A method for biocatalytic synthesis of p-hydroxybenzylideneacetone

Abstract

The present invention discloses a method for biocatalytic synthesis of p-hydroxybenzylideneacetone, belonging to the technical field of bioengineering. First, a recombinant Escherichia coli overexpressing deoxyriboaldolase was constructed, and the whole cells and immobilized cells of this recombinant strain were used to catalyze p-hydroxybenzaldehyde to generate p-hydroxybenzylideneacetone with acetone as the reaction medium. When the whole cells of the recombinant Escherichia coli provided by the present invention were used for catalytic preparation of p-hydroxybenzylideneacetone, the yield reached 19 g / L, and the molar conversion rate of p-hydroxybenzaldehyde reached 99.8%. The method for preparing p-hydroxybenzylideneacetone by the biological method provided by the present invention has the advantages of mild reaction conditions, simple process, easy control, etc., and is also beneficial to environmental protection and easy to promote and apply.

Description

Technical Field

[0001] The present invention relates to a method for biocatalytically synthesizing p-hydroxybenzylidene acetone, in particular to a recombinant Escherichia coli overexpressing deoxynuclear aldolase and application thereof in synthesizing p-hydroxybenzylidene acetone, belonging to the technical field of bioengineering. Background Art

[0002] p-Hydroxybenzylideneacetone (4-hydroxybenzylideneacetone) is a structural analogue of dehydrogingerone. Firstly, relevant studies have shown that p-Hydroxybenzylideneacetone has anti-cancer and anti-inflammatory functions and can be used in healthcare products. Secondly, raspberry ketone, the hydrogenation product of p-Hydroxybenzylideneacetone, is a flavor compound second only to vanillin and has a high market value.

[0003] Currently, the preparation of p-hydroxybenzylideneacetone is primarily based on chemical synthesis, namely, through the base-catalyzed cross-aldol condensation of p-hydroxybenzaldehyde and acetone. However, the large amount of base used in this process can easily cause problems such as equipment corrosion and environmental pollution. For example, Yong Jixin et al. used 10% to 20% sodium hydroxide as a catalyst to catalyze the condensation of p-hydroxybenzaldehyde and acetone, achieving a yield of 96%. The condensation product was then added with glacial acetic acid to neutralize the base and then crystallized to obtain the product. However, the large amount of acid and base used can easily cause environmental pollution and equipment corrosion (CN93120105.5). To address the environmental issues caused by the acid and base in this catalytic process, Li Guanbing et al. condensed p-hydroxybenzaldehyde and acetone in a supercritical fluid state, achieving a yield of 96%. The reaction was carried out in a pipeline reactor using toluene as the reaction solvent at a reaction temperature of 250°C to 350°C and a reaction pressure of 10 MPa to 25 MPa. This resulted in high equipment costs and the high toxicity of toluene (CN201811599717.7). There are few studies on the biosynthesis of p-hydroxybenzylideneacetone, and there is a problem of low product concentration. G. Feron et al. obtained p-hydroxybenzylideneacetone at a maximum concentration of 160 mg / L using Escherichia coli ATCC 86963 fermentation (Letters in applied microbiology, 2007). However, the low product concentration of the fermentation method has no practical value. Summary of the Invention

[0004] [Technical Issues]

[0005] The technical problem to be solved by the present invention is that the product concentration is low when the existing biological method synthesizes p-hydroxybenzylidene acetone.

[0006] [Technical solution]

[0007] The present invention provides a recombinant Escherichia coli containing a recombinant plasmid for overexpressing a deoxyribose aldolase. In certain embodiments of the present invention, the nucleotide sequence of the gene encoding the deoxyribose aldolase is shown in SEQ ID NO. 1. In certain embodiments of the present invention, the recombinant plasmid is recombinant pRSF-duet-1, which is a high-copy plasmid.

[0008] In certain embodiments of the present invention, E. coli BL21 (DE3) is used as the expression host.

[0009] The present invention also provides a method for constructing the above-mentioned recombinant Escherichia coli, comprising the following steps:

[0010] (1) The gene encoding deoxyribose aldolase was cloned into the expression vector pRSF-duet-1 to obtain a recombinant plasmid.

[0011] (2) Transform the recombinant plasmid into host cells.

[0012] In certain embodiments of the present invention, step (1) involves cloning the gene encoding deoxyribose aldolase into the expression vector pRSF-duet-1 to obtain a recombinant plasmid.

[0013] In certain embodiments of the present invention, in step (2), the recombinant plasmid is transformed into E. coli BL21 (DE3) competent cells, and the correctly constructed recombinant E. coli is screened on an LB resistance plate containing 30-100 mg / L kanamycin.

[0014] The present invention provides an immobilized recombinant Escherichia coli using carrageenan as a carrier to facilitate the reuse of the catalyst. The preparation method of the immobilized recombinant Escherichia coli comprises the following steps:

[0015] (1) culturing the recombinant Escherichia coli and inducing it to express deoxyribose aldolase, and then centrifuging and collecting to obtain wet cells,

[0016] (2) Mix 8–10 g of wet bacterial cells with 8–10 mL of normal saline to prepare a bacterial suspension, and keep it at 45–50°C.

[0017] (3) dissolving 1-2 g of carrageenan in 30-40 mL of normal saline, heating at 80-100° C. to form a transparent gel, and then cooling to 45-50° C.; the carrageenan is preferably K-carrageenan;

[0018] (4) The bacterial suspension was mixed with carrageenan colloid and immobilized at 4-10°C for 30-60 min, then placed in 0.3 M KCl solution for 4-6 h, and then cut into 3*3*3 mm fixed cells.

[0019] The present invention provides a method for producing p-hydroxybenzylideneacetone using the recombinant Escherichia coli, comprising the following steps:

[0020] (1) culturing the recombinant Escherichia coli and inducing it to express deoxyribose aldolase, and then centrifuging and collecting to obtain wet cells,

[0021] (2) The wet bacteria are mixed with p-hydroxybenzaldehyde and acetone. The wet bacteria serve as a catalyst, and p-hydroxybenzaldehyde and acetone serve as substrates to react to obtain p-hydroxybenzylideneacetone.

[0022] In certain embodiments of the present invention, step (1) culture the recombinant Escherichia coli and induce it to express deoxyribose aldolase with IPTG, and then centrifuge and collect to obtain wet cells.

[0023] In certain embodiments of the present invention, after the recombinant E. coli is activated in step (1), it is transferred to 30 mL of LB medium and cultured at 37°C at a speed of 220 rpm for 12 h. The above bacterial solution is then transferred to 50 mL of TB medium at an inoculum size of 2%, and cultured at 37°C at a speed of 220 rpm for 1.5 h. IPTG is added to a final concentration of 0.8 mM and induced at 20°C for 20 h. The precipitate is then collected by centrifugation at 8000 r / min for 10 min to obtain the wet bacterial cells.

[0024] In certain embodiments of the present invention, in step (2), the ratio of the wet recombinant E. coli cells to the substrates acetone and p-hydroxybenzaldehyde is (1:3:0.03) to (1:4:0.3), and the concentration of the substrate p-hydroxybenzaldehyde is 60 mM to 480 mM.

[0025] In certain embodiments of the present invention, in step (2), 1 g of the wet cells obtained in step (1) is added to 4 mL of acetone to prepare a 5 mL reaction system, and p-hydroxybenzaldehyde is added to a final concentration of 120 mM, and the reaction is carried out at 200 rpm and 60° C. for 48 h.

[0026] In certain embodiments of the present invention, in step (2), the substrate and / or catalyst may be added in batches or continuously during the reaction process.

[0027] The present invention also provides a method for preparing p-hydroxybenzylidene acetone by using immobilized recombinant Escherichia coli, wherein the immobilized recombinant Escherichia coli is used as a catalyst, and p-hydroxybenzaldehyde and acetone are used as substrates to react to obtain p-hydroxybenzylidene acetone.

[0028] In certain embodiments of the present invention, after one batch of reactions is completed, the immobilized recombinant E. coli is recovered and used for the next batch of reactions.

[0029] In certain embodiments of the present invention, 8-9 g of the above-mentioned immobilized recombinant E. coli were added to 5 ml of acetone, and then p-hydroxybenzaldehyde was added to a final concentration of 120 mM, and the mixture was allowed to react at 60° C. for 36 h.

[0030] [Beneficial Effects]

[0031] Deoxyribose aldolase, derived from Escherichia coli, is an enzyme that catalyzes cross-aldol condensation reactions. This invention overexpresses deoxyribose aldolase in E. coli and uses whole cells of this engineered strain as a catalyst to synthesize and increase the yield of p-hydroxybenzylideneacetone in a non-aqueous system. Recombinant E. coli whole cells catalyze the reaction of 120 mM p-hydroxybenzaldehyde and acetone, producing 19.26 g / L of p-hydroxybenzaldehyde with an 89% yield and a p-hydroxybenzaldehyde molar conversion of 99%.

[0032] To reduce the cost of whole-cell catalysts, the present invention further utilizes carrageenan to immobilize cells, enabling the reuse of the whole-cell catalyst. After 10 uses, the p-hydroxybenzylideneacetone yield showed no significant decrease, and the molar conversion of p-hydroxybenzaldehyde was 95%, reducing catalyst production costs during the catalytic process. This also avoids the need for alkaline catalysts in chemical synthesis and acid neutralization for product extraction.

[0033] The reaction principle of the present invention is that the substrates p-hydroxybenzaldehyde and acetone are first condensed into β-hydroxyaldehyde under the catalysis of deoxyribose aldolase, and the β-hydroxyaldehyde is further dehydrated to form p-hydroxybenzylideneacetone. Acetone serves as both the substrate and the reaction medium of the catalytic reaction. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Reaction principle diagram of the present invention.

[0035] Figure 2 Diagram of whole-cell catalysis and immobilized cell catalysis devices.

[0036] Figure 3 The p-hydroxybenzylideneacetone in the extracted product was detected by HPLC. DETAILED DESCRIPTION

[0037] The culture medium involved in the following examples is as follows:

[0038] LB liquid medium: 10 g / L sodium chloride, 10 g / L tryptone, 5 g / L yeast extract.

[0039] TB liquid medium: 11.8 g / L tryptone, 23.6 g / L yeast extract, 9.4 g / L K2HPO4, 2.2 g / L KH2PO4, 4 ml / L glycerol.

[0040] LB solid medium: 10 g / L sodium chloride, 10 g / L tryptone, 5 g / L yeast extract, and 15 g / L agar powder.

[0041] Detection method of p-hydroxybenzaldehyde and p-hydroxybenzylideneacetone content: The content of p-hydroxybenzaldehyde and p-hydroxybenzylideneacetone during the reaction was determined by high performance liquid chromatography: Waters, Agilent C18 column, mobile phase of 20:80 acetonitrile, 0.08% phosphoric acid, flow rate of 1 mL / min, detection wavelength of 222 nm, and single sample running time of 25 min.

[0042] Sample treatment method: After the catalytic reaction is completed, take 1 mL of the conversion solution and centrifuge it at 14000 r / min for 5 minutes. Then take 100 μL of the supernatant obtained by centrifugation and add 900 μL of methanol for dilution. Then centrifuge it at 14000 r / min for 5 minutes. Filter the supernatant obtained by centrifugation with a 0.22 μm organic filter membrane. Take the filtrate and use high performance liquid chromatography to quantitatively detect the substrate p-hydroxybenzaldehyde and the product p-hydroxybenzylideneacetone.

[0043] Calculation method of molar conversion and yield of p-hydroxybenzaldehyde:

[0044]

[0045]

[0046] Example 1: Preparation of recombinant Escherichia coli

[0047] (1) Construction of recombinant plasmid pRSF-Deoc

[0048] The nucleotide sequence of the Deoc gene of Escherichia coli BL21 (DE3) (as shown in SEQ ID NO.1) was used as a template and Deoc-F and Deoc-R were used as primers for PCR amplification. The PCR reaction conditions were as follows: pre-denaturation at 90-98°C for 3-5 min, denaturation at 95°C for 30-45 sec, annealing at 55°C for 30-45 sec, extension at 70-72°C for 1 min, 30 cycles, and full extension at 70-72°C for 5-10 min.

[0049] After the PCR reaction was completed, the PCR product was detected by agarose gel electrophoresis, and the deoxyribose aldolase gene Deoc was recovered from the gel. The primers were:

[0050] Deoc-F:CGGGATCCAATGACTGATCTGAAAGCAAGCAG

[0051] Deoc-R:CCCAAGCTTTTAGTAGCTTGCTGGCGCTC.

[0052] The Deoc gene obtained in the above steps and the vector pRSF-duet-1 were digested with restriction endonucleases Bam HI and Hind III, respectively, and then ligated with ligase. The ligation product was introduced into Escherichia coli JM 109 competent cells to obtain a transformed strain. The transformed strain was spread on LB solid medium containing 30-100 mg / L kanamycin resistance. Positive clones were picked, and colony PCR was used to verify the correct recombinant strain. The strain was named pRSF-Deoc and sent to Suzhou Anshengda Biotechnology Co., Ltd. for sequencing.

[0053] (2) Transform the recombinant plasmid into host cells

[0054] The correctly sequenced recombinant plasmid pRSF-Deoc was mixed with Escherichia coli BL21 (DE3) competent cells and then placed on ice for 30 minutes. After heat shock at 42°C for 45 seconds, the mixture was quickly placed on ice for 2 minutes. 890ul of LB liquid medium was added and incubated at 37°C for 1 hour. After centrifugation at 10,000 rpm for 1 minute, the transformed strain was spread on LB solid medium containing 30-100 mg / L of kanamycin resistance. Positive clones were picked and colony PCR was used to verify the correct recombinant strain, which was named BL21 (DE3) / pRSF-Deoc, which is the prepared recombinant Escherichia coli.

[0055] Example 2: Production of p-Hydroxybenzylideneacetone using recombinant Escherichia coli (different reaction temperatures)

[0056] The specific steps are as follows:

[0057] (1) The recombinant E. coli BL21 / pRSF-Deoc prepared in Example 1 was streaked onto LB solid medium and cultured at 37°C for 12 hours to obtain a single colony; the single colony was inoculated into 30 ml of liquid LB medium and cultured at 37°C for 12 hours at 220 rpm to obtain a seed solution. The seed solution was inoculated into 50 ml of TB liquid medium at a 2% inoculum, cultured at 37°C for 1.5 hours at 220 rpm, and then induced at 20°C for 20 hours by adding IPTG at a final concentration of 0.8 mM. After induction, the precipitate was collected by centrifugation at 8000 rpm for 10 minutes to obtain the desired wet bacterial cells.

[0058] (2) 1 g of wet cells was added to 4 ml of acetone to prepare a 5 ml reaction system. p-Hydroxybenzaldehyde was added to a final concentration of 120 mM. The reaction was carried out at 200 rpm and 30, 40, 50, 60, or 70°C for 36 h. The product p-hydroxybenzylideneacetone in the conversion solution was detected by HPLC. The results are shown in Table 1.

[0059] Table 1: Effect of temperature on the production of p-hydroxybenzylideneacetone by recombinant Escherichia coli whole cells

[0060] Temperature (℃) p-Hydroxybenzylideneacetone yield (g / L) 30 4.96 40 8.85 50 11.72 60 16.94 70 16.90

[0061] Example 3: Production of p-Hydroxybenzylideneacetone using recombinant Escherichia coli (different substrate concentrations)

[0062] The specific steps are as follows:

[0063] 1 g of the wet cells obtained in step (1) of Example 2 above was added to 4 ml of acetone to prepare a 5 ml reaction system. p-Hydroxybenzaldehyde was added at final concentrations of 120, 240, 360, and 480 mM, respectively. The reaction was carried out at 200 rpm and 60°C for 48 h. The results of HPLC detection are shown in Table 2.

[0064] Table 2: Effect of the concentration of substrate p-hydroxybenzaldehyde on the production of p-hydroxybenzylideneacetone by whole-cell catalysis

[0065]

[0066] Example 4: Production of p-Hydroxybenzylideneacetone using recombinant Escherichia coli (fed-batch)

[0067] The specific steps are as follows:

[0068] 1 g of the wet cells obtained in step (1) of Example 2 above was added to 4 ml of acetone to prepare a 5 ml reaction system. Initially, p-hydroxybenzaldehyde was added to a final concentration of 360 mM. After reacting at 200 rpm and 60°C for 24 h, the residual concentration of p-hydroxybenzaldehyde was detected to be 84 mM. 120 mM p-hydroxybenzaldehyde was added, and the reaction was continued at 200 rpm and 60°C for 60 h. The p-hydroxybenzylideneacetone was detected by HPLC.

[0069] The concentration of p-hydroxybenzylideneacetone was detected to be 60.6 g / L after 84 h of reaction using a fed-batch strategy, and the molar conversion rate of p-hydroxybenzaldehyde increased to 94%.

[0070] Example 5: Synthesis of p-Hydroxybenzylideneacetone using immobilized recombinant Escherichia coli

[0071] The specific steps are as follows:

[0072] (1) Preparation of recombinant Escherichia coli cells

[0073] According to the method of step (1) of Example 2, wet cells of recombinant Escherichia coli were prepared.

[0074] (2) Preparation of immobilized cells

[0075] 8 g of the wet bacteria were dissolved in 8 ml of normal saline to obtain a bacterial suspension, which was kept warm at 45°C. 1.5 g of K-carrageenan was dissolved in 34 ml of normal saline and heated at high temperature to form a transparent gel. After cooling to 50°C, the mixture was evenly mixed with the bacterial suspension. The mixture was placed at 10°C to solidify for 30 min, and then placed in 0.3 M KCl solution to harden for 4 h. After hardening, the gel blocks were cut into 3*3*3 mm blocks to obtain the prepared immobilized cells.

[0076] (3) Reuse of immobilized cells

[0077] 8.5 g of the immobilized cells were added to 5 ml of acetone and p-hydroxybenzaldehyde (final concentration: 360 mM) and soaked for 24 h. The acetone solution was then poured out, and 5 ml of acetone and p-hydroxybenzaldehyde (final concentration: 120 mM) were added. The mixture was allowed to react at 60°C for 36 h. The reaction solution was then poured out, and 5 ml of acetone and p-hydroxybenzaldehyde (final concentration: 120 mM) were added again. The mixture was allowed to react at 60°C for 36 h. After this reaction was repeated 10 times, the molar conversion of p-hydroxybenzaldehyde still reached 94%.

[0078] The results are shown in Table 3.

[0079] Table 3: p-Hydroxybenzylideneacetone production and p-Hydroxybenzaldehyde molar conversion of immobilized cells under different reaction times

[0080]

[0081] Example 6: Extraction of whole cell catalytic product p-hydroxybenzylideneacetone

[0082] The specific steps are as follows:

[0083] (1) 1 g of wet cells obtained in step (1) of Example 2 above was added to 4 ml of acetone to prepare a 5 ml reaction system. p-Hydroxybenzaldehyde was added to a final concentration of 120 mM, and the reaction was carried out at 200 rpm and 60°C for 48 h. 60 ml of the whole-cell transformation solution was centrifuged at 8000 rpm for 10 min, and the supernatant was collected.

[0084] (2) The supernatant was evaporated at 40°C for 1 hour in a vacuum rotary evaporator to obtain a brown oil. 120 ml of pH 10 distilled water was added thereto and stirred at 60°C for 30 minutes to fully dissolve the p-hydroxybenzylideneacetone.

[0085] (3) The aqueous solution obtained in step (2) was cooled at 4°C for 12 h, and the yellow crystals obtained were filtered and vacuum dried at 40°C for 2 h.

[0086] (4) Take 5 mg of the obtained sample and add methanol to prepare a 1 g / L extraction sample. The obtained sample is filtered through a 0.22 μm organic filter membrane and then the purity is detected by HPLC.

[0087] The purity of the obtained p-hydroxybenzylideneacetone is greater than 99% as determined by HPLC.

[0088] Although the present invention has been disclosed above in terms of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. Recombinant Escherichia coli, characterized in that, It contains a recombinant plasmid for overexpressing deoxyriboaldolase, and the nucleotide sequence of the gene encoding the deoxyriboaldolase is shown as SEQ ID NO.

1.

2. The recombinant Escherichia coli according to claim 1, characterized in that, The recombinant plasmid is recombinant pRSF-duet-1.

3. The recombinant Escherichia coli according to claim 1, wherein Using E. coli BL21(DE3) as the expression host.

4. The method for constructing the recombinant Escherichia coli according to any one of claims 1 to 3, characterized in that, It includes the following steps: (1) Clone the gene encoding deoxyriboaldolase into the expression vector pRSF-duet-1 to obtain a recombinant plasmid. (2) Transform the recombinant plasmid into a host cell.

5. An immobilized recombinant Escherichia coli, characterized in that, The preparation method includes the following steps: (1) Cultivate the recombinant Escherichia coli according to any one of claims 1 to 4 and induce it to express deoxyriboaldolase, then centrifuge and collect to obtain wet bacterial cells. (2) Mix 8 - 10 g of wet bacterial cells with 8 - 10 mL of physiological saline to prepare a bacterial suspension, and keep it warm at 45 - 50 °C. (3) Dissolve 1 - 2 g of carrageenan in 30 - 40 mL of physiological saline, heat it to a transparent gel at 80 - 100 °C, and then cool it to 45 - 50 °C; the carrageenan is K-carrageenan. (4) Mix the bacterial suspension with the carrageenan colloid, immobilize it at 4 - 10 °C for 30 - 60 min, then place it in a 0.3 M KCl solution to harden for 4 - 6 h, and then cut it into immobilized cells of 3×3×3 mm.

6. A method for producing p-hydroxybenzylideneacetone using the recombinant Escherichia coli according to any one of claims 1 to 3, characterized in that, It includes the following steps: (1) Cultivate the recombinant Escherichia coli and induce it to express deoxyriboaldolase, then centrifuge and collect to obtain wet bacterial cells. (2) Mix the wet bacterial cells with p-hydroxybenzaldehyde and acetone. The wet bacterial cells serve as a catalyst, and p-hydroxybenzaldehyde and acetone serve as substrates to react to obtain p-hydroxybenzylideneacetone.

7. The method according to claim 6, characterized in that, In step (2), the concentration of the substrate p-hydroxybenzaldehyde is 60 mM - 480 mM.

8. Use of the recombinant Escherichia coli according to any one of claims 1 to 3 or the immobilized recombinant Escherichia coli according to claim 5 in the preparation of p-hydroxybenzylideneacetone.

9. Use of the recombinant Escherichia coli according to any one of claims 1 to 3 or the immobilized recombinant Escherichia coli according to claim 5 in the preparation of a product containing p-hydroxybenzylideneacetone.

Images