Nanobodies neutralizing the toxicity of pseudomonas aeruginosa exotoxin a and uses thereof
By developing nanobodies with specific CDR region sequences, the problem of insufficient affinity of traditional antibodies for Pseudomonas aeruginosa exotoxin A was solved, achieving highly efficient neutralization of Pseudomonas aeruginosa exotoxin A and protecting cells from toxic effects.
Patent Information
- Application Number
- CN202211304762.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-10-24
- Publication Date
- 2026-01-13
- Estimated Expiration
- 2042-10-24
AI Technical Summary
Existing antibodies have low affinity for Pseudomonas aeruginosa exotoxin A, low immune recognition efficiency, and difficulty in effectively binding to and neutralizing antigens and toxins with high concealment. Traditional antibodies have not been effective in clinical diagnosis and treatment.
A nanobody against Pseudomonas aeruginosa exotoxin A was developed, possessing specific CDR1, CDR2, and CDR3 region sequences. A nanobody library was constructed using phage display technology, and the nanobody 2H6 with high affinity and high activity was screened out. The nanobody was then expressed and purified in Escherichia coli using an expression vector.
Nanobody 2H6 exhibits high neutralizing activity, effectively reducing the inhibitory rate of Pseudomonas aeruginosa exotoxin A on cells, protecting cells, and possessing excellent neutralizing ability.
Smart Images

Figure CN115724964B_ABST
Abstract
Description
Technical Field
[0001] This invention discloses a nanobody, which belongs to the field of immunology. Background Technology
[0002] Pseudomonas aeruginosa, also known as Pseudomonas aeruginosa, is a Gram-negative, aerobic, rod-shaped bacterium with unidirectional motility. It was first isolated from wound pus by Gersard in 1882. This bacterium is widely distributed in nature, found in water, soil, air, and in the intestines and skin of animals. It is an opportunistic pathogen that can cause infection and disease in humans and animals under specific conditions.
[0003] In 1972, Pv. Liu discovered exotoxin A, the toxic agent causing Pseudomonas aeruginosa infection, in the culture medium of clinical isolates. He pointed out that Pseudomonas aeruginosa exotoxin A (PE) has a necrotizing effect on skin and mucous membranes and can induce sepsis when it enters the bloodstream. In organ tissues and cells, Pseudomonas aeruginosa exotoxin A is similar to diphtheria toxin, inhibiting protein synthesis; it is highly susceptible to mice and rats, has a lethal effect, and exhibits "cell breakdown toxicity" in cultured cells. Pseudomonas aeruginosa exotoxin A is extremely toxic, capable of causing great damage to body tissues and organs, and can even destroy corneal stromal cells. In order to explore effective methods for controlling and treating diseases related to Pseudomonas aeruginosa exotoxin A, research on the biological characteristics and pathogenicity of Pseudomonas aeruginosa exotoxin A is increasing.
[0004] Existing research indicates that Pseudomonas aeruginosa exotoxin A (PE) is a 66kD single-chain toxin protein with three domains. Domain Ia is primarily responsible for cell recognition, enabling PE to bind to target cells. Domain II is the translocation domain, allowing it to enter the cytoplasm. Domain III is the active domain, catalyzing the ADP ribosylation of elongation factor 2 (EF2), leading to EF2 inactivation, inhibiting protein synthesis, and ultimately causing cell death. The function of domain Ib remains unclear, but the deletion of most amino acids does not affect the activity of the toxin molecule. PE is one of the most potent known cytotoxins. Because it combines cell binding, translocation, and enzymatic activity, it is more suitable for genetic modification than other toxins to construct recombinant immunotoxins. Modified PE lacking the cell recognition domain is one of the most commonly used toxin proteins, exerting its damaging and killing effects by inhibiting cellular protein synthesis. Due to these characteristics, combining PE with specific carriers (such as monoclonal antibodies and cytokines) to form corresponding immunotoxins can be used in research on targeted cancer therapy.
[0005] Given the prominent characteristics of PE toxin in clinicopathology and its promising application as a component of immunotoxins in clinical treatment, especially in tumor treatment, the development of specific neutralizing antibodies against PE toxin to improve the efficiency of clinical diagnosis and treatment has become an urgent need for existing technologies.
[0006] However, due to some shortcomings of traditional antibodies, such as low affinity and low immune recognition efficiency, it is difficult to achieve ideal binding and neutralization effects for some highly concealed antigens and toxins.
[0007] In 1993, Hamers-Casterman et al. discovered a class of antibodies consisting only of heavy chain dimers (H2) in camel species (camels, dromedary camels, and llamas). These are primarily IgG2 and IgG3 types. Because they lack light chains, they are called heavy chain only like antibodies (HCAbs). Their antigen-binding site consists of a single domain called the VHH region, hence they are also called single-domain antibodies or single-domain antibodies (sdAbs). Since these antibodies are variable regions after removing the constant region, their molecular weight is only 15 kDa, approximately 10 nanometers in diameter, and they are also called nanobodies (Nbs). Additionally, this type of single-domain antibody, called VNAR, has also been observed in sharks. These heavy chain only antibodies were originally recognized only as a pathological form of a human B-cell proliferative disorder (heavy chain disease). This antibody containing only the heavy chain may be due to mutations and deletions at the genomic level that prevent the expression of the CH1 domain of the heavy chain. As a result, the expressed heavy chain lacks CH1 and thus lacks the ability to bind to the light chain, thus forming a heavy chain dimer.
[0008] Compared to conventional tetrachain antibody scFvs, nanobodies are comparable to their corresponding scFvs in terms of affinity, but surpass scFvs in terms of solubility, stability, resistance to aggregation, refoldability, expression yield, and ease of DNA manipulation, library construction, and 3D structure determination.
[0009] Nanobodies possess the smallest functional antigen-binding fragments derived from HCAbs in adult camels, exhibiting high stability and strong affinity for antigens. They can interact with protein clefts and enzyme active sites, acting similarly to inhibitors. Therefore, nanobodies can provide a new approach for designing small-molecule enzyme inhibitors from peptide-mimicking drugs. Due to their heavy chain composition, nanobodies are easier to manufacture than monoclonal antibodies. The unique properties of nanobodies, such as their stability in extreme temperature and pH environments, allow for low-cost, high-volume production. Therefore, nanobodies have significant value in disease treatment and diagnosis, and hold great promise for antibody-targeted diagnosis and treatment of tumors.
[0010] The purpose of this invention is to provide an anti-PE toxin nanobody that can fully utilize the superior performance of nanobodies while overcoming their inherent defects, and further provide its application in PE toxin detection and in the pharmaceutical field. Summary of the Invention
[0011] Based on the above-mentioned objectives, the present invention first provides a nanobody against Pseudomonas aeruginosa exotoxin A. The variable region of the nanobody has three complementarity-determining regions CDR1, CDR2, and CDR3, wherein the amino acid sequence of CDR1 is shown in SEQ ID NO.1, the amino acid sequence of CDR2 is shown in SEQ ID NO.2, and the amino acid sequence of CDR3 is shown in SEQ ID NO.3.
[0012] In a preferred embodiment, the amino acid sequence of the variable region of the nanobody is shown in SEQ ID NO.4.
[0013] Second, the present invention also provides a polynucleotide encoding the above-mentioned nanobody, the sequence of which is shown in SEQ ID NO.5.
[0014] Third, the present invention provides an expression vector containing the above-mentioned polynucleotides, wherein the expression vector is pMES4.
[0015] Fourth, the present invention provides a host cell containing the above-mentioned expression vector, wherein the host cell is *Escherichia coli* BL... 21 (DE3).
[0016] Finally, the present invention also provides the application of the above-mentioned nanobodies in the preparation of anti-PE toxin drugs.
[0017] The nanobody against Pseudomonas aeruginosa exotoxin A provided by this invention possesses unique CDR1, CDR2, and CDR3 region sequences, enabling the antibody to specifically recognize and bind to the Pseudomonas aeruginosa exotoxin A antigen. Most importantly, this antibody exhibits superior neutralizing ability against PE toxin toxicity compared to other antibodies, demonstrating that the nanobody provided by this invention possesses high neutralizing activity and can effectively reduce the inhibitory rate of PE toxin on cells, thereby protecting cells. Attached Figure Description
[0018] Figure 1 Image showing double enzyme digestion identification of the recombinant PE immunotoxin vector plasmid;
[0019] Figure 2 SDS-PAGE electrophoresis image of recombinant PE immunotoxin expression and purification;
[0020] Figure 3 SDS-PAGE electrophoresis image of HIS tag excised by recombinant PE immunotoxin;
[0021] Figure 4 Schematic diagram of the PMES4 expression vector structure;
[0022] Figure 5 Electrophoretic identification image of the variable region gene from the first round of PCR amplification;
[0023] Figure 6 Electrophoretic identification image of the variable region gene by antibody amplification in the second round of PCR;
[0024] Figure 7 Electrophoretic identification image of the pMES4 vector double enzyme digestion reaction product;
[0025] Figure 8 . Electroporation results of antibody library;
[0026] Figure 9 Colony PCR identification and electrophoresis identification of transformants;
[0027] Figure 10 SDS-PAGE identification image of purified nanobody;
[0028] Figure 11 . Dissociation curve of nanobody binding to PE antigen;
[0029] Figure 12 . In vitro cell PE toxicity neutralization curve of nanobody. Detailed Implementation
[0030] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection of the present invention.
[0031] Example 1. Prokaryotic expression and purification of recombinant PE immunotoxin
[0032] 1.1 Prokaryotic expression of recombinant PE immunotoxin
[0033] The partial sequence of the PE toxin synthesized from the whole genome (AE004091.2) plasmid PE-PUC57 (synthesized by Genewiz) and vector pET28a were simultaneously digested with NcoI and NotI (purchased from NEB) restriction enzymes. The 1.4kb target gene fragment was recovered, ligated with T4 DNA ligase, and named PE-pET28a. After transformation into BL21 host bacteria, positive colonies were selected by kanamycin resistance screening, amplified, and plasmids were extracted. The plasmids were then identified using NcoI and NotI restriction enzymes. Figure 1 M stands for Trans 2K plus DNA marker; 1 represents the product of PE-pET28a digested with NcoI and NotI. After overnight amplification, the correctly identified strain was inoculated at a 1:50 ratio into 200 ml of Kans. + In LB medium, amplified to OD at 37°C. 600 When the concentration is approximately 0.6, add IPTG to a final concentration of 1 mmol / L and induce for 6 hours.
[0034] 1.2 Purification of recombinant PE immunotoxin
[0035] The bacterial cells were collected by centrifugation at 8000g for 10 minutes at 4℃. PBS solution was added at a ratio of 1:20, and the cells were sonicated until clear. The supernatant was collected again at 8000g. Purification was performed using Ni-NTA resin, with different concentrations of imidazole used for elution and collection. The collected samples were analyzed by reduced protein electrophoresis. Figure 2 M stands for PageRuler™ Prestained Protein Ladder; 1 is the 20mM imidazole elution product; 2 is the 80mM imidazole elution product; 3 is the 100mM imidazole elution product; 4 is the 200mM imidazole elution product. Finally, the PE toxin was dialyzed into PBS.
[0036] 1.3 Recombinant PE Immunotoxin Removal of HIS Tag
[0037] After diluting enterokinase 1:8000, the diluted enterokinase was added to the purified recombinant PE immunotoxin, and the mixture was digested at 37°C for 3 hours. The digested PE toxin protein was then analyzed by reducing protein electrophoresis. Figure 3M represents the Rainbow 180 broad-spectrum protein marker; 1 represents undigested recombinant PE immunotoxin protein; 2 represents the product of PE immunotoxin protein digested with protease for 2 hours; and 3 represents the product of PE immunotoxin protein digested with protease for 3 hours. The PE protein with the HIS tag removed was recovered using Ni-NTA resin, and the permeate was collected.
[0038] Example 2. Construction and screening of anti-PE nanobody phage display library
[0039] 2.1 Alpaca Immunity
[0040] One healthy adult alpaca was selected, and recombinant protein PE was mixed with Freund's adjuvant at a 1:1 ratio. The alpaca was immunized with the mixture at multiple subcutaneous injections on its back at a dose of 6-7 μg / kg, for a total of four immunizations, with an interval of 2 weeks between each immunization. Peripheral blood was then collected from the alpaca for the construction of a phage display library.
[0041] 2.2 Isolation of camel-derived lymphocytes
[0042] Lymphocytes were analyzed from anticoagulated whole blood collected from camels according to standard procedures in this technical field, with each sample containing 2.5 × 10⁻⁶ lymphocytes. 7 Add 1 mL of RNA separation reagent to each live cell, extract RNA from 1 mL of the solution, and store the remainder at -80°C.
[0043] 2.3 Total RNA Extraction
[0044] Total RNA was extracted according to standard procedures in this technical field, and the concentration was adjusted to 1 μg / μL with RNase-free water.
[0045] 2.4 Reverse transcription to synthesize cDNA
[0046] Reverse transcription of cDNA was performed using the RNA obtained in step 2.3 as a template, according to the instructions of the reverse transcription kit (Roche's transcripor first stand cDNAsynthesis KIT).
[0047] 2.5 Antibody variable region gene amplification
[0048] The cDNA obtained from reverse transcription was used as a template for PCR. Two rounds of amplification were performed. The primer sequences for the first round of PCR are as follows:
[0049] CALL001:GTCCTGGCTGCTCTTCTACAAGG
[0050] CALL002:GGTACGTGCTGTTGAACTGTTCC
[0051] The PCR reaction conditions and procedure were as follows: 95℃ for 5 minutes; 95℃ for 30 seconds, 57℃ for 30 seconds, 72℃ for 30 seconds, 30 cycles; 72℃ for 7 minutes. Agarose gel extraction kit was used to recover bands of approximately 700 bp. The nucleic acid concentration was finally adjusted to 5 ng / μl with water. Figure 5 M stands for Trans 2K DNA Marker; 1 represents the first-round PCR product.
[0052] The primer sequences for the second round of PCR are as follows:
[0053] VHH-Back: GATGTGCAGCTGCAGGAGTCTGGRGGAGG
[0054] VHH-For:CTAGTGCGGCCGCTGGAGACGGTGACCTGGGT
[0055] The PCR reaction conditions and procedure were as follows: 95℃ for 5 minutes; 95℃ for 30 seconds, 55℃ for 30 seconds, 72℃ for 30 seconds, 15 cycles; 72℃ for 7 minutes. The PCR products were purified using a PCR product recovery kit. Figure 6 M stands for Trans 2K DNA Marker; 1 stands for the second-round PCR product.
[0056] 2.6 Carrier Construction
[0057] pMES4 (purchased from Biovector, its structural diagram is shown below) was used. Figure 4 The pMES4 vector and the second PCR product were double-digested with PstI and BstEII, respectively. 1.5 μg of the digested vector and 450 ng of the second PCR product were added, along with 15 μL of T4 DNA ligase. Buffer and water were added to a total volume of 150 μL, and the mixture was incubated overnight at 16°C. The ligation product was then recovered. The product was recovered using a PCR product recovery kit, and eluted with 20 μL of water. The results of the double digestion of the pMES4 vector were detected by 1% agarose gel electrophoresis. Figure 7 M stands for Trans 2K DNA Marker; 1 is the undigested plasmid of the pMES4 vector; 2 is the product of double digestion of the pMES4 vector.
[0058] 2.7 Electroconversion and Storage Capacity Measurement
[0059] Take 10 μL of the purified ligation product and add it to a pre-cooled electroporation cuvette containing 50 μL of E. coli TG1 competent cells. Place the cuvette in an electroporator (BTX ECM630 electroporator) for electroporation. Remove the cuvette, revive and culture the transformants. Figure 8 (For transformation culture plates). Eighteen clones were randomly selected for colony PCR identification. Figure 9M stands for Trans 2K DNA Marker; 1-18 are randomly selected monoclonal PCR identification products. Library capacity is estimated based on the PCR positivity rate (library capacity = number of clones × dilution factor × PCR positivity rate × 10).
[0060] The primer sequences are as follows:
[0061] MP57: TTATGCTTCCGGCTCGTATG
[0062] GIII: CCACAGACAGCCCTCATAG
[0063] 2.8 Phage Amplification
[0064] The revived bacterial culture was inoculated into YT-AG medium and cultured at 37°C and 200 rpm until the culture OD reached its maximum. 600 =0.5. Take 10ml of bacterial culture and add 4×10 10 VCSM13 cells were statically infected at 37°C for 30 minutes. The cells were then centrifuged at 4000 rpm for 10 minutes at room temperature, and the supernatant was discarded. The cells were resuspended in 2×YT-AK medium (containing ampicillin and kanamycin) and incubated overnight at 37°C and 200 rpm. After centrifugation, 40 ml of the supernatant was collected and 10 ml of PEG / NaCl (20% / 2.5M) solution was added. The mixture was thoroughly mixed, centrifuged, and the supernatant was discarded. The precipitate was washed with 1 ml of ice-cold PBS and centrifuged again. 250 μl of pre-chilled PEG / NaCl was collected, thoroughly mixed, washed, and resuspended.
[0065] Determine phage titer: Incubate TG1 cells until OD500. 600 =0.4, use LB medium to serially dilute the phage, take the serially diluted phage TG1 culture and mix them for culture. The next day, observe the formation of phage plaques in the culture plate. Count the phage plaques in the dilution gradient plates with the number of phages between 30 and 300 and calculate the phage titer (pfu) according to the following formula.
[0066] Phage titer (pfu / ml) = dilution factor × number of phage plaques × 100
[0067] 2.9 Nanobody Screening
[0068] Positive clones were screened using recombinant PE antigen via ELISA. ELISA plates were coated with recombinant PE antigen, blocked with 5% BSA, and washed with PBST. 100 μl of phage supernatant was added to each well, and the plates were incubated at 37°C for 1 hour. The supernatant was discarded, and HRP-labeled mouse anti-M13 secondary antibody was added, followed by incubation at 37°C for 1 hour. The supernatant was then discarded, and TMB solution was added. The plates were incubated at room temperature for 5 hours, and 2M sulfuric acid stop solution was added to each well. Readings were taken at 450 nm using a microplate reader.
[0069] 2.10 Nanobody Expression and Purification in Escherichia coli
[0070] Clones that tested positive for phage ELISA were selected, plasmids were extracted, and the plasmids were transformed into strain BL. 21 Competent cells were induced to express nanobody proteins with IPTG. The supernatant (periplasmic extract) was collected and dialyzed into PBS. The periplasmic extract was purified using Ni-NTA resin, eluted and collected with different concentrations of imidazole, and the collected samples were analyzed by reduced protein electrophoresis. Finally, the nanobody was dialyzed into PBS.
[0071] Three anti-PE nanobodies were screened through alpaca immunization, cell isolation, phage library construction, and nanobody screening. Sequencing results were analyzed using Vector NTI software and logged into IMGT (…). http: / / www.imgt.org / IMGT_vquest The antibody light chain and heavy chain genes were analyzed to identify the framework regions (FRs) and complementary determining regions (CDRs) of the variable region.
[0072] The nanobody of a preferred embodiment selected by this invention is named "2H6". Through DNA sequencing, the heavy chain nucleic acid sequence of the nanobody 2H6 is shown in SEQ ID NO.5, and the amino acid sequence of the variable region is shown in SEQ ID NO.4, wherein amino acids 1-30 are FR1, amino acids 31-37 are CDR1, amino acids 38-51 are FR2, amino acids 52-68 are CDR2, amino acids 69-100 are FR3, amino acids 101-116 are CDR3, and amino acids 117-127 are FR4.
[0073] Example 3. Preparation of anti-PE nanobodies
[0074] 3.1 Amplification of the original nanobody strain TG1 and transformation of Escherichia coli BL with recombinant nanobody plasmid 21 (DE3)
[0075] The original strain TG1 glycerol bacteria containing nanobody nucleic acid was inoculated into 5 mL of fresh LB-A medium at a ratio of 1:1000 and cultured overnight at 37°C and 200 rpm. The next day, plasmids were extracted using the Plasmid mini kit (OMEGA) according to the manufacturer's instructions. After verification, 1 μl of the plasmid was transformed into 100 μl of competent cells, gently mixed, placed on ice for 30 minutes, heat-shocked in a 42°C water bath for 90 seconds, and cooled in an ice bath for 3 minutes. 600 μl of LB medium was added to a centrifuge tube and cultured at 37°C with shaking for 60 minutes. 100 μl of the supernatant was taken and spread onto LB-A plates using a triangular spreader and incubated upside down at 37°C overnight.
[0076] 3.2 Induction, Expression, and Extraction of Nanobodies
[0077] Pick the above single colonies and place them in LB-A medium, then incubate overnight at 37°C with shaking. The next day, add the bacterial suspension to 100 ml of fresh LB-A medium at a ratio of 1:100, and incubate at 37°C with shaking for 3 hours until the bacterial growth rate reaches OD. 600 =Approximately 0.8, add IPTG to a final concentration of 1 mM, and induce overnight at 30°C. On the third day, centrifuge at 8000 rpm for 10 minutes to collect the bacterial cells, and resuspend the pellet in 1.5 mL of pre-chilled TES buffer. After incubating on ice for 2 minutes, gently vortex for 30 seconds, repeating this cycle 6 times. Add 3.0 mL of TES / 4 (TES diluted 4 times with water), gently vortex for 30 seconds, and incubate on ice for 2 minutes, repeating the vortexing and incubation steps 6 times. Centrifuge at 9000 rpm at 4°C for 10 minutes, collect approximately 4.5 mL of supernatant (periplasmic extract), and perform protein electrophoresis analysis on the supernatant.
[0078] 3.3 Purification and Identification of Nanobodies
[0079] After resuspending the IMAC Sepharose (GE), add 2 ml to a gravity column and let it stand for 30 minutes to allow the sepharose to settle naturally to the bottom of the column. Then, drain the preservation buffer. Add 2 column volumes of 0.1 M nickel sulfate solution and drain the solution at a rate of approximately 8 drops per second. Add 10 column volumes of equilibration buffer to equilibrate and wash the sepharose, maintaining a constant flow rate. Dilute the sample 2-fold with equilibration buffer and add it to the gravity column, adjusting the flow rate to 6 drops per second, and collect the breakthrough solution. Add 10 column volumes of wash buffer to wash the sepharose, maintaining a constant flow rate, and collect the wash solution. Add 3 column volumes of elution buffer, maintaining a flow rate of 6 drops per second, and collect the eluent containing the target protein. Finally, add 10 column volumes of equilibration buffer, 10 column volumes of pure water, and 10 column volumes of 20% ethanol sequentially to wash the sepharose, and finally retain 4 ml of 20% ethanol to preserve the column. The collected samples were analyzed by SDS-PAGE. Figure 10 M represents the Rainbow 180 broad-spectrum protein marker; 1 represents the positive control; and 2 represents the purified nanobody 2H6 induced by E. coli.
[0080] Example 4. Affinity activity of anti-PE nanobodies with PE antigens
[0081] 4.1 Chip antigen conjugation
[0082] The antigen was prepared into a 20 μg / mL working solution using sodium acetate buffers at different pH values (pH 5.5, pH 5.0, pH 4.5, pH 4.0). A 50 mM NaOH regeneration solution was also prepared. The electrostatic binding between the antigen and the chip (GE) surface under different pH conditions was analyzed using the template method in the Biacore T100 protein interaction analysis system. A 5-fold increase in signal strength (RL) was used as the standard to select a suitable, near-neutral pH system, and the antigen concentration was adjusted as needed for coupling. The chip was coupled according to the instrument's built-in template method: channel 1 was selected in blank coupling mode, and channel 2 was selected in target coupling mode, with the target set to the designed theoretical coupling amount. The coupling process took approximately 60 minutes.
[0083] 4.2 Exploration of Analyte Concentration Setting Conditions and Optimization of Regeneration Conditions
[0084] Manual injection was used, selecting channel 1 and channel 2 in 2-1 mode, with a flow rate of 30 μL / min. Injection conditions were 120 seconds and 30 μL / min for both. Regeneration conditions were 30 seconds and 30 μL / min for both. First, the run buffer was continuously run empty until all baselines were stable. Nanobody solutions with a wide concentration range were prepared using the run buffer, with recommended concentrations of 200 μg / mL, 150 μg / mL, 100 μg / mL, 50 μg / mL, 20 μg / mL, 10 μg / mL, and 2 μg / mL. Regeneration solutions were prepared using four pH gradients of the glutamate hydrochloride system: 1.5, 2.0, 2.5, and 3.0. A 200 μg / mL analyte sample was manually injected, and channel 2 was observed. Regeneration was performed using the most neutral pH regeneration buffer until the response line in channel 2 returned to the same height as the baseline. Manually inject another 200 μg / mL analyte sample, observe the signal change in channel 2-1 and record the binding amount. Regenerate using the regeneration solution used in the previous step to bring the response line back to baseline. Manually inject another 200 μg / mL analyte sample, observe the signal change in channel 2-1 and record the binding amount. Compare this to the previous binding amount. If the deviation is less than 5%, the regeneration solution at this pH is considered the optimal regeneration solution. If the binding amount after the second injection is lower, continue the experiment using a regeneration buffer with a lower pH. Use the selected optimal regeneration solution as the chip surface regeneration reagent after each injection. Inject samples of the analyte concentrations set above and analyze the binding amount at each concentration to ultimately determine the concentration gradient required for affinity testing.
[0085] 4.3 Affinity Test
[0086] Following the optimized sample concentration gradient and regeneration solution, the affinity between the nanobody and the antigen was tested using the instrument's built-in template method (with injection conditions set to 60 seconds, 30 μL / min; dissociation time: 600 seconds; regeneration conditions: 30 seconds, 30 μL / min). The signal in channel 2-1 was continuously monitored. The affinity test process took approximately 200 minutes. In the specific experiment, the PE nanobody on the chip was captured to an appropriate signal value, and then injected onto the chip at a flow rate of 30 μL / min using system running buffer HBS-EP (10 mM HEPES, 150 mM NaCl, 3 mM EDTA, 0.05% P2O) to obtain the dynamic process of the interaction between the nanobody and the PE antigen.
[0087] 4.4 Results Analysis
[0088] Binding and dissociation curves at several suitable concentration gradients were selected and fitted using a 1:1 binding mode to obtain the affinity values, binding constants, dissociation constants, and other important parameters. The affinity value of the anti-PE toxicity nanobody 2H6 was 1.339E-10 (affinity results are shown in [link to results]). Figure 11 ).
[0089] Example 5. In vitro tumor cell experiment to detect the neutralizing immunotoxin effect of anti-PE nanobodies
[0090] 5.1 Inhibition rate of natural PE immunotoxin on A431 cells and SK-OV3 cells
[0091] 2H6 was used in in vitro cell experiments along with VHH-PE1 (referred to as 2H10 in this example) from Chinese invention patent CN107827981B and VHH-PE2 (referred to as 3A7 in this example) from Chinese invention patent CN110423273B. Since the cytotoxic effect of PE immunotoxin on cells is related to the number of EGFR cells on the cell surface, the tumor cells used in this experiment, A431 cells (purchased from ATCC) and SK-OV3 cells (purchased from ATCC), were two types of tumor cells with significantly different numbers of EGFR cells on their cell surface. The number of EGFR cells on the surface of A431 cells was approximately 3 × 10⁻⁶. 6 The number of EGFR on the surface of SK-OV3 cells is less than 2 × 10⁻⁶. 5 Cytotoxicity assays were performed using the MTT assay (MTT Cell Proliferation and Cytotoxicity Assay Kit). A431 cells (purchased from ATCC) were seeded into 96-well plates at 6,000 cells per well and incubated at 37°C and 5% CO2 for 24 hours. Natural PE antigen (purchased from SIGMA) was added to a final concentration of 5 μg / ml, followed by two antibodies at final concentrations of 200 μg / ml, 160 μg / ml, 80 μg / ml, 40 μg / ml, 20 μg / ml, and 10 μg / ml, with each antibody concentration used in triplicate. A blank control was set up using PBS, a negative control using purified antigen, and a positive control using purified antibody. The plates were incubated at 37°C and 5% CO2 for 24 hours. The culture medium was discarded, and 10 μl of MTT and 100 μl of fresh culture medium were added, followed by incubation for 4 hours. Then, the culture medium was discarded, and 110 μl of Formazan solvent was added, followed by low-speed shaking for 10 minutes. Finally, the absorbance of each well was measured by enzyme-linked immunosorbent assay (570 nm) to compare the changes in the inhibition rate of natural PE immunotoxin on A431 and SK-OV3 tumor cells before and after the addition of nanobodies.
[0092] 5.2 Results Analysis
[0093] Without antibodies, the natural PE toxin inhibited A431 cells by 92% and SK-OV3 cells by 100%. With the addition of different concentrations of nanobodies, the inhibition rate of A431 cells gradually decreased, while the inhibition rate of SK-OV3 cells remained unchanged. The results showed that a 2H6 antibody concentration of 10 μg / ml produced a significant protective effect on cells, with a cell inhibition rate of 0%. This means that a 2H6 antibody concentration of 10 μg / ml was sufficient to completely neutralize the toxic effects of PE toxin, achieving a 100% protection rate for cells. Its neutralizing activity was significantly higher than that of 2H10 and 3A7. (Inhibition rate curves are shown in...) Figure 12 ).
Claims
1. A nanobody against PE toxin, characterized in that, The amino acid sequence of the variable region of the nanobody is shown as SEQ ID NO.
4.
2. A polynucleotide encoding the Nanobody of claim 1, characterized in that, The sequence of the polynucleotide is shown as SEQ ID NO.
5.
3. An expression vector containing the polynucleotide of claim 2.
4. The carrier of claim 3, wherein, The vector is pMES4.
5. A host cell containing the expression vector of claim 4.
6. The host cell of claim 5, wherein, The cell is Escherichia coli BL21 (DE3).
7. The nanobody of claim 1 for use in the preparation of a medicament for the treatment of Pseudomonas aeruginosa exotoxin A.
Citation Information
Patent Citations
Nanobodies against Pseudomonas aeruginosa exotoxin A and their applications
CN107827981B
Anti-Pseudomonas aeruginosa exotoxin A nanobody and its application
CN110423273B
High-neutralization-activity pseuduomonas exotoxin A resistant nanometer antibody and application thereof
CN110423273A