A kasp marker associated with wheat kernel circumference and thousand kernel weight and its application
By locating the KASP marker related to grain perimeter at 386292170bp on wheat chromosome 3D, the problem of low efficiency in grain size improvement in existing technologies has been solved, enabling efficient screening of superior genotypes and improving the genetic improvement efficiency of wheat thousand-grain weight.
Patent Information
- Application Number
- CN202211238947.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-11
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2042-10-11
AI Technical Summary
Existing technologies cannot effectively increase the thousand-grain weight of wheat by using only grain size as a factor. The efficiency of grain size improvement is low and is significantly affected by environmental conditions.
A KASP marker associated with wheat grain perimeter is provided, located at 386292170 bp on wheat chromosome 3D. The genetic status of grain perimeter and thousand-grain weight is detected by primer pair, and the KASP marker is used to screen for superior genotypes in wheat breeding.
It enables high-throughput screening of superior genotypes in early generations or seedling stages, improving the efficiency of high-yield genetic improvement of wheat, and provides an efficient, simple, and reliable method for predicting grain size and thousand-grain weight.
Smart Images

Figure BDA0003884241400000051 
Figure BDA0003884241400000061 
Figure BDA0003884241400000071
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of molecular biology, and particularly relates to a KASP marker related to wheat grain circumference and thousand kernel weight and application thereof. BACKGROUND
[0002] Wheat is one of the most important food crops in the world, and high-yield genetic improvement of wheat has always been the pursuit and challenge of wheat breeders.
[0003] Thousand kernel weight, ear number and grain number per ear are important yield components. Among them, thousand kernel weight, as one of the three yield components with the highest heritability, is the most important consideration factor in early generation selection of high-yield breeding of wheat. Thousand kernel weight is determined by grain size indicators such as grain length, grain width, grain circumference and related factors, and in particular, grain size-related traits are usually significantly positively correlated with thousand kernel weight, so grain size-related traits are often used to predict thousand kernel weight. However, whether it is thousand kernel weight or grain size elements such as grain length and grain width, they are all quantitative traits controlled by multiple genes, with complex genetic basis and obvious influence of environmental conditions, so genetic loci that are stably expressed under different environmental conditions have high practical application value for breeding.
[0004] Although grain length, grain width and other traits can be used to predict the high and low of thousand kernel weight, from the genetic basis, the genes controlling these individual elements are not completely consistent, especially the genes controlling grain length and the genes controlling grain width and grain thickness, which are usually controlled by different genes. Therefore, if single grain size element screening is performed, there may be a possibility that the grain length is increased but the width is not increased or even decreased, which ultimately results in ineffective improvement of grain size, thereby affecting the efficiency of thousand kernel weight improvement. Grain circumference is also a complex trait composed of single grain size elements such as grain length, grain width and grain thickness, and compared with single element, it can more comprehensively and comprehensively reflect the level of grain size, and has high reference value for yield-related traits such as thousand kernel weight.
[0005] Therefore, if a molecular marker highly related to grain size and thousand kernel weight can be provided, it will have important scientific research value and broad application prospect. SUMMARY
[0006] The purpose of the present application is to provide a KASP marker related to wheat grain circumference and thousand kernel weight and application thereof.
[0007] To achieve the above-mentioned purpose of the application, the technical solution adopted by the present application is: application of a KASP marker in wheat breeding, wherein the KASP marker is located at 386292170bp of wheat 3D chromosome, and the base at the 386292170th position is A or G.
[0008] Preferably, the KASP marker is used for detecting the QTL site located in the 0-452 Mb interval of the 3D chromosome of wheat.
[0009] Correspondingly, a primer pair for amplifying the QTL site.
[0010] Preferably, the primer pair comprises: a first forward primer: a first probe-GTGTGATGAGTGATATTAGGATTG-A; a second forward primer: a second probe-GTGTGATGAGTGATATTAGGATTG-G; and a reverse primer: GTAAACTACAAACCCAAATTTGACG, wherein the first probe and the second probe belong to different probes.
[0011] Preferably, different fluorescent groups are respectively combined on the first probe and the second probe.
[0012] Correspondingly, a set of primer pairs, wherein the primer pair comprises: a first forward primer GAAGGTGACCAAGTTCATGCTGTGTGATGAGTGATATTAGGATTGA; a second forward primer: GAAGGTCGGAGTCAACGGATTGTGTGATGAGTGATATTAGGATTGG; and a reverse primer: GTAAACTACAAACCCAAATTTGACG.
[0013] Correspondingly, the primer pair is applied to amplify the QTL site or in the wheat breeding.
[0014] Correspondingly, a product for identifying wheat varieties or breeding wheat is prepared by using the KASP marker or the QTL site or the primer pair.
[0015] Preferably, the product is any one of reagents, test paper, and kit.
[0016] The present application has the following beneficial effects: based on the recombinant inbred line population constructed by Zhongke Mai 138 and Kecheng Mai 2, a stable QTL site for controlling the circumference of wheat kernels is located at the 0-16.5 cM position of the 3D chromosome of wheat, and the candidate segment corresponds to the physical position interval of about 0-452 Mb. Based on the genetic position and the corresponding physical position of the QTL site, a set of primer pairs are further provided, which can predict the genetic conditions of the circumference of wheat kernels and the thousand kernel weight.
[0017] The present application provides an efficient, simple and reliable reference marker for screening high grain weight and high yield wheat, which can complete the screening of excellent genotype materials through genotyping in early generations or seedling stage before the kernels are not yet set, thereby effectively improving the genetic improvement efficiency of high yield of wheat. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 A schematic diagram of grain circumference and thousand kernel weight results of different genotypes identified using the primers provided by the present application. DETAILED DESCRIPTION
[0019] The present application provides a QTL site for controlling the circumference of wheat grains, QKp.cib-3D, which is located by QTL analysis based on a genetic linkage map of a wheat 55K SNP chip using a recombinant inbred line population. The population phenotype data are from two growth seasons in 2020 and 2021, two locations in Shifang and Shuangliu, a total of 4 environments for planting. After the grains in each environment mature, they are naturally dried, and 6 single plants are randomly selected from each family. The phenotypes of grain length, grain width and grain circumference of wheat in all 4 environments are investigated by using the automatic grain analysis instrument of Wanshen SC-G. Finally, a stable QTL site for controlling the circumference of wheat grains is located at the position of 0-16.5 cM of wheat 3D chromosome, and the candidate segment corresponds to the interval of about 0-452 Mb in physical position. In addition to this interval, stable QTL sites for controlling the length and width of wheat grains can also be co-located, but the advantageous alleles for increasing grain length and grain width come from different parents, respectively, indicating that this site cannot be used to predict grain size or grain weight by a single grain length or grain width element. On the contrary, using grain circumference to predict grain size or thousand kernel weight is a more comprehensive and reliable method. In the candidate segment, a single nucleotide polymorphism (SNP) site of A / G is found at the position of 386292170. When the base is A, the grain length decreases, the grain width increases, but the grain circumference decreases, and when the base is G, the grain length increases, the grain width decreases, and the grain circumference increases.
[0020] Based on the QTL site, the present application further provides a set of primer pairs. The primer pair consists of three sequences, specifically including: forward primer chr3D-386292170-A, wherein the F probe is GAAGGTGACCAAGTTCATGCT, combined with a first fluorescent group, for example, combined with a FAM fluorescent group, and the primer is GAAGGTGACCAAGTTCATGCT GTGTGATGAGTGATATTAG GATTG A; forward primer chr3D-386292170-G, wherein the H probe is GAAGGTCGGAGTCAACGGATT, combined with a second fluorescent group of another kind and color different from the corresponding fluorescent group of the F probe, for example, combined with a HEX fluorescent group, and the primer is GAAGGTCGGAGTCAACGGATT GTGTGATGAGTGATATTAGGATTG G; reverse primer: chr3D-386292170-Common, primer: GTAAACTACAAACCCAAATTTGAC G.
[0021] The primer can successfully mark the wheat kernel circumference trait, the genotype carrying the first fluorescent group is the genotype that cannot increase the kernel circumference (the base of the site is A), which is defined as the A-type genotype; and the genotype carrying the second fluorescent group is the genotype that can increase the kernel circumference (the base of the site is G), which is defined as the B-type genotype.
[0022] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. If not specifically indicated, the technical means used in the embodiments are conventional means familiar to those skilled in the art. The obtained data are all average values obtained after at least 3 repetitions, and the data obtained in each repetition are all valid data.
[0023] Embodiments
[0024] 1. Using the above primer, CTAB method was used to extract DNA at the seedling stage, and QTL positioning population parents Kema 138 and Kechengmai 2 were selected for marker polymorphism test, and the mixed parent DNA was used as a heterozygote control. The fluorescence quantitative PCR reaction system is shown in Table 1.
[0025] Table 1 Fluorescence quantitative PCR reaction system
[0026] Reactants Amount chr3D-386292170-A (10 μΜ) 0.2 μΐ chr3D-386292170-G (10 μΜ) 0.2 μΐ chr3D-386292170-Common (10 μΜ) 0.4 μΐ H2O 3 μΐ AQP 2x Master Mix 5 μΐ DNA (50-200 ng / μΐ) 2 μΐ
[0027] 95℃ pre-denaturation for 10 minutes, 95℃ denaturation for 20 seconds, 61℃ annealing and extension for 40 seconds, 10 cycles, the annealing and extension temperature decreases by 0.6℃ each cycle, 95℃ denaturation for 20 seconds, 55℃ annealing and extension for 40 seconds, 30 cycles, 10℃ incubation, and fluorescence model is collected.
[0028] Since the patent cannot provide color pictures, the population genotyping result schematic diagram is omitted. The genotyping result shows that Kema 138 shows carrying FAM fluorescent group, and is identified as the genotype of reducing kernel circumference; Kechengmai 2 shows carrying HEX fluorescent group, and is identified as the genotype of increasing kernel circumference; the heterozygote control is identified as the heterozygous genotype. The identification result is consistent with the actual situation.
[0029] 2. According to the above method and reaction system, the primer set is used to genotype 120 different wheat varieties in different wheat regions to verify the detection effect of the primer set on the kernel circumference phenotype. At the same time, the thousand kernel weight of the above genotyped materials is investigated. The phenotype data is obtained from the 2021 test, and the genotyping results and the phenotype investigation results are shown in Tables 2, 3 and Figure 1
[0030] Table 2 Detection of kernel circumference and thousand kernel weight of different varieties
[0031]
[0032]
[0033] Table 3 Statistical results of grain circumference and 1000-grain weight of different genotypes
[0034]
[0035] The results showed that 101 materials were A-type genotypes with an average grain circumference of 14.26 mm, and 101 materials were B-type genotypes with an average grain circumference of 14.5.16 mm, which was significantly longer than that of the A-type genotypes (P<0.001), indicating that the marker could be used to classify the materials with different grain circumferences in the natural population with different genetic backgrounds, and had reliability and effectiveness in detecting the grain circumference phenotype. Meanwhile, it was found that there was a significant difference in 1000-grain weight between the materials classified by the marker, indicating that the marker could be used not only to detect the grain circumference phenotype, but also to directly select the 1000-grain weight, and provided a reference for the selection of breeding parents for genetic improvement.
[0036] The above-described embodiments are only used to describe the preferred modes of the present application, and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications, variations, modifications and replacements of the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.
Claims
1. A set of primer pairs for use in the selection of wheat grain circumference or thousand kernel weight, characterised in that: The primer pair is used for detecting a KASP marker located at 386292170 bp of a 3D chromosome of wheat, the base of the 386292170 bp is A or G, and the primer pair comprises: a first forward primer: a first probe-GTGTGATGAGTGATATTAGGATTG-A; a second forward primer: a second probe-GTGTGATGAGTGATATTAGGATTG-G; and a reverse primer: GTAAACTACAAACCCAAATTTGACG, wherein the first probe and the second probe belong to different probes.
2. Use according to claim 1, characterized in that: The first probe and the second probe are respectively provided with different fluorescent groups.
3. Use according to claim 1, characterized in that: The primer pair comprises: a first forward primer GAAGGTGACCAAGTTCATGCTGTGTGATGAGTGATATTAGGATTGA; a second forward primer: GAAGGTCGGAGTCAACGGATTGTGTGATGAGTGATATTAGGATTGG; and a reverse primer: GTAAACTACAAACCCAAATTTGACG.