A mutated subgroup k avian leukosis virus receptor gene and its application in resisting subgroup k avian leukosis virus infection

By mutating key amino acid sites in the avian leukosis virus receptor gene Tva, a DF-1 cell line resistant to avian leukosis virus infection was constructed using CRISPR/Cas9 technology. This solved the problem of the lack of effective prevention and control measures in existing technologies and achieved efficient and safe gene editing results.

CN115704033BActive Publication Date: 2026-05-19HARBIN VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES (CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER HARBIN BRANCH CENTER)
View PDF 5 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HARBIN VETERINARY RESEARCH INSTITUTE CHINESE ACADEMY OF AGRICULTURAL SCIENCES (CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENTER HARBIN BRANCH CENTER)
Filing Date
2022-01-30
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

There are currently no effective vaccines or drugs to control avian leukosis. High infection rates depend on culling and eliminating diseased animals, and traditional gene editing methods carry the risk of random integration.

Method used

By using CRISPR/Cas9 technology to mutate or delete key amino acid sites E53, L55, H59 and G70 of the avian leukosis virus receptor gene Tva, a DF-1 cell line resistant to K subgroup avian leukosis virus infection was constructed, and the gene-edited cell line r-Tva was obtained by flow cytometry screening.

Benefits of technology

An effective natural barrier against ALV-K infection was established, reducing the risk of random insertion of transfected plasmids into the host genome and improving the safety and disease resistance of gene-edited chickens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0003495718250000011
    Figure HDA0003495718250000011
  • Figure HDA0003495718250000012
    Figure HDA0003495718250000012
  • Figure HDA0003495718250000021
    Figure HDA0003495718250000021
Patent Text Reader

Abstract

The application discloses a mutated K subgroup avian leukosis virus (ALV-K) receptor gene (Tva) and application thereof in resisting K subgroup avian leukosis virus infection. The application identifies key functional amino acid sites E53, L55, H59 and G70 of a receptor protein Tva mediating ALV-K infection of chicken cells, and finds that after the four sites are mutated, ALV-K cannot infect host cells. Further, the application also discloses a method for constructing a DF-1 cell line resisting ALV-K infection, which utilizes a CRISPR / Cas9 method and flow cytometry screening, and mutates the key amino acid sites E53, L55, H59 and G70 of the Tva gene as the ALV-K receptor. Results show that a replacement sequence containing the above site mutation can efficiently replace the corresponding sequence of the Tva gene; the Tva gene edited cell line can resist ALV-K infection without affecting the cell proliferation level. The application lays a foundation for further studying the function of the Tva gene and establishing a new technology for resisting ALV-K infection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a mutated K subgroup avian leukosis virus receptor gene (Tva) and its application in combating K subgroup avian leukosis virus (ALV-K) infection. This invention belongs to the field of biotechnology. Background Technology

[0002] Avian leukosis (AL) is a germplasm-borne disease caused by avian leukosis virus (ALV), resulting in tumors in birds. ALV belongs to the genus α-retrovirus and is an enveloped RNA virus. Based on differences in its envelope proteins, ALV is currently classified into 10 subgroups, AJ. In recent years, a new ALV subgroup has emerged in my country, designated as subgroup K (Cui N, Su S, Chen Z, et al. Genomic sequence analysis and biological characteristics of a rescued clone of avian leukosis virus strain JS11C1, isolated from indigenous chickens[J]. J Gen Virol, 2014, 95(Pt 11):2512-2522.). ALV-K, as a newly emerging ALV subtype, mainly causes gliomas in infected chicken flocks.

[0003] Different subpopulations of ALV utilize different surface proteins as receptors to infect host cells. However, the specific amino acid interactions between the envelope proteins and receptor molecules of all ALV subtypes are a crucial step in establishing infection. The ALV-A receptor gene (Tva) is also the cellular receptor gene for ALV-K, containing a domain called LDL-A, a key functional domain mediating viral entry. The key amino acids E53, L55, H59, and G70, which mediate ALV-K infection, are located in this LDL-A domain. As a homolog of human CD320, Tva is one of the cellular receptor molecules for TC-mediated Cbl (vitamin B12) uptake; therefore, Tva is essential for chicken growth.

[0004] Deleting or mutating key functional domains or amino acids in receptor molecules that mediate viral entry into host cells, thereby causing the receptor to lose its ability to mediate viral entry while retaining its function in maintaining normal cellular life activities, is the best strategy for establishing resistance to ALV-infected chickens by targeting receptor molecules. CRISPR / Cas9 gene editing technology, as a next-generation gene editing technology, can achieve "precise" gene editing, providing a valuable tool for constructing disease-resistant chickens.

[0005] Therefore, this invention aims to lay the foundation for further constructing gene-edited chickens resistant to ALV-K by using CRISPR / Cas9 technology to mutate or delete key amino acid sites that mediate ALV-K invasion through Tva. Summary of the Invention

[0006] One of the objectives of this invention is to provide a mutated K subgroup avian leukosis virus (ALV-K) receptor gene (Tva) and its application in resisting K subgroup avian leukosis virus infection;

[0007] The second objective of this invention is to provide a method for constructing a DF-1 cell line resistant to K subgroup avian leukosis virus infection using the above-mentioned mutated K subgroup avian leukosis virus receptor gene (Tva).

[0008] To achieve the above objectives, the present invention employs the following technical means:

[0009] A mutated K subgroup avian leukosis virus receptor gene (Tva), characterized in that the 53rd, 55th, 59th and 70th amino acid sites of the Tva protein encoded by the mutated K subgroup avian leukosis virus receptor gene (Tva) are mutated or deleted.

[0010] The inventors of this invention discovered through research that amino acids 53, 55, 59, and 70 of Tva are key amino acid sites for mediating ALV-K invasion. Any mutation or deletion of these four amino acid sites will prevent Tva from acting as an ALV-K receptor to mediate ALV-K infection. Therefore, any mutant chicken Tva gene obtained by mutating or deleting these four sites should fall within the protection scope of this invention.

[0011] For more specific illustration, in one particular embodiment of the present invention, the nucleotide sequence of the mutated K subgroup avian leukosis virus receptor gene (Tva) is shown in SEQ ID NO.1.

[0012] Furthermore, this invention also proposes the application of the mutated K subgroup avian leukosis virus receptor gene (Tva) in studying the function of the Tva gene and in preparing biomaterials resistant to K subgroup avian leukosis virus through gene editing.

[0013] Preferably, the biological material is a cell line resistant to K subgroup avian leukosis virus infection.

[0014] Preferably, the cell line is the DF-1 cell line.

[0015] Furthermore, this invention also proposes a method for constructing a DF-1 cell line resistant to K subgroup avian leukosis virus infection. The method utilizes the CRISPR / Cas9 method and flow cytometry screening to mutate or delete amino acid sites 53, 55, 59, and 70 of the Tva protein encoded by the chicken Tva gene.

[0016] Preferably, the nucleotide sequence of the mutated K subgroup avian leukosis virus receptor gene (Tva) is shown in SEQ ID NO.1.

[0017] More preferably, the method includes the following steps:

[0018] (1) Construction of Tva-sgRNA knockout plasmid

[0019] A Tva knockout guide RNA sequence was synthesized and inserted into the pMD-18T vector to construct the Tva-sgRNA knockout plasmid, wherein the guide RNA sequence is shown in SEQ ID NO.2;

[0020] (2) Synthesis of ssODN sequence

[0021] The ssODN sequence shown in SEQ ID NO.3 was synthesized, and the amino acids encoded by the original Tva gene at positions E53, L55, H59, and G70 were mutated for expression.

[0022] (3) Construction and screening of r-Tva cell lines

[0023] pCas9-GFP plasmid, Tva-sgRNA plasmid and ssOND were co-transfected into DF-1 cells. After 48 h of culture, cells with GFP fluorescence were screened using a flow cytometer. Positive cells were inoculated into 96-well plates. After 7 days, the single-clonal cell lines were observed under an optical microscope and the culture was expanded.

[0024] (4) Identification of cell lines

[0025] The genome of the monoclonal cell line was extracted using a genome extraction kit. A sequence upstream and downstream of the mutation site was selected as primers for PCR amplification. The amplified products were sequenced and analyzed. The replacement sequence was successfully inserted into the Tva gene, indicating that the DF-1 cell line resistant to K subgroup avian leukosis virus infection was successfully obtained.

[0026] Preferably, the primer sequence described in step (4) is:

[0027] Tva-CX-F:gttctttggcgcagtgctc;

[0028] Tva-CX-R:cgctgcagctgagctttatg.

[0029] The DF-1 cell line resistant to K subgroup avian leukosis virus infection constructed according to the method is also within the scope of protection of this invention.

[0030] Compared with the prior art, the beneficial effects of the present invention are:

[0031] ALV infection rates remain high in breeding flocks in my country. For diseases like avian leukosis, for which there are currently no vaccines or effective treatments, the main control measures rely on eradication and culling of infected animals, requiring significant manpower and resources. However, the development of CRISPR / Cas9 gene editing technology has brought new opportunities for the control of avian leukosis. By editing the genes of essential host factors required for viral infection of host cells, a natural barrier against ALV infection can be established. However, some receptor molecules involved in maintaining normal cellular physiological functions cannot be directly knocked out. Therefore, gene editing technology that constructs mutations at key amino acid sites of receptors in vitro is crucial for creating gene-edited animals.

[0032] The Tva gene, acting as the receptor for ALV-K, is crucial for cellular uptake of vitamin B12. This invention identified key functional amino acid sites E53, L55, H59, and G70 of the receptor protein Tva (also known as CD320), which mediates ALV-K infection of chicken cells. Mutations at these four sites resulted in ALV-K's inability to infect host cells. Therefore, this invention mutated or deleted amino acid sites 53, 55, 59, and 70 of chicken Tva. Using CRISPR / Cas9 technology, mutations at these sites were successfully achieved. Results showed that the Tva gene-edited cell line r-Tva could be effectively obtained using CRISPR / Cas9 technology. Inoculation results showed that the Tva gene-edited cell line r-Tva was effectively resistant to ALV-K infection, laying the foundation for further development of gene-edited chickens.

[0033] Currently, the construction of DF-1 gene-edited cells mainly involves transfecting Cas9 expression plasmids containing resistance and replacing fragments. This method obtains gene-edited cell lines through drug screening, increasing the probability of random integration of exogenous resistance genes into the host genome. However, this method poses certain risks for the construction of transgenic chickens. This invention successfully screened and obtained the Tva gene-edited cell line r-Tva using flow cytometry, reducing the risk of random insertion of transfected plasmids into the host genome. Attached Figure Description

[0034] Figure 1For the identification of the r-Tva cell line;

[0035] Figure 2 To identify the proliferation level of the r-Tva cell line;

[0036] Figure 3 To detect the level of infection against ALV-K-GFP strain in r-Tva cell lines;

[0037] Figure 4 To quantitatively detect the level of infection against ALV-K strain in r-Tva cell lines. Detailed Implementation

[0038] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become clearer as a result. However, these examples are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.

[0039] Example 1: Design of the mutant K subgroup avian leukosis virus receptor gene (Tva)

[0040] The inventors of this invention discovered through research that amino acids 53, 55, 59, and 70 of the chicken Tva are key amino acid sites mediating ALV-K invasion. Any mutation or deletion of these four amino acid sites will prevent the Tva from acting as an ALV-K receptor to mediate ALV-K infection. Therefore, this invention involves mutations or deletions at these four amino acid sites in the chicken Tva.

[0041] In this specific embodiment, the E at position 53 of the Tva protein is mutated to L, the L at position 55 to A, the H at position 59 to D, and the G at position 70 to three amino acids PQR. The nucleotide sequence of the mutated Tva gene is shown in SEQ ID NO.1. The nucleotide sequence of the original Tva gene is shown in SEQ ID NO.4.

[0042] Example 2: Construction of DF-1 cell line resistant to K subgroup avian leukosis virus infection

[0043] 1. Materials and Methods

[0044] 1.1 Main Experimental Materials

[0045] DF-1 cells and the recombinant virus ALV-K-GFP strain expressing green fluorescent protein were preserved in our laboratory; ALV-K(JS15SG01) was isolated in our laboratory; the TIANamp Genomic DNA extraction kit was purchased from TIANGEN; the pMD-18T vector was purchased from TARAKA; and the pCas9-GFP plasmid was preserved in our laboratory.

[0046] 1.2 Carrier Construction

[0047] The Tva knockout guide RNA (gRNA) sequence (CCACTCCAGCGGGTAGCAGT, SEQ ID NO.2) was designed using the E-CRISP online software (http: / / www.e-crisp.org / E-CRISP / designcris / html) and inserted into the pMD-18T vector to construct the Tva-sgRNA knockout plasmid. Based on the Tva gene sequence in NCBI (https: / / www.ncbi.nlm.nih.gov / ), an ssODN (TTCGGAGCCGCACGATCCCCAGACCGACTGCTACCCGCTGCTGTGG GCCTGCGACGGGGACCCCGACTGCGACGATGGACGGGACGAGTGGCCGCAGCGCTGCGGAGCGAGCGAGCGGGAGCCCCGCGGTGCCCACCGCCGGCG, as shown in SEQ ID NO.3) was designed. The E at position 53 of the Tva protein was mutated to L, the L at position 55 was mutated to A, the H at position 59 was mutated to D, and the G at position 70 was mutated to three amino acids PQR.

[0048] 1.3 Construction and screening of r-Tva cell lines

[0049] pCas9-GFP plasmid, Tva-sgRNA plasmid, and ssOND were co-transfected into DF-1 cells. After 48 h of culture, cells with GFP fluorescence were screened using a flow cytometry sorter. The sorted positive cells were then transferred into 96-well plates. After 7 days, the selected monoclonal cell line (r-Tva) was observed under an optical microscope and expanded. The genome of the r-Tva cell line was extracted using a genome extraction kit. The substitution sequence was amplified using Tva-CX-F (gttctttggcgcagtgctc) and Tva-CX-R (cgctgcagctgagctttatg) primers. The amplified products were recovered and sequenced for identification.

[0050] 1.4 Detection of growth level of r-Tva cell line

[0051] r-Tva cell line and wild-type DF-1 cell line were seeded into 96-well plates. 12 hours after seeding, the growth level of the cell lines was detected using the CCK8 assay kit according to the instructions. In short, 10 μL of chromogenic solution was added to each well, and the cells were incubated at 37°C in the dark for 2 hours. The readings were then taken using a microplate reader at the 450 nm channel.

[0052] 1.5 Detection of anti-ALV-K-GFP infection level in r-Tva cell lines

[0053] r-Tva cell line and wild-type DF-1 cell line were seeded into 12-well plates and inoculated with ALV-K-GFP strain (102) after 16 h. 5.2 TCID 50 100 μL / well ( / mL) was prepared, with three parallel wells for each cell type. 72 h after inoculation, the GFP fluorescence ratio was observed using an inverted fluorescence microscope to detect the proportion of r-Tva cell lines and wild-type DF-1 cell lines infected with the ALV-K-GFP strain.

[0054] 1.6 Detection of anti-ALV-K wild-type strain infection level in r-Tva cell lines

[0055] r-Tva cell line and wild-type DF-1 cell line were seeded into 12-well plates and inoculated with ALV-K(JS15SG01) strain (10 μL) after 16 h. 5.5 TCID 50 / mL) / well, with 3 parallel wells per group. After 72 hours of inoculation, the virus suspension was collected by freeze-thaw and the viral genome was extracted. Using K-gp85-F(CAGACAGGTTCTCGCTTCCG) and K-gp85-R(CCATATACCTCCTGTGCGTGT) as primers, the proportion of r-Tva cell lines and wild-type DF-1 cell lines infected with ALV-K was detected by quantitative real-time fluorescence method.

[0056] 2 Results

[0057] 2.1 Construction and screening of r-Tva cell lines

[0058] Using the CRISPR / Cas9 method, a substitution sequence was inserted into the chicken Tva gene, causing the expression of the E53, L55, H59, and G70 mutants encoded by it. Figure 1 The genome of the r-Tva cell line was extracted and amplified using PCR. Using the r-Tva cell line genome as a template, primers were selected to amplify sequences upstream and downstream of the mutation site. Sequencing analysis of the amplified products showed that the replacement sequence was successfully inserted into the Tva gene. This indicates that the r-Tva cell line was successfully obtained. Figure 1 ).

[0059] 2.2 Detection of proliferation level of r-Tva cell line

[0060] r-Tva cell line and wild-type DF-1 cell line were seeded into 96-well plates, respectively. Cell viability was detected using a CCK8 assay kit after 12 hours. The results are as follows: Figure 2 As shown, the results indicate that there is no difference in cell viability between the r-Tva cell line and the wild-type DF-1 cell line.

[0061] 2.3 Detection of anti-ALV-K-GFP infection level in r-Tva cell lines

[0062] r-Tva cell line and wild-type DF-1 cell line were seeded into 12-well plates, and after 16 h, they were inoculated with ALV-K-GFP virus. The GFP fluorescence ratio was observed 72 h after inoculation. The results are as follows: Figure 3 As shown, the results indicated that, compared to wild-type DF-1 cells, the r-Tva cell line showed no GFP fluorescence after inoculation with the ALLV-A-GFP strain. This suggests that the r-Tva cell line is resistant to infection by the ALV-K-GFP strain.

[0063] 2.4 Detection of the level of r-Tva cell line against wild-type ALV-K strain infection

[0064] r-Tva cell line and wild-type DF-1 cell line were seeded into 12-well plates, respectively. After 16 hours, they were inoculated with ALV-K wild-type strain. 72 hours after inoculation, the virus suspension was collected and the genome was extracted for quantitative real-time PCR detection. Results are as follows: Figure 4 As shown, the results indicated that the r-Tva cell line was not infected with the wild-type ALLV-K strain compared with wild-type DF-1 cells, suggesting that the r-Tva cell line is resistant to infection by the wild-type ALLV-K strain. sequence list <110> Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences (Harbin Branch of China Animal Health and Epidemiology Center) <120> A mutant chicken K subgroup avian leukosis virus receptor gene and its application in resisting K subgroup avian leukosis virus infection <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 375 <212> DNA <213> artificial sequence <400> 1 atggtgcggttgttggagctgctggtgctgctgcgcgccgtccgcccgctgcccacccccacctccgcgcccggcaacggttctttggcgcagtgctcacccgagcagttccactgttcggagccgcacgatccccagaccgactgctacccgctgctgtgggcctgcgacggggaccccgactgcgacgatggacgggacgagtggccgcagcgctgcggagcgagcgggagccccgcggtgcccaccgccggcggcacagagacttcagctgtccctgcgcctgggcgtgctctgccatccaggaaccacggccgcatgtggatgctgatcgttgcagggatctttcactgtgaggtggtaagatgggactga <210> 2 <211> 369 <212> DNA <213> Tva <400> 2 cgctggagtggctctgcgac <210> 3 <211> 140 <212> DNA <213> artificial sequence <400> 3 ttcggagccgcacgatccccagaccgactgctacccgctgctgtgggcctgcgacggggaccccgactgcgacgatggacgggacgagtggccgcagcgctgcggagcgagcgggagccccgcggtgcccaccgccggcg <210> 4 <211> 369 <212> DNA <213> Tva <400> 4 atggtgcggttgttggagctgctggtgctgctgcgcgccgtccgcccgctgcccacccccacctccgcgcccggcaacggttctttggcgcagtgctcacccgagcagttccactgttcggagccgcacgatccccagaccgactgctacccgctggagtggctctgcgacgggcatcccgactgcgacgatggacgggacgagtggggctgcggagcgagcgggagccccgcggtgcccaccgccggcggcacagagacttcagctgtccctgcgcctgggcgtgctctgccatccaggaaccacggccgcatgtggatgctgatcgttgcagggatctttcactgtgaggtggtaagatgggactga

Claims

1. A method for constructing a DF-1 cell line resistant to K subgroup avian leukosis virus infection, characterized in that, The method includes using CRISPR / Cas9 and flow cytometry to screen for the K subgroup avian leukosis virus receptor gene ( Tva The 53rd, 55th, 59th, and 70th amino acid sites of the Tva protein encoded by the K subgroup avian leukosis virus receptor gene were mutated, resulting in the K subgroup avian leukosis virus receptor gene (…). Tva The nucleotide sequence of is shown in SEQ ID NO.

1.

2. The method as described in claim 1, characterized in that, Includes the following steps: (1) Construction of Tva-sgRNA knockout plasmid synthesis Tva The guide RNA sequence was knocked out and inserted into the pMD-18T vector to construct the Tva-sgRNA knockout plasmid, wherein the guide RNA sequence is shown in SEQ ID NO.2; (2) Synthesis of ssODN sequence The synthesized ssODN sequence shown in SEQ ID NO.3 was used to transform the original... Tva The amino acids encoded by the gene at positions E53, L55, H59, and G70 are mutated for expression. (3) Construction and screening of r-Tva cell lines pCas9-GFP plasmid, Tva-sgRNA plasmid, and ssOND were co-transfected into DF-1 cells. After 48 h of culture, cells with GFP fluorescence were screened using a flow cytometry system. Positive cells were then inoculated into 96-well plates. After 7 days, single-clonal cell lines were observed and screened under an optical microscope and then expanded for further culture. (4) Identification of cell lines The genome of a single-clonal cell line was extracted using a genome extraction kit. A sequence upstream and downstream of the mutation site was selected as primers for PCR amplification, and the amplified products were sequenced. The inserted replacement sequence was successfully confirmed. Tva The gene sequence indicates that the DF-1 cell line resistant to K subgroup avian leukosis virus infection has been successfully obtained. The primer sequence is as follows: Tva-CX-F:gttctttggcgcagtgctc; Tva-CX-R:cgctgcagctgagctttatg.

3. The DF-1 cell line resistant to K subgroup avian leukosis virus infection constructed according to the method of claim 1 or 2.