows the LC3B protein level detected by Western blot after 48 hours of treatment of SH-SY5Y cells with different shRNA-interfering lentiviral vectors (sh-ctrl, h1-PI4Ka, sh2-PI4Ka, sh3-PI4Ka), and the statistical analysis. Figure 35 C, Figure 35 D shows that shRNA interfered with lentiviral vector transfection and was simultaneously treated with CBE, incubated for 48 hours, and LC3B protein levels were detected and statistically analyzed. n=3; data are expressed as mean ± SEM, one-way ANOVA analysis, compared with sh-ctrl *p<0.03.
[0097] Figure 36 The figure shows the percentage of Penh, the enhanced expiratory interval value induced by methacholine, relative to baseline.
[0098] Figure 37 The total counts of eosinophils, macrophages, neutrophils, and lymphocytes in bronchoalveolar lavage fluid (BALF) are shown. T. Test, single-tailed, *<0.5, **<0.1, are the ratios to the total cell count in the model group.
[0099] Figure 38 The counts of eosinophils, macrophages, neutrophils, and lymphocytes in bronchoalveolar lavage fluid (BALF) are shown separately. T. Test, single-tailed, *<0.5, **<0.1. Comparison with BALF from the model group.
[0100] Figure 39 The table shows the plasma collagen type I content, normal group (ctrl).
[0101] Figure 40 The comparison shows the effect of PAO and dPAO on downregulating plasma hyaluronic acid in mice with pulmonary fibrosis compared with the positive control drug nintedanib, and the normal group (ctrl). Detailed Implementation
[0102] The present invention will now be described in detail with reference to embodiments and the accompanying drawings. The above and other aspects of the invention will become apparent from the following detailed description. The scope of the invention is not limited to the following embodiments.
[0103] The term “compound” as used herein is intended to include all stereoisomers (e.g., enantiomers and diastereomers), geometric isomers, tautomers, and isotopes of the structures shown.
[0104] According to another aspect of the invention, the present invention relates to deuterated phenylarsenic oxide, preferably a fully benzene-ring-substituted deuterated isotope.
[0105] The compounds described herein may be asymmetric (e.g., having one or more stereocenters). Unless otherwise specified, all stereoisomers, such as enantiomers and diastereomers, are intended to be included. Various geometric isomers, such as alkenes and carbon-carbon double bonds, may also exist in the compounds described herein, and all such stable isomers have been considered herein. Cis and trans geometric isomers of the compounds are described herein, and they can be isolated as mixtures of isomers or as individual isomers.
[0106] The compounds described in this article also include tautomers. Tautomers are formed by the exchange of a single bond with an adjacent double bond, accompanied by a proton migration. Tautomers include proton tautomers with isoprotonated states having the same chemical formula and total charge. Examples of proton tautomers include keto-enol pairs, amide-imine pairs, lactam-lactamimide pairs, enamine-imide pairs, and cyclic forms, where the proton can occupy two or more positions in a heterocyclic system, such as 1H- and 3H-imidazolium, 1H-, 2H- and 4H-1,2,4-triazole, 1H- and 2H-isoindole, and 1H- and 2H-pyrazole. Tautomers can be balanced or sterically locked into one form through suitable substitution.
[0107] In some embodiments, the small molecule compounds described herein can be obtained by organic synthesis. The compounds described herein can be prepared using any known organic synthetic technique and can be synthesized according to a variety of possible synthetic routes, including their salts, esters, hydrates, or solvates.
[0108] The term "phenylarsine oxide" (PAO) used in this article refers to a small molecule compound with the following specific chemical structure:
[0109] .
[0110] Diseases related to intracellular protein misfolding
[0111] The term "intracellular protein misfolding-related diseases" as used in this article refers to diseases characterized by the aggregation of abnormally folded proteins within the cytoplasm, also diagnosed as aggregation, accumulation, or misfolding diseases. Furthermore, the term "intracellular protein misfolding-related diseases" also includes some intracellular inclusion body disorders, such as protein inclusion body accumulation diseases. These inclusion bodies are primarily composed of a core protein aggregated due to folding errors, surrounded by various stress proteins involved in responding to unfolded proteins.
[0112] Intracellular protein misfolding-related diseases include, but are not limited to, Parkinson's disease (PD), Lewy body dementia (LBD), multiple system atrophy (MSA), inclusion body myoinflammatory disease (IBM), frontotemporal dementia (FTD), Huntington's disease (HD), polyglutamine disease (PolyQ), amyotrophic lateral sclerosis (ALS), and prion diseases.
[0113] Lysosomal storage disease
[0114] The term "lysosomal storage disease" as used in this article refers to diseases caused by the accumulation of endogenous or exogenous substances in lysosomes due to various reasons. These include, but are not limited to, lysosomal functional defects caused by insufficient enzyme activity, lack of activating proteins, transport proteins, or lysosomal protein processing and correction enzymes in lysosomes, resulting in the inability to digest corresponding substrates in secondary lysosomes, substrate accumulation, metabolic disorders, and the formation of storage diseases.
[0115] Lysosomal storage disorders include, but are not limited to, sphingolipid metabolism disorders, mucopolysaccharidosis, glycogen storage disorders, glycoprotein storage disorders, lipid storage disorders, post-translational modification defects, intrinsic membrane protein loss disorders, neuronal cerebrolipofuscin deposition disorders, or lysosomal-related organelle disorders. Among these, sphingolipid metabolism disorders include, but are not limited to, Fabry disease, metabolic skin disorders (Farbe disease), Gaucher disease types I, II, III and prenatal death type, GM1 ganglioside deposition diseases types I, II, III, GM2 ganglioside deposition diseases (familial amaurotic idiocy), GM2 ganglioside deposition diseases, globular leukodystrophy (Clapey's disease), metachromatic leukodystrophy, Niemann-Pick disease types A and B; mucopolysaccharidosis includes, but is not limited to, Haller-Sch'é syndrome and Sch'é syndrome (ML I), Hunter syndrome (MPS II), St. Philippian disease A (MPS IIIA), St. Philippian disease B (MPS IIIB), St. Philippian disease C (MPS IIIC), St. Philippian disease D (MPS IIID), centrifugal chondrodysplasia syndrome (MPS IVA), centrifugal chondrodysplasia syndrome (MPS IVB), and mucopolysaccharidosis type VI (Lami syndrome, MPS VI), Sly disease (MPS VII), MPS IX; Glycogen storage diseases including but not limited to the rare disease Ponzi scheme (GSD II); Glycoprotein storage diseases including but not limited to α-manninoside storage disease, β-manninoside storage disease, fucoside storage disease, asparagine glucosamineuria, Schindler disease type I (infantile axonal dystrophy), Schindler disease type II (Kanzaki disease), Schindler disease type III (moderate severity), sialic acid storage disease type I (cherry red dot myoclonus syndrome), sialic acid storage disease type II (mucopolysaccharidosis I), galactosylsialic acid storage disease; Lipid storage diseases including but not limited to acid lipase deficiencies such as Wolman's disease. Diseases and cholesterol ester deposition diseases; post-translational modification defects including but not limited to multiple sulfatase deficiency, mucolipidemia IIα / β (I-cell syndrome), mucolipidemia IIα / β (pseudo-Heller syndrome), mucolipidemia IIIγ (pseudo-Heller syndrome variant); intrinsic membrane protein deficiency disorders including but not limited to hypercystinemia, Danon's disease, myoclonic renal failure syndrome, sialic acid storage diseases such as ISSD, Sala disease and moderate severe Sala disease, Niemann-Pick disease C1 and C2, and mucolipidemia IV;Neuronal ceroid lipofuscin deposition diseases include, but are not limited to, neuronal ceroid lipofuscin deposition disease type 1 (Haltia-Santavuori disease and INCL), neuronal ceroid lipofuscin deposition disease type 2 (Jansky-Bielschowsky disease), neuronal ceroid lipofuscin deposition disease type 3 (Batten-Spielmeyer-Sjogren disease), and neuronal ceroid lipofuscin deposition disease type 4 (Parry disease and Kufs disease). (Classes A and B), Ceramide Lipoproteinosis Type 5 (Late Infant Finnish Aberration), Ceramide Lipoproteinosis Type 6 (Lake-Cavanagh or Indian Aberration), Ceramide Lipoproteinosis Type 7 (Turkish Aberration), Ceramide Lipoproteinosis Type 8 (Northern Epilepsy, Epilepsy with Intellectual Disorder), Ceramide Lipoproteinosis Type 9, Ceramide Lipoproteinosis Type 10, Ceramide Lipoproteinosis Type 11, Ceramide Lipoproteinosis Type 12, Ceramide Lipoproteinosis Type 13, Ceramide Lipoproteinosis Type 14; Lysosomal-associated organelle disorders including but not limited to Hermansky-Pudlak disease type 1, Hermansky-Pudlak disease type 2, Hermansky-Pudlak disease type 3, Hermansky-Pudlak disease type 4, Hermansky-Pudlak disease type 5, ... Hermansky-Pudlak disease type 2, Hermansky-Pudlak disease type 3, Hermansky-Pudlak disease type 4, Hermansky-Pudlak disease type 5, Hermansky-Pudlak disease type 6, Hermansky-Pudlak disease type 7, Hermansky-Pudlak disease type 8, Hermansky-Pudlak disease type 9, Griscelli syndrome 1 (Elejalde syndrome), Griscelli syndrome 2, Chédiak–Higashi disease.
[0116] Drug administration and medicinal use
[0117] As used herein, the term "pharmaceutically acceptable" refers to compounds, materials, compositions, and / or dosage forms that, to a reasonable extent of medical judgment, are suitable for use in contact with tissues of humans and animals without excessive toxicity, irritation, allergic reactions, or other problems or complications, and have a reasonable benefit / risk ratio. In some embodiments, pharmaceutically acceptable compounds, materials, compositions, and / or dosage forms refer to those approved by regulatory authorities (such as the U.S. Food and Drug Administration, the China Food and Drug Administration, or the European Medicines Agency) or listed in generally accepted pharmacopoeias (such as the United States Pharmacopeia, the Chinese Pharmacopoeia, or the European Pharmacopoeia) for use in animals (more particularly for humans).
[0118] The term "object" as used in this document can include humans and non-human animals. Non-human animals include all vertebrates, such as mammals and non-mammals. An "object" can also be a domestic animal (e.g., a cow, pig, sheep, chicken, rabbit, or horse), or a rodent (e.g., a rat or mouse), or a primate (e.g., a gorilla or monkey), or a domesticated animal (e.g., a dog or cat). An "object" can be male or female, or at different ages. A human "object" can be elderly, adult, adolescent, child, or infant.
[0119] In some implementations, the subject described herein is a human or a non-human primate.
[0120] The deuterated phenylarsine oxide disclosed herein can be administered via routes of administration known in the art, such as injection (e.g., subcutaneous injection, intraperitoneal injection, intravenous injection (including intravenous infusion or drip), intramuscular injection, or intradermal injection) or non-injection administration (e.g., oral administration, nasal administration, sublingual administration, rectal administration, or topical administration). In some embodiments, the deuterated phenylarsine oxide described herein is administered orally, subcutaneously, intramuscularly, or intravenously. In some embodiments, the deuterated phenylarsine oxide described herein is administered orally.
[0121] As used herein, the term "therapeuticly effective amount" refers to an amount of medication that can alleviate or eliminate a disease or symptom in a subject, or that can preventively inhibit or prevent the occurrence of a disease or symptom. A therapeutically effective amount can be an amount of medication that alleviates one or more diseases or symptoms in a subject to a certain degree; an amount of medication that can partially or completely restore one or more physiological or biochemical parameters related to the cause of a disease or symptom to normal; and / or an amount of medication that can reduce the likelihood of the occurrence of a disease or symptom. In some embodiments, the term "therapeuticly effective amount" as used herein refers to an amount of medication that can alleviate or eliminate diseases or lysosomal storage diseases related to intracellular protein misfolding in a subject.
[0122] The therapeutically effective dose of deuterated phenylarsine oxide provided herein depends on a number of factors known in the art, such as weight, age, medical history, current treatment, the subject's health status and the strength of drug interactions, allergies, hypersensitivity and side effects, as well as the route of administration and the degree of disease progression. Those skilled in the art (e.g., physicians or veterinarians) may adjust the dose accordingly based on these or other conditions or requirements.
[0123] In some implementations, the treatment further includes administering a second agent to the recipient.
[0124] In some implementations, the second reagent is a reagent for treating diseases related to intracellular protein misfolding, including but not limited to levodopa and riluzole.
[0125] In some embodiments, the deuterated phenylarsine oxide is applied before, after, or simultaneously with the second reagent.
[0126] This application also relates to methods for preventing or treating diseases related to intracellular protein misfolding, including administering an effective amount of deuterated phenylarsine oxide to a subject in need of it.
[0127] This application also relates to methods for the prevention or treatment of lysosomal storage diseases, including administering an effective amount of deuterated phenylarsine oxide to a subject in need of it.
[0128] Example 1. Synthesis and physical properties of the compound
[0129] 1. Synthesis and physical properties of d5PAO (pentadeuterated phenylarsine oxide)
[0130] Synthesis of 1.1d5PAO
[0131] The synthetic route for d5PAO is as follows:
[0132]
[0133] Step 1: Synthesis of d5-PA:
[0134]
[0135] Add 91.35 mL of water and 18.27 g of d5-Aniline to a three-necked flask, stir, and cool to 0℃~10℃. Add 37.45 mL of concentrated hydrochloric acid dropwise. After the hydrochloric acid addition is complete, add an aqueous solution of sodium nitrite (13.43 g of solid sodium nitrite dissolved in 36.5 mL of water), maintaining the temperature below 5℃. After the addition is complete, keep the solution at this temperature for approximately 2-3 hours. This completes the preparation of the diazonium salt.
[0136] In another container, add 274 mL of purified water, 69.06 g of sodium carbonate, 36.82 g of arsenic trioxide, and 2.83 g of copper sulfate pentahydrate (CuSO4·5H2O). Heat to 90-100°C and stir for 30 minutes, then cool to 5-15°C. Slowly add the prepared diazonium salt in batches, keeping the temperature below 15°C. Stir for 2-3 hours, then allow to rise naturally to room temperature and stir overnight. Filter, and rinse the filter cake with water. Combine the filtrates, and slowly add concentrated hydrochloric acid to adjust the pH to 3.0, resulting in the precipitation of a small amount of brown flocculent matter. Filter under vacuum. Wash the filtrate three times with 100 mL of ethyl acetate. Concentrate the aqueous phase under reduced pressure at 50-60°C to approximately 170 mL, resulting in the precipitation of a large amount of white solid. The mixture was filtered, the filter cake was rinsed with cold water, dried, and then directly dried in a forced-air oven at 50 degrees Celsius for 18 hours to obtain 35 g of off-white solid d5-PA, yield: 90.83%, MS ES+ (m / z): 208.0 [(M+H)]. + ].
[0137] Step 2: Synthesis of d5-PAO:
[0138]
[0139] Add 400 mL of purified water, 25 g of d5-PA, 75.4 g of sodium bisulfite, 0.32 g of potassium iodide, and 125 mL of methanol to a three-necked flask and start stirring. React overnight at 30–40 °C until the reactants are almost completely reacted, then stop the reaction. Keep the temperature of this solution below 30 °C and adjust the pH to 7.0 with concentrated hydrochloric acid. Extract four times with ethyl acetate, and combine the organic phases after extraction. Concentrate to dryness at 35–45 °C to obtain 20 g of white solid wet product. Reflux the solid with 240 mL of tert-butyl methyl ether for 1 hour, cool, filter, and wash the filter cake with cold MTBE. Dry the filter cake overnight in a forced-air oven at 50 °C to obtain 8.7 g of white solid d5PAO. 13 C-NMR (δ, DMSO-d6): 149.9, 129.6, 129.4, 128.2, MS ES+ (m / z): 173.99[(M+H) + ].
[0140] 1.2d5PAO physicochemical properties
[0141] 1.2.1 Instruments
[0142] An Agilent 1260 Prime high-performance liquid chromatograph, a Mettler Toledo XS105 balance (0.01 mg), a KQ5200B ultrasonic instrument (Kunshan Ultrasonic Instrument Co., Ltd.), a BR2000-GM variable speed oscillator (VWR International), and a 0.45 μm filter membrane (Shanghai Qingyang Biotechnology Co., Ltd.) were used.
[0143] 1.2.2 Experimental Drugs
[0144] d5PAO (purity 97.9%), acetonitrile was chromatographic grade (Sinopharm Chemical Reagent Co., Ltd.), hydrochloric acid and DMSO were analytical grade (Sinopharm Chemical Reagent Co., Ltd.).
[0145] 1.2.3 Solution Preparation
[0146] Take 2 mL of 0.1 M hydrochloric acid solution, add deionized water to dilute to 20 mL to obtain 0.01 M hydrochloric acid solution, and measure pH2 using precision pH test paper.
[0147] Take 2 mL of 0.01 M hydrochloric acid solution and dilute it with deionized water to 20 mL to obtain 0.001 M hydrochloric acid solution.
[0148] Take 2 mL of 0.001 M hydrochloric acid solution and dilute it with deionized water to 20 mL to obtain a 0.0001 M hydrochloric acid solution. The pH of this solution is determined to be 4 using precision pH paper.
[0149] Take 20 mL of deionized water and measure the pH to be 6.
[0150] Take 7.5 mg of d5PAO and place it in a centrifuge tube. Add 1 mL of DMSO and sonicate to dissolve. Dilute to 10 mL with an acetonitrile / water (1 / 1) mixture to obtain a 0.75 mg / mL d5PAO stock solution. Dilute the d5PAO stock solution to prepare different d5PAO working solutions with concentrations of 0.3 mg / mL, 0.15 mg / mL, 0.075 mg / mL, 0.03 mg / mL, and 0.015 mg / mL.
[0151] 1.2.4 Chromatographic conditions
[0152] Liquid Chromatography System: Agilent 1260 Infinity II Prime Ultra-High Performance Liquid Chromatography System.
[0153] Column: ACQUITY UPLC® Peptide C18 130Å 2.1*100 mm ID., 1.7 μm (Waters).
[0154] Mobile phase A: Water: ACN (v:v, 95:5) solution containing 0.01% AA and 2 mmol / L NH4OAc.
[0155] Mobile phase B: Water: ACN (v:v, 5:95) solution containing 0.01% AA and 2 mmol / L NH4OAc.
[0156] Elution gradient:
[0157]
[0158] Column temperature: 40°C
[0159] Injection volume: 4 μL
[0160] Detection wavelength: 254 nm
[0161] 1.2.5 Methodological Examination
[0162] Examination of linear relationships
[0163] Take different d5PAO solutions with concentrations of 0.75 mg / mL, 0.3 mg / mL, 0.15 mg / mL, 0.075 mg / mL, 0.03 mg / mL, and 0.015 mg / mL; inject and determine the chromatograms according to the above chromatographic conditions. Perform linear regression on peak area against injection concentration to obtain the regression equation:
[0164] y = 1647.7x + 0.9623, R² = 0.9999
[0165] The results showed that the peak area had a good linear relationship between the d5PAO injection concentration and the peak area in the range of 0.015~0.75 mg·mL⁻¹.
[0166] 1.2.6 Determination of equilibrium solubility
[0167] Take 2 mL of each of the different pH buffer solutions and place them in separate 3 mL centrifuge tubes. Add excess d5PAO powder until a large amount of white insoluble precipitate appears in the solution. Sonicate for 30 minutes, place in a constant temperature shaker, shake at 25℃ for 24 h, sonicate for another 30 minutes, filter through a 0.45 μm filter membrane, take the filtrate, dilute 10 times with water, and inject for determination under the above chromatographic conditions. Record the chromatogram and calculate the solubility of d5PAO in different pH buffer solutions as 5.36 mg / mL, 5.39 mg / mL, and 5.98 mg / mL, respectively.
[0168] Table 1. Solubility of d5PAO
[0169]
[0170] 2. Synthesis and physical properties of PAO
[0171] 2.1 Synthesis of PAO
[0172] Synthesis route:
[0173]
[0174] first step:
[0175]
[0176] In a 250 mL single-necked flask, add aniline (10.0 g, 107 mmol, 1.0 eq.) and acetone (20 mL). Cool to approximately -15 °C (higher temperatures will result in a darker product color), and slowly add 48% HBF4 (30 mL, 29.5 g, 161 mmol, 1.5 eq.). Dissolve NaNO2 (11.0 g, 161 mmol, 1.5 eq.) in 20 mL of H2O and slowly add it dropwise to the above solution. After the addition is complete, incubate at -15 °C for 2 hours, then stir the reaction at 0 °C for approximately 1 hour. Filter the solid (white) and wash with isopropyl ether (50 mL × 2). Vacuum dry the product (30 °C), weighing 17.5 g, yield: 85%, a pink solid. Use directly for the next reaction.
[0177] Step Two:
[0178]
[0179] In a 250 mL flask, add Na₂CO₃ (21.2 g, 200.6 mmol, 3.85 eq.), As₂O₃ (11.3 g, 57.3 mmol, 1.1 eq.), CuSO₄⁻⁵H₂O (800 mg, 3.13 mol, 0.06 eq.), and H₂O (60 mL). Heat the suspension to 90°C. o Keep it at around 0°C for about 20 minutes to dissolve most of the solid. Cool to 0°C. o C-15 oAt approximately °C, a suspension of azobenzene fluoroborate (10.0 g, 52.1 mmol, 1.0 eq.) and H2O (60 mL) was slowly added in batches, with a small amount of acetone added to reduce foam aggregation. After the addition was complete, the mixture was stirred at room temperature for approximately 12 hours. Diatomaceous earth was spread on the mixture, and it was filtered and washed with H2O (20 mL × 3). If the filtrate was too dark, activated carbon was added for decolorization, followed by filtration. Concentrated hydrochloric acid (12 N, 40 mL) was added to the filtrate to neutralize it, further adjusting the reaction solution to acidity. The filtrate was concentrated to approximately 50 mL of the mixture volume. The solid was filtered and washed once with cold water; the filtrate was concentrated, and the resulting solid was filtered and washed once with cold water. The solids were combined and dried; the resulting white solid weighed 8.6 g, yielding 82%. MS ES + ( m / z ): 202.9 [(M+H) + ].
[0180] Step 3:
[0181]
[0182] A mixture of phenylarsonic acid (8.0 g, 40 mmol, 1.0 eq.), methanol (40 mL), concentrated hydrochloric acid (15 mL), and a catalytic amount of KI (50 mg) was saturated with SO2 and stirred at room temperature for 2 hours. NaOH solution (2N) was added to the mixture until the solution became clear. Concentrated hydrochloric acid was then added to neutralize the solution. A solid precipitated out and was filtered; the result was a white solid. The solid was recrystallized from water / ethanol (1 / 5), dried, and weighed: 4.0 g, yield: 60%. The product was a white powdery solid. 1 H NMR (δ, CDCl3): 7.41-7.62 (m,3H), 7.75-7.78 (m, 2H). MS ES + ( m / z ): 168.8 [(M+H) + ].
[0183] 2.2 Physicochemical properties of PAO
[0184] The molecular formula of PAO is C6H5AsO, and its molecular weight is 168.03.
[0185] 2.2.1 Instruments
[0186] An Agilent 1260 Prime high-performance liquid chromatograph, a Mettler Toledo XS105 balance (0.01 mg), a KQ5200B ultrasonic instrument (Kunshan Ultrasonic Instrument Co., Ltd.), a BR2000-GM variable speed oscillator (VWR International), and a 0.45 μm filter membrane (Shanghai Qingyang Biotechnology Co., Ltd.) were used.
[0187] 2.2.2 Experimental Drugs
[0188] PAO (purity 98%), acetonitrile (chromatographic grade, Sinopharm Chemical Reagent Co., Ltd.), hydrochloric acid and DMSO (analytical grade, Sinopharm Chemical Reagent Co., Ltd.)
[0189] 2.2.3 Solution Preparation
[0190] Take 2 mL of 0.1 M hydrochloric acid solution, add deionized water to dilute to 20 mL to obtain 0.01 M hydrochloric acid solution, and measure pH2 using precision pH test paper.
[0191] Take 2 mL of 0.01 M hydrochloric acid solution and dilute it with deionized water to 20 mL to obtain 0.001 M hydrochloric acid solution.
[0192] Take 2 mL of 0.001 M hydrochloric acid solution and dilute it with deionized water to 20 mL to obtain a 0.0001 M hydrochloric acid solution. The pH of this solution is determined to be 4 using precision pH paper.
[0193] Take 20 mL of deionized water and measure the pH to be 6.
[0194] Take 7.5 mg of PAO and place it in a centrifuge tube. Add 1 mL of DMSO and sonicate to dissolve. Dilute to 10 mL with an acetonitrile / water (1 / 1) mixture to obtain a 0.75 mg / mL PAO stock solution. Dilute the PAO stock solution to prepare different PAO working solutions with concentrations of 0.3 mg / mL, 0.15 mg / mL, 0.075 mg / mL, 0.03 mg / mL, and 0.015 mg / mL.
[0195] 2.2.4 Chromatographic conditions
[0196] Liquid Chromatography System: Agilent 1260 Infinity II Prime Ultra-High Performance Liquid Chromatography System.
[0197] Column: ACQUITY UPLC® Peptide C18 130Å 2.1*100 mm ID., 1.7 μm (Waters).
[0198] Mobile phase A: Water: ACN (v:v, 95:5) solution containing 0.01% AA and 2 mmol / L NH4OAc.
[0199] Mobile phase B: Water: ACN (v:v, 5:95) solution containing 0.01% AA and 2 mmol / L NH4OAc.
[0200] Elution gradient:
[0201]
[0202] Column temperature: 40°C
[0203] Injection volume: 4 μL
[0204] Detection wavelength: 254 nm
[0205] 2.2.5 Methodological Examination
[0206] Examination of linear relationships
[0207] Take different PAO solutions with concentrations of 0.75 mg / mL, 0.3 mg / mL, 0.15 mg / mL, 0.075 mg / mL, 0.03 mg / mL, and 0.015 mg / mL; inject and determine the chromatograms according to the above chromatographic conditions. Perform linear regression on peak area against injection concentration to obtain the regression equation:
[0208] y = 1834.8x - 4.2355R 2 =1
[0209] The results showed that the PAO injection concentration had a good linear relationship with the peak area in the range of 0.015~0.75 mg·mL⁻¹.
[0210] 2.2.6 Determination of equilibrium solubility
[0211] Take 2 mL of each of the different pH buffer solutions and place them in separate 3 mL centrifuge tubes. Add excess PAO powder until a large amount of white insoluble precipitate appears in the solution. Sonicate for 30 minutes, place in a constant temperature shaker, and shake at 25°C for 24 h. Sonicate again for 30 minutes, filter through a 0.45 μm filter membrane, take the filtrate, dilute it 10 times with water, and inject it for determination under the above chromatographic conditions. Record the chromatogram and calculate the solubility of PAO in the different pH buffer solutions as 1.15 mg / mL, 3.38 mg / mL, and 4.52 mg / mL, respectively.
[0212] Table 2. Solubility of PAO
[0213]
[0214] 3. Synthesis and physicochemical properties of deuterated compounds d1PAO, d2PAO and d3PAO
[0215] 3.1 Preparation of d1PAO
[0216]
[0217] Under nitrogen atmosphere, p-bromoaniline (3.44 g) was dissolved in deuterated methanol (5 mL), refluxed for 30 minutes, and evaporated to dryness. This process was repeated three times, and the solutions were evaporated to dryness and then dried for later use. 3 g of metallic sodium was added in portions to deuterated methanol (10 mL). After the reaction was complete, heavy water (30 mL) was slowly added to prepare a 10% heavy aqueous solution of sodium deuterium oxide. Under nitrogen atmosphere, the product from the first step was dissolved in deuterated methanol (5 mL), zinc powder (6.5 g) and the prepared 10% heavy aqueous solution of sodium deuterium oxide were added, and the mixture was heated to reflux for 3 hours. TLC monitoring showed the disappearance of p-bromoaniline. The mixture was cooled to room temperature, extracted with diethyl ether, and evaporated to dryness at low temperature to obtain the product p-deuterated aniline.
[0218]
[0219] Add 0.94 g of p-deuteraniline obtained in the previous step to a round-bottom flask equipped with a magnetic stirrer and add 5 mL of water. Cool the flask to 0 – 5 °C and at this temperature, slowly add 2 mL of 37% hydrochloric acid aqueous solution. Dilute with 5 mL of water and continue stirring. React for 30 minutes. Next, slowly add NaNO2 aqueous solution (724.5 mg, 10.5 mmol, 3 mL H2O) to the reaction solution, controlling the reaction temperature at 0–5℃. The addition should be completed over 30–40 minutes, until the solution turns brownish-yellow. Continue stirring at low temperature for 2 hours. In another round-bottom reaction flask, add Na2CO3 (4.0 g, 38.0 mmol, 3.8 eq.), As2O3 (1.0 g, 5.0 mmol, 0.5 eq.), CuSO4·5H2O (150 mg, 0.6 mmol, 0.06 eq.), and H2O (13 mL). React at 95℃ for 45 minutes; the solution will be green. Cool to 0–5℃. Slowly add the azo hydrochloride prepared in step 1 to the reaction solution from step 2, controlling the reaction system temperature below 5℃. During the dropwise addition, foam was generated. A small amount of acetone was added to remove the foam. After the foam disappeared, the dropwise addition continued, completing the addition within 1 hour. After the addition was completed, the temperature was naturally raised, and the mixture was stirred overnight. The reaction solution was filtered through diatomaceous earth, and the filter cake was washed with ice water (2 mL × 2). The aqueous phase was concentrated to 10 mL under reduced pressure at 50 °C. 4 mL of 6N HCl was added dropwise in an ice-water bath to adjust the pH to 7-8, resulting in a small amount of yellowish-brown solid. The solid was filtered, washed with 2 mL of ice water, and discarded. 2.5 mL of 6N HCl was added dropwise to the filtrate to adjust the pH to 2-3, resulting in a large number of bubbles. The filtrate was concentrated under reduced pressure. When a large amount of solid appeared in the system, the temperature was lowered, and the solid was collected by vacuum filtration. 6N HCl was added to the obtained filtrate to adjust the pH to 1, and the mixture was rotary evaporated. When a large amount of solid appeared in the system, the temperature was lowered, and the solid was collected by vacuum filtration. The mother liquor was washed twice, and the solid was collected. A total of 900 mg of pure p-deuterated arsonic acid was obtained, with a yield of 44%. 1H NMR (δ,DMSO-d6): 7.60 (d, 2H), 7.53 (d, 2H).
[0220]
[0221] Add p-deuterated arsine (880 mg, 4.3 mmol, 1.0 eq.), KI (16.6 mg, 0.1 mmol, 0.023 eq.), 37% HCl (1.7 mL, 20.0 mmol, 4.6 eq.), and methanol (5.8 mL) sequentially to a 25 mL three-necked flask. Stir at room temperature for 5–10 minutes, continuously purging with sulfur dioxide gas, and react for 3 hours. Monitor the reaction for completeness using TLC. Filter the reaction solution and wash with methanol (1.5 mL × 2). Adjust the pH to 14 by adding 15% NaOH solution dropwise to the liquid in an ice-water bath, at which point the system becomes an orange turbid liquid. Extract with ethyl acetate (50 mL × 2), combine the organic phases, dry with anhydrous Na₂SO₄, filter, and evaporate to dryness at low temperature (20–28 °C) to obtain the crude product. Approximately 4 mL of diethyl ether was added to the crude product and stirred for about 30 minutes. The mixture was then filtered and dried to obtain approximately 430 mg of d1PAO, an off-white solid. 1 H NMR (δ, DMSO-d6): 7.70 (d, 2H), 7.46 (d,2H), MS ES + (m / z): 169.9 [(M+H) + The yield is approximately 59%.
[0222] 3.2 Preparation of d2PAO
[0223]
[0224] Concentrated hydrochloric acid (5 mL) was added dropwise to an ether solution of o-bromoaniline (3.44 g), resulting in the formation of a solid. The solid was filtered through a sintered glass funnel, washed with ether, and dried to obtain aniline hydrochloride. Under nitrogen atmosphere, the solid was dissolved in heavy water (7 mL) in a sealed tube, heated to 120 °C, and reacted for 24 hours. The heavy water was then evaporated to dryness, the nitrogen atmosphere was replaced, and heavy water (7 mL) was added again. The reaction was continued for 48 hours, cooled to room temperature, and the pH was adjusted to 7 using 30% sodium hydroxide. The mixture was extracted with ether, dried over anhydrous sodium sulfate, and evaporated to dryness to obtain 2-bromo-4,6-dideuterated-aniline. Under nitrogen atmosphere, 22 mL of methanol was added to a mixture of 2-bromo-4,6-dideuterated-aniline and 10% Pd / C (300 mg). The nitrogen atmosphere was replaced with hydrogen atmosphere, and the reaction was carried out for 3 hours. The disappearance of 2-bromo-4,6-dideuterated-aniline was observed by TLC. After filtration through diatomaceous earth, washing with a small amount of methanol, and direct evaporation, the hydrobromide of 2,4-dideuterated-aniline was obtained.
[0225]
[0226] Add the hydrobromide of 2,4-dideuterium-aniline obtained in the previous step to a 25 mL round-bottom flask equipped with a magnetic stirrer, along with 5 mL of water. Cool to 0–5 °C, and at this temperature, slowly add 1.1 mL of 37% hydrochloric acid aqueous solution, dilute with 5 mL of water, and continue stirring. React for 30 minutes. Then, slowly add NaNO2 aqueous solution (724.5 mg, 10.5 mmol, 3 mL H2O) to the reaction solution, controlling the reaction temperature at 0–5 °C. The addition should be completed over 30–40 minutes, until the solution turns brownish-yellow. Continue stirring at low temperature for 2 hours. Add Na2CO3 (4.0 g, 38.0 mmol, 3.8 eq.), As2O3 (1.0 g, 5.0 mmol, 0.5 eq.), and CuSO4 to a 50 mL round-bottom reaction flask. . 5H₂O (150 mg, 0.6 mmol, 0.06 eq.), H₂O (13 mL), reacted at 95 °C for 45 minutes, resulting in a green solution. The solution was then cooled to 0–5 °C. The azo hydrochloride prepared in step 1 was slowly added dropwise to the reaction solution from step 2, maintaining the reaction temperature below 5 °C. Foam was generated during the addition; a small amount of acetone was added to remove the foam. The addition continued until the foam disappeared, and was completed within one hour. After the addition was complete, the temperature was naturally raised, and the mixture was stirred overnight. The reaction solution was filtered through diatomaceous earth, and the filter cake was washed with ice water (2 mL × 2). The aqueous phase was concentrated to 10 mL under reduced pressure at 50 °C. 4 mL of 6N HCl was added dropwise in an ice-water bath to adjust the pH to 7–8, resulting in a small amount of yellowish-brown solid. This solid was filtered, washed with 2 mL of ice water, and discarded. 2 mL of 6N HCl was added dropwise to the filtrate to adjust the pH to 3–4, resulting in a viscous solid. The solid was filtered and discarded (NMR showed that this solid did not contain product). The resulting filtrate was concentrated to 8 mL, and 0.5 mL of 6 N HCl was added to adjust the pH to 2-3. A large amount of solid appeared. The solid was filtered to obtain 1.15 g of 2,4-dideuterium-benzoarsonic acid solid, with a yield of 56.4%. 1 H NMR (δ, DMSO-d6): 7.72(d, 1H), 7.56-7.59 (m, 2H).
[0227]
[0228] Add 2,4-dideuterium-benzoarsine (1.1 g, 5.4 mmol, 1.0 eq.), KI (20.6 mg, 0.124 mmol, 0.023 eq.), 37% HCl (2.1 mL, 25.0 mmol, 4.6 eq.), and MeOH (7.3 mL) sequentially to a 25 mL three-necked flask. Stir at room temperature for 5–10 minutes, continuously purging with sulfur dioxide gas, and react for 3 hours. Monitor the reaction for completeness using TLC. Under an ice-water bath, add 15% NaOH solution dropwise to adjust the pH to 7. At this point, a large amount of insoluble matter appears in the system. Extract with ethyl acetate (50 mL × 2), combine the organic phases, dry with anhydrous Na2SO4, filter, and evaporate to dryness at low temperature (20–28 °C) to obtain the crude product. Add about 3 mL of ethyl acetate to the crude product, stir for about 30 minutes, filter, and evaporate to dryness to obtain about 400 mg of off-white solid d2PAO. 1 ¹H NMR (δ, DMSO-d6): 7.58 (d, 1H), 7.36–7.39 (m, 2H). MS ES+ (m / z): 170.7 [(M+H)+]. Yield approximately 48%.
[0229] 3.3 Preparation of d3PAO
[0230]
[0231] Concentrated hydrochloric acid (5 mL) was added dropwise to an aniline solution (2.65 g aniline, 7 mL heavy water), resulting in the formation of a solid. The solid was filtered through a sintered glass funnel, washed with diethyl ether, and dried to obtain aniline hydrochloride, which was used directly in the next step. Under nitrogen atmosphere, the solid was dissolved in heavy water (7 mL) in a sealed tube, heated to 120 °C, and reacted for 24 h. The heavy water was then evaporated, the nitrogen atmosphere was replaced, and heavy water (7 mL) was added again. The reaction was continued for 48 h, and the resulting 2,4,6-trideuterium-aniline heavy aqueous solution was used directly in the next step.
[0232]
[0233] Add 4.33 mL of a heavy aqueous solution of 2,4,6-trideuterium-aniline to a 25 mL round-bottom flask equipped with a magnetic stirrer, and add 2.5 mL of water. Cool to 0–5 °C, and at this temperature, slowly add 1.1 mL of a 37% hydrochloric acid aqueous solution, dilute with 5 mL of water, and continue stirring. React for 30 minutes. Then, slowly add an aqueous solution of NaNO2 (724.5 mg, 10.5 mmol, 3 mL H2O) to the reaction solution, controlling the reaction temperature at 0–5 °C. The addition should be completed over 30–40 minutes, and the solution will change from purple to yellow. Continue stirring at low temperature for 2 hours. Add Na2CO3 (4.0 g, 38.0 mmol, 3.8 eq.), As2O3 (1.0 g, 5.0 mmol, 0.5 eq.), and CuSO4 to a 50 mL round-bottom reaction flask. . 5H₂O (150 mg, 0.6 mmol, 0.06 eq), H₂O (13 mL), reacted at 95℃ for 45 minutes, resulting in a green solution. The solution was then cooled to 0–5℃. The azo hydrochloride prepared in step 1 was slowly added dropwise to the reaction solution from step 2, maintaining the reaction temperature below 5℃. Foam was generated during the addition; a small amount of acetone was added to remove the foam, and the addition continued after the foam disappeared. The addition was completed within 1 hour, and the temperature was naturally raised overnight with stirring. The reaction solution was filtered through diatomaceous earth, and the filter cake was washed with ice water (2 mL × 2). The aqueous phase was concentrated under reduced pressure to 10 mL at 50℃. 1.8 mL of 6N HCl was added dropwise in an ice-water bath to adjust the pH to 7–8, resulting in a small amount of yellowish-brown solid. This was filtered, washed with 2 mL of ice water, and the solid was discarded. 1.8 mL of 6N HCl was added dropwise to the filtrate to adjust the pH to 3, resulting in a pale yellow solid. The mixture was filtered and washed with 2 mL of ice water, and the solid was collected. The filtrate was concentrated to 8 mL, and the pH was adjusted to 1 by adding 0.8 mL of 6 N HCl. A large amount of solid appeared, which was then filtered and collected. A total of 860 mg of solid 2,4,6-trideuterium-benzoarsonic acid was obtained, with a yield of 39%. 1 H NMR (δ, DMSO-d6):7.56 (s, 2H).
[0234]
[0235] Add 2,4,6-trideuterium-benzoarsine (3.9 mmol, 1.0 eq.), KI (15 mg, 0.09 mmol, 0.023 eq.), 37% HCl (1.3 mL, 18.0 mmol, 4.6 eq.), and methanol (5.3 mL) sequentially to a 25 mL three-necked flask. Stir at room temperature for 5–10 minutes, continuously purge with SO2, and react for 3 h. Monitor the reaction for completeness by TLC. Filter the reaction solution and wash with methanol (1.5 mL × 2). Under an ice-water bath, add 4.3 mL of 17% NaOH solution dropwise to adjust the pH to 7. At this point, a yellow oily substance appears on the flask wall. Extract with ethyl acetate (25 mL × 2), combine the organic phases, dry with anhydrous NaSO4, filter, and evaporate to dryness at low temperature (20–28 °C). Add approximately 3 mL of ethyl acetate to the obtained solid, stir for about 30 minutes, filter, and dry under vacuum to obtain approximately 200 mg of off-white solid d3PAO. Dry the mother liquor obtained in the previous step, add approximately 1.5 mL of ethyl acetate to the obtained solid, stir for about 30 minutes, filter, and dry under vacuum to obtain approximately 170 mg of off-white solid d3PAO. After combining the d3PAO, the yield is approximately 55%. 1 H NMR (δ, DMSO-d6): 7.46 (s, 2H). MS ES + ( m / z ): 171.9 [(M+H) + ].
[0236] Example 2. Pharmacokinetic Study of d5PAO and PAO
[0237] d5PAO (d5-PAO) was prepared by the method described in Example 1, and PAO (PAO) was prepared by the company itself. In adult male rats, after a single intravenous injection of PAO, d5PAO (administered at a dose of 0.1 mg / kg, the compound dissolved in 0.1% DMSO), or a single oral gastric perfusion of the above reagent mixture (administered at a dose of 0.2 mg / kg), venous blood was collected at 0, 0.083, 0.25, 0.5, 1, 2, 4, 6, 8, 24, 32, and 48 hours post-administration for pharmacokinetic testing. PAO and d5PAO were extracted from the test samples by protein precipitation. The processed samples were then injected into liquid chromatography-mass spectrometry (LC-MS / MS) and detected using ESI negative ion mode after liquid phase separation.
[0238] Sample processing (blood sample):
[0239] 1) Add 40 µL of unknown sample, calibration standard, quality control, single blank sample, and double blank sample to a 96-well plate;
[0240] 2) Add 120 µl of 0.1 mg / mL sodium dimercaptopropanesulfonate dissolved in water to each sample;
[0241] 3) Add 40 µL of 0.2% formic acid dissolved in water to each sample. Mix well and incubate with shaking at 45 °C for 15 minutes, then centrifuge at 4 °C for 5 minutes (×3220 g).
[0242] 4) Each sample (except for the double blank) was quenched with 200 µL IS1 (double blank samples were quenched with 240 µL MeOH), shaken and mixed for 15 minutes, and then centrifuged at 4 ℃ for 15 minutes (×3220 g).
[0243] 5) Transfer 50 µL of supernatant to a 96-well plate and centrifuge at 4 °C for 5 minutes (×3220 g). Then use the supernatant for LC-MS / MS analysis. Analysis was performed using a Triple Quad 6500 micrometer. + The LC-MS / MS (SCIEX) system is complete.
[0244] Experimental results:
[0245] Male SD rats (n=3) were administered the same dose of PAO (0.1 mg / Kg) via single intravenous injection or the same dose of d5PAO (0.2 mg / Kg) via single oral gavage. No significant differences were observed in the pharmacokinetic parameters between the two treatments (see Tables 3 and 4). Figure 1 and Figure 2 The bioavailability of the 0.1 mg / kg gavage dose group was 15.7%.
[0246] Table 3. Pharmacokinetic parameters of PAO and d5PAO after a single intravenous injection in male SD rats (0.1 mg / Kg).
[0247]
[0248] Table 4. Pharmacokinetic parameters of PAO and d5PAO after a single oral gavage (0.2 mg / Kg) in male SD rats.
[0249]
[0250] Example 3. Comparison of the effects of d5PAO and PAO on cell viability and pharmacological efficacy
[0251] Cell culture and drug administration: The complete culture system for SH-SY5Y cells consisted of 15% FBS (Gibco) supplemented with high-glucose DMEM (Gibco). Plasmids were transfected using Fugene HD transfection reagent (Promega, Beijing Biotech Co., Ltd., Catalog No. E2311). The plasmids were purchased from Obio Technology (Shanghai Corp., Ltd.), and the vector map is shown below. Figure 3 As shown. The sequence of the α-synuclein overexpression plasmid is as follows:
[0252] ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGGCTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAGACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTGGTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACAAATGTTGGAGGAGCAGTGG TGACGGGTGTGACAGCAGTAGCCCAGAAGACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAAAAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAATTCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCTTCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA (SEQ ID NO:1)
[0253] The stable APP (SW) HEK293 cell line is a human embryonic kidney cell line transfected with Swedish double mutant APP695 cDNA. Before seeding, the wells of the plate were treated with 20 μg / mL poly-D-Lysine (PDL) for 24 h. The culture medium was 10% FBS with added high-glucose DMEM, and selection was performed simultaneously with 200 μg / mL G418. After seeding and culturing for 48 h, the cells were starved (i.e., serum was removed, and only high-glucose DMEM medium was used). After 24 h of culture, the medium was replaced with a complete culture system and drug treatment was initiated.
[0254] Detection of cell viability using the thiazolyl blue (MTT) method
[0255] After 12 hours of drug administration, MTT was added to a final concentration of 0.5 mg / mL. After incubation for 4 hours, the culture medium was removed, and 100 μL of DMSO was added to dissolve the adsorbed MTT. The absorbance value was read after shaking for 15 minutes.
[0256] ELISA testing
[0257] a) α-synuclein ELISA detection: α-synuclein monoclonal antibody (Mouse monoclonal) was purchased from Sigma-Aldrich (Shanghai, Catalog No. S5566); the α-synuclein ELISA kit was purchased from Thermo Fisher Scientific (Catalog No. KHB0061). Add 50 μL of Hu α-synuclein Detection Antibody solution to each well (except for the chromogen blanks, i.e., blank colorimetric wells), then add 50 μL of sample and standard curve (see standard curve preparation instructions). Figure 4 Add 100 μL of Stabilized Chromogen to each well (except for the empty chromogen blanks), gently vortex to mix, cover and incubate overnight at 4°C. Wash the wells four times thoroughly with 100 μL of 1× Wash buffer. Add 100 μL of Anti-Rabbit IgG HRP to each well (except for the blank wells), cover and incubate at room temperature for 30 minutes, then wash four times thoroughly with 1× Wash buffer. Add 100 µL of Stabilized Chromogen to each well; the solution turns blue, incubate at room temperature in the dark for 30 minutes. Add 100 µL of StopSolution to each well. Gently vortex to mix; the solution turns yellow. Read the absorbance at 450 nm using a NovoStar microplate reader (BMG company, Germany).
[0258] b) Aβ ELISA detection
[0259] The Amyloid beta 42 Human ELISA Kit was purchased from Thermo Fisher Scientific (Catalog No. KHB3544). Add 100 μL each of diluted standard curve, blank control, and sample to the corresponding wells of the detection plate. Cover the plate and incubate at 37°C for 2 h. Discard the liquid in each well, add 100 μL of Detection Reagent A Working Solution to each well, cover the plate, and incubate at 37°C for 1 h. Discard the supernatant, wash each well three times with 1× Wash buffer for 2 minutes each time, ensuring minimal liquid residue. Add 100 μL of Detection Reagent B Working Solution to each well, cover the plate, and incubate at 37°C for 1 h. Repeat the washing process five times. Add 90 µL of Substrate Solution to each well, cover the plate, and incubate at 37°C in the dark for 20 minutes. The solution turns blue. Add 50 µL of Stop Solution to each well, gently vortex to mix, and read the solution as soon as possible using a microplate reader (absorption wavelength 450 nm).
[0260] Propidium Iodide (PI) staining
[0261] PI (Cell Signaling Technology, Catalog No. 4087) was added 15 minutes before immunofluorescence staining and the cells were incubated in a cell culture incubator for 15 minutes. The longest excitation and emission wavelengths of the PI / RNase staining solution were 535 nm and 617 nm, respectively.
[0262] Immunofluorescence staining
[0263] After aspirating the supernatant from the treated cells, wash three times with pre-cooled PBS, treat with 4% PFA, incubate at room temperature for 30 minutes, and wash three times with PB-S for 10 minutes each time. Prepare a 0.1% Triton-X solution in PBS and treat for 15 minutes. Block with 10% donkey serum for 1 hour; primary antibody: Mouse anti-Ki67 (Cell Signaling Technology, Catalog No. 9129); secondary antibody: anti-Mouse Alex 488.
[0264] Statistical analysis
[0265] Data were analyzed using GraphPad Prism 5 software. One-way ANOVA was performed, with mean ± SEM, and p < 0.03 was considered statistically significant.
[0266] Experimental results:
[0267] Effects of d5PAO and PAO on SH-sy5y cell viability
[0268] The complete culture system for the SH-sy5y cell line consisted of digoxin DMEM medium supplemented with 15% FBS. In the cytotoxicity assay, SH-sy5y cells were cultured for 48 h and then treated with different concentrations of d5PAO and PAO for 24 h. Thiazol blue (MTT) was added to a final concentration of 0.5 mg / mL, and after incubation for 4 hours, the culture medium was aspirated, and 100 μL of DMSO was added to dissolve the adsorbed MTT. The cells were shaken for 15 minutes, and the absorbance was then recorded. The results showed that d5PAO at concentrations of 6.25 nM, 25 nM, 50 nM, 100 nM, and 200 nM significantly promoted SH-sy5y cell proliferation. PAO at 200 nM showed toxicity after 24 h of treatment, resulting in significant cell death. To further investigate the cytotoxic effects of different concentrations of d5PAO and PAO on SH-sy5y cell apoptosis / death and proliferation, we examined the effects of d5PAO and PAO on SH-sy5y cell apoptosis / death and proliferation using PI staining and Ki67 immunofluorescence staining. Propidium iodide (PI) is a fluorescent dye that can intercalate between DNA and RNA bases and the staining agent. It cannot pass through the membranes of living cells, but it can pass through damaged cell membranes to stain the nuclei of apoptotic / dead cells. Ki67 is an essential protein in cell proliferation, and its function is closely related to mitosis. Therefore, Ki67 is often used to label cells in the cell cycle, and in clinical applications, cells with high Ki67 positivity are generally considered to have faster tumor growth. After treatment with different concentrations of d5PAO and PAO for 24 hours, PI and Ki67 staining were performed. The results showed that 50 nM and 100 nM d5PAO and PAO did not significantly increase the Ki67 positivity rate, while the number of PI-positive cells decreased compared to the control group (ctrl). This indicates that d5PAO and PAO reduced cell apoptosis or death, but did not significantly promote cell proliferation. Figure 5 ).
[0269] Example 4. Effects of d5PAO and PAO on the viability and Aβ release of stable APP (SW) HEK293 cells.
[0270] The stable APP (SW) HEK293 cell line is a human embryonic kidney cell line transfected with Swedish double mutant amyloid precursor protein (APP) 695 cDNA and carrying the G418 selection marker. Before seeding, the wells of the plate were treated with 20 μg / mL poly-D-Lysine (PDL) for 24 h. The culture medium was high-glucose DMEM with 10% FBS, and selection was performed simultaneously with 200 μg / mL G418. After 48 h of culture, different concentrations of d5PAO and PAO were added for 24 h each. Thiazol blue (MTT) was added to a final concentration of 0.5 mg / mL, and after incubation for 4 hours, the culture medium was aspirated, and 100 μL of DMSO was added to dissolve the adsorbed MTT. The cells were shaken for 15 minutes, and the absorbance was then read.
[0271] In the experiment to detect the effects of d5PAO and PAO on Aβ release in stable APP (SW) HEK293 cells, after culturing for 48 h and starving for 24 h, the cells were replaced with a complete culture system and treated with compounds d5PAO and PAO for 4 h. The Aβ level in the cell culture supernatant was detected by ELISA.
[0272] Experimental results:
[0273] Treatment of stably transfected APP (SW) HEK293 cells with 25 nM, 50 nM, 100 nM, and 200 nM d5PAO for 24 h significantly increased cell viability compared to the control group. Previous studies have shown that PAO can promote the release of proteins such as amyloid β-protein (Aβ). ELISA analysis of Aβ levels in the supernatant of stably transfected APP (SW) HEK293 cells showed that 25 nM, 50 nM, and 100 nM d5PAO significantly increased extracellular Aβ levels. Figure 6 ).
[0274] Example 5. Comparison of the effects of other deuterated compounds on Aβ release in stably converted APP (SW) HEK293 cells.
[0275] The three selected PAO deuterated compounds were d1PAO, d2PAO, and d3PAO. The administration method for APP(SW) HEK293 cell culture was the same as in Example 4. The treatment groups were divided into: control group (ctrl), d5PAO 50 nM treatment group, d5PAO 100 nM treatment group, PAO 50 nM treatment group, PAO 75 nM treatment group, d1PAO 25 nM treatment group, d1PAO 50 nM treatment group, d1PAO 75 nM treatment group, d2PAO 25 nM treatment group, d2PAO 50 nM treatment group, d2PAO 75 nM treatment group, d3PAO 25 nM treatment group, d3PAO 50 nM treatment group, and d3PAO 75 nM treatment group. The results showed that, compared with the control group, the treatment groups of 50 nM and 75 nM d5PAO; 50 nM and 75 nM PAO; 25 nM, 50 nM and 75 nM d1PAO; 25 nM, 50 nM and 75 nM d2PAO; and 25 nM, 50 nM and 75 nM d3PAO all significantly promoted extracellular Aβ content. Except for the control group, compared with the 50 nM d5PAO treatment group, the other treatment groups showed significant differences in Aβ content in the cell culture supernatant. These included the 50 nM PAO treatment group, the 25 nM, 50 nM and 75 nM d1PAO treatment groups, the 25 nM and 75 nM d2PAO treatment groups, and the 25 nM and 75 nM d3PAO treatment groups. Figure 7 A and Figure 7 B).
[0276] Example 6. Effects of d5PAO and PAO on α-synuclein secretion
[0277] SH-SY5Y cell lines were transfected with α-synuclein overexpression (α-syn OE) plasmid using Fugene HD transfection reagent. After 24 hours of starvation treatment, the cells were replaced with a complete culture system and treated with either d5PAO or PAO for 24 hours. The effects of d5PAO and PAO on the viability of SH-sy5y cells transfected with α-synuclein plasmid were detected by MTT assay. The results showed that α-synuclein overexpression significantly decreased SH-sy5y cell viability. 25 nM, 50 nM, 75 nM, 100 nM, and 200 nM d5PAO, and 50 nM, 75 nM, and 100 nM PAO significantly increased the viability of SH-sy5y cells overexpressing α-synuclein compared to the α-synuclein overexpression group. The results of ELISA testing of α-synuclein in cell supernatant showed that 50 nM d5PAO significantly increased the α-synuclein content in the supernatant, and PAO and d5PAO had a similar trend of promoting the increase of α-synuclein. Figure 8 ).
[0278] Example 7. Therapeutic effects of d5PAO and PAO on Gaucher disease
[0279] 1. d5PAO and PAO inhibit CBE-induced apoptosis or death in SH-SY5Y cells.
[0280] Conduritol epoxide (CBE) is an inhibitor of the GBA1 enzyme, encoded by the lysosomal glucocerebrosidase GBA gene, and is commonly used to construct cell and animal models of Gaucher disease (GD). Treatment of SH-SY5Y cells with CBE for 48 hours resulted in a concentration-dependent decrease in cell viability. Figure 9 A). We selected 100 μM CBE for subsequent experiments. SH-SY5Y cells were treated with 100 μM CBE for 24 hours, and then co-incubated for 24 hours with different concentrations of d5PAO or PAO according to different groups. Cell viability was detected by MTT assay. The results showed that compared with the 100 μM CBE treatment group, the cell viability of the groups treated with 100 μM CBE and 25 nM, 50 nM, 100 nM d5PAO and 25 nM, 50 nM, and 100 nM PAO was significantly increased. Figure 9 (B, C) suggests that d5PAO or PAO has a protective effect against CBE-induced apoptosis or death in SH-SY5Y cells.
[0281] 2. PAO reduces lysosomal storage and promotes the efflux of glucosylceramide (GlcCer).
[0282] Gastrointestinal dysplasia (GD) is a common lysosomal storage disease. We investigated whether d5PAO and PAO alleviated lysosomal storage induced by cytosomal embolism (CBE) using the lysosomal marker DND99 (Lyso-tracker redDND99). The results showed that, compared with the control group (ctrl), the fluorescence intensity of the 100 μM CBE treatment group and the 100 μM CBE Lyso-tracker was significantly increased. Figure 10 (A, B) suggests that CBE treatment leads to lysosomal accumulation in SH-SY5Y cells. Compared with the 100 μM CBE treatment group, the co-treatment groups of 100 μM CBE with 50 nM and 100 nM PAO significantly reduced the fluorescence intensity of Lyso-tracker (A, B). Figure 10 A, B). The fundamental defect of GD lies in the lack of glucocerebrosidase activity, which mainly mediates the breakdown of glucocerebroside into glucose and GlcCer. Therefore, GlcCer and other substrates accumulate in cells from GD patients or those treated with CBE. To further investigate whether PAO affects GlcCer accumulation in the SH-SY5Y cell model, we used LC-MS to analyze the content of different side chains of GlcCer in intracellular and cell culture supernatant. The results showed that the concentration of various side chains of GlcCer in the 100 μM CBE treatment group was much higher than that in the control group (ctrl). The GlcCer concentration in the 100 μM CBE and 50 nM PAO co-treatment group was lower than that in the 100 μM CBE treatment group (…). Figure 10 C). Treatment with 100 μM CBE alone reduced GlcCer concentration in cell culture supernatant, while co-treatment with 100 μM CBE and 50 nM PAO restored GlcCer concentration. Figure 10 D).
[0283] 3. Knockdown PI4Ka Promotes reduction of lysosomal storage
[0284] Previous studies have shown that PAO at low concentrations (<5 μM) primarily acts on phosphatidylinositol 4-kinase PI4KⅢα. To further investigate the role of PAO's target PI4KⅢα in the fibrosis process, we designed shRNA-interfering lentiviral vectors (containing a green fluorescent protein (GFP) expression sequence) targeting the gene sequence encoding PI4KⅢα protein. Western blot results showed that, 48 hours after transfection of SH-SY5Y cells, the three shRNA-interfering lentiviral vectors targeting PI4Ka, sh1, sh2, and sh3, all significantly reduced PI4KⅢα expression levels in the treated group. Figure 11 A, B). The fluorescence intensity of Lyso-tracker was observed by immunofluorescence 48 hours after treatment with shRNA-interfered lentiviral vector. Compared with sh-ctrl, the immunofluorescence intensity of Lyso-tracker was significantly increased in the sh-ctrl and 100 μM CBE co-treatment group. Compared with the sh-ctrl and 100 μM CBE co-treatment group, the decrease in immunofluorescence intensity of Lyso-tracker was significant in the sh1-PI4Ka and 100 μM CBE co-treatment group. Figure 11 C). The above results indicate that knocking down PI4Ka promotes a reduction in lysosomal storage.
[0285] Example 8. Study on the inhibitory effects of d5PAO and PAO on pulmonary fibrosis
[0286] Pulmonary fibrosis (PF) is a chronic, fibrotic lung disease caused by various factors. Its main symptoms are dry cough and progressive dyspnea, with a poor prognosis and currently being difficult to cure. The main pathological feature of PF is excessive scarring and repair following the destruction of normal lung tissue structure, ultimately leading to respiratory failure. Although significant progress has been made in researching the pathophysiological mechanisms of pulmonary fibrosis, its pathogenesis is not fully understood, and there are currently no effective treatments available clinically.
[0287] Human embryonic lung fibroblasts (MRC-5 cells) are important cell tools for studying the pathological changes of fibroblastic fibrosis (PF) and for drug development. During the development of PF, related transcription factors such as transforming growth factor-β1 (TGF-β1) can regulate abnormal activation, proliferation, and migration of fibroblasts, leading to abnormal deposition of the extracellular matrix (ECM) and destruction of alveolar structure, ultimately resulting in PF formation. TGF-β1 is one of the key factors inducing PF; it can regulate the transformation of fibroblasts into myofibroblasts by binding to its corresponding receptor. Therefore, in experiments, a certain concentration of TGF-β1 is usually used to treat MRC-5 cells to induce fibrosis. d5PAO and PAO are oxidized phenylarsine and its modified form, respectively. Previous studies have shown that PAO has the potential to inhibit PF.
[0288] Experimental methods:
[0289] MRC-5 cell culture and treatment
[0290] MRC-5 cells were purchased from the Center for Excellence in Molecular Cell Science, Chinese Academy of Sciences. Following the cell culture instructions, cells were cultured in MEM (Gibco) medium containing 10% fetal bovine serum (FBS) at 37°C, 5% CO2, and saturated humidity for 24 hours to allow for cell adhesion. The following day, cells were added with 5 ng / mL TGF-β1 (Proteintech Group, HZ-1011), and MEM medium (Gibco) containing different concentrations of PAO or d5PAO were added simultaneously according to the cell groupings. Cells were cultured for another 24 hours as needed. The groups are as follows: control (ctrl) group, 5 ng / mL TGF-β1 group, 5 ng / mL TGF-β1 and 50 nM d5PAO co-treatment group (5 ng / mL TGF-β1 + 50 nM d5PAO group), 5 ng / mL TGF-β1 and 25 nM d5PAO co-treatment group (5 ng / mL TGF-β1 + 25 nM d5PAO group), 5 ng / mL TGF-β1 and 50 nM PAO co-treatment group (5 ng / mL TGF-β1 + 50 nM PAO group), and 5 ng / mL TGF-β1 and 25 nM PAO co-treatment group (5 ng / mL TGF-β1 + 25 nM PAO group).
[0291] Primary culture and treatment of rat bone marrow mesenchymal stem cells
[0292] Six-week-old Sprague-Dawley (SD) rats (Shanghai Slack Laboratory Animal Co., Ltd.) were anesthetized with chloral hydrate. After disinfection with 75% ethanol, the tibia and femur were separated and removed in a laminar flow hood. The ends were removed with sterilized scissors to expose the medullary cavity. The medullary cavity was flushed with 5 mL of MEM medium containing 10% FBS. The flushing solution containing bone marrow was added to a culture dish. The cells were filtered through a 70 μm cell sieve and centrifuged at 2000 rpm for 3 minutes. The supernatant was removed, and the cells were resuspended in MEM medium containing 10% FBS. After seeding, the cells were cultured in an incubator at 37°C, 5% CO2, and saturated humidity. After 6 hours, non-adherent cells were removed by changing the medium. When the cells reached 80% confluence, they were digested with 2.5% trypsin for 1 minute and passaged at a 1:2 ratio. Mesenchymal stem cells for immunofluorescence experiments were seeded at 3000-5000 cells per well on coverslips of 24-well plates. When the cell density reached 70%, MEM medium (without FBS) containing different concentrations of PAO or d5PAO was added according to the groupings, and the cells were cultured for 24 hours in a constant temperature, 5% CO2, and saturated humidity incubator. The groups were as follows: control (ctrl) group, 50 nM d5PAO treatment group, 25 nM d5PAO treatment group, 50 nM PAO treatment group, and 25 nM PAO treatment group.
[0293] Immunofluorescence staining
[0294] After treating MRC-5 cells for 24 hours, the supernatant was aspirated, and the cells were washed three times with phosphate buffered saline (PBS). 4% paraformaldehyde (PFA) was added, and the cells were incubated at room temperature for 30 minutes. The 4% PFA was discarded, and the cells were washed three times with PBS for 10 minutes each time. 0.3% nonionic detergent Triton-X (dissolved in PBS) was added, and the cells were incubated at room temperature for 30 minutes. 0.3% Triton-X was aspirated, and PBS blocking buffer containing 10% goat serum (GS) was added, and the cells were incubated at room temperature for 1 hour. The cells were then incubated overnight at 4°C with primary antibody (primary antibody diluted with 10% GS blocking buffer, α-Smooth Muscle Actin (rabbit anti-α-Smooth Muscle Actin, Cell Signaling Technology #19245)).
[0295] The dilution ratio was 1:200, and the Calponin 1 dilution ratio was 1:100. The next day, the cells were washed three times with PBS for 10 minutes each time. The secondary antibody Alexa Flour 555 goat anti-rabbit IgG (Molecular Probes) was incubated using blocking buffer diluted to 1:500, and 1 μg / mL 4',6-diamidinyl-2-phenylindole (DAPI) was added. The cells were incubated at room temperature for 2 hours, followed by three washes with PBS for 10 minutes each time. After mounting with mounting media, the cells were observed under a microscope. The immunofluorescence staining process for bone marrow mesenchymal stem cells was the same as described above.
[0296] Western blot assay
[0297] 1) Place the cell culture dish on ice, aspirate the supernatant, and wash the cells three times with pre-cooled PBS;
[0298] 2) Add 120 μL / well of cell lysis buffer and incubate horizontally on ice for 30 minutes;
[0299] 3) Use a cell scraper to collect the lysate into a 1.5 mL EP tube;
[0300] 4) Centrifuge at 15000g for 15 minutes, collect the supernatant into a new EP tube, and take 5 μL of sample for protein content detection (BCA method). Add 1 / 4 volume of loading buffer to the remaining lysis buffer.
[0301] 5) Boil in water for 5 minutes;
[0302] 6) Prepare 10% SDS separating adhesive and prepare building block adhesive;
[0303] 7) Proteins of different molecular weights were separated by SDS-PAGE gel electrophoresis;
[0304] 8) Configure a wet transfer buffer and conduct a transfer experiment using a 0.45μm PVDF membrane;
[0305] 9) Seal 5% skim milk at room temperature for 1 hour;
[0306] 10) After washing, incubate with the primary antibody at 4°C overnight;
[0307] 11) The next day, wash three times with TBST solution, incubate with secondary antibody, and leave at room temperature for 2 hours;
[0308] 12) Use ECL developer for color development and GE.
[0309] Enzyme-linked immunosorbent assay (ELISA): Human Collagen Type I ELISA Kit
[0310] A total of 8 samples were included: control group (ctrl), 5 ng / mL TGF-β1 group, 5 ng / mL TGF-β1 and 50 nM d5PAO co-treatment group (5 ng / mL TGF-β1 + 50 nM d5PAO group), 5 ng / mL TGF-β1 and 25 nM d5PAO co-treatment group (5 ng / mL TGF-β1 + 25 nM d5PAO group), 5 ng / mL TGF-β1 and 50 nM PAO co-treatment group (5 ng / mL TGF-β1 + 50 nM PAO group), and 5 ng / mL TGF-β1 and 25 nM PAO co-treatment group (5 ng / mL TGF-β1 + 25 nM PAO group).
[0311] The Human Collagen Type I ELISA Kit was purchased from Novus Biologicals (catalog number: NBP2-30102). The following experimental steps were performed according to the instructions:
[0312] 1) Standard curve samples were prepared using Standard Diluent: 4000 pg / mL, 2000 pg / mL, 1000 pg / mL, 500 pg / mL, 250 pg / mL, 125 pg / mL, 62.5 pg / mL, and 0 pg / mL;
[0313] 2) Add 100 μL of the sample to be tested (3 replicates) or the standard curve sample to each well, seal the well plate with sealing film, and incubate at 37°C for 2 hours;
[0314] 3) Remove the supernatant; no rinsing is required.
[0315] 4) Add 100 μL of Detection Reagent A solution to each well, seal the plate with sealing film, and incubate at 37°C for 1 hour;
[0316] 5) Discard the supernatant, add 350 μL of 1×Wash solution to each well, wash in a shaker for 2 minutes, invert the plate onto a piece of non-stick paper and remove the supernatant by tapping, repeat 3 times.
[0317] 6) Add 100 μL of Detection Reagent B solution to each well, seal the plate with sealing film, and incubate at 37°C for 30 minutes;
[0318] 7) Discard the supernatant, add 350 μL of 1×Wash solution to each well, wash in a shaker for 2 minutes, invert the plate onto a piece of non-stick paper and remove the supernatant by tapping, repeat 5 times;
[0319] 8) After cleaning, add 90 μL of TMB substrate to each well. The liquid in the well plate will gradually turn blue. Seal the well plate with sealing film and let it stand at room temperature for 10 minutes.
[0320] 9) Add 50 μL of stop solution to each well; the liquid in the well plate will turn yellow.
[0321] 10) Use an ELISA reader with an absorption wavelength of 450 nm (to read and analyze the data).
[0322] Construction and processing of shRNA lentiviral vectors
[0323] against PI4Ka The interfering shRNA lentiviral vector was designed and manufactured by Giman Biotechnology (Shanghai) Co., Ltd. Vector information: pGMLV-SC5 RNAi vector ( Figure 12 ).
[0324] The target points are designed as follows:
[0325]
[0326] MRC-5 cells were cultured in MEM medium containing 10% fetal bovine serum (FBS) at a constant temperature of 37°C, 5% CO2, and saturated humidity for 24 hours to allow them to adhere. The following day, 1 μL of lentiviral vector was added to each well according to the assigned group. After 24 hours, 5 ng / mL TGF-β1 was added according to the group and incubated for another 24 hours. Proteins were then collected for Western blotting or immunofluorescence staining.
[0327] statistics
[0328] Fluorescence intensity was processed using ImageJ software, and data processing and statistics were performed using GraphPad Prism5 software. Data are expressed as mean ± standard error (mean ± SEM). One-way ANOVA was used to compare differences between groups, and p < 0.03 was considered statistically significant.
[0329] Experimental results:
[0330] MRC-5 cells were treated with MEM (FBS-free) medium containing 5 ng / mL TGF-β1 for 24 hours, and then treated with different concentrations of d5PAO or PAO according to their grouping. Compared with the control group, TGF-β1 treatment alone or in combination with a certain concentration of d5PAO or PAO did not cause significant cell death or apoptosis. Figure 13α-Smooth muscle actin (α-SMA) and actin-binding protein Calponin1 are markers of myofibroblasts. To investigate whether d5PAO and PAO have a regulatory effect on pulmonary fibrosis, we detected α-SMA and Calponin1, respectively. Western blot results showed that compared with the control group (ctrl), the 5 ng / mL TGF-β1 treatment group showed a significant increase in α-SMA expression, suggesting that 5 ng / mL TGF-β1 treatment of MRC-5 cells for 24 hours led to cell fibrosis. 25 nM, 50 nM, and 100 nM d5PAO and 50 nM and 100 nM PAO significantly inhibited 5 ng / mL TGF-β1-induced α-SMA overexpression in a dose-dependent manner. Figure 14 A, B). The results of Western blotting of Calponin1 were similar to those of the α-SMA assay above. The Calponin1 expression level in the 5 ng / mL TGF-β1 treatment group was significantly increased compared to the ctrl group. The Calponin1 expression level in the groups treated with a certain concentration of d5PAO or PAO combined with 5 ng / mL TGF-β1 was significantly reduced compared to the 5 ng / mL TGF-β1 treatment group alone. Figure 14 A, C). Furthermore, the immunofluorescence results were consistent with the Western blot results, showing that the α-SMA expression level in the 5 ng / mTGF-β1 treatment group was significantly higher than that in the control group ( Figure 15 A, C). The expression levels of α-SMA in the co-treatment groups of 5 ng / mL TGF-β1 and 25 nM d5PAO, 5 ng / mL TGF-β1 and 50 nM d5PAO, 5 ng / mL TGF-β1 and 25 nM PAO, and 5 ng / mL TGF-β1 and 50 nM PAO showed no significant difference compared to the control group. However, the expression levels of α-SMA in the co-treatment groups of 5 ng / mL TGF-β1 and 25 nM d5PAO, 5 ng / mL TGF-β1 and 50 nM d5PAO, 5 ng / mL TGF-β1 and 25 nM PAO, and 5 ng / mL TGF-β1 and 50 nM PAO were significantly lower than those in the 5 ng / mL TGF-β1 treatment group. Figure 15 A, C). The immunofluorescence results of actin-binding protein Calponin 1 were consistent with the results of α-SMA described above. Figure 15 (B, D). The above results indicate that d5PAO and PAO can significantly inhibit TGF-β1-induced fibrosis in MRC-5 cells.
[0331] d5PAO and PAO inhibit Calponin1 in bone marrow mesenchymal stem cells. Expression in cells (bMSCs)
[0332] Pulmonary fibrosis lacks effective treatments and therapies, while stem cells, due to their unique biological characteristics and potential biomedical applications, have become a hot research area for treating pulmonary fibrosis in recent years. Mesenchymal stem cells (MSCs) have become ideal engineered cells for trauma tissue repair, organ function reconstruction, and cell therapy due to their low immunogenicity, diverse differentiation potential, immunomodulatory and anti-inflammatory capabilities, wide availability, ease of isolation and culture, and fewer ethical controversies. Therefore, we isolated and cultured rat skeletal MSCs and investigated whether d5PAO and PAO regulate Calponin1 expression in MSCs. The isolated MSCs were cultured in MEM medium containing 10% FBS. In immunofluorescence experiments, 3000-5000 cells per well were seeded on coverslips of 24-well plates. When the cell density reached 70%, MEM medium (without FBS) containing different concentrations of PAO or d5PAO was added according to the grouping, and the cells were cultured for 24 hours in an incubator at 37°C, 5% CO2, and saturated humidity. Immunofluorescence results showed that MSC treatment with 25 nM, 50 nM d5PAO, and PAO for 24 hours tended to inhibit Calponin1 expression in MSCs. Figure 16 ).
[0333] d5PAO and PAO inhibit the secretion of type I collagen in TGF-β1-treated MRC-5 cells. COL1)
[0334] COL1 is an important component of the extracellular matrix. Studies have shown that TGF-β1 significantly increases COL1 secretion during MRC-5 cell fibrosis. To further investigate whether d5PAO and PAO have a regulatory effect on COL1 secretion during the inhibition of pulmonary fibrosis, we detected COL1 levels in cell supernatants using ELISA. MRC-5 cells were treated with MEM (FBS-free) medium containing 5 ng / mL TGF-β1 for 24 hours, and then treated with different concentrations of d5PAO or PAO for 24 hours according to grouping. The supernatants were collected for ELISA experiments. The experimental results showed that compared with the ctrl group, the concentration of COL1 in the cell supernatant of the 5 ng / mL TGF-β1 treatment group was significantly increased. The co-treatment groups of 5 ng / mL TGF-β1 and 25 nM d5PAO, 5 ng / mL TGF-β1 and 50 nM d5PAO, 5 ng / mL TGF-β1 and 100 nM d5PAO, 5 ng / mL TGF-β1 and 25 nM PAO, 5 ng / mL TGF-β1 and 50 nM PAO, and 5 ng / mL TGF-β1 and 100 nM PAO significantly decreased the COL1 level in the cell supernatant compared with the 5 ng / mL TGF-β1 treatment group alone. Figure 17 (A, B) indicates that d5PAO and PAO can inhibit COL1 secretion in the MRC-5 cell model.
[0335] Knockdown of PI4Kα inhibits MRC-5 cell fibrosis
[0336] Previous studies have shown that PAO at low concentrations (<5 μM) primarily acts on phosphatidylinositol 4-kinase PI4KⅢα. To further investigate the role of PAO's target PI4KⅢα in the fibrosis process, we designed a gene sequence encoding the PI4KⅢα protein. PI4Ka The shRNA interfered with the lentiviral vector (containing a green fluorescent protein GFP expression sequence). Western blot results showed that three [unclear] targets... PI4Ka The shRNA-interfering lentiviral vector, after transfection of MRC-5 cells for 48 hours, significantly reduced the expression level of PI4KⅢα in the treatment group using the interfering sequences sh1, sh2, and sh3. Figure 18A, B). The expression of Calponin1 and α-SMA was observed by immunofluorescence 48 hours after treatment with shRNA-interfered lentiviral vectors. Compared with the vector control group (sh-ctrl), the α-SMA expression level was significantly increased in the sh-ctrl plus 5 ng / mL TGF-β1 co-treatment group. Compared with the sh-ctrl plus 5 ng / mL TGF-β1 co-treatment group, the α-SMA expression levels were significantly decreased in the sh1 plus 5 ng / mL TGF-β1 co-treatment group and the sh3 plus 5 ng / mL TGF-β1 co-treatment group, and the α-SMA expression level in the sh2 plus 5 ng / mL TGF-β1 co-treatment group also showed a decreasing trend. Figure 19 A, C). The observations of Calponin 1 are consistent with those of α-SMA ( Figure 19 (B, D) both indicate that knocking down PI4Kα inhibits MRC-5 cell fibrosis.
[0337] Example 9. Comparison of anti-inflammatory effects of d5PAO and PAO
[0338] d5PAO and PAO inhibit the release of inflammatory factors from mouse microglia (BV2) cells.
[0339] BV2 cells were immortalized by retroviral transfection of mouse microglia with v-raf / v-myc, retaining various morphological, characterizing, and functional features of microglia. In experiments related to nervous system inflammation, lipopolysaccharide (LPS) stimulation of BV2 cells is commonly used to obtain an inflammatory cell model. This experiment used LPS-stimulated BV2 cells as an inflammatory cell model to observe the effects of d5PAO and PAO on the secretion of inflammatory factors such as tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6). Indomethacin, a commonly used anti-inflammatory drug, was used as a positive control.
[0340] Cell culture and processing
[0341] BV2 cells were cultured in high-glucose DMEM with 10% FBS at 37°C in a 5% CO2 incubator for 48 hours. The medium was then removed and replaced with high-glucose DMEM (without FBS) containing 1 μg / mL LPS (lipopolysaccharide, purchased from Sigma, catalog number: L2880). Different concentrations of d5PAO or PAO were then co-incubated for 24 hours according to the cell groups. The supernatant was collected, centrifuged, and used for subsequent experiments. The groups are as follows: control (ctrl) group, 1 μg / mL LPS group, 1 μg / mL LPS and 50 nM d5PAO co-treatment group (1 μg / mL LPS + 50 nM d5PAO group), 1 μg / mL LPS and 25 nM d5PAO co-treatment group (1 μg / mL LPS + 25 nM d5PAO group), 1 μg / mL LPS and 12.5 nM d5PAO co-treatment group (1 μg / mL LPS + 12.5 nM d5PAO group), 1 μg / mL LPS and 50 nM PAO co-treatment group (1 μg / mL LPS + 50 nM PAO group), 1 μg / mL LPS and 25 nM PAO co-treatment group (1 μg / mL LPS + 25 nM PAO group), 1 μg / mL LPS and 12.5 nM PAO co-treatment group (1 μg / mL LPS + 25 nM PAO group). LPS + 12.5 nM PAO group), and co-treatment group with 1 μg / mL LPS and 100 μM indomethacin.
[0342] Mouse Tumor Necrosis Factor Alpha (TNFα) ELISA Experiment
[0343] The Mouse Tumor Necrosis Factor Alpha (TNFα) ELISA Kit was purchased from SignalwayAntibody LLC, catalog number EK16997. The following experiments were performed according to the product instructions:
[0344] 1) Standards were prepared using Diluent buffer at concentrations of: 10 ng / mL, 5 ng / mL, 2.5 ng / mL, 1.25 ng / mL, 0.625 ng / mL, 0.312 ng / mL, 0.156 ng / mL, and 0.
[0345] 2) Gently shake Detection Reagent A and Detection Reagent B, and use Diluent buffer to dilute Reagent A and Reagent B to 1 / 100 of the stock solution to achieve the working solution concentration.
[0346] 3) Dilute the Wash solution with deionized water to 1 / 30 of the mother solution to form the working solution.
[0347] 4) Add 100 μL of the sample or standard to each well, seal the plate with sealing film, and incubate at 37°C for 2 hours;
[0348] 5) Remove the supernatant; no rinsing is required.
[0349] 6) Add 100 μL of Detection Reagent A working solution to each well, seal the plate with sealing film, and incubate at 37°C for 1 hour;
[0350] 7) Discard the supernatant, wash 3 times with 300 μL Wash solution, let stand for 2 minutes each time, and invert the plate onto absorbent paper to remove as much cleaning solution as possible;
[0351] 8) Add 100 μL of Detection Reagent B working solution to each well, seal the plate with sealing film, and incubate at 37°C for 1 hour;
[0352] 9) Clean the orifice plate 5 times following the method in step 7);
[0353] 10) Add 90 μL of Substrate solution to each well. Observe the plate and you will see blue liquid. Seal the plate with sealing film and incubate at 37°C for 20 minutes in the dark.
[0354] 11) Add 50 μL of Stop solution to each well. Observe the well plate and the blue liquid will turn yellow. Seal the well plate with sealing film and shake it on a shaker for 10 minutes.
[0355] 12) Use an ELISA reader (NOVOstar transfer ELISA reader) to read the absorbance value of the sample at a wavelength of 450 nM.
[0356] Mouse IL-6 ELISA experiment
[0357] The Mouse IL-6 ELISA Kit was purchased from Proteintech Group, item number: KE10007. The following experiments were performed according to the product instructions:
[0358] Add 100 µL of standard curves or samples of each concentration to the corresponding wells of the detection plate, leaving blank control wells. Cover the plate and place it in a humidified chamber, incubating at 37°C for 2 h. Wash each well four times with 350 µL of Wash Solution, 1-2 minutes each time, ensuring minimal liquid residue. Add 100 µL of Diluent Antibody Solution (Detection Antibody Solution) to each well, cover the plate and place it in a humidified chamber, incubating at 37°C for 1 h. Repeat the washing operation four times, 1-2 minutes each time, ensuring minimal liquid residue. Add 100 µL of HRP-Conjugate Antibody to each well, cover the plate and place it in a humidified chamber, incubating at 37°C for 40 minutes. Repeat the washing operation four times, ensuring minimal liquid residue. Add 100 µL of TMB Substrate Solution to each well, cover the plate and incubate at 37°C in the dark for 15 minutes. The solution turns blue; add 100 µL of Stop Solution to each well, gently shake to mix, the solution turns yellow, and read the value as soon as possible using a NOVOstar microplate reader (absorption wavelength 450 nm).
[0359] statistics
[0360] Data processing and statistical analysis were performed using GraphPad Prism 5 software. Data are expressed as mean ± standard error (mean ± SEM). Differences between groups were compared using one-way ANOVA, and p < 0.03 was considered statistically significant.
[0361] Experimental results
[0362] BV2 cells were cultured in high-glucose DMEM medium supplemented with 10% FBS at 37°C in a 5% CO2 cell culture incubator for 48 hours. The medium was then removed and replaced with high-glucose DMEM medium (without FBS) containing 1 μg / mL LPS. Cells were then co-incubated for 24 hours with different concentrations of d5PAO or PAO. The supernatant was collected, and the concentrations of IL-6 and TNF-α in the medium were detected using ELISA (enzyme-linked immunosorbent assay). The results showed that the concentrations of IL-6 and TNF-α in the supernatant of BV2 cells treated with 1 μg / mL LPS were significantly higher than those in the control (ctrl) group, indicating that treatment with 1 μg / mL LPS promoted the release of inflammatory factors (IL-6 and TNF-α). Figure 20 AD). Compared with the 1 μg / mL LPS treatment group, the positive control drug indomethacin at a concentration of 100 μM significantly inhibited TNF-α secretion (AD). Figure 20Similar to the positive drug results, the supernatant TNF-α concentrations in the groups treated with 1 μg / mL LPS and 12.5 nM, 25 nM, and 50 nM d5PAO, as well as the groups treated with 12.5 nM, 25 nM, and 50 nM PAO, were significantly lower than those in the 1 μg / mL LPS-only group, indicating that d5PAO and PAO can inhibit LPS-induced TNF-α release. ELISA results for IL-6 showed that treatment with certain concentrations of d5PAO and PAO tended to inhibit LPS-induced IL-6 secretion from BV2 cells. Figure 20 CD). The above experiments demonstrate that certain concentrations of d5PAO and PAO can inhibit LPS-induced release of inflammatory factors from BV2 cells.
[0363] Example 10. Comparison of the antitumor effects of d5PAO and PAO
[0364] 1. Pharmacodynamic experiments of PAO and d5PAO on tumor cell models
[0365] Experimental methods
[0366] Cell plating
[0367] Prepare complete culture medium and mix thoroughly. Passage the resuscitated primary tumor cells (Shanghai Ruizhi Chemical Co., Ltd.) approximately two times, selecting cell lines with good growth. For adherent cells: aspirate the culture medium, wash once with trypsin, discard the waste liquid, and add 3 ml of fresh trypsin to the culture flask for digestion. When the cells are loose and about to detach from the flask wall, add 8 ml of complete culture medium to stop the trypsin digestion and gently mix. Transfer the cell suspension to a centrifuge tube using a pipette and centrifuge at 1000 rpm for 4 minutes. For suspension cells: aspirate the cell suspension and transfer to a centrifuge tube, centrifuge at 1000 rpm for 4 minutes. Discard the supernatant. Add an appropriate volume of culture medium to the centrifuge tube and gently pipette to resuspend the cells evenly. Count the cells using a Vi-Cell XR cell counter. Adjust the cell suspension to the appropriate concentration.
[0368] Preparation and addition of compound plates
[0369] Test compounds: Compounds were prepared into 10 mM solutions in DMSO, and compounds PAO and d5PAO were diluted into 0.5 mM solutions in DMSO. The compounds were added to the corresponding cell wells using an HPD300 instrument. Incubation was performed in a CO2 incubator for 72 hours.
[0370] Reagent preparation and testing
[0371] Thaw CellTiter-Glo Buffer at room temperature. Equilibrate the lyophilized CellTiter-Glo substrate to room temperature. Add CellTiter-Glo Buffer to the CellTiter-Glo substrate and mix thoroughly. Remove the cell plate and equilibrate to room temperature. Add 100 μL of the mixed CellTiter-Glo reagent to each well, shake in the dark for 10 minutes, and incubate for 10 minutes. Place the culture plate in an Envision reader and record the luminescence readings; calculate the inhibition rate using the following formula: Inhibition rate (%) = (1 - (RLU compound - RLU blank) / (RLU DMSO – RLU blank)) × 100%. Plot the drug efficacy inhibition rate curve using XLFit and calculate the IC50 value. Use the 4-parameter model [fit = (A + ((BA) / (1 + ((C / x) ^D))))].
[0372] Experimental results:
[0373] As shown in Table 5 below, both d5PAO and PAO have inhibitory effects on the tested tumor cells, and the inhibitory IC50 of both is [missing information]. 50 Similar to other cells, d5PAO had a slightly lower IC50; both showed the strongest inhibitory effects on U2-OS and A-375 cells, with IC50 values of [missing value]. 50 All values were less than 50 nM; they showed strong inhibitory effects on HeLa, SK-HEP-1, Daudi, EL4, HL-60, Jurkat, Clone E6-1, and NAMALWA cells, with IC50 values of less than 50 nM. 50 The inhibitory effect was weakest against A-431 cells (IC50: 300 nM) at 50-100 nM, while the IC50 for other cell types was between 100-200 nM. Compared to PAO (the original compound) and d5PAO (five deuterated compounds), a single deuterated compound, d1PAO, showed an effective inhibitory concentration greater than 200 nM against most tumor cells, indicating that its inhibitory effect on tumor cells was not as strong as that of PAO and d5PAO.
[0374] Table 5. List of inhibitory effects of d5PAO and PAO on tumor cells (cultured for 72 hours)
[0375]
[0376] 2. Pharmacodynamic experiments of PAO and d5PAO on mouse tumor models
[0377] Laboratory animals were housed in an SPF-grade barrier facility at the Animal Center of Beijing Biocytogen Biotechnology Co., Ltd. The barrier system maintained a temperature of 20-26℃ and humidity of 40-70%. Lighting was alternated every 12 hours. SPF-grade growth and reproduction feed was purchased from Beijing Keao Xieli Feed Co., Ltd. Drinking water was acidified (pH 2.5-3.0) and autoclaved. Animals had free access to sterile food and water.
[0378] 2.1 Inhibitory effect of PAO on breast cancer
[0379] Experimental methods:
[0380] Vaccination and grouping in the PDX model
[0381] The PDX tumor to be inoculated grew to 800-1000 mm 3 After lateral ... 3 Mice with moderate tumor volume were selected for the experiment and randomly assigned to four experimental groups (n=8 per group) based on tumor volume. Drug administration began on the day of group assignment. All groups received the test drug orally (PO) once daily for a total of 20 doses. Paclitaxel was administered intravenously (iv) once weekly for a total of four doses. At the end of the experiment or when a humane endpoint was reached, the animals were euthanized using an excess of CO2.
[0382] Tumor volume: After grouping, tumor volume was measured twice a week using calipers. Tumor volume was also measured before euthanasia, including both the major and minor diameters. The volume was calculated using the formula: Tumor volume = 0.5 × major diameter × minor diameter 2 .
[0383] Weight monitoring: Animals were weighed after vaccination, grouping (i.e., before the first administration), twice a week during administration, and before euthanasia.
[0384] Drug evaluation indicators:
[0385] Tumor volume inhibition rate (TGI) TV )
[0386] TGI (%) = [1-(Ti-T0) / (Vi-V0)] × 100%
[0387] (Ti: mean tumor volume on day i of drug administration in the treatment group; T0: mean tumor volume on day 0 of drug administration in the treatment group; Vi: mean tumor volume on day i of drug administration in the solvent control group; V0: mean tumor volume on day 0 of drug administration in the solvent control group)
[0388] Tumor weight inhibition rate (TGI) TW ):
[0389] At the end of the experiment, surviving animals were euthanized, tumor tissue was removed, and the tumor weight was measured to calculate the tumor weight for each group. 差异 To further calculate the tumor weight suppression rate (TGI) TW The calculation formula is as follows:
[0390] Tumor weight inhibition rate TGI TW %= (W 溶剂对照组 - W 治疗组 ) / W 溶剂对照组 ×100%, where W refers to tumor weight.
[0391] Data collection and statistical analysis:
[0392] The raw data were analyzed, and the results are expressed as mean ± SEM. Statistical analysis was performed on tumor volume, with P < 0.05 considered statistically significant. Both statistical and biological significance were considered in the analysis.
[0393] Experimental results:
[0394] During the experiment, all animals maintained good activity and appetite during the drug administration period. The body weight of non-tumor-bearing mice increased to some extent, while the body weight of tumor-bearing mice decreased slightly, indicating that the animals tolerated the test products well. On day 21 of drug administration, the average tumor volume in the solvent control group G1 was 436 ± 40 mm. 3 The mean tumor volume in the treatment groups G2 (PAO, 2 mg / Kg), G3 (paclitaxel, 7 mg / Kg), and G4 (paclitaxel 7 mg / Kg + PAO, 2 mg / Kg) was 519 ± 96 mm. 3 290±63mm 3 162 ±26 mm 3 Tumor growth inhibition rate (TGI) TV The percentages were -25.7%, 44.8%, and 84.1%, respectively (P=0.01). The results indicate that the combination of PAO and paclitaxel can effectively inhibit tumor volume growth. Figure 21 ).
[0395] 2.2 Inhibitory effect of PAO on lymphoma
[0396] Experimental methods:
[0397] Mouse lymphoma SU-DHL-1 cells were purchased from ATCC and cultured in an incubator at 37°C and 5% CO2. The culture medium consisted of Dulbecco's Modified Eagle's medium containing 10% inactivated fetal bovine serum.
[0398] Inoculation and grouping of tumor cells:
[0399] SU-DHL-1 lymphoma cells resuspended in PBS were charged at 1×10⁻⁶. 7 A concentration of 0.1 mL / mole was administered subcutaneously to the right side of B-NDG humanized mice. The tumor volume was 0.1 mL / mouse. Induction was performed when the average tumor volume reached approximately 100 mm. 3 Thirty-six mice with suitable individual tumor volumes were selected for the study and randomly assigned to six experimental groups of six mice each, based on tumor volume. Drug administration began on the day of group assignment. The test drug PAO was administered once daily for a total of 17 doses. Cyclophosphamide was administered subcutaneously (iv) once weekly for a total of four doses. At the end of the experiment or when a humane endpoint was reached, the animals were euthanized using an excess of CO2.
[0400] Experimental results:
[0401] During the experiment, all animals maintained good activity and appetite during the drug administration period. The body weight of non-tumor-bearing mice increased to some extent, while the body weight of tumor-bearing mice decreased slightly, indicating that the animals tolerated the test products well. On day 17 of group drug administration, the average tumor volume in the solvent control group G1 was 3899 ± 272 mm. 3 The mean tumor volume in the treatment groups G2 (cyclophosphamide, 50 mg / Kg), G3, G4, G5 (PAO, 0.3 mg / Kg, 0.6 mg / Kg, 1.2 mg / Kg), and G6 (cyclophosphamide 50 mg / Kg + PAO 0.6 mg / Kg) was 367 ± 79 mm. 3 3427±128 mm 3 3784 ±114 mm 3 3735±205 mm 3 497±106 mm 3 Tumor growth inhibition rate (TGI) TV The percentages were -93% (**P<0.001), 17.2%, 3%, 4.3%, and 89.9% (P<0.001**), respectively. The experimental results were also confirmed in tumor weight. Cyclophosphamide effectively inhibited the growth of lymphoma tumor volume, and the combination of PAO and cyclophosphamide failed to further enhance the inhibitory effect (Figure 22).
[0402] 2.3 Inhibitory effect of d5PAO on melanoma
[0403] Experimental methods:
[0404] A2058 cells were fed at a rate of 1×10 7 A concentration of 0.1 mL / mole was administered subcutaneously to the right side of B-NDG mice at a dose of 0.1 mL / mouse. The tumor volume was increased when the average tumor volume reached approximately 100 mm. 3 Forty-eight mice with suitable tumor volumes were selected and enrolled. The animals were randomly assigned to six experimental groups (n=8 per group) based on tumor volume: G3 (saline / solvent), G4 (d5PAO, 0.5 mg / kg), G5 (d5PAO, 1.5 mg / kg), G6 (temozolomide, 30 mg / kg + d5PAO, 0.5 mg / kg), G7 (temozolomide, 30 mg / kg + d5PAO, 1.5 mg / kg), and G8 (temozolomide, 30 mg / kg). Simultaneously, 16 non-tumor-bearing mice were selected based on body weight and randomly divided into two experimental groups (n=8 per group): G1 (saline / solvent) and G2 (d5PAO, 1.5 mg / kg). All mice were administered the drug via gavage, starting on the day of group assignment. The test drug d5PAO was administered once daily for a total of 23 doses. The test drug temozolomide was administered four times a week for a total of 12 weeks. Mouse body weight and tumor volume were measured twice weekly during the administration and observation periods, and the measurements were recorded. Figure 23 At the end of the experiment, the animals were euthanized, the tumors were removed, weighed, photographed, and the tumor growth inhibition rate (TGI%) was calculated.
[0405] Experimental results:
[0406] During the experiment, all animals maintained good activity and appetite during the administration period. The body weight of non-tumor-bearing mice increased to some extent, while the body weight of tumor-bearing mice decreased slightly, indicating that the animals tolerated the test products well. On day 25 of group administration, the average tumor volume in the solvent control group G3 was 2806 ± 240 mm. 3 The mean tumor volume in the treatment groups G4 (d5PAO 0.5 mg / Kg), G5 (d5PAO 1.5 mg / Kg), G6 (temozolomide 30 mg / Kg + d5PAO 0.5 mg / Kg), G7 (temozolomide 30 mg / Kg + d5PAO 1.5 mg / Kg), and G8 (temozolomide 30 mg / Kg) was 2907 ± 295 mm. 3 2180±312 mm 3 1064 ±164 mm 3 1213 ±155 mm 3 1480±136mm3 Tumor growth inhibition rate (TGI) TV The percentages were -3.7%, 23.2%, 64.5%, 58.9%, and 49.1%, respectively. The experimental results were also confirmed in tumor weight. The tumor tissue weights obtained from the animals at the test endpoint were as follows: G3 group (solvent / saline), 3.413±0.253 g; G4 group (d5PAO 0.5 mg / kg), 3.557±0.379 g; G5 group (d5PAO 1.5 mg / kg), 2.744±0.459 g; G6 group (temozolomide 30 mg / kg + d5PAO 0.5 mg / kg), 1.413±0.233 g; G7 group (temozolomide 30 mg / kg + d5PAO 1.5 mg / kg), 1.442±0.251 g; G8 group (temozolomide 30 mg / kg), 1.884±0.217 g. Figure 24 ).
[0407] Compared with the control group G3, temozolomide at a dose of 30 mg / kg, when used alone, and in combination with d5PAO at doses of 0.5 mg / kg and 1.5 mg / kg, both showed a highly significant inhibitory effect on the growth of A2058 subcutaneous xenografts (P<0.001). The combination therapy further enhanced the inhibitory effect compared to temozolomide alone.
[0408] Example 11. Comparison of the effects of d5PAO and PAO on anti-tumor cachexia
[0409] Cancer is the second leading cause of death worldwide, accounting for nearly one-sixth of all deaths globally. Cancer treatment primarily utilizes methods such as chemotherapy, radiation therapy, surgery, immunotherapy, gene therapy, and hormone therapy. Chemotherapy is currently one of the most effective treatments. However, a major problem with chemotherapy is its side effects: while killing cancer cells, the drugs also kill rapidly growing cells in the body, including those in the blood, mouth, digestive system, and hair follicles, leading to digestive problems, hair loss, bone marrow suppression, and functional decline in other systems.
[0410] Cachexia, also known as blood cachexia, is characterized by extreme emaciation, weight loss, fat loss, and decreased dissolution of skeletal and cardiac muscle, leading to progressive functional impairment and ultimately systemic failure. Cachexia is often caused by severe chronic wasting diseases, including cancer, AIDS, severe trauma, post-surgery, malabsorption, and severe sepsis. Cachexia associated with cancer is the most common, also known as cancer cachexia. 31-87% of patients with malignant tumors have cachexia, and approximately 20% of cancer patients die directly from malnutrition caused by cachexia, rather than the disease itself. Cachexia is particularly strongly associated with pancreatic cancer, gastric cancer, lung cancer, and liver cancer. Cachexia directly affects the effectiveness of cancer treatment, increases the incidence of complications, reduces quality of life, shortens survival time, prolongs treatment duration, and increases medical costs.
[0411] The causes of cachexia are not fully understood, but recent research has gradually revealed various pathogenic factors released from tumor cells or cells in their surrounding environment. Slowing down or preventing the development of cancer cachexia can improve patients' quality of life and prolong survival, making it a major component of anti-cancer treatment regimens. Animal model studies have shown that preventing weight loss during tumor development can extend survival rates. The main approach to treating cachexia in cancer patients is to reverse weight loss and muscle mass loss through medication. To date, most first-line anti-cachexia drugs have very limited effectiveness in preventing and treating cancer cachexia.
[0412] 1. Effects of PAO and d5PAO on body weight in healthy mice
[0413] Twenty-two 2-month-old and twenty 6-month-old male C57B / 6 mice were used, with 5-6 mice per cage. Twelve 2-month-old mice and ten 6-month-old mice were administered d5PAO dissolved in MCT solvent at a dose of 2.1 mg / kg daily. The remaining ten 2-month-old and ten 6-month-old mice were administered PAO dissolved in MCT solvent at a dose of 2.0 mg / kg daily. Starting from the first day of administration, the weight of each mouse was measured and recorded before administration on the first day of every four days. Based on this weight, the appropriate dose of PAO or d5PAO was administered via gavage over the following four days. The number of surviving mice was recorded every four days.
[0414] The results are as follows Figure 25As shown, for 2-month-old d5PAO and PAO mice (2M-d5PAO and 2M-PAO), the average body weight of the two groups of mice was exactly the same during the first 24 days after gavage administration, and gradually increased. After 24 days, the body weight of the mice in both groups decreased, but the body weight of the 2M-PAO group decreased significantly faster than that of the 2M-d5PAO group. Furthermore, one mouse in the 2M-d5PAO group died between days 44 and 48 after administration, while there were no deaths in the 2M-d5PAO group. For 6-month-old d5PAO and PAO mice (6M-d5PAO and 6M-PAO), the average body weight of the mice in both groups decreased slowly and fluctuated throughout the 48 days after gavage administration. However, from day 32 onwards, the body weight loss in the 6M-PAO group was significantly faster than that in the 6M-d5PAO group, and there were animal deaths in both groups, with 5 mice (50%) in the 6M-PAO group and 2 mice (20%) in the 6M-d5PAO group. Therefore, the toxicity of d5PAO administered by gavage is significantly lower than that of 6M-PAO.
[0415] 2. Effects of PAO on body weight in tumor model animals
[0416] 2.1 Effect of PAO on body weight in a mouse model of breast cancer
[0417] Paclitaxel injection caused weight loss in animals. On day 21, the weight loss decreased from 101.4% ± 1.6% (solvent group, relative to Day 0 mean body weight) to 94.3% ± 2.6% (paclitaxel group 7 mg / kg, relative to Day 0 mean body weight, P = 0.036*). The addition of PAO prevented the weight loss induced by paclitaxel (105.3% ± 2.4%, P = 0.187). Notably, PAO itself also increased the body weight of tumor-bearing animals (106.1% ± 2.5%, P = 0.128). Figure 26 ).
[0418] 2.2 Effect of PAO on body weight in pancreatic cancer model
[0419] The pancreatic cancer model was established in the same manner as above. On day 28 of treatment, the mean body weight of the gemcitabine (1.5 mg / kg) and paclitaxel (7 mg / kg) groups (104.3% ± 4.0%, relative to the mean body weight on Day 0) was not significantly different from that of the solvent group (99.0% ± 2.2%, relative to the mean body weight on Day 0). However, the addition of PAO increased body weight to 116.7% ± 3.9% (P = 0.002 vs. the solvent group and the gemcitabine + paclitaxel group). Figure 27 ).
[0420] 2.3 Effects of PAO on body weight in lymphoma model animals
[0421] The lymphoma model was established in the same manner as above. Although the addition of PAO failed to further inhibit tumor growth, it alleviated the weight loss induced by cyclophosphamide injection. On day 17 of treatment, the animals' body weight decreased from 117.4% ± 1.4% (G1 solvent group, relative to the average body weight on Day 0) to 104.7% ± 1.6% (G2, cyclophosphamide group 50 mg / Kg, relative to the average body weight on Day 0, P < 0.01*). The combination of PAO (0.6 mg-0.9 mg / Kg) and cyclophosphamide alleviated the weight loss induced by cyclophosphamide (G6 111.1% ± 1.9%, P = 0.032 vs. solvent group, P = 0.05 vs. cyclophosphamide group). Figure 28 ).
[0422] 2.4 Effects of d5PAO on body weight in melanoma model animals
[0423] Compared with healthy mice, all tumor-bearing animals showed a decrease in body weight. Compared with the solvent group, temozolomide alone at a dose of 30 mg / kg resulted in a decrease in body weight (88% ± 1.5%, relative to Day 0), while the combined use of high-dose d5PAO (1.5 mg / kg) with temozolomide alleviated the weight loss (95% ± 2%, P = 0.01 vs. temozolomide; P = 0.038 vs. solvent group). d5PAO alone had no significant effect on the body weight of tumor-bearing animals. Figure 29 ).
[0424] Example 12. Inhibitory effects of PAO and d5PAO on HCoV 229E (influenza coronavirus)
[0425] Test compound and control compound
[0426] The control compound, Remdesivir, will be provided by WuXi AppTec. The compound will be prepared as a 20 mM stock solution using DMSO. Eight concentrations of both the test sample and the control compound will be tested, with 2- or 3-fold serial dilutions in duplicate.
[0427] Cell lines, virus strains and reagents
[0428] MRC5 cells and HCoV 229E strain were purchased from ATCC. Cells were cultured in EMEM (Sigma) medium supplemented with 10% fetal bovine serum (Hyclone), 1% penicillin-dextrin (Hyclone), 1% L-glutamine (Gibco), and 1% non-essential amino acids (Gibco). Experimental culture media supplemented with 5% fetal bovine serum (Hyclone), 1% penicillin-dextrin (Hyclone), 1% L-glutamine (Gibco), and 1% non-essential amino acids (Gibco) were used. The main reagent used in this project was the CellTiter-Glo (Promega) cell viability assay kit.
[0429] Test methods
[0430] MRC5 cells were seeded at a density of 20,000 cells per well in 96-well test plates and incubated overnight in a 5% CO2, 37°C incubator. The next day, serially diluted compounds (8 concentration points, 2- or 3-fold serial dilutions, double replicates) were added, followed by the addition of virus at 200 TCID⁻¹ per well. 50 Cells were added. A cell control (cells, no compound treatment or viral infection), a virus control (cells infected with virus, no compound treatment), and a culture medium control (culture medium only) were set up. The final concentration of DMSO in the culture medium was 0.5%. Cells were cultured in an incubator for 3 days. Cytotoxicity and antiviral experiments were performed simultaneously under identical conditions, but without viral infection. Cell viability was assessed using the CellTiter Glo (Promega) cell viability assay kit. The antiviral activity and cytotoxicity of the compounds were expressed as the inhibition rate (%) of the compound's effect on virus-induced cytopathic effects and the viability (%) of MRC5 cells at different concentrations, respectively. The calculation formulas are as follows:
[0431] Inhibition rate (%) = (Test well reading - Average value of virus control) / (Average value of cell control - Average value of virus control) × 100
[0432] Cell viability (%) = (Test well reading - Average value of culture medium control) / (Average value of cell control - Average value of culture medium control) (Average) × 100
[0433] The inhibition rate and cell viability of the compound were analyzed using nonlinear fitting analysis with GraphPad Prism (version 5) to calculate the half-maximal effective concentration (EC50) of the compound. 50 ) and half-maximal cytotoxic concentration (CC) 50 The fitting formula is: log(inhibitor) vs. response -- Variable slope.
[0434] result
[0435] The dose-response curves for PAO and d5PAO are shown below. Figure 30 The control compound, Remdesivir, showed the expected antiviral activity and cytotoxicity.
[0436] Test results showed that the tested compounds PAO and P100 had antiviral activity against HCoV 229E, and their EC50... 50 The values were 55.35 nM and 47.21 nM, respectively. The tested compounds PAO and P100 showed significant toxicity to MRC5 cells, with their CC values being 55.35 nM and 47.21 nM, respectively. 50 The values are 256.8 nM and 317.5 nM, respectively.
[0437] Example 13. Comparison of the anti-anxiety and antidepressant effects of low-dose d5PAO and PAO
[0438] experimental animals
[0439] Thirty male 2-month-old ICR mice were housed in a clean-grade mouse room under normal circadian rhythm and other conditions for 8 weeks. They were then randomly divided into three groups: carrier, PAO, and d5PAO groups. Five mice were placed in one cage, with two cages in each group. Each group was given chronic unpredictable multiple stimulation (CUMS).
[0440] CUMS Depression Model
[0441] CUMS Depression Model: Mice were given multiple stimuli alternately each day of the week to make the duration of each stimulus unpredictable, as well as the pattern and duration of the next stimulus. The stimulus and time schedule for the first week is shown in Table 6. The stimulus pattern and time for each day in the table constitute a module, for a total of 7 modules. From the second week onwards, the stimulus for Monday was randomly selected from the 7 modules, Tuesday from the remaining 6, Wednesday from the remaining 5, and so on. If a test experiment was scheduled for a particular day, the stimuli for the previous two days and the test day were adjusted accordingly.
[0442] Table 6. CUMS Stimulation Schedule
[0443]
[0444] Administration method
[0445] After completing the first week of CUMS stimulation, mice in the PAO and d5PAO groups were administered PAO and d5PAO compound solutions daily by gavage at a dose of 0.05 mg / kg / day, respectively. Mice in the carrier group were administered a daily gavage of MCT (MIGLYOL 812N, supplier IOI Oleo GmbH), a carrier used to prepare solutions of PAO and d5PAO compounds. The concentration of the MCT solution for both PAO and d5PAO was 0.005 mg / mL.
[0446] Novelty Suppression Feeding Test (NSF)
[0447] The novelty-suppressed feeding test (NSF) involves a box made of opaque plexiglass, measuring 25 cm x 25 cm x 20 cm, with only the top open. A small platform with a single piece of mouse food is placed in the center. During the test, a mouse is placed into the box from any corner, facing that corner, and allowed free movement for 5 minutes without any disturbances. The latency of the first feeding within those 5 minutes is recorded. If the mouse does not feed after 5 minutes, it is removed, and the latency of its first feeding is recorded as 300 seconds. The length of this latency (in seconds) represents the mouse's anxiety level.
[0448] Depressive Behavioral Indicators: Sugar Water Preference Test
[0449] In a sucrose preference test, two pre-weighed identical water bottles were placed at the water supply point of a clean mouse cage. One bottle contained water, and the other contained a 1% sucrose solution. During the test, a mouse was placed at the end of the clean cage furthest from the water bottle, with its head facing the opposite direction. The mouse was allowed free choice to drink either the sucrose solution or water for one hour without disturbance. After one hour, the mouse was removed, and both water bottles were carefully taken out and weighed to calculate the weight of the sucrose solution and water consumed by the mouse, denoted as W. 水 and W 糖水 Mouse preference for sucrose solution = W 糖水 / (W) 水 and W 糖水 ) × 100%.
[0450] Statistical methods
[0451] use SPSS The software performs statistical analysis, and the data is expressed as mean ± standard error. (± sem) is used. Since PAO is known to have antidepressant effects, differences in sucrose preference between the PAO and d5PAO groups and the carrier group after administration were expressed using one-tail unpaired data.t The test is used to determine the significance of the test. P < 0.05 is marked as *, and P < 0.01 is marked as **.
[0452] result
[0453] Three groups of mice underwent a 3-week CUMS trial and were subsequently administered a novelty food intake suppression (NSF) test after 15 days of gavage with the carrier (MCT), PAO, and d5PAO formulations, respectively. The results showed that only 2 out of 10 mice in the carrier group ate, while the remaining 8 did not eat within the specified 5-minute timeframe (latency period was 300 seconds). The average anxiety index in this group was 282 ± 12 seconds. The average anxiety indices in the PAO and d5PAO groups were 227 ± 29 seconds and 181 ± 36 seconds, respectively, significantly lower than those in the carrier group. This suggests that low-dose (0.05 mg / kg / day) PAO and d5PAO also have significant anxiolytic effects, with d5PAO showing a more significant anxiolytic effect than d5PAO. Figure 31 ).
[0454] Forty-eight hours after completing the NSF test, the three groups of mice underwent a sucrose preference test to assess the degree of depression in the three groups of mice. Figure 27 As shown, the preference for sucrose water among the three groups of mice (carrier, PAO, and d5PAO) was 66±3.8%, 75±4.3%, and 78±2.4%, respectively. The preference for sucrose water was significantly higher in the PAO and d5PAO groups than in the carrier group, suggesting that low-dose (0.05 mg / Kg / day) PAO and d5PAO also have significant antidepressant effects, and that d5PAO has a more significant antidepressant effect than PAO. Figure 32 After the first saccharide preference test, the three groups of mice were given CUMS for a total of 38 days, and then the saccharide preference test was repeated. The results showed that the preference for saccharide in the carrier, PAO, and d5PAO groups was 71±3.5%, 77±2.0%, and 82±2.9%, respectively. The PAO and d5PAO groups showed a higher preference for saccharide than the carrier group, but the difference between the PAO and carrier groups was not statistically significant. This suggests that low doses (0.05 mg / Kg / day) of PAO and d5PAO still have antidepressant effects, and the antidepressant effect of d5PAO is more significant and stable than that of d5PAO. Figure 32 ).
[0455] Example 14. Study on the therapeutic effects of d5PAO and PAO on NPC
[0456] U18666A is an intracellular cholesterol transport inhibitor that is often used to construct cell models of Niemann's disease type C (NPC).
[0457] 1. Cell Culture and Compound Treatment
[0458] SH-SY5Y cells were cultured in a complete medium of high-glucose DMEM with 15% FBS at 37°C in a 5% CO2 incubator. When the cells reached 70% confluence, 10 μM U18666A (purchased from Absin Biotech (Shanghai) Co., Ltd., catalog number: abs819512) was added, along with different depths of d5PAO and PAO according to the cell groups, and the cells were cultured for 24 hours.
[0459] 2. Filipin staining
[0460] 1) Discard the culture medium in the 24-well plate, add 1 mL of PBS buffer, let stand for 1 minute, discard the liquid in the 24-well plate, and repeat this step twice.
[0461] 2) Add 1 mL of 4% paraformaldehyde to each well and fix at room temperature for 30 minutes;
[0462] 3) Discard the 4% paraformaldehyde in the 24-well plate, add 1 mL of PBS buffer, gently shake the 24-well plate for 1 minute, discard the liquid in the 24-well plate, and repeat this step twice.
[0463] 4) Add 1 mL of 1.5 mg / mL glycine solution to each well and incubate at room temperature for 10 minutes;
[0464] 5) Discard the liquid in the 24-well plate, add 1 mL of Filipin staining solution (purchased from Sigma-Aldrich, catalog number: SAE0087) with a final concentration of 50 μg / mL, and incubate at room temperature for 1 hour, avoiding light;
[0465] 6) Discard the liquid in the 24-well plate, add 1 mL of PBS buffer, gently shake the 24-well plate for 1 minute, discard the liquid in the 24-well plate, and repeat this step twice.
[0466] 7) Take a glass slide, add 5 μL of mounting medium (containing DAPI) to the center of the slide, remove the cell smear and let it dry, then place the cell-containing side down on the glass slide, ensuring full contact with the mounting medium, and incubate at room temperature in the dark for 30 minutes.
[0467] 8) Observation using laser confocal microscopy.
[0468] Experimental results
[0469] SH-SY5Y cells were treated with 10 μM U18666A, and different concentrations of d5PAO and PAO were added according to the grouping. After incubation for 24 hours, Filipin staining was performed and observed. Immunofluorescence staining results showed that the Filipin fluorescence intensity in the 10 μM U18666A-treated group was significantly higher than that in the control group (ctrl), suggesting that 10 μM U18666A treatment led to an increase in the amount of cholesterol bound to Filipin, i.e., cholesterol accumulation. The Filipin fluorescence intensity in the groups treated with 10 μM U18666A in combination with 35 nM, 70 nM d5PAO, and 35 nM d5PAO and 70 nM PAO was decreased compared to the 10 μM U18666A-treated group. Figure 33 The above results indicate that certain concentrations of d5PAO and PAO can inhibit cholesterol accumulation caused by U18666A.
[0470] Example 15. PAO and knockdown PI4Ka Activation of the autophagy-lysosome pathway (ALP)
[0471] Previous studies have shown that ALP is blocked during the development of lysosomal storage diseases such as Graves' disease (GD). SH-SY5Y cells were treated with CBE for 48 hours, and then different concentrations of PAO or the mTOR inhibitor rapamycin (RAPA) were added as positive controls according to their grouping. After incubation for 24 hours, Western blotting or immunofluorescence experiments were performed to investigate the effects of PAO and other compounds on the autophagy-lysosomal pathway by observing common ALP markers. Common ALP markers LC3B and p62 were detected. Western blotting experiments showed that in the SH-SY5Y cell model constructed by CBE, PAO dose-dependently promoted LC3B protein expression and inhibited p62 protein levels, indicating that PAO activates the ALP pathway and activates autophagic flux. Figure 34 AC), similar to the positive control 500 nM RAPA results ( Figure 34 AC). The immunofluorescence results were consistent with the results of the Western blot experiment. Figure 34 D). In addition, H +Bafilomycin A1 (Baf-A1), an ATPase inhibitor, is a commonly used ALP inhibitor. Blocking ALP signaling with Baf-A1 can further verify whether the protective effect of compounds such as PAO on CBE-constructed SH-SY5Y cells is related to ALP. SH-SY5Y cells were treated with CBE for 48 hours, and then incubated for 24 hours with different concentrations of PAO or 50 nM Baf-A1 according to their grouping. Cell viability was assessed by MTT assay. The results showed that, compared with the control group (ctrl), 100 μM CBE significantly inhibited SH-SY5Y cell viability. Compared with the 100 μM CBE treatment group, the cell viability of the co-treatment groups of 100 μM CBE with 25 nM, 50 nM, and 75 nM PAO was significantly increased. Treatment with 50 nM Baf-A1 decreased the protective effect of PAO in the corresponding groups. There was no significant difference in cell viability between the 50 nM Baf-A1 and 100 μM CBE co-treatment groups with 25 nM, 50 nM, and 75 nM PAO and the 100 μM CBE treatment group. Figure 34 E), indicating that Baf-A1 blocks the protective effect of PAO on CBE-treated SH-SY5Y cells by inhibiting ALP signaling. These results confirm that PAO activates ALP, thereby activating autophagic flux and exerting a protective effect on the GD cell model through ALP. The ALP pathway marker LC3B was detected in SH-SY5Y cells treated with shRNA-interfered lentiviral vectors. The results showed that compared with the sh-ctrl group, the LC3B protein level was significantly increased after knocking down PI4Ka (E). Figure 35 In CBE-treated SH-SY5Y cells, knockdown of PI4Ka also promoted LC3B protein expression, indicating that, similar to the results of the PI4Ka inhibitor PAO, knockdown of PI4Ka also activated the ALP pathway.
[0472] Example 16. PAO and d5PAO anti-chemical factor-induced pneumonia response and pulmonary fibrosis
[0473] The lungs and upper respiratory tract are the organs and tissues most frequently subjected to inflammatory responses caused by various factors, including pathogens, chemical agents (such as drugs and foreign bodies), physical damage to tissues, allergic reactions, and autoimmune abnormalities. These inflammatory responses include an increase in white blood cells (such as neutrophils, macrophages, and lymphocytes) in local tissues or systemic blood, as well as an increase in various inflammatory factors or cytokines. Pathogens include microorganisms and parasites. Microorganisms include bacteria, viruses, chlamydia, mycoplasma, spirochetes, and fungi. Lung inflammation can sometimes lead to pulmonary fibrosis, impairing lung structure and function, particularly ventilation and oxygen diffusion.
[0474] Bleomycin is a known drug or chemical that can cause pneumonia and pulmonary fibrosis. Its induction of interstitial pneumonia and pulmonary fibrosis in animal lungs is a commonly used model for studying idiopathic pulmonary fibrosis (IPF). IPF is a fatal disease characterized by progressive and irreversible pulmonary fibrosis. Currently, there is no specific treatment, and existing treatments are not very effective. Most patients die from progressive respiratory failure within 3–8 years after symptom onset. Although the basic mechanisms of IPF pathogenesis are poorly understood, key pathological features include inflammatory responses, excessive fibroblast proliferation, and abnormal extracellular matrix deposition.
[0475] The efficacy of PAO and d5PAO in treating bleomycin-induced pneumonia and pulmonary fibrosis in mice is an example of the application of PAO and d5PAO in inflammatory responses and tissue fibrosis.
[0476] Experimental methods:
[0477] Bleomycin induction
[0478] 1. Preparation of bleomycin
[0479] Bleomycin is dissolved in physiological saline, and the final concentration is adjusted according to the dosage.
[0480] 2. Induction methods
[0481] On day 1, animals will be anesthetized by inhaling 2-5% isoflurane. Based on body weight, animals will be administered bleomycin (2 mg / kg, the specific volume to be administered will be calculated and recorded based on the animal's body weight) via tracheal administration.
[0482] 3. Administration
[0483] The day of bleomycin induction is considered Day 1 of the experiment. Animals were screened and grouped on Day 3. All animals will begin administration on Day 8 of the experiment, once daily until the end of the experiment; the specific dosing regimen is shown in Table 7.
[0484] Table 7. Grouping and Dosing Regimens
[0485]
[0486] a: MCT
[0487] 4. Sample collection and analysis
[0488] On day 21, after all animals underwent airway responsiveness testing following drug administration, at least 0.5 mL of whole blood was collected from all animals via the orbital cavity after anesthesia with inhalation of 2-5% isoflurane. The blood was anticoagulated with EDTA-2K, and the plasma was centrifuged at 10,000 rpm for 10 minutes at 4°C and stored at -80°C. After blood collection, the animals were anesthetized with salbutamol (intraperitoneal injection, 25-50 mg / kg, containing 1 mg / mL toluidine) and endotracheally intubated. The lungs were first lavaged with 0.5 mL of PBS (containing 1% FBS). A second lavage was performed with an additional 0.5 mL of PBS (containing 1% FBS). 100 μL of the suspension was collected for total cell count in the BALF. Bronchoalveolar lavage fluid (BALF) was centrifuged at 300g for 5 minutes at 4°C. The supernatant of the collected BALF, free of cell clumps, was analyzed using electrochemiluminescence immunoassay (Merck's MSD Mouse Factor 10 Assay Kit, V-PLEX Proinflammatory Panel 1 Mouse Ki, catalog number 15048D-X) to detect the concentrations of inflammatory and cytokine factors such as TNF-α, IL-1β, IL-6, and IFN-γ in mouse BALF. The cell clumps obtained after centrifugation were resuspended for smear preparation and stained with Wright-Giemsa staining solution to distinguish eosinophils, neutrophils, macrophages, and lymphocytes. Cells were counted under a light microscope.
[0489] After irrigation, the animals were euthanized by cervical spondylosis. Lung tissue was collected, the right lung was cryopreserved, homogenized, and total protein was extracted. The contents of type I collagen, hyaluronic acid, and α-SMA were detected using a commercially available ELISA kit, with replicate loading for all samples.
[0490] Left lungs were collected, fixed in neutral formaldehyde, and three segments were cut from the left lung of each animal. The segments were then embedded in a paraffin block to prepare paraffin-embedded and 5-micrometer-thick ultrathin sections. Masson's staining was performed on each section before histopathological evaluation.
[0491] ELISA test method for plasma hyaluronic acid and collagen levels
[0492] Hyaluronic acid and type I collagen in the plasma of mice in each group were detected according to the product instructions of the Hyaluronic Acid ELISA Kit (Mouse Quantikine ELISA Kit, Biotechne, catalog number: DHYAL0) and the Collagen Type I ELISA Kit (Mouse Type I Collagen Detection ELISA Kit, Chondrex, catalog number: 6012).
[0493] detection indicators
[0494] 1. Weight
[0495] Throughout the experimental period, the animals were weighed once on the day of model creation, once on the day of grouping, and three times a week after grouping, and their weight was recorded.
[0496] 2. Lung function test
[0497] Lung function was assessed in mice to measure airway hyperresponsiveness using an unconstrained whole-body plethysmograph (WBP) system. First, mice were nebulized with PBS solution, followed by continuous nebulization with methacholine (Mch) at concentrations of 1.5625, 3.125, 6.25, 12.5, 25, and 50 mg / mL. The enhanced expiratory interval (Penh) was measured at each concentration, with stimulation lasting 90 seconds. The rate of change of Penh relative to baseline was plotted against Mch concentration, and the area under the curve was calculated.
[0498] 3. Pathological evaluation
[0499] The left lung of each animal was cut into three segments and embedded in a paraffin block. Paraffin embedding and ultrathin sections with a thickness of 5 micrometers were prepared. One section was prepared from each paraffin block, stained with Masson stain, and used for fibrosis evaluation. The scoring criteria are shown in Table 8.
[0500] Table 8. Fibrosis Scoring Criteria
[0501]
[0502] Detection of type I collagen content, hyaluronic acid, α-SMA and ten factors including TNF-α, IL-1β, and IL-6.
[0503] The collected right lung tissue will be homogenized and analyzed according to the instructions of a commercially available diagnostic kit to determine the content of type I collagen, hyaluronic acid, and α-SMA; the expression of cytokines in BALF will be measured using an MSD kit.
[0504] The cell-free BALF supernatant was collected and the expression of cytokines (including TNF-α, IL-1β, and IL-6, etc.) in the BALF was measured using an MSD kit. The samples were loaded onto duplicate wells.
[0505] Experimental observation
[0506] Observe the animals' health status twice a day at the edge of their cages and record it in the animal room log.
[0507] While weighing the animals, project team members should separately observe their condition, and any abnormal appearance or behavior should be recorded in detail in the Pengli Biotechnology Experiment Observation Form. For example, if the animal's weight drops significantly (more than 15%) or other side effects occur after administration (such as lethargy, inactivity, or mental fatigue), such events should be immediately reported to the client, and the client should be consulted on whether to change the dosage or administration regimen.
[0508] Statistical analysis:
[0509] Experimental data are expressed as mean ± standard error (mean ± SEM). SPSS or Graphpad Prism were used to analyze the data. The specific analytical methods used will be explained in the legends and footnotes below the tables. P A value <0.05 is considered statistically significant.
[0510] Experimental results:
[0511] Airway hyperresponsiveness in mice was assessed using a WBP system. First, mice were nebulized with PBS solution, followed by continuous nebulization with methacholine (Mch) at concentrations of 1.5625, 3.125, 6.25, 12.5, 25, and 50 mg / mL. Enhanced expiratory interval (Penh) was measured at each concentration, with stimulation lasting 90 seconds at each concentration. The percentage of Penh relative to baseline for each mouse at PBS and different Mch concentrations was calculated. The results are shown in Table 9, and a curve of the rate of change of Penh relative to baseline versus Mch concentration was plotted. Figure 36 The area under the curves was calculated (Table 10). These results suggest that PAO and d5PAO can effectively improve the damage to lung function caused by pulmonary fibrosis, and that d5PAO is more effective than PAO.
[0512] The 10 inflammatory and cytokine factors, including TNF-α, IL-1β, and IL-6, in the BALF of each group of animals were detected using electrochemiluminescence immunoassay. As shown in Table 11, PAO and d5PAO inhibited the upregulation of IFN-γ, IL-1β, IL-2, IL-5, IL-6, and TNF-α, especially showing a strong inhibitory effect on the upregulation of IL-6.
[0513] Cell smears were prepared from the BALF of mice in each group. Wright-Giemsa staining was used to distinguish eosinophils, neutrophils, macrophages, and lymphocytes, and they were counted under a light microscope. The total counts of the four cell types in each group are shown in Table 9, and the individual counts of the four cell types in each group are shown in [Table 1]. Figure 38 The results showed that PAO and d5PAO had varying degrees of inhibitory effects on the total number of inflammatory cells caused by pulmonary fibrosis and on the increase of four types of inflammatory cells, especially on the increase of neutrophils.
[0514] Pulmonary fibrosis is often accompanied by elevated levels of hyaluronic acid and collagen in the blood; therefore, plasma hyaluronic acid and collagen levels were tested using ELISA. Some results showed... Figure 39 and Figure 40 The results suggest that PAO and d5PAO have an inhibitory effect on the increase of plasma hyaluronic acid and collagen caused by pulmonary fibrosis, and their effect on the increase of hyaluronic acid is significantly better than that of the positive control drug nintedanib.
[0515] Table 9. Percentage of Penh (the enhanced inter-expiratory value) relative to baseline, representing the increase in acetylcholine production.
[0516]
[0517] Two-way ANOVA, ### <0.001 compared to the normal group; ** <0.01 and *** <0.001 compared to the model group.
[0518] Table 10. Area under the Penh-Mch concentration curve (AUC) representing the rate of change of Penh relative to baseline.
[0519]
[0520] Table 11. Levels of inflammation and cytokines in bronchoalveolar lavage fluid (BALF) of each group of animals (pg / mL)
[0521]
[0522] Those skilled in the art will understand that although specific embodiments of the invention have been described herein for illustrative purposes, various modifications can be made thereto without departing from the spirit and scope of the invention. Therefore, the specific embodiments and examples of the invention should not be considered as limiting the scope of the invention. The invention is limited only by the appended claims. All documents cited herein are incorporated by reference in their entirety.
Claims
1. The compound shown in the following formula, or a pharmaceutically acceptable salt thereof, 。 2. Use of the compound of claim 1 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for the prevention or treatment of a disease in a subject, wherein the disease is selected from tumors, Alzheimer's disease, diseases related to intracellular protein misfolding, lysosomal storage diseases, tissue and organ fibrosis, diseases caused by viral infections, or neurosis; The tumor is selected from lymphoma, cervical cancer, liver cancer, breast cancer, lung cancer, colorectal cancer, stomach cancer, skin cancer, bone cancer, osteosarcoma, myeloma, leukemia, or ovarian cancer.
3. The use as described in claim 2, wherein the subject is a human or a non-human mammal.
4. The use as described in claim 2, wherein the breast cancer is triple-negative breast cancer; The lung cancer is non-small cell lung cancer or small cell lung cancer; and / or The skin cancer in question is melanoma.
5. The use as described in claim 2, wherein the intracellular protein misfolding-related disease is Parkinson's disease, Lewy body dementia, multiple system atrophy, inclusion body myoinflammatory disease, frontotemporal dementia, Huntington's disease, polyglutamine disease, amyotrophic lateral sclerosis, or prion disease.
6. The use as described in claim 2, wherein the lysosomal storage disease is a sphingolipid metabolism disorder, mucopolysaccharidosis, glycogen storage disease, glycoprotein storage disease, lipid storage disease, post-translational modification deficiency, intrinsic membrane protein deficiency disorder, neuronal cerebrolipofuscin deposition disease, or lysosomal-related organelle disorder.
7. The use as described in claim 6, wherein the sphingolipid metabolism disorder is Gaucher disease or Niemann's disease type C.
8. The use as claimed in claim 2, wherein the organ fibrosis is selected from pulmonary fibrosis or liver fibrosis.
9. The use as described in claim 2, wherein the virus comprises coronavirus and non-coronavirus, wherein the coronavirus is selected from chicken infectious bronchitis virus, porcine epidemic diarrhea virus, porcine transmissible gastroenteritis virus, porcine hemagglutinating encephalomyelitis virus, porcine delta coronavirus, canine respiratory coronavirus, mouse hepatitis virus, feline coronavirus, human coronavirus, severe acute respiratory syndrome virus, Middle East respiratory syndrome virus, or novel coronavirus; and wherein the non-coronavirus is selected from hepatitis C virus or HIV.
10. The use as described in claim 2, wherein the neurosis is selected from neurasthenia, anxiety disorder, depression, or mania.
11. The use as described in any one of claims 2-10, further comprising administering a second agent to a subject who requires it.
12. The use as claimed in claim 11, wherein the disease is selected from tumors and the second reagent is a reagent for treating tumors; or wherein the disease is selected from pulmonary fibrosis and the second reagent is a reagent for treating pulmonary fibrosis.
13. The use as described in claim 12, wherein the agent for treating pulmonary fibrosis is a vascular endothelial growth factor receptor tyrosine kinase inhibitor.
14. The use as described in claim 13, wherein the agent for treating pulmonary fibrosis is nintedanib.
15. The use as described in claim 14, wherein the agent for treating tumors is selected from at least one of paclitaxel, gemcitabine, cyclophosphamide, and temozolomide.
16. The use as described in claim 15, wherein the compound of claim 1 or a pharmaceutically acceptable salt thereof is administered before, after, or simultaneously with the second reagent.
17. A pharmaceutical composition comprising the compound of claim 1 or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
18. The pharmaceutical composition of claim 17, wherein the pharmaceutical composition further comprises a medicament for treating tumors.
19. The pharmaceutical composition of claim 18, wherein the antitumor drug is selected from at least one of paclitaxel, gemcitabine, cyclophosphamide, and temozolomide.
20. A method for preparing the compound of claim 1 or a pharmaceutically acceptable salt thereof, comprising the following steps: 1) At 0℃~10℃, add concentrated hydrochloric acid and sodium nitrite aqueous solution sequentially to an aqueous solution of aniline or its salt with the structure corresponding to formula (I), and keep the temperature below 5℃; 2) Heat the aqueous solution of sodium carbonate, arsenic trioxide and copper sulfate to 90~100℃ and then cool it down. Add the solution prepared in step 1) above to the aqueous solution, stir and filter. Add acid to the filtrate to adjust the pH value and separate the precipitated solid. 3) The above-precipitated solid, potassium iodide, sodium bisulfite or hydrochloric acid and sulfur dioxide are stirred in methanol until the reaction is complete, and then post-processed to obtain the compound. In the formula, R 1 To R 5 All are D.
Citation Information
Patent Citations
Reagent for inhibiting liver fibrosis and application thereof
CN108721622A
Organoarsenic compound and use thereof
CN109369724A
Application of PI4KIIIΑ protein and related membrane protein complex in treating alzheimer's disease
WO2016172952A1
Method for screening drug and therapeutic target used for treating alzheimer's disease
WO2016172955A1
Application of PI4KIIIΑ protein and related membrane protein complex in treating alzheimer's disease
WO2016173562A1