Method for promoting activity enhancement of lactic acid bacteria
By amplifying and constructing the recombinant expression vector of LPxTG structural protein and signal peptide, the problem of insufficient activity and adhesion performance of lactic acid bacteria in the prior art was solved, and the high survival rate and strong adhesion of recombinant bacteria in gastric and intestinal fluid was achieved, and the colonization of Lactobacillus plantarum C8 was promoted in the intestinal tract.
Patent Information
- Application Number
- CN202510554430.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-29
- Publication Date
- 2025-07-22
AI Technical Summary
In the prior art, there are few studies on the combination of LPxTG structural proteins and signal peptides, and it has not effectively improved the activity and adhesion properties of lactic acid bacteria.
By amplifying the gene of interest of LPxTG structural protein and signal peptide, recombinant expression vectors were constructed and introduced into E. coli BL-21 and Lactobacillus plantarum C8, recombinant bacterial species were formed and co-cultured to enhance their activity and adhesion properties.
It improves the survival rate and adhesion performance of recombinant bacterial strains in gastric and intestinal fluid, enhances the colonization ability of Lactobacillus plantarum C8 in the intestine, and is beneficial to intestinal health.
Smart Images

Figure CN120350049A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of lactic acid bacteria, and particularly to a method for promoting the enhancement of lactic acid bacteria activity. Background Art
[0002] Lactic acid bacteria are a group of bacteria that can ferment sugars and produce a large amount of lactic acid. They play an important role in food fermentation, probiotic research, and the biomedical field. Lactic acid bacteria are widely present in nature and the human intestine and play an important role in maintaining human health. Currently, lactic acid bacteria are widely used in the manufacture of probiotic preparations. Common lactic acid bacteria include, for example, Lactobacillus plantarum.
[0003] In recent years, it has been found that surface proteins containing the LPxTG motif (LPxTG motif proteins) are a class of adhesion-related proteins mainly located on the cell surface of Lactobacillus plantarum. This protein can promote the tolerance of Lactobacillus plantarum and its colonization in host intestinal epithelial cells, and is also regulated by the quorum sensing of Lactobacillus plantarum.
[0004] Signal peptides can act as signal molecules and play an important role in the quorum sensing process of Lactobacillus plantarum. Signal peptides can affect the physiological functions of Lactobacillus plantarum (such as survival, adhesion performance, etc.) and the information exchange between bacterial communities by mediating signal transduction and gene regulation.
[0005] Currently, there is little research on the combination of LPxTG motif proteins and signal peptides. Whether there is a method to improve the activity of lactic acid bacteria needs to be further explored. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to provide a method for promoting the increase of lactic acid bacteria activity in view of the current situation of the prior art.
[0007] The technical solution adopted by the present invention to solve the above technical problem is as follows: A method for promoting the enhancement of lactic acid bacteria activity, characterized by comprising the following steps:
[0008] Step S1: Amplify the target gene corresponding to the LPxTG motif protein and the target gene corresponding to the signal peptide;
[0009] Step S2: Use the two target genes obtained in Step S1 as raw materials for amplification to obtain a target gene connecting the LPxTG motif and the signal peptide;
[0010] Step S3: Connect the target gene obtained in Step S2 with the plasmid gene sequence to construct a recombinant expression vector;
[0011] Step S4: Introduce the recombinant expression vector obtained in Step S3 into Escherichia coli BL-21 to increase the number of recombinant expression vectors;
[0012] Step S5: Introduce the recombinant expression vector obtained in Step S4 into Lactobacillus plantarum C8 to obtain a recombinant strain;
[0013] Step S6: Co-culture Lactobacillus plantarum C8 with the recombinant strain obtained in Step S5.
[0014] Preferably, in Step S1, the upstream primer for amplifying the target gene corresponding to the LPxTG structural protein is:
[0015] cagcaaatgggtcgcggatccATGAATGGCACGGTCAGTTTAGC;
[0016] The downstream primer for amplifying the target gene corresponding to the LPxTG structural protein is:
[0017] ACCAGTCTGTGGTAACATGGCC;
[0018] The upstream primer for amplifying the signal peptide gene is:
[0019] ccatgttaccacagactggtAATTTCAAAACAGCTGCAAAAGTAA;
[0020] The downstream primer for amplifying the signal peptide gene is:
[0021] gtggtggtggtggtgctcgagAGCTAAGAATAGTACGGATGCGC.
[0022] Preferably, in Step S3, the plasmid is pMG-36e;
[0023] Step S3 further includes amplifying the target gene obtained in Step S2 and amplifying the plasmid gene;
[0024] The upstream primer for amplifying the target gene obtained in Step S2 is:
[0025] cttgcttaggcagctgacttATGAATGGCACGGTCAGTTTAGC;
[0026] The downstream primer for amplifying the target gene obtained in Step S2 is:
[0027] cagctgatctcaacaatgtgAGCTAAGAATAGTACGGATGCGC;
[0028] The upstream primer for amplifying the plasmid gene is:
[0029] CACATTGTTGAGATCAGCTGCC;
[0030] The downstream primer for amplifying plasmid genes is as follows:
[0031] AAGTCAGCTGCCTAAGCAAGGT.
[0032] Compared with the prior art, the advantages of the present invention are as follows: By amplifying the target gene, constructing a recombinant expression vector, and recombinant strains, and co-culturing Lactobacillus plantarum C8 with the recombinant strains, the LPxTG structure and signal peptide recombinant protein expressed by the recombinant strains are released from the signal peptide under the action of the sortase of Lactobacillus plantarum C8. The signal peptide can affect the quorum sensing and other links of Lactobacillus plantarum C8. First, the survival rates of the whole of Lactobacillus plantarum C8 and the recombinant strains in gastric juice and intestinal juice are higher than those of Lactobacillus plantarum C8 alone and the recombinant strains alone, that is, it is beneficial to enhance the overall activity of lactic acid bacteria; Second, the adhesion performance of the whole of Lactobacillus plantarum C8 and the recombinant strains is better than that of Lactobacillus plantarum C8 alone and the recombinant strains alone, which is beneficial to the colonization of Lactobacillus plantarum C8 in the intestine, thus being beneficial to intestinal health. Description of the Drawings
[0033] Figure 1 Electrophoresis diagram of the amplification products of primers 1PCR, 2PCR, 3PCR, and 4PCR designed in Example 1 of the present invention;
[0034] Figure 2 Electrophoresis diagram of the recombinant lactic acid bacteria strain of the recombinant expression vector pMG-36e-LPxTG + signal peptide structural protein in Example 1 of the present invention;
[0035] Figure 3 Influence diagram of the overexpression system of the lactic acid bacteria surface protein containing LPxTG structure and signal peptide constructed in Example 2 of the present invention on the relative expression level of the target protein;
[0036] Figure 4 Influence diagram of the overexpression system of the lactic acid bacteria surface protein containing LPxTG structure and signal peptide constructed in Example 3 of the present invention on the gastrointestinal tolerance activity under co-culture conditions;
[0037] Figure 5 Influence diagram of the overexpression system of the lactic acid bacteria surface protein containing LPxTG structure and signal peptide constructed in Example 3 of the present invention on the adhesion characteristics of Caco-2 cells under co-culture conditions; Detailed Embodiments
[0038] The present invention will be further described in detail below in conjunction with the embodiments of the drawings.
[0039] Example 1:
[0040] A method for promoting the enhancement of lactic acid bacteria activity, including the following steps S1-S6.
[0041] 1.1 Amplify the target gene corresponding to the LPxTG structural protein and the target gene corresponding to the signal peptide (step S1)
[0042] Lactiplantibacillus plantarum C8 is deposited in the China General Microbiological Culture Collection Center. The deposit date is May 6, 2024, and the deposit number is CGMCC No. 30504. The taxonomic name is Lactiplantibacillus plantarum.
[0043] In this example, the whole genome of Lactiplantibacillus plantarum C8 was extracted using the Easy Pure Bacteria Genomic DNA Kit from TransGen Biotech, and the DNA concentration was verified using a ultra-micro spectrophotometer and sequenced.
[0044] Extract the protein of Lactiplantibacillus plantarum C8 and sequence it.
[0045] Screen out the gene sequences of the LPxTG structural protein and signal peptide related to quorum sensing from the whole genomics and whole proteomics of Lactiplantibacillus plantarum C8 (shown as SEQ ID No.1 and SEQ ID No.2), design primers with Primer premier5, the upstream and downstream of the primers are shown in Table 1, and they are synthesized by Shanghai Sangon Biotech Co., Ltd. Using the extracted whole genome of Lactiplantibacillus plantarum C8 as a template, perform PCR amplification using primer 1 (1-LPXTG-F / R) and primer 2 (2-signal peptide-F / R).
[0046] The nucleotide sequence of the LPxTG structural protein in Lactiplantibacillus plantarum C8 is (SEQ ID No.1):
[0047]
[0048] The nucleotide sequence of the signal peptide in Lactobacillus plantarum C8 is (SEQ ID No.2):
[0049] AGCCGCCTTCACAGCTGGGTTATTTTCGACCTGACTTGCTAAACTGACCGTGC CATTCAT.
[0050] The reaction system is as follows: a 20 μL reaction system, 1 μL of template, 1 μL of upstream primer, 1 μL of downstream primer, 10 μL of 2×Taq PCR MasterMix, and 7 μL of dd H2O.
[0051] After adding samples according to the above reaction system, amplification is carried out. The amplification conditions are:
[0052] Pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 sec, annealing at 56°C for 15 sec, extension at 72°C for 1 min, and further extension at 72°C for 5 min, repeating 35 cycles. The electrophoresis pattern of the amplification product is as shown in Figure 1 A, and it can be seen from Figure 1 that the size of the amplified target gene (LPxTG structural protein) is between 1000 - 1500 bp, and 1 PCR amplification product is obtained. It can be seen from Figure 1 that the size of the amplified target gene (signal peptide) is between 60 bp, and 2 PCR amplification products are obtained, both of which are in line with the expected target gene size.
[0053] Table 1 Primers for the target genes containing LPxTG structure and signal peptide
[0054]
[0055] 1.2 Obtain the target gene connecting the LPxTG structure and the signal peptide, that is, the target gene of the LPxTG structure and signal peptide recombinant protein (step S2)
[0056] In this example, the genes were purified using the Novizan FastPure Gel DNA Extraction Mini Kit for the 1 PCR product and the 2 PCR product, and the concentration of the purified DNA was verified using a ultra-micro spectrophotometer. The purified 1 PCR product and 2 PCR product were subjected to PCR amplification. The reaction system is as follows: a 20 μL reaction system, 1 μL each of the 1 PCR product and 2 PCR product templates, 1 μL each of the 1-LPXTG-F primer and 2-signal peptide-R primer (the same as Table 1), 10 μL of 2×Taq PCR MasterMix, and 6 μL of dd H2O. The amplification conditions are: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 sec, annealing at 56°C for 15 sec, extension at 72°C for 1 min, and further extension at 72°C for 5 min, repeating 35 cycles.
[0057] After connection, the target gene of the LPxTG structure and the signal peptide recombinant protein is obtained.
[0058] The electrophoresis pattern of the amplification product is as Figure 1 shown in B. It can be seen therefrom that the size of the target gene after the connection of LPxTG and the signal peptide is 1098 bp, between 1000 - 1500 bp, and 3 PCR products are obtained, which is in line with the expected size of the target gene.
[0059] 1.3 The target gene obtained in amplification step S2 (the target gene of the LPxTG structure and the signal peptide recombinant protein), amplify the gene sequence of the pMG-36e plasmid, and ligate the target gene in step S2 with the gene sequence of the pMG-36e plasmid to construct a recombinant expression vector (step S3)
[0060] In this example, the pMG-36e plasmid was extracted using the Novoprotein FastPure Plasmid Mini Kit, and the plasmid concentration was verified using a ultra-micro spectrophotometer.
[0061] Using the gene sequence of the pMG-36e plasmid published in the NCBI database (shown as SEQ ID No. 4) and the target gene sequence of the LPxTG structure and the signal peptide recombinant protein obtained in the above step S2 as templates, primers were designed using Primer premier5 and PCR amplification was performed. The primers (3-LPxTG + signal peptide-F / R) are shown in Table 2 and were synthesized by Shanghai Sangon Biotech Co., Ltd. The reaction system is as follows: 20 μL reaction system, 1 μL of template, 1 μL of 3-LPxTG + signal peptide-F primer, 1 μL of 3-LPxTG + signal peptide-R primer, 10 μL of 2×Taq PCR MasterMix, 7 μL of dd H2O. Using the extracted pMG-36e plasmid as a template, PCR amplification was performed using the primers (4-pMG-36e-F / R). The reaction system is as follows: 20 μL reaction system, 1 μL of template, 1 μL of 4-pMG-36e-F primer, 1 μL of 4-pMG-36e-R primer, 10 μL of 2×Taq PCR MasterMix, 7 μL of dd H2O. After loading the samples according to the above reaction system, amplification was carried out. The amplification conditions were: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 15 sec, annealing at 56°C for 15 sec, extension at 72°C for 2 min, and further extension at 72°C for 5 min, repeating 35 cycles.
[0062] Finally, the target gene of the LPxTG structure and the signal peptide recombinant protein and the linear pMG-36e plasmid gene were obtained respectively, and purified using the FastPure Gel DNA Extraction Mini Kit.
[0063] The purified LPxTG structure and signal peptide recombinant protein target gene were ligated by homologous recombination with the linear expression vector pMG-36e. The ligation reaction system was as follows: 10 μL (5 μL of 2×ClonExpress Mix, 1 μL of linearized vector pMG-36e, 1 μL of the LPxTG structure and signal peptide recombinant protein target gene, supplemented with ddH2O to 10 μL). The molar ratio of the linearized plasmid vector to the fragment of the LPxTG structure and signal peptide recombinant protein target gene was 1:1, and the ligation condition was to react at 50 °C for 1 h.
[0064] The nucleotide sequence of the LPxTG structure and signal peptide recombinant protein is (SEQ ID No.3):
[0065]
[0066] The nucleotide sequence of the pMG-36e plasmid is (SEQ ID No.4):
[0067]
[0068] The electrophoresis pattern of the amplified product is as shown in Figure 1 C and Figure 1 D. The size of the target gene is 1098 bp, within 1000 bp - 1500 bp, and the size of the linear plasmid gene is above 3000 bp, which is in line with the expected sizes of the target gene and the plasmid gene.
[0069] Table 2 Primers for pMG-36e plasmid and the target gene of LPxTG + signal peptide
[0070]
[0071] 1.4 The recombinant expression vector is introduced into Escherichia coli BL-21 to increase the number of recombinant expression vectors (Step S4)
[0072] The recombinant plasmid is added to the cloning competent cell BL-21(DE3), incubated on ice for 30 min, then quickly placed in a water bath at 42 °C for 90 sec, and then transferred to an ice box and incubated for 2 min. Then 900 μL of LB liquid medium is added and pipetted evenly. It is cultured with shaking on a shaker for 2 h (37 °C, 200 rpm), centrifuged at 5000 rpm for 3 min, and then the supernatant is discarded. An equal volume of LB liquid medium is added to resuspend, and the bacterial liquid is pipetted and spread evenly on an LB agar plate containing erythromycin (200 mg / mL) and cultured overnight. Single colonies are picked and cultured in an LB resistant liquid medium for 12 h, and the bacterial liquid is identified by PCR and sequenced (completed by Shanghai Sangon Biotech Co., Ltd.) to determine the Escherichia coli strain into which the recombinant plasmid has been successfully introduced.
[0073] 1.5 The recombinant expression vector obtained in Step S4 is introduced into Lactobacillus plantarum C8 to obtain a recombinant strain (Step S5)
[0074] Lactobacillus plantarum C8 is inoculated into 100 mL of MRS liquid medium and cultured statically overnight in an incubator at 37 °C for 3 generations of activation. It is inoculated into the competent medium (6.8332 g of sorbitol and 0.5 g of glycine dissolved in 50 mL of MRS liquid medium) at an inoculation amount of 2%, and cultured statically in an incubator at 37 °C until OD 600 = 0.3 - 0.6. The cultured competent Lactobacillus plantarum C8 is placed in an ice-water bath for 30 min, and the bacterial cells are washed 3 times (6000 r / min, 4 °C, 5 min) with sterile water. 10 mL of SM Buffer (16.3 g of sucrose and 0.036 g of magnesium chloride hexahydrate dissolved in 50 mL of sterile water) is added to resuspend the bacterial cells, and the bacterial cells are washed 2 times (6000 r / min, 4 °C, 5 min). Finally, the bacterial cells are resuspended with 2 mL of SM Buffer, aliquoted at 100 μL per tube into 1.5 mL sterile centrifuge tubes, and stored in a -80 °C refrigerator for later use.
[0075] The recombinant plasmid and the empty plasmid were extracted from recombinant Escherichia coli BL-21(DE3) using the Novizan FastPure Plasmid Mini Kit. 10 μL of the recombinant plasmid and the empty plasmid with a concentration of 0.1 μg / μL were added to the prepared competent Lactobacillus plantarum C8 and incubated on ice for 30 min. The ice-bathed mixture was added to a pre-chilled 2 mm electroporation cuvette and transformed by high-voltage pulsed electroporation. Transformation conditions: electric field strength 2000 v, resistance 400 Ω, time 5 ms, capacitance 25 mF.
[0076] After electroporation, 900 μL of pre-chilled recovery MRS liquid medium (6.832 g of sorbitol and 0.056 g of calcium chloride dissolved in 50 mL of MRS liquid medium) was quickly added to the electroporation cuvette. After mixing evenly, it was transferred into a sterile 1.5 mL centrifuge tube and statically cultured in a 37 °C incubator for 3 h. After recovery, centrifugation (3000 r / min, 4 °C, 1 min) was carried out to discard the supernatant, 1 mL of MRS liquid medium was added to resuspend the cells, 200 μL of the cell suspension was spread on an MRS plate containing 5 μg / mL of erythromycin, and after statically culturing in a 37 °C incubator for 48 h, single colonies were picked into MRS resistant liquid medium and cultured for 12 h, and the bacterial liquid was identified by PCR, as Figure 2 shown, and the lactic acid bacteria strains successfully introduced with the recombinant plasmid were determined and recorded as "recombinant strains". The lactic acid bacteria strains successfully introduced with the single pMG-36e plasmid were recorded as "empty vector strains".
[0077] 1.6 Co-culture Lactobacillus plantarum C8 with the recombinant strains obtained in step S5 (step S6).
[0078] Lactobacillus plantarum C8 and the recombinant strains can be used together as intestinal flora regulators, fermentation agents, etc. The recombinant strains can be used as biosynthetic agents under adverse environments, such as in biosynthesis and bioengineering, and can also be used in oral products as fermentation agents, etc.
[0079] Example 2: Verification of the expression level of the target gene in the overexpression system
[0080] 2.1 Determination of the expression level of the target gene by RT-qPCR
[0081] Lactobacillus plantarum C8, the empty vector strains, and the recombinant strains were activated for 3 generations and inoculated into 100 mL of MRS liquid medium at an inoculation amount of 2%, and statically cultured in a 37 °C incubator until OD 600= 1.0 ± 0.01. Extract the RNA of Lactobacillus plantarum C8, the empty vector strain, and the recombinant strain using the OMEGA HiPure Bacterial RNA Kit kit, and measure the RNA concentration and purity. Use the above-extracted RNA as a template to generate cDNA, and prepare a reverse transcription system (4 μL UEIris II RT MasterMix, 500 ng template RNA, 1 μL dsDNase, supplemented with RNase-free water to 20 μL) in a nuclease-free centrifuge tube on ice. After gently mixing, centrifuge briefly to make the liquid sink to the bottom, and perform the reaction under the following conditions on a PCR instrument: incubate at 37 °C for 2 min, incubate at 55 °C for 10 min, and then at 85 °C for 10 sec.
[0082] Use Table 3 for RT-qPCR amplification. The reaction system is as follows: 20 μL reaction system, 1 μL template, 0.4 μL upstream primer, 0.4 μL downstream primer, 10 μL 2×ChamQ Universal SYBR qPCR Master Mix, and 8.2 μL dd H2O. After adding the samples according to the above reaction system, perform the amplification. The amplification conditions are: pre-denature at 95 °C for 30 sec, and then perform 45 cycles of 95 °C for 10 sec and 60 °C for 30 sec.
[0083] The RT-qPCR results are as Figure 3 shown. Compared with Lactobacillus plantarum C8, the expression level of the target gene in the empty vector strain is 1.28, and there is no significant difference between the two; while the expression level of the target gene in the recombinant strain is 5.81, and the expression level of its target gene is significantly up-regulated.
[0084] Note: The overexpression system was successfully constructed.
[0085] Table 3 RT-qPCR primers
[0086]
[0087] Example 3: Verify the gastrointestinal tolerance activity and adhesion functional characteristics of the overexpression system under co-culture conditions
[0088] 3.1 Analysis of gastrointestinal tolerance of the overexpression system
[0089] The experiment was divided into five groups. Under the same volume of MRS broth medium, the following strains were inoculated respectively, and the total cell density of each group was controlled to be equal, all OD 600 = 1.0 ± 0.01;
[0090] The first group: Lactobacillus plantarum C8, denoted as L.plantarum C8;
[0091] The second group: the empty vector strain, denoted as pMG36e-L.C8;
[0092] Group 3: Recombinant strain, denoted as LP.SP-pMG36e-L.C8;
[0093] Group 4: Co-culture of Lactobacillus plantarum C8 and the empty vector strain (the cell numbers of Lactobacillus plantarum C8 and the empty vector strain each account for half of the total cell numbers), denoted as pMG36e-L.C8+L.plantarum C8;
[0094] Group 5: Co-culture of Lactobacillus plantarum C8 and the recombinant strain (the cell numbers of Lactobacillus plantarum C8 and the empty vector strain each account for half of the total cell numbers), denoted as LP.SP-pMG36e-L.C8+L.plantarum C8.
[0095] Groups 1 to 5 were used for a control experiment. Each group was statically cultured in an incubator at 37°C for 2 h, and colony counting was performed on MRS agar medium.
[0096] Groups 1 to 5 were used for a gastric juice treatment experiment. The cells were washed 3 times with sterile PBS (6000 r / min, 4°C, 5 min), and then the cells were resuspended in an equal volume of artificial gastric juice (pH = 2, 0.5% NaCl by mass fraction, 0.3% pepsin by mass fraction), statically cultured in an incubator at 37°C for 2 h, and colony counting was performed on MRS agar medium.
[0097] Groups 1 to 5 were used for an intestinal juice treatment experiment. The cells were washed three times with PBS, and then the cells were resuspended in an equal volume of artificial intestinal juice (pH = 8, 0.5% NaCl by mass fraction, 0.5% bile salts by mass fraction, 0.3% trypsin by mass fraction), statically cultured in an incubator at 37°C for 3 h, and colony counting was performed on MRS agar medium.
[0098] The results are as Figure 4 shown. In the control experiment without gastrointestinal fluid treatment, the viable cell counts of Group 1 (Lactobacillus plantarum C8), Group 2 (empty vector strain), Group 3 (recombinant strain), Group 4 (co-culture of Lactobacillus plantarum C8 and the empty vector strain), and Group 5 (co-culture of Lactobacillus plantarum C8 and the recombinant strain) were 9.126 log CFU / mL, 9.113 log CFU / mL, 9.077 log CFU / mL, 9.139 log CFU / mL, and 9.129 log CFU / mL, respectively. There was no significant difference among the five groups, indicating that each group could survive well in the standard environment and the viable cell counts of each group were the same at the initial experiment.
[0099] After 2 hours of gastric juice digestion, the viable cell counts of the first to fifth groups were 7.836 log CFU / mL, 7.839 log CFU / mL, 8.066 log CFU / mL, 7.884 log CFU / mL, and 8.106 log CFU / mL, respectively. Among them, the viable cell counts of the third and fifth groups were significantly different from those of the other three groups, and the viable cell count of the fifth group was the highest.
[0100] After 3 hours of intestinal juice digestion, the viable cell counts of the first to fifth groups were 5.527 log CFU / mL, 5.535 log CFU / mL, 5.594 log CFU / mL, 5.563 log CFU / mL, and 5.602 log CFU / mL, respectively. Compared with the other three groups, the viable cell counts of the third and fifth groups increased significantly, and the viable cell count of the fifth group was the highest.
[0101] In summary, it is shown that the overall survival rate of Lactobacillus plantarum C8 and the recombinant strain in gastric juice and intestinal juice is better than that of Lactobacillus plantarum C8 alone and the recombinant strain alone.
[0102] Moreover, according to the interaction relationship among the signal peptide, the LPxTG structural protein on Lactobacillus plantarum C8, and the quorum sensing of Lactobacillus plantarum, it can be analyzed that this overall can improve the survival of Lactobacillus plantarum C8. Specifically, the LPxTG structure and signal peptide protein expressed by the recombinant strain, under the action of the sortase of Lactobacillus plantarum C8, release the signal peptide, and the signal peptide can affect the quorum sensing and other links of Lactobacillus plantarum C8, thereby affecting the quantity and survival of Lactobacillus plantarum C8.
[0103] 3.2 Adhesion analysis of Caco-2 cells in the co-culture system with the overexpression system
[0104] The experimental grouping was the same as in 3.1 above, divided into five groups, denoted as the first to fifth groups respectively, and the total viable cell concentration of each group was controlled to be the same initially.
[0105] The first group: Lactobacillus plantarum C8, denoted as L.plantarum C8;
[0106] The second group: the empty vector strain, denoted as pMG36e-L.C8;
[0107] The third group: the recombinant strain, denoted as LP.SP-pMG36e-L.C8;
[0108] The fourth group: co-culture of Lactobacillus plantarum C8 and the empty vector strain (the cell numbers of Lactobacillus plantarum C8 and the empty vector strain each accounted for half of the total cell number), denoted as pMG36e-L.C8 + L.plantarum C8;
[0109] Group 5: Co - culture of Lactobacillus plantarum C8 and recombinant strain (the cell numbers of Lactobacillus plantarum C8 and the empty - vector strain each account for half of the total cell number), denoted as LP.SP - pMG36e - L.C8+L.plantarum C8.
[0110] The specific experimental operations are as follows.
[0111] Inoculate well - grown Caco - 2 cells into 6 - well and 12 - well plates, and grow them overnight at 37°C in an incubator containing 5% CO2 to make them adhere to the wall. Activate Lactobacillus plantarum C8, the empty - vector strain, and the recombinant strain for 3 generations, and inoculate them into 100 mL of MRS liquid medium at an inoculation amount of 2% under co - culture conditions, and statically culture them in an incubator at 37°C until OD 600 = 0.6. Centrifuge (3000 r / min, 4°C, 5 min) to remove the supernatant, wash the cells 3 times with sterile PBS, and then resuspend them with DMEM to make the OD 600 = 1.00 ± 0.01. Then stain the lactic acid bacteria with 10 μM fluorescein isothiocyanate (FITC) in the dark at 37°C for 30 min, wash 3 times with sterile PBS to remove the excess dye, and measure and record the initial fluorescence intensity A0 of the lactic acid bacteria using Tecan Infin M200Pro (Tecan Group, Switzerland) (excitation wavelength 485 nm; emission wavelength 538 nm). Add the FITC - stained lactic acid bacteria to the 6 - well and 12 - well plates separately and incubate for 2 hours. Finally, remove the non - adherent bacteria, and wash the 6 - well and 12 - well plates 3 times with PBS. Observe the adhesion of lactic acid bacteria to cells in the 6 - well plate through an inverted fluorescence microscope and take pictures; digest the cells and bacteria in the 12 - well plate with trypsin, collect the digestion solution to determine the fluorescence intensity, record it as the fluorescence value A1 after elution, and calculate the adhesion rate of bacteria according to the formula:
[0112] Bacterial adhesion rate (%)=(A1 / A0)×100%, where A1 is the fluorescence value of the sample; A0 is the blank fluorescence value.
[0113] The results are as Figure 5As shown in Figure A, the adhesion rates of the first group (Lactobacillus plantarum C8), the second group (empty vector strain), and the third group (recombinant strain) were 18.69 ± 0.34%, 16.05 ± 0.02%, and 19.79 ± 0.62%, respectively. That is, the adhesion ability of the recombinant strain was significantly better than that of Lactobacillus plantarum C8 and the empty vector strain, showing a significant advantage of the recombinant strain in adhesion. In the co-culture system, the adhesion rates of the fourth group (co-culture of Lactobacillus plantarum C8 and the empty vector strain) and the fifth group (co-culture of Lactobacillus plantarum C8 and the recombinant strain) were 18.35 ± 0.29% and 23.4 ± 0.81%, respectively, and the adhesion rate of the fifth group was the highest. These results indicate that the recombinant strain has strong adhesion ability when cultured alone, and the adhesion rate is the highest under the co-culture condition of Lactobacillus plantarum C8 and the recombinant strain, which may be related to the interaction or synergistic effect between strains.
[0114] As Figure 5 As shown in Figure B, through the fluorescence image, bright-field image, and superimposed image, it can be found that the green fluorescence is evenly dispersed and surrounds the Caco-2 cells in the field of view, indicating that the strain can effectively adhere to the surface of Caco-2 cells through a certain mechanism. Compared with the first group (Lactobacillus plantarum C8) and the second group (empty vector strain), the green fluorescence intensity of the third group (recombinant strain) was significantly enhanced, which indicates that the adhesion effect of the recombinant strain is significantly better than that of Lactobacillus plantarum C8 and the empty vector strain. In addition, in the co-culture system, the fluorescence intensity of the fifth group (co-culture of Lactobacillus plantarum C8 and the recombinant strain) was the strongest, further proving that the adhesion effect of Lactobacillus plantarum C8 and the recombinant strain under the co-culture condition is the best.
[0115] In summary, it shows that the overall adhesion of Lactobacillus plantarum C8 and the recombinant strain under co-culture is relatively high, which is beneficial to the colonization of Lactobacillus plantarum C8 in the intestine and thus beneficial to intestinal health.
[0116] Moreover, according to the interaction relationship among the signal peptide, the LPxTG structural protein of Lactobacillus plantarum C8, and the quorum sensing of Lactobacillus plantarum, it can be analyzed that this whole can improve the adhesion of Lactobacillus plantarum C8. Specifically, the LPxTG structure and signal peptide protein expressed by the recombinant strain are released from the signal peptide under the action of the sortase of Lactobacillus plantarum C8. The signal peptide can affect the quorum sensing and other links of Lactobacillus plantarum C8, thereby affecting the adhesion performance of Lactobacillus plantarum C8.
Claims
1. A method for promoting the enhancement of lactic acid bacteria activity, characterized in that, It includes the following steps: Step S1: Amplify the target gene corresponding to the LPxTG structural protein and amplify the target gene corresponding to the signal peptide; Step S2: Use the two target genes obtained in Step S1 as raw materials for amplification to obtain the target gene connecting the LPxTG structure and the signal peptide; Step S3: Connect the target gene obtained in Step S2 with the plasmid gene sequence to construct a recombinant expression vector; Step S4: Introduce the recombinant expression vector obtained in Step S3 into Escherichia coli BL-21 to increase the number of recombinant expression vectors; Step S5: Introduce the recombinant expression vector obtained in Step S4 into Lactobacillus plantarum C8 to obtain a recombinant strain; Step S6: Co-culture Lactobacillus plantarum C8 with the recombinant strain obtained in Step S5.
2. The method according to claim 1, wherein: In the said Step S1, the upstream primer for amplifying the target gene corresponding to the LPxTG structural protein is: cagcaaatgggtcgcggatccATGAATGGCACGGTCAGTTTAGC; The downstream primer for amplifying the target gene corresponding to the LPxTG structural protein is: ACCAGTCTGTGGTAACATGGCC; The upstream primer for amplifying the signal peptide gene is: ccatgttaccacagactggtAATTTCAAAACAGCTGCAAAAGTAA; The downstream primer for amplifying the signal peptide gene is: gtggtggtggtggtgctcgagAGCTAAGAATAGTACGGATGCGC.
3. The method according to claim 1, wherein In the said Step S3, the plasmid is pMG-36e; Step S3 also includes amplifying the target gene obtained in Step S2 and amplifying the plasmid gene; The upstream primer for amplifying the target gene obtained in Step S2 is: cttgcttaggcagctgacttATGAATGGCACGGTCAGTTTAGC; The downstream primer for amplifying the target gene obtained in Step S2 is: cagctgatctcaacaatgtgAGCTAAGAATAGTACGGATGCGC; The upstream primer for amplifying the plasmid gene is: CACATTGTTGAGATCAGCTGCC; The downstream primer for amplifying the plasmid gene is: AAGTCAGCTGCCTAAGCAAGGT.
Citation Information
Cited By
Recombinant lactobacillus plantarum method for overexpressing GAPDH and application of recombinant lactobacillus plantarum
CN120818543A
Method for overexpressing recombinant plant lactobacillus gapdh and application thereof
CN120818543B